HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Absconditicoccaceae [G1] bacterium HMT-345 (GCA_003260355.1)

Select a Genome:
BAKTA Annotations for GCA_003260355.1
Genome Selected: Absconditicoccaceae [G1] bacterium HMT-345
ContigsBases CDSrRNA tmRNAtRNA
3 1144105 2086 3 0 41
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4265 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4265 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer
Range
(bp)
Show Sequences
(length) NA / AA
BAKTA
Gene
BAKTA
GeneProduct
1 MPSQ01000001.1 repeat_region open 325753-325942 CRISPR array with 3 repeats of length 38%2C consensus sequence CATTTAAAGAAAGCTCCAAACAAGGAGCATCGAAACTC and spacer length 33
2 MPSQ01000001.1 repeat_region open 604083-604323 CRISPR array with 4 repeats of length 36%2C consensus sequence ATCTACAAAAGTAGAAATCTTACATATTTTCTAAAC and spacer length 28
3 MPSQ01000001.1 repeat_region open 604596-604893 CRISPR array with 5 repeats of length 36%2C consensus sequence ATCTACAAAAGTAGAAATCTTACATATTTTCTAAAC and spacer length 26
4 MPSQ01000001.1 repeat_region open 629063-629422 CRISPR array with 6 repeats of length 36%2C consensus sequence ATCTACAAAAGTAGAAATCTTATATAAGTTCTAAAC and spacer length 26
5 MPSQ01000001.1 repeat_region open 630326-630689 CRISPR array with 6 repeats of length 36%2C consensus sequence ATCTACAAAAGTAGAAATCTTATATAAGTTCTAAAC and spacer length 27
6 MPSQ01000001.1 GCA003260355_00001 CDS open 46-450 _na     134_aa hypothetical protein
7 MPSQ01000001.1 GCA003260355_00002 CDS open 556-1014 _na     152_aa hypothetical protein
8 MPSQ01000001.1 GCA003260355_00003 CDS open 1211-4018 _na     935_aa BIG2 domain-containing protein
9 MPSQ01000001.1 GCA003260355_00004 CDS open 4541-4828 _na     95_aa hypothetical protein
10 MPSQ01000001.1 GCA003260355_00005 CDS open 5000-5389 _na     129_aa hypothetical protein
11 MPSQ01000001.1 GCA003260355_00006 CDS open 5610-5870 _na     86_aa 4'-phosphopantetheinyl transferase domain-containing protein
12 MPSQ01000001.1 GCA003260355_00007 CDS open 6233-6565 _na     110_aa hypothetical protein
13 MPSQ01000001.1 GCA003260355_00008 CDS open 6605-7663 _na     352_aa SLH domain-containing protein
14 MPSQ01000001.1 GCA003260355_00009 CDS open 7751-7963 _na     70_aa hypothetical protein
15 MPSQ01000001.1 GCA003260355_00010 CDS open 8425-8625 _na     66_aa hypothetical protein
16 MPSQ01000001.1 GCA003260355_00011 CDS open 8902-9093 _na     63_aa hypothetical protein
17 MPSQ01000001.1 GCA003260355_00012 CDS open 9285-9599 _na     104_aa hypothetical protein
18 MPSQ01000001.1 GCA003260355_00013 CDS open 9609-10148 _na     179_aa Glycosyltransferase 2-like domain-containing protein
19 MPSQ01000001.1 GCA003260355_00014 CDS open 10199-10459 _na     86_aa hypothetical protein
20 MPSQ01000001.1 GCA003260355_00015 CDS open 10598-10873 _na     91_aa hypothetical protein
21 MPSQ01000001.1 GCA003260355_00016 CDS open 11206-11469 _na     87_aa DUF1206 domain-containing protein
22 MPSQ01000001.1 GCA003260355_00017 CDS open 11546-11983 _na     145_aa DUF1795 domain-containing protein
23 MPSQ01000001.1 GCA003260355_00018 CDS open 11999-12163 _na     54_aa hypothetical protein
24 MPSQ01000001.1 GCA003260355_00019 CDS open 12497-12895 _na     132_aa DUF998 domain-containing protein
25 MPSQ01000001.1 GCA003260355_00020 CDS open 12995-13333 _na     112_aa ATP synthase subunit I
26 MPSQ01000001.1 GCA003260355_00021 CDS open 13293-13628 _na     111_aa MIP18 family-like domain-containing protein
27 MPSQ01000001.1 GCA003260355_00022 CDS open 14733-14888 _na     51_aa hypothetical protein
28 MPSQ01000001.1 GCA003260355_00023 CDS open 14892-15161 _na     89_aa Type II secretion system protein J
29 MPSQ01000001.1 GCA003260355_00024 CDS open 15194-15475 _na     93_aa Type II secretion system protein J
30 MPSQ01000001.1 GCA003260355_00025 CDS open 15626-15829 _na     67_aa hypothetical protein
31 MPSQ01000001.1 GCA003260355_00026 CDS open 15953-16405 _na     150_aa DUF177 domain-containing protein
32 MPSQ01000001.1 GCA003260355_00027 CDS open 16530-17564 _na     344_aa leuS leucine--tRNA ligase
33 MPSQ01000001.1 GCA003260355_00028 CDS open 17610-17798 _na     62_aa hypothetical protein
34 MPSQ01000001.1 GCA003260355_00029 CDS open 18021-18542 _na     173_aa hypothetical protein
35 MPSQ01000001.1 GCA003260355_00030 CDS open 18549-19181 _na     210_aa hypothetical protein
36 MPSQ01000001.1 GCA003260355_00031 CDS open 19643-19861 _na     72_aa DNA-binding protein
37 MPSQ01000001.1 GCA003260355_00032 CDS open 20176-20574 _na     132_aa PNPLA domain-containing protein
38 MPSQ01000001.1 GCA003260355_00033 CDS open 20674-20874 _na     66_aa hypothetical protein
39 MPSQ01000001.1 GCA003260355_00034 CDS open 20886-21047 _na     53_aa hypothetical protein
40 MPSQ01000001.1 GCA003260355_00035 CDS open 21051-21338 _na     95_aa hypothetical protein
41 MPSQ01000001.1 GCA003260355_00036 CDS open 21387-21683 _na     98_aa hypothetical protein
42 MPSQ01000001.1 GCA003260355_00037 CDS open 21675-22247 _na     190_aa hypothetical protein
43 MPSQ01000001.1 GCA003260355_00038 CDS open 22251-22952 _na     233_aa Radical SAM core domain-containing protein
44 MPSQ01000001.1 GCA003260355_00039 CDS open 23043-23570 _na     175_aa hypothetical protein
45 MPSQ01000001.1 GCA003260355_00040 CDS open 23751-24071 _na     106_aa hypothetical protein
46 MPSQ01000001.1 GCA003260355_00041 CDS open 24426-25010 _na     194_aa hypothetical protein
47 MPSQ01000001.1 GCA003260355_00042 CDS open 25536-25715 _na     59_aa hypothetical protein
48 MPSQ01000001.1 GCA003260355_00043 CDS open 25662-26564 _na     300_aa DUF4153 domain-containing protein
49 MPSQ01000001.1 GCA003260355_00044 CDS open 26961-27107 _na     48_aa hypothetical protein
50 MPSQ01000001.1 GCA003260355_00045 CDS open 27128-27637 _na     169_aa Methylated-DNA--protein-cysteine methyltransferase
51 MPSQ01000001.1 GCA003260355_00046 CDS open 28071-28208 _na     45_aa hypothetical protein
52 MPSQ01000001.1 GCA003260355_00047 CDS open 28245-28397 _na     50_aa hypothetical protein
53 MPSQ01000001.1 GCA003260355_00048 CDS open 28434-28700 _na     88_aa hypothetical protein
54 MPSQ01000001.1 GCA003260355_00049 CDS open 28740-29330 _na     196_aa hypothetical protein
55 MPSQ01000001.1 GCA003260355_00050 CDS open 29551-30807 _na     418_aa ppiC PpiC domain-containing protein
56 MPSQ01000001.1 GCA003260355_00051 CDS open 30874-31011 _na     45_aa hypothetical protein
57 MPSQ01000001.1 GCA003260355_00052 CDS open 31184-31450 _na     88_aa CoA-binding domain-containing protein
58 MPSQ01000001.1 GCA003260355_00053 CDS open 31501-31668 _na     55_aa hypothetical protein
59 MPSQ01000001.1 GCA003260355_00054 CDS open 31816-32037 _na     73_aa hypothetical protein
60 MPSQ01000001.1 GCA003260355_00055 CDS open 32134-32715 _na     193_aa ATP-dependent Clp protease proteolytic subunit
61 MPSQ01000001.1 GCA003260355_00056 CDS open 33010-33879 _na     289_aa Peptidoglycan binding-like domain-containing protein
62 MPSQ01000001.1 GCA003260355_00057 CDS open 33898-34140 _na     80_aa hypothetical protein
63 MPSQ01000001.1 GCA003260355_00058 CDS open 34183-34440 _na     85_aa Peptidoglycan-binding protein
64 MPSQ01000001.1 GCA003260355_00059 CDS open 34481-35083 _na     200_aa gspG Type II secretion system protein GspG C-terminal domain-containing protein
65 MPSQ01000001.1 GCA003260355_00060 CDS open 35132-35383 _na     83_aa hypothetical protein
66 MPSQ01000001.1 GCA003260355_00061 CDS open 35839-36222 _na     127_aa hypothetical protein
67 MPSQ01000001.1 GCA003260355_00062 CDS open 36319-36615 _na     98_aa hypothetical protein
68 MPSQ01000001.1 GCA003260355_00063 CDS open 36961-37293 _na     110_aa hypothetical protein
69 MPSQ01000001.1 GCA003260355_00064 CDS open 37522-37692 _na     56_aa hypothetical protein
70 MPSQ01000001.1 GCA003260355_00065 CDS open 37699-37881 _na     60_aa hypothetical protein
71 MPSQ01000001.1 GCA003260355_00066 CDS open 38188-38370 _na     60_aa hypothetical protein
72 MPSQ01000001.1 GCA003260355_00067 CDS open 38380-38817 _na     145_aa hypothetical protein
73 MPSQ01000001.1 GCA003260355_00068 CDS open 38845-39066 _na     73_aa hypothetical protein
74 MPSQ01000001.1 GCA003260355_00069 CDS open 39072-39227 _na     51_aa hypothetical protein
75 MPSQ01000001.1 GCA003260355_00070 CDS open 39282-39572 _na     96_aa nucleoside-diphosphate kinase
76 MPSQ01000001.1 GCA003260355_00071 CDS open 39799-39951 _na     50_aa hypothetical protein
77 MPSQ01000001.1 GCA003260355_00072 CDS open 39964-40107 _na     47_aa hypothetical protein
78 MPSQ01000001.1 GCA003260355_00073 CDS open 40111-40389 _na     92_aa hypothetical protein
79 MPSQ01000001.1 GCA003260355_00074 CDS open 40411-40731 _na     106_aa Undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase
80 MPSQ01000001.1 GCA003260355_00075 CDS open 40816-40947 _na     43_aa hypothetical protein
81 MPSQ01000001.1 GCA003260355_00076 CDS open 41104-41628 _na     174_aa hypothetical protein
82 MPSQ01000001.1 GCA003260355_00077 CDS open 41647-42063 _na     138_aa DNA polymerase III subunit tau
83 MPSQ01000001.1 GCA003260355_00078 CDS open 42199-42327 _na     42_aa hypothetical protein
84 MPSQ01000001.1 GCA003260355_00082 CDS open 44019-44393 _na     124_aa DNA-binding protein
85 MPSQ01000001.1 GCA003260355_00083 CDS open 44579-44791 _na     70_aa hypothetical protein
86 MPSQ01000001.1 GCA003260355_00084 CDS open 44978-45076 _na     32_aa hypothetical protein
87 MPSQ01000001.1 GCA003260355_00085 CDS open 45196-45363 _na     55_aa hypothetical protein
88 MPSQ01000001.1 GCA003260355_00086 CDS open 45373-45762 _na     129_aa hypothetical protein
89 MPSQ01000001.1 GCA003260355_00087 CDS open 45944-46318 _na     124_aa hypothetical protein
90 MPSQ01000001.1 GCA003260355_00088 CDS open 46319-46420 _na     33_aa hypothetical protein
91 MPSQ01000001.1 GCA003260355_00089 CDS open 46625-46741 _na     38_aa hypothetical protein
92 MPSQ01000001.1 GCA003260355_00090 CDS open 47470-47673 _na     67_aa hypothetical protein
93 MPSQ01000001.1 GCA003260355_00091 CDS open 47713-47877 _na     54_aa hypothetical protein
94 MPSQ01000001.1 GCA003260355_00092 CDS open 47884-48009 _na     41_aa hypothetical protein
95 MPSQ01000001.1 GCA003260355_00093 CDS open 48656-48799 _na     47_aa hypothetical protein
96 MPSQ01000001.1 GCA003260355_00094 CDS open 48802-48906 _na     34_aa hypothetical protein
97 MPSQ01000001.1 GCA003260355_00095 CDS open 49294-49476 _na     60_aa hypothetical protein
98 MPSQ01000001.1 GCA003260355_00096 CDS open 49559-49861 _na     100_aa hypothetical protein
99 MPSQ01000001.1 GCA003260355_00097 CDS open 49903-50076 _na     57_aa hypothetical protein
100 MPSQ01000001.1 GCA003260355_00098 CDS open 50098-50256 _na     52_aa hypothetical protein
101 MPSQ01000001.1 GCA003260355_00102 CDS open 52581-52988 _na     135_aa infC translation initiation factor IF-3
102 MPSQ01000001.1 GCA003260355_00103 CDS open 52998-53132 _na     44_aa 50S ribosomal protein L35
103 MPSQ01000001.1 GCA003260355_00104 CDS open 53204-53551 _na     115_aa rplT 50S ribosomal protein L20
104 MPSQ01000001.1 GCA003260355_00106 CDS open 53772-54005 _na     77_aa Transposase
105 MPSQ01000001.1 GCA003260355_00107 CDS open 54032-54349 _na     105_aa rplU 50S ribosomal protein L21
106 MPSQ01000001.1 GCA003260355_00108 CDS open 54367-54546 _na     59_aa infA translation initiation factor IF-1
107 MPSQ01000001.1 GCA003260355_00109 CDS open 54780-55076 _na     98_aa rpsM 30S ribosomal protein S13
108 MPSQ01000001.1 GCA003260355_00110 CDS open 55180-55419 _na     79_aa Small ribosomal subunit protein uS11
109 MPSQ01000001.1 GCA003260355_00111 CDS open 55441-55563 _na     40_aa hypothetical protein
110 MPSQ01000001.1 GCA003260355_00112 CDS open 55624-56244 _na     206_aa rpsD 30S ribosomal protein S4
111 MPSQ01000001.1 GCA003260355_00113 CDS open 56289-57224 _na     311_aa DNA-directed RNA polymerase subunit alpha
112 MPSQ01000001.1 GCA003260355_00114 CDS open 57325-57711 _na     128_aa 50S ribosomal protein L17
113 MPSQ01000001.1 GCA003260355_00115 CDS open 57752-58210 _na     152_aa rplM 50S ribosomal protein L13
114 MPSQ01000001.1 GCA003260355_00116 CDS open 58210-58632 _na     140_aa rpsI 30S ribosomal protein S9
115 MPSQ01000001.1 GCA003260355_00118 CDS open 59026-59280 _na     84_aa rpsO 30S ribosomal protein S15
116 MPSQ01000001.1 GCA003260355_00119 CDS open 59433-60491 _na     352_aa S1 motif domain-containing protein
117 MPSQ01000001.1 GCA003260355_00120 CDS open 60498-60614 _na     38_aa hypothetical protein
118 MPSQ01000001.1 GCA003260355_00121 CDS open 60905-61006 _na     33_aa hypothetical protein
119 MPSQ01000001.1 GCA003260355_00122 CDS open 61022-61246 _na     74_aa Pyrimidine nucleoside phosphorylase C-terminal domain-containing protein
120 MPSQ01000001.1 GCA003260355_00123 CDS open 61261-61431 _na     56_aa hypothetical protein
121 MPSQ01000001.1 GCA003260355_00124 CDS open 61474-62259 _na     261_aa Glycosyl transferase family 3 N-terminal domain-containing protein
122 MPSQ01000001.1 GCA003260355_00125 CDS open 62514-63116 _na     200_aa DEAD/DEAH box helicase family protein
123 MPSQ01000001.1 GCA003260355_00126 CDS open 63144-63917 _na     257_aa DEAD/DEAH box helicase family protein
124 MPSQ01000001.1 GCA003260355_00127 CDS open 63984-64871 _na     295_aa hypothetical protein
125 MPSQ01000001.1 GCA003260355_00128 CDS open 64889-65023 _na     44_aa hypothetical protein
126 MPSQ01000001.1 GCA003260355_00129 CDS open 65972-66079 _na     35_aa hypothetical protein
127 MPSQ01000001.1 GCA003260355_00130 CDS open 66194-66307 _na     37_aa hypothetical protein
128 MPSQ01000001.1 GCA003260355_00131 CDS open 66587-66832 _na     81_aa hypothetical protein
129 MPSQ01000001.1 GCA003260355_00132 CDS open 66989-67339 _na     116_aa hypothetical protein
130 MPSQ01000001.1 GCA003260355_00133 CDS open 67439-67717 _na     92_aa hypothetical protein
131 MPSQ01000001.1 GCA003260355_00134 CDS open 68224-68394 _na     56_aa hypothetical protein
132 MPSQ01000001.1 GCA003260355_00135 CDS open 70206-70769 _na     187_aa hypothetical protein
133 MPSQ01000001.1 GCA003260355_00136 CDS open 70756-71289 _na     177_aa Nucleotidyl transferase AbiEii/AbiGii toxin family protein
134 MPSQ01000001.1 GCA003260355_00137 CDS open 71478-71732 _na     84_aa Site-specific DNA-methyltransferase (adenine-specific)
135 MPSQ01000001.1 GCA003260355_00138 CDS open 71907-72062 _na     51_aa hypothetical protein
136 MPSQ01000001.1 GCA003260355_00139 CDS open 72213-72347 _na     44_aa hypothetical protein
137 MPSQ01000001.1 GCA003260355_00140 CDS open 72480-72746 _na     88_aa hypothetical protein
138 MPSQ01000001.1 GCA003260355_00141 CDS open 72762-72923 _na     53_aa hypothetical protein
139 MPSQ01000001.1 GCA003260355_00142 CDS open 73426-73653 _na     75_aa hypothetical protein
140 MPSQ01000001.1 GCA003260355_00143 CDS open 73657-74133 _na     158_aa hypothetical protein
141 MPSQ01000001.1 GCA003260355_00144 CDS open 74329-74565 _na     78_aa hypothetical protein
142 MPSQ01000001.1 GCA003260355_00145 CDS open 74674-74895 _na     73_aa hypothetical protein
143 MPSQ01000001.1 GCA003260355_00146 CDS open 75249-75407 _na     52_aa hypothetical protein
144 MPSQ01000001.1 GCA003260355_00147 CDS open 75459-75800 _na     113_aa hypothetical protein
145 MPSQ01000001.1 GCA003260355_00148 CDS open 76026-76277 _na     83_aa hypothetical protein
146 MPSQ01000001.1 GCA003260355_00149 CDS open 76278-76598 _na     106_aa hypothetical protein
147 MPSQ01000001.1 GCA003260355_00150 CDS open 76635-76916 _na     93_aa hypothetical protein
148 MPSQ01000001.1 GCA003260355_00151 CDS open 77246-77662 _na     138_aa hypothetical protein
149 MPSQ01000001.1 GCA003260355_00152 CDS open 77732-77992 _na     86_aa hypothetical protein
150 MPSQ01000001.1 GCA003260355_00153 CDS open 78011-78178 _na     55_aa hypothetical protein
151 MPSQ01000001.1 GCA003260355_00154 CDS open 78200-78469 _na     89_aa hypothetical protein
152 MPSQ01000001.1 GCA003260355_00155 CDS open 78521-78862 _na     113_aa hypothetical protein
153 MPSQ01000001.1 GCA003260355_00156 CDS open 78977-79675 _na     232_aa hypothetical protein
154 MPSQ01000001.1 GCA003260355_00157 CDS open 79724-80140 _na     138_aa Translation initiation factor IF- 2 domain-containing protein
155 MPSQ01000001.1 GCA003260355_00158 CDS open 80153-80527 _na     124_aa hypothetical protein
156 MPSQ01000001.1 GCA003260355_00159 CDS open 80546-81577 _na     343_aa Translation initiation factor IF-2
157 MPSQ01000001.1 GCA003260355_00160 CDS open 81650-82189 _na     179_aa hypothetical protein
158 MPSQ01000001.1 GCA003260355_00161 CDS open 82379-82789 _na     136_aa hypothetical protein
159 MPSQ01000001.1 GCA003260355_00162 CDS open 82688-82981 _na     97_aa hypothetical protein
160 MPSQ01000001.1 GCA003260355_00163 CDS open 83102-83572 _na     156_aa hypothetical protein
161 MPSQ01000001.1 GCA003260355_00164 CDS open 83606-84559 _na     317_aa ABC-2 type transporter transmembrane domain-containing protein
162 MPSQ01000001.1 GCA003260355_00165 CDS open 84705-84926 _na     73_aa HEPN domain-containing protein
163 MPSQ01000001.1 GCA003260355_00166 CDS open 84945-85310 _na     121_aa hypothetical protein
164 MPSQ01000001.1 GCA003260355_00167 CDS open 85398-85667 _na     89_aa hypothetical protein
165 MPSQ01000001.1 GCA003260355_00168 CDS open 85758-86108 _na     116_aa hypothetical protein
166 MPSQ01000001.1 GCA003260355_00169 CDS open 86148-86405 _na     85_aa hypothetical protein
167 MPSQ01000001.1 GCA003260355_00170 CDS open 86616-86870 _na     84_aa hypothetical protein
168 MPSQ01000001.1 GCA003260355_00171 CDS open 87091-87447 _na     118_aa Pseudouridine synthase
169 MPSQ01000001.1 GCA003260355_00172 CDS open 87579-88115 _na     178_aa Elongation factor 4
170 MPSQ01000001.1 GCA003260355_00173 CDS open 88158-88397 _na     79_aa hypothetical protein
171 MPSQ01000001.1 GCA003260355_00174 CDS open 88398-88526 _na     42_aa Elongation factor 4
172 MPSQ01000001.1 GCA003260355_00175 CDS open 88536-88808 _na     90_aa Elongation factor EFG domain-containing protein
173 MPSQ01000001.1 GCA003260355_00176 CDS open 88869-89024 _na     51_aa hypothetical protein
174 MPSQ01000001.1 GCA003260355_00177 CDS open 89142-90707 _na     521_aa hypothetical protein
175 MPSQ01000001.1 GCA003260355_00178 CDS open 90691-91023 _na     110_aa hypothetical protein
176 MPSQ01000001.1 GCA003260355_00179 CDS open 90996-91262 _na     88_aa hypothetical protein
177 MPSQ01000001.1 GCA003260355_00180 CDS open 91500-91769 _na     89_aa hypothetical protein
178 MPSQ01000001.1 GCA003260355_00181 CDS open 91776-92075 _na     99_aa hypothetical protein
179 MPSQ01000001.1 GCA003260355_00182 CDS open 92094-92297 _na     67_aa hypothetical protein
180 MPSQ01000001.1 GCA003260355_00183 CDS open 92532-93071 _na     179_aa hypothetical protein
181 MPSQ01000001.1 GCA003260355_00184 CDS open 93261-93533 _na     90_aa hypothetical protein
182 MPSQ01000001.1 GCA003260355_00185 CDS open 93748-93933 _na     61_aa hypothetical protein
183 MPSQ01000001.1 GCA003260355_00186 CDS open 93944-94150 _na     68_aa Mur ligase central domain-containing protein
184 MPSQ01000001.1 GCA003260355_00187 CDS open 94151-94483 _na     110_aa Mur ligase central domain-containing protein
185 MPSQ01000001.1 GCA003260355_00188 CDS open 94592-94786 _na     64_aa hypothetical protein
186 MPSQ01000001.1 GCA003260355_00189 CDS open 94859-95074 _na     71_aa Mur ligase C-terminal domain-containing protein
187 MPSQ01000001.1 GCA003260355_00190 CDS open 95387-95599 _na     70_aa hypothetical protein
188 MPSQ01000001.1 GCA003260355_00191 CDS open 95666-95845 _na     59_aa hypothetical protein
189 MPSQ01000001.1 GCA003260355_00192 CDS open 95894-96121 _na     75_aa hypothetical protein
190 MPSQ01000001.1 GCA003260355_00193 CDS open 96137-96637 _na     166_aa hypothetical protein
191 MPSQ01000001.1 GCA003260355_00194 CDS open 96674-96817 _na     47_aa hypothetical protein
192 MPSQ01000001.1 GCA003260355_00195 CDS open 96925-97044 _na     39_aa dnaJ DnaJ domain-containing protein
193 MPSQ01000001.1 GCA003260355_00196 CDS open 97073-97381 _na     102_aa hypothetical protein
194 MPSQ01000001.1 GCA003260355_00197 CDS open 97570-97827 _na     85_aa hypothetical protein
195 MPSQ01000001.1 GCA003260355_00198 CDS open 97824-98000 _na     58_aa hypothetical protein
196 MPSQ01000001.1 GCA003260355_00199 CDS open 98192-98938 _na     248_aa hypothetical protein
197 MPSQ01000001.1 GCA003260355_00200 CDS open 98948-100189 _na     413_aa polyribonucleotide nucleotidyltransferase
198 MPSQ01000001.1 GCA003260355_00201 CDS open 100427-100822 _na     131_aa Rhodanese domain-containing protein
199 MPSQ01000001.1 GCA003260355_00202 CDS open 101091-101204 _na     37_aa hypothetical protein
200 MPSQ01000001.1 GCA003260355_00203 CDS open 101384-101596 _na     70_aa hypothetical protein
201 MPSQ01000001.1 GCA003260355_00204 CDS open 101636-101920 _na     94_aa hypothetical protein
202 MPSQ01000001.1 GCA003260355_00205 CDS open 101991-102194 _na     67_aa hypothetical protein
203 MPSQ01000001.1 GCA003260355_00206 CDS open 102327-102728 _na     133_aa hypothetical protein
204 MPSQ01000001.1 GCA003260355_00207 CDS open 103068-103289 _na     73_aa hypothetical protein
205 MPSQ01000001.1 GCA003260355_00208 CDS open 103559-103759 _na     66_aa hypothetical protein
206 MPSQ01000001.1 GCA003260355_00209 CDS open 103716-103823 _na     35_aa hypothetical protein
207 MPSQ01000001.1 GCA003260355_00210 CDS open 104194-104316 _na     40_aa hypothetical protein
208 MPSQ01000001.1 GCA003260355_00211 CDS open 104772-104924 _na     50_aa hypothetical protein
209 MPSQ01000001.1 GCA003260355_00212 CDS open 104937-105134 _na     65_aa hypothetical protein
210 MPSQ01000001.1 GCA003260355_00213 CDS open 105219-105581 _na     120_aa hypothetical protein
211 MPSQ01000001.1 GCA003260355_00214 CDS open 105703-106173 _na     156_aa recA recombinase RecA
212 MPSQ01000001.1 GCA003260355_00215 CDS open 106177-106359 _na     60_aa recA Protein RecA
213 MPSQ01000001.1 GCA003260355_00216 CDS open 106369-106596 _na     75_aa ATPase domain-containing protein
214 MPSQ01000001.1 GCA003260355_00217 CDS open 106852-107061 _na     69_aa hypothetical protein
215 MPSQ01000001.1 GCA003260355_00218 CDS open 107015-107443 _na     142_aa Integron-associated effector binding protein domain-containing protein
216 MPSQ01000001.1 GCA003260355_00219 CDS open 107563-107757 _na     64_aa tfoX TfoX C-terminal domain-containing protein
217 MPSQ01000001.1 GCA003260355_00220 CDS open 107723-107896 _na     57_aa hypothetical protein
218 MPSQ01000001.1 GCA003260355_00221 CDS open 107984-108409 _na     141_aa Peptidase S24/S26A/S26B/S26C domain-containing protein
219 MPSQ01000001.1 GCA003260355_00222 CDS open 108542-108763 _na     73_aa hypothetical protein
220 MPSQ01000001.1 GCA003260355_00223 CDS open 108794-108964 _na     56_aa YdbS-like PH domain-containing protein
221 MPSQ01000001.1 GCA003260355_00224 CDS open 109768-111069 _na     433_aa DNA primase
222 MPSQ01000001.1 GCA003260355_00225 CDS open 111239-111679 _na     146_aa Signal peptidase (SPase) II
223 MPSQ01000001.1 GCA003260355_00226 CDS open 111708-112019 _na     103_aa DUF3127 domain-containing protein
224 MPSQ01000001.1 GCA003260355_00227 CDS open 112172-112654 _na     160_aa N-acetyltransferase domain-containing protein
225 MPSQ01000001.1 GCA003260355_00228 CDS open 112693-113034 _na     113_aa hypothetical protein
226 MPSQ01000001.1 GCA003260355_00229 CDS open 113092-113334 _na     80_aa Asparagine--tRNA ligase
227 MPSQ01000001.1 GCA003260355_00230 CDS open 113389-113778 _na     129_aa hypothetical protein
228 MPSQ01000001.1 GCA003260355_00231 CDS open 113875-114009 _na     44_aa hypothetical protein
229 MPSQ01000001.1 GCA003260355_00232 CDS open 114017-114145 _na     42_aa hypothetical protein
230 MPSQ01000001.1 GCA003260355_00233 CDS open 114372-114524 _na     50_aa hypothetical protein
231 MPSQ01000001.1 GCA003260355_00234 CDS open 114841-115107 _na     88_aa hypothetical protein
232 MPSQ01000001.1 GCA003260355_00235 CDS open 115798-116547 _na     249_aa hypothetical protein
233 MPSQ01000001.1 GCA003260355_00236 CDS open 116587-117333 _na     248_aa Anaerobic ribonucleoside-triphosphate reductase
234 MPSQ01000001.1 GCA003260355_00237 CDS open 117439-117936 _na     165_aa hypothetical protein
235 MPSQ01000001.1 GCA003260355_00238 CDS open 118161-118436 _na     91_aa DUF192 domain-containing protein
236 MPSQ01000001.1 GCA003260355_00239 CDS open 118858-119037 _na     59_aa hypothetical protein
237 MPSQ01000001.1 GCA003260355_00240 CDS open 119984-120277 _na     97_aa DUF2178 domain-containing protein
238 MPSQ01000001.1 GCA003260355_00241 CDS open 120302-120508 _na     68_aa Transcriptional regulator
239 MPSQ01000001.1 GCA003260355_00242 CDS open 120865-121119 _na     84_aa hypothetical protein
240 MPSQ01000001.1 GCA003260355_00243 CDS open 121363-121746 _na     127_aa hypothetical protein
241 MPSQ01000001.1 GCA003260355_00244 CDS open 121810-122184 _na     124_aa hypothetical protein
242 MPSQ01000001.1 GCA003260355_00245 CDS open 122280-122549 _na     89_aa hypothetical protein
243 MPSQ01000001.1 GCA003260355_00246 CDS open 123009-123149 _na     46_aa hypothetical protein
244 MPSQ01000001.1 GCA003260355_00247 CDS open 123300-124430 _na     376_aa hypothetical protein
245 MPSQ01000001.1 GCA003260355_00248 CDS open 124836-125147 _na     103_aa hypothetical protein
246 MPSQ01000001.1 GCA003260355_00249 CDS open 125154-125369 _na     71_aa hypothetical protein
247 MPSQ01000001.1 GCA003260355_00250 CDS open 125817-126119 _na     100_aa hypothetical protein
248 MPSQ01000001.1 GCA003260355_00251 CDS open 126167-127123 _na     318_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
249 MPSQ01000001.1 GCA003260355_00252 CDS open 127130-127435 _na     101_aa hypothetical protein
250 MPSQ01000001.1 GCA003260355_00253 CDS open 127559-127720 _na     53_aa hypothetical protein
251 MPSQ01000001.1 GCA003260355_00254 CDS open 127754-128134 _na     126_aa Glycerophosphoryl diester phosphodiesterase membrane domain-containing protein
252 MPSQ01000001.1 GCA003260355_00255 CDS open 128144-128425 _na     93_aa hypothetical protein
253 MPSQ01000001.1 GCA003260355_00256 CDS open 128993-129481 _na     162_aa hypothetical protein
254 MPSQ01000001.1 GCA003260355_00257 CDS open 129788-130045 _na     85_aa hypothetical protein
255 MPSQ01000001.1 GCA003260355_00259 CDS open 130525-130818 _na     97_aa DUF4190 domain-containing protein
256 MPSQ01000001.1 GCA003260355_00260 CDS open 130871-131020 _na     49_aa hypothetical protein
257 MPSQ01000001.1 GCA003260355_00261 CDS open 131020-131259 _na     79_aa hypothetical protein
258 MPSQ01000001.1 GCA003260355_00265 CDS open 131911-132147 _na     78_aa ABC transmembrane type-1 domain-containing protein
259 MPSQ01000001.1 GCA003260355_00266 CDS open 132199-132348 _na     49_aa hypothetical protein
260 MPSQ01000001.1 GCA003260355_00267 CDS open 132417-132842 _na     141_aa ruvC Crossover junction endodeoxyribonuclease RuvC
261 MPSQ01000001.1 GCA003260355_00268 CDS open 132959-133360 _na     133_aa hypothetical protein
262 MPSQ01000001.1 GCA003260355_00269 CDS open 133613-133990 _na     125_aa hypothetical protein
263 MPSQ01000001.1 GCA003260355_00270 CDS open 134021-134233 _na     70_aa hypothetical protein
264 MPSQ01000001.1 GCA003260355_00271 CDS open 134264-134752 _na     162_aa hypothetical protein
265 MPSQ01000001.1 GCA003260355_00272 CDS open 134876-135214 _na     112_aa hypothetical protein
266 MPSQ01000001.1 GCA003260355_00273 CDS open 135441-135563 _na     40_aa hypothetical protein
267 MPSQ01000001.1 GCA003260355_00274 CDS open 135751-135858 _na     35_aa hypothetical protein
268 MPSQ01000001.1 GCA003260355_00275 CDS open 135898-136209 _na     103_aa CRISPR type III A-associated protein Csm2
269 MPSQ01000001.1 GCA003260355_00276 CDS open 136434-137324 _na     296_aa Helicase ATP-binding domain-containing protein
270 MPSQ01000001.1 GCA003260355_00277 CDS open 137328-138029 _na     233_aa Helicase ATP-binding domain-containing protein
271 MPSQ01000001.1 GCA003260355_00278 CDS open 138296-138811 _na     171_aa hypothetical protein
272 MPSQ01000001.1 GCA003260355_00279 CDS open 138864-139265 _na     133_aa hypothetical protein
273 MPSQ01000001.1 GCA003260355_00280 CDS open 139734-140087 _na     117_aa hypothetical protein
274 MPSQ01000001.1 GCA003260355_00281 CDS open 140285-140398 _na     37_aa hypothetical protein
275 MPSQ01000001.1 GCA003260355_00282 CDS open 140700-141119 _na     139_aa hypothetical protein
276 MPSQ01000001.1 GCA003260355_00283 CDS open 141142-141897 _na     251_aa CBS domain-containing protein
277 MPSQ01000001.1 GCA003260355_00284 CDS open 142079-142357 _na     92_aa IS1 family transposase
278 MPSQ01000001.1 GCA003260355_00285 CDS open 142386-142763 _na     125_aa Nicotianamine synthase
279 MPSQ01000001.1 GCA003260355_00286 CDS open 142767-142928 _na     53_aa hypothetical protein
280 MPSQ01000001.1 GCA003260355_00287 CDS open 142950-143180 _na     76_aa hypothetical protein
281 MPSQ01000001.1 GCA003260355_00288 CDS open 143186-143308 _na     40_aa hypothetical protein
282 MPSQ01000001.1 GCA003260355_00289 CDS open 143492-144178 _na     228_aa hypothetical protein
283 MPSQ01000001.1 GCA003260355_00290 CDS open 144248-144544 _na     98_aa hypothetical protein
284 MPSQ01000001.1 GCA003260355_00291 CDS open 145339-145554 _na     71_aa hypothetical protein
285 MPSQ01000001.1 GCA003260355_00292 CDS open 145701-145889 _na     62_aa Transposase
286 MPSQ01000001.1 GCA003260355_00293 CDS open 146031-146528 _na     165_aa tatD Hydrolase TatD
287 MPSQ01000001.1 GCA003260355_00294 CDS open 147213-147551 _na     112_aa hypothetical protein
288 MPSQ01000001.1 GCA003260355_00295 CDS open 147564-147725 _na     53_aa hypothetical protein
289 MPSQ01000001.1 GCA003260355_00296 CDS open 147766-147984 _na     72_aa hypothetical protein
290 MPSQ01000001.1 GCA003260355_00297 CDS open 148262-148444 _na     60_aa hypothetical protein
291 MPSQ01000001.1 GCA003260355_00298 CDS open 148478-148825 _na     115_aa Succinylglutamate desuccinylase
292 MPSQ01000001.1 GCA003260355_00299 CDS open 149430-150170 _na     246_aa rplI 50S ribosomal protein L9
293 MPSQ01000001.1 GCA003260355_00300 CDS open 150558-151346 _na     262_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
294 MPSQ01000001.1 GCA003260355_00301 CDS open 151452-151727 _na     91_aa hypothetical protein
295 MPSQ01000001.1 GCA003260355_00302 CDS open 151785-152360 _na     191_aa hypothetical protein
296 MPSQ01000001.1 GCA003260355_00303 CDS open 152562-152855 _na     97_aa hypothetical protein
297 MPSQ01000001.1 GCA003260355_00304 CDS open 153166-153627 _na     153_aa hypothetical protein
298 MPSQ01000001.1 GCA003260355_00305 CDS open 153696-154679 _na     327_aa RCK N-terminal domain-containing protein
299 MPSQ01000001.1 GCA003260355_00306 CDS open 154830-154934 _na     34_aa hypothetical protein
300 MPSQ01000001.1 GCA003260355_00307 CDS open 154962-155132 _na     56_aa hypothetical protein
301 MPSQ01000001.1 GCA003260355_00308 CDS open 155199-155408 _na     69_aa hypothetical protein
302 MPSQ01000001.1 GCA003260355_00309 CDS open 155611-156216 _na     201_aa hypothetical protein
303 MPSQ01000001.1 GCA003260355_00310 CDS open 156366-156641 _na     91_aa DUF5673 domain-containing protein
304 MPSQ01000001.1 GCA003260355_00311 CDS open 156654-156842 _na     62_aa hypothetical protein
305 MPSQ01000001.1 GCA003260355_00312 CDS open 156958-157170 _na     70_aa hypothetical protein
306 MPSQ01000001.1 GCA003260355_00313 CDS open 157227-157463 _na     78_aa hypothetical protein
307 MPSQ01000001.1 GCA003260355_00314 CDS open 157512-157835 _na     107_aa hypothetical protein
308 MPSQ01000001.1 GCA003260355_00315 CDS open 158229-159074 _na     281_aa Peptidase C51 domain-containing protein
309 MPSQ01000001.1 GCA003260355_00316 CDS open 159485-159838 _na     117_aa Lipoprotein
310 MPSQ01000001.1 GCA003260355_00317 CDS open 160040-161485 _na     481_aa PIN domain-containing protein
311 MPSQ01000001.1 GCA003260355_00318 CDS open 161797-162291 _na     164_aa hypothetical protein
312 MPSQ01000001.1 GCA003260355_00319 CDS open 162316-162405 _na     29_aa hypothetical protein
313 MPSQ01000001.1 GCA003260355_00320 CDS open 162421-162750 _na     109_aa hypothetical protein
314 MPSQ01000001.1 GCA003260355_00321 CDS open 162907-163149 _na     80_aa Aspartyl-tRNA(Asn) amidotransferase subunit A Glutamyl-tRNA(Gln) amidotransferase subunit A
315 MPSQ01000001.1 GCA003260355_00322 CDS open 163465-163977 _na     170_aa rplJ 50S ribosomal protein L10
316 MPSQ01000001.1 GCA003260355_00323 CDS open 164027-164410 _na     127_aa rplL 50S ribosomal protein L7/L12
317 MPSQ01000001.1 GCA003260355_00324 CDS open 164521-165186 _na     221_aa rpsB 30S ribosomal protein S2
318 MPSQ01000001.1 GCA003260355_00325 CDS open 165322-165771 _na     149_aa hypothetical protein
319 MPSQ01000001.1 GCA003260355_00326 CDS open 165891-166685 _na     264_aa tsf translation elongation factor Ts
320 MPSQ01000001.1 GCA003260355_00327 CDS open 166862-167962 _na     366_aa Peptidase M23 domain-containing protein
321 MPSQ01000001.1 GCA003260355_00328 CDS open 168053-168403 _na     116_aa hypothetical protein
322 MPSQ01000001.1 GCA003260355_00329 CDS open 168643-169002 _na     119_aa hypothetical protein
323 MPSQ01000001.1 GCA003260355_00330 CDS open 169557-169673 _na     38_aa hypothetical protein
324 MPSQ01000001.1 GCA003260355_00331 CDS open 169758-170114 _na     118_aa rpsR 30S ribosomal protein S18
325 MPSQ01000001.1 GCA003260355_00332 CDS open 170149-170307 _na     52_aa rpmH 50S ribosomal protein L34
326 MPSQ01000001.1 GCA003260355_00333 CDS open 170496-170786 _na     96_aa hypothetical protein
327 MPSQ01000001.1 GCA003260355_00334 CDS open 170805-170951 _na     48_aa hypothetical protein
328 MPSQ01000001.1 GCA003260355_00335 CDS open 171090-171353 _na     87_aa hypothetical protein
329 MPSQ01000001.1 GCA003260355_00336 CDS open 171525-171758 _na     77_aa hypothetical protein
330 MPSQ01000001.1 GCA003260355_00337 CDS open 172017-172325 _na     102_aa hypothetical protein
331 MPSQ01000001.1 GCA003260355_00338 CDS open 172353-172604 _na     83_aa hypothetical protein
332 MPSQ01000001.1 GCA003260355_00339 CDS open 172662-174764 _na     700_aa DNA-directed RNA polymerase subunit beta
333 MPSQ01000001.1 GCA003260355_00340 CDS open 174894-175364 _na     156_aa hypothetical protein
334 MPSQ01000001.1 GCA003260355_00341 CDS open 175389-175625 _na     78_aa hypothetical protein
335 MPSQ01000001.1 GCA003260355_00342 CDS open 175753-178365 _na     870_aa rpoC DNA-directed RNA polymerase subunit beta'
336 MPSQ01000001.1 GCA003260355_00343 CDS open 178384-178929 _na     181_aa hypothetical protein
337 MPSQ01000001.1 GCA003260355_00344 CDS open 179107-179565 _na     152_aa RNA polymerase Rpb1 domain-containing protein
338 MPSQ01000001.1 GCA003260355_00345 CDS open 179929-180084 _na     51_aa hypothetical protein
339 MPSQ01000001.1 GCA003260355_00346 CDS open 180190-180540 _na     116_aa RNase H family protein
340 MPSQ01000001.1 GCA003260355_00347 CDS open 180489-180674 _na     61_aa hypothetical protein
341 MPSQ01000001.1 GCA003260355_00348 CDS open 180671-180820 _na     49_aa hypothetical protein
342 MPSQ01000001.1 GCA003260355_00349 CDS open 180974-182053 _na     359_aa hypothetical protein
343 MPSQ01000001.1 GCA003260355_00350 CDS open 182075-182662 _na     195_aa hypothetical protein
344 MPSQ01000001.1 GCA003260355_00351 CDS open 182675-182797 _na     40_aa hypothetical protein
345 MPSQ01000001.1 GCA003260355_00352 CDS open 182954-184270 _na     438_aa hypothetical protein
346 MPSQ01000001.1 GCA003260355_00353 CDS open 184280-184480 _na     66_aa hypothetical protein
347 MPSQ01000001.1 GCA003260355_00354 CDS open 184568-184792 _na     74_aa hypothetical protein
348 MPSQ01000001.1 GCA003260355_00355 CDS open 184796-185095 _na     99_aa hypothetical protein
349 MPSQ01000001.1 GCA003260355_00356 CDS open 185231-186964 _na     577_aa hypothetical protein
350 MPSQ01000001.1 GCA003260355_00357 CDS open 187123-187512 _na     129_aa hypothetical protein
351 MPSQ01000001.1 GCA003260355_00358 CDS open 187615-187848 _na     77_aa hypothetical protein
352 MPSQ01000001.1 GCA003260355_00359 CDS open 188562-188789 _na     75_aa hypothetical protein
353 MPSQ01000001.1 GCA003260355_00360 CDS open 188817-189077 _na     86_aa hypothetical protein
354 MPSQ01000001.1 GCA003260355_00361 CDS open 189349-190047 _na     232_aa hypothetical protein
355 MPSQ01000001.1 GCA003260355_00362 CDS open 190090-190542 _na     150_aa hypothetical protein
356 MPSQ01000001.1 GCA003260355_00363 CDS open 190597-190764 _na     55_aa hypothetical protein
357 MPSQ01000001.1 GCA003260355_00364 CDS open 190781-190909 _na     42_aa hypothetical protein
358 MPSQ01000001.1 GCA003260355_00365 CDS open 191182-192093 _na     303_aa hypothetical protein
359 MPSQ01000001.1 GCA003260355_00366 CDS open 192109-193434 _na     441_aa valine--tRNA ligase
360 MPSQ01000001.1 GCA003260355_00367 CDS open 193450-193836 _na     128_aa hypothetical protein
361 MPSQ01000001.1 GCA003260355_00368 CDS open 194085-194321 _na     78_aa hypothetical protein
362 MPSQ01000001.1 GCA003260355_00369 CDS open 194960-195295 _na     111_aa hypothetical protein
363 MPSQ01000001.1 GCA003260355_00370 CDS open 195628-195894 _na     88_aa hypothetical protein
364 MPSQ01000001.1 GCA003260355_00371 CDS open 196594-196881 _na     95_aa hypothetical protein
365 MPSQ01000001.1 GCA003260355_00372 CDS open 197044-197313 _na     89_aa Pseudouridine synthase RsuA/RluA-like domain-containing protein
366 MPSQ01000001.1 GCA003260355_00373 CDS open 197499-198089 _na     196_aa DNA damage-inducible protein D
367 MPSQ01000001.1 GCA003260355_00374 CDS open 198096-198389 _na     97_aa hypothetical protein
368 MPSQ01000001.1 GCA003260355_00375 CDS open 198464-199018 _na     184_aa Elongation factor P
369 MPSQ01000001.1 GCA003260355_00376 CDS open 199082-199192 _na     36_aa hypothetical protein
370 MPSQ01000001.1 GCA003260355_00377 CDS open 199272-199508 _na     78_aa hypothetical protein
371 MPSQ01000001.1 GCA003260355_00378 CDS open 199508-199597 _na     29_aa hypothetical protein
372 MPSQ01000001.1 GCA003260355_00379 CDS open 200383-200580 _na     65_aa hypothetical protein
373 MPSQ01000001.1 GCA003260355_00380 CDS open 200739-200915 _na     58_aa hypothetical protein
374 MPSQ01000001.1 GCA003260355_00381 CDS open 202130-202366 _na     78_aa hypothetical protein
375 MPSQ01000001.1 GCA003260355_00382 CDS open 202685-202825 _na     46_aa Response regulatory domain-containing protein
376 MPSQ01000001.1 GCA003260355_00383 CDS open 203120-203671 _na     183_aa hypothetical protein
377 MPSQ01000001.1 GCA003260355_00384 CDS open 203693-203914 _na     73_aa hypothetical protein
378 MPSQ01000001.1 GCA003260355_00385 CDS open 204041-204796 _na     251_aa DNA 3'-5' helicase
379 MPSQ01000001.1 GCA003260355_00386 CDS open 204968-205312 _na     114_aa hypothetical protein
380 MPSQ01000001.1 GCA003260355_00387 CDS open 205322-205426 _na     34_aa hypothetical protein
381 MPSQ01000001.1 GCA003260355_00388 CDS open 205890-205985 _na     31_aa hypothetical protein
382 MPSQ01000001.1 GCA003260355_00389 CDS open 205998-206114 _na     38_aa hypothetical protein
383 MPSQ01000001.1 GCA003260355_00390 CDS open 206210-206500 _na     96_aa Magnesium transporter
384 MPSQ01000001.1 GCA003260355_00391 CDS open 206466-206672 _na     68_aa hypothetical protein
385 MPSQ01000001.1 GCA003260355_00392 CDS open 206687-207115 _na     142_aa hypothetical protein
386 MPSQ01000001.1 GCA003260355_00393 CDS open 207405-207806 _na     133_aa Aminoacyl-tRNA synthetase class II (D/K/N) domain-containing protein
387 MPSQ01000001.1 GCA003260355_00394 CDS open 207869-208120 _na     83_aa hypothetical protein
388 MPSQ01000001.1 GCA003260355_00395 CDS open 208238-208438 _na     66_aa hypothetical protein
389 MPSQ01000001.1 GCA003260355_00396 CDS open 208604-208744 _na     46_aa hypothetical protein
390 MPSQ01000001.1 GCA003260355_00397 CDS open 208817-209260 _na     147_aa hypothetical protein
391 MPSQ01000001.1 GCA003260355_00398 CDS open 209598-209822 _na     74_aa HIT domain-containing protein
392 MPSQ01000001.1 GCA003260355_00399 CDS open 210570-210788 _na     72_aa hypothetical protein
393 MPSQ01000001.1 GCA003260355_00400 CDS open 210831-211163 _na     110_aa Dipeptidase E
394 MPSQ01000001.1 GCA003260355_00401 CDS open 211461-211595 _na     44_aa hypothetical protein
395 MPSQ01000001.1 GCA003260355_00402 CDS open 211629-211802 _na     57_aa hypothetical protein
396 MPSQ01000001.1 GCA003260355_00403 CDS open 211741-211899 _na     52_aa hypothetical protein
397 MPSQ01000001.1 GCA003260355_00404 CDS open 212226-212666 _na     146_aa hypothetical protein
398 MPSQ01000001.1 GCA003260355_00405 CDS open 212952-213761 _na     269_aa hypothetical protein
399 MPSQ01000001.1 GCA003260355_00406 CDS open 213855-214076 _na     73_aa hypothetical protein
400 MPSQ01000001.1 GCA003260355_00407 CDS open 214141-214767 _na     208_aa Lipoprotein
401 MPSQ01000001.1 GCA003260355_00408 CDS open 214784-214927 _na     47_aa hypothetical protein
402 MPSQ01000001.1 GCA003260355_00409 CDS open 214966-215304 _na     112_aa hypothetical protein
403 MPSQ01000001.1 GCA003260355_00410 CDS open 215317-215430 _na     37_aa hypothetical protein
404 MPSQ01000001.1 GCA003260355_00411 CDS open 215815-215955 _na     46_aa hypothetical protein
405 MPSQ01000001.1 GCA003260355_00412 CDS open 216607-216957 _na     116_aa hypothetical protein
406 MPSQ01000001.1 GCA003260355_00413 CDS open 217009-217677 _na     222_aa Peptidase C39-like domain-containing protein
407 MPSQ01000001.1 GCA003260355_00414 CDS open 218105-218653 _na     182_aa Large ribosomal subunit protein bL27
408 MPSQ01000001.1 GCA003260355_00415 CDS open 218694-218927 _na     77_aa rpmF 50S ribosomal protein L32
409 MPSQ01000001.1 GCA003260355_00416 CDS open 218997-219218 _na     73_aa hypothetical protein
410 MPSQ01000001.1 GCA003260355_00417 CDS open 219501-219602 _na     33_aa hypothetical protein
411 MPSQ01000001.1 GCA003260355_00418 CDS open 219676-219966 _na     96_aa hypothetical protein
412 MPSQ01000001.1 GCA003260355_00419 CDS open 220138-220761 _na     207_aa hypothetical protein
413 MPSQ01000001.1 GCA003260355_00420 CDS open 220819-221442 _na     207_aa hypothetical protein
414 MPSQ01000001.1 GCA003260355_00421 CDS open 221599-221817 _na     72_aa 23S rRNA (pseudouridine1915-N3)-methyltransferase
415 MPSQ01000001.1 GCA003260355_00422 CDS open 221938-222048 _na     36_aa hypothetical protein
416 MPSQ01000001.1 GCA003260355_00423 CDS open 222117-222686 _na     189_aa hypothetical protein
417 MPSQ01000001.1 GCA003260355_00424 CDS open 222958-223095 _na     45_aa hypothetical protein
418 MPSQ01000001.1 GCA003260355_00425 CDS open 223290-223403 _na     37_aa hypothetical protein
419 MPSQ01000001.1 GCA003260355_00426 CDS open 223566-223706 _na     46_aa hypothetical protein
420 MPSQ01000001.1 GCA003260355_00427 CDS open 223899-224213 _na     104_aa hypothetical protein
421 MPSQ01000001.1 GCA003260355_00428 CDS open 224155-224325 _na     56_aa hypothetical protein
422 MPSQ01000001.1 GCA003260355_00429 CDS open 224435-224773 _na     112_aa hypothetical protein
423 MPSQ01000001.1 GCA003260355_00430 CDS open 224728-224853 _na     41_aa hypothetical protein
424 MPSQ01000001.1 GCA003260355_00431 CDS open 224846-225205 _na     119_aa hypothetical protein
425 MPSQ01000001.1 GCA003260355_00432 CDS open 225425-225607 _na     60_aa hypothetical protein
426 MPSQ01000001.1 GCA003260355_00433 CDS open 225760-226179 _na     139_aa hypothetical protein
427 MPSQ01000001.1 GCA003260355_00434 CDS open 226273-226764 _na     163_aa Pseudouridine synthase
428 MPSQ01000001.1 GCA003260355_00435 CDS open 226813-226962 _na     49_aa hypothetical protein
429 MPSQ01000001.1 GCA003260355_00436 CDS open 227083-227262 _na     59_aa hypothetical protein
430 MPSQ01000001.1 GCA003260355_00437 CDS open 227417-227803 _na     128_aa hypothetical protein
431 MPSQ01000001.1 GCA003260355_00438 CDS open 227804-228013 _na     69_aa hypothetical protein
432 MPSQ01000001.1 GCA003260355_00439 CDS open 228802-229215 _na     137_aa Haloacid dehalogenase
433 MPSQ01000001.1 GCA003260355_00440 CDS open 229576-229731 _na     51_aa hypothetical protein
434 MPSQ01000001.1 GCA003260355_00441 CDS open 229971-230096 _na     41_aa hypothetical protein
435 MPSQ01000001.1 GCA003260355_00442 CDS open 230151-230567 _na     138_aa Pyrimidine 5'-nucleotidase (UMPH-1)
436 MPSQ01000001.1 GCA003260355_00443 CDS open 230673-230936 _na     87_aa Isoleucine--tRNA ligase
437 MPSQ01000001.1 GCA003260355_00444 CDS open 230946-231086 _na     46_aa hypothetical protein
438 MPSQ01000001.1 GCA003260355_00445 CDS open 231449-231676 _na     75_aa hypothetical protein
439 MPSQ01000001.1 GCA003260355_00446 CDS open 231725-231904 _na     59_aa hypothetical protein
440 MPSQ01000001.1 GCA003260355_00447 CDS open 231926-232153 _na     75_aa hypothetical protein
441 MPSQ01000001.1 GCA003260355_00448 CDS open 232205-232381 _na     58_aa hypothetical protein
442 MPSQ01000001.1 GCA003260355_00449 CDS open 233097-233801 _na     234_aa hypothetical protein
443 MPSQ01000001.1 GCA003260355_00450 CDS open 233845-234294 _na     149_aa hypothetical protein
444 MPSQ01000001.1 GCA003260355_00451 CDS open 234435-234554 _na     39_aa hypothetical protein
445 MPSQ01000001.1 GCA003260355_00452 CDS open 234696-234854 _na     52_aa hypothetical protein
446 MPSQ01000001.1 GCA003260355_00453 CDS open 234969-235241 _na     90_aa hypothetical protein
447 MPSQ01000001.1 GCA003260355_00454 CDS open 235413-235640 _na     75_aa hypothetical protein
448 MPSQ01000001.1 GCA003260355_00455 CDS open 235710-235931 _na     73_aa hypothetical protein
449 MPSQ01000001.1 GCA003260355_00456 CDS open 235938-236375 _na     145_aa hypothetical protein
450 MPSQ01000001.1 GCA003260355_00457 CDS open 236437-236649 _na     70_aa hypothetical protein
451 MPSQ01000001.1 GCA003260355_00458 CDS open 236728-237555 _na     275_aa Bacterial type II secretion system protein E domain-containing protein
452 MPSQ01000001.1 GCA003260355_00459 CDS open 237613-237873 _na     86_aa hypothetical protein
453 MPSQ01000001.1 GCA003260355_00460 CDS open 238060-238605 _na     181_aa hypothetical protein
454 MPSQ01000001.1 GCA003260355_00461 CDS open 238804-239208 _na     134_aa hypothetical protein
455 MPSQ01000001.1 GCA003260355_00462 CDS open 239747-240406 _na     219_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
456 MPSQ01000001.1 GCA003260355_00463 CDS open 240467-240583 _na     38_aa hypothetical protein
457 MPSQ01000001.1 GCA003260355_00464 CDS open 240589-240795 _na     68_aa ftsL Cell division protein FtsL
458 MPSQ01000001.1 GCA003260355_00465 CDS open 240835-240984 _na     49_aa hypothetical protein
459 MPSQ01000001.1 GCA003260355_00466 CDS open 241196-241519 _na     107_aa hypothetical protein
460 MPSQ01000001.1 GCA003260355_00467 CDS open 241616-241897 _na     93_aa hypothetical protein
461 MPSQ01000001.1 GCA003260355_00468 CDS open 241997-242110 _na     37_aa hypothetical protein
462 MPSQ01000001.1 GCA003260355_00469 CDS open 242730-243812 _na     360_aa Elongation factor G
463 MPSQ01000001.1 GCA003260355_00470 CDS open 243819-244835 _na     338_aa fusA elongation factor G
464 MPSQ01000001.1 GCA003260355_00471 CDS open 245008-245421 _na     137_aa terC Tellurium resistance protein TerC
465 MPSQ01000001.1 GCA003260355_00472 CDS open 245659-245937 _na     92_aa hypothetical protein
466 MPSQ01000001.1 GCA003260355_00473 CDS open 246182-246301 _na     39_aa hypothetical protein
467 MPSQ01000001.1 GCA003260355_00474 CDS open 246323-246424 _na     33_aa hypothetical protein
468 MPSQ01000001.1 GCA003260355_00475 CDS open 246485-246841 _na     118_aa Cation efflux protein cytoplasmic domain-containing protein
469 MPSQ01000001.1 GCA003260355_00476 CDS open 246887-247015 _na     42_aa hypothetical protein
470 MPSQ01000001.1 GCA003260355_00477 CDS open 247103-247267 _na     54_aa hypothetical protein
471 MPSQ01000001.1 GCA003260355_00478 CDS open 247939-248256 _na     105_aa hypothetical protein
472 MPSQ01000001.1 GCA003260355_00479 CDS open 248548-249021 _na     157_aa Ferric uptake regulation protein
473 MPSQ01000001.1 GCA003260355_00480 CDS open 249065-249346 _na     93_aa hypothetical protein
474 MPSQ01000001.1 GCA003260355_00481 CDS open 249416-253222 _na     1268_aa ileS isoleucine--tRNA ligase
475 MPSQ01000001.1 GCA003260355_00482 CDS open 253315-253776 _na     153_aa hypothetical protein
476 MPSQ01000001.1 GCA003260355_00483 CDS open 254849-255664 _na     271_aa Peptidase metallopeptidase domain-containing protein
477 MPSQ01000001.1 GCA003260355_00484 CDS open 255823-256089 _na     88_aa hypothetical protein
478 MPSQ01000001.1 GCA003260355_00485 CDS open 256270-256581 _na     103_aa hypothetical protein
479 MPSQ01000001.1 GCA003260355_00486 CDS open 256765-256974 _na     69_aa HU domain-containing protein
480 MPSQ01000001.1 GCA003260355_00487 CDS open 257189-257902 _na     237_aa sufC Fe-S cluster assembly ATPase SufC
481 MPSQ01000001.1 GCA003260355_00488 CDS open 257959-258081 _na     40_aa hypothetical protein
482 MPSQ01000001.1 GCA003260355_00489 CDS open 258286-258396 _na     36_aa hypothetical protein
483 MPSQ01000001.1 GCA003260355_00490 CDS open 258661-259215 _na     184_aa nth endonuclease III
484 MPSQ01000001.1 GCA003260355_00491 CDS open 259433-259903 _na     156_aa Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
485 MPSQ01000001.1 GCA003260355_00493 CDS open 260209-260586 _na     125_aa HIT domain-containing protein
486 MPSQ01000001.1 GCA003260355_00494 CDS open 260757-261254 _na     165_aa hypothetical protein
487 MPSQ01000001.1 GCA003260355_00495 CDS open 261348-261833 _na     161_aa hypothetical protein
488 MPSQ01000001.1 GCA003260355_00496 CDS open 261951-262055 _na     34_aa hypothetical protein
489 MPSQ01000001.1 GCA003260355_00497 CDS open 262444-262773 _na     109_aa hypothetical protein
490 MPSQ01000001.1 GCA003260355_00498 CDS open 262837-263313 _na     158_aa mscS Mechanosensitive ion channel protein MscS
491 MPSQ01000001.1 GCA003260355_00499 CDS open 263335-263904 _na     189_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
492 MPSQ01000001.1 GCA003260355_00500 CDS open 264094-264885 _na     263_aa hypothetical protein
493 MPSQ01000001.1 GCA003260355_00501 CDS open 266077-266586 _na     169_aa hypothetical protein
494 MPSQ01000001.1 GCA003260355_00502 CDS open 266614-267096 _na     160_aa hypothetical protein
495 MPSQ01000001.1 GCA003260355_00503 CDS open 267289-267489 _na     66_aa hypothetical protein
496 MPSQ01000001.1 GCA003260355_00504 CDS open 267544-267810 _na     88_aa hypothetical protein
497 MPSQ01000001.1 GCA003260355_00505 CDS open 268017-268178 _na     53_aa hypothetical protein
498 MPSQ01000001.1 GCA003260355_00506 CDS open 268191-268421 _na     76_aa hypothetical protein
499 MPSQ01000001.1 GCA003260355_00507 CDS open 268578-268682 _na     34_aa hypothetical protein
500 MPSQ01000001.1 GCA003260355_00508 CDS open 268698-268862 _na     54_aa hypothetical protein