HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Eggerthella lenta (GCA_003340105.1)

Select a Genome:
BAKTA Annotations for GCA_003340105.1
Genome Selected: Eggerthella lenta
ContigsBases CDSrRNA tmRNAtRNA
75 3596161 3098 3 1 49
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 6324 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 6324 [13 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 PPUH01000008.1 GCA003340105_03017 gene open 99701-102565 dmsA
3002 PPUH01000008.1 GCA003340105_03018 gene open 102707-103609 lysR
3003 PPUH01000008.1 GCA003340105_03019 gene open 103798-104340 wrbA
3004 PPUH01000008.1 GCA003340105_03020 gene open 104501-104890 soxR
3005 PPUH01000008.1 GCA003340105_03021 gene open 105495-106748 araJ
3006 PPUH01000008.1 GCA003340105_03022 gene open 107147-108391 srmB
3007 PPUH01000008.1 GCA003340105_03023 gene open 108399-108845
3008 PPUH01000008.1 GCA003340105_03024 gene open 108842-109153 relB
3009 PPUH01000008.1 GCA003340105_03025 gene open 109261-111609 mgtA
3010 PPUH01000008.1 GCA003340105_03026 gene open 111658-112350 dotG
3011 PPUH01000008.1 GCA003340105_03027 gene open 112428-113018
3012 PPUH01000008.1 GCA003340105_03028 gene open 113018-113485 rimI
3013 PPUH01000008.1 GCA003340105_03029 gene open 113799-114110
3014 PPUH01000008.1 GCA003340105_03030 gene open 114464-115810 dinP
3015 PPUH01000008.1 GCA003340105_03031 gene open 116015-116722
3016 PPUH01000008.1 GCA003340105_03032 gene open 116834-117817 rhtA
3017 PPUH01000008.1 GCA003340105_03033 gene open 117950-119458
3018 PPUH01000008.1 GCA003340105_03034 gene open 119451-120170 rbbA
3019 PPUH01000008.1 GCA003340105_03035 gene open 120167-121285 xRE
3020 PPUH01000008.1 GCA003340105_03036 gene open 121928-123427 kdpD
3021 PPUH01000008.1 GCA003340105_03037 gene open 123415-124077 ompR
3022 PPUH01000008.1 GCA003340105_03038 gene open 124146-125033
3023 PPUH01000008.1 GCA003340105_03039 gene open 125033-125809
3024 PPUH01000008.1 GCA003340105_03040 gene open 125806-126504 rbbA
3025 PPUH01000008.1 GCA003340105_03041 gene open 126684-127712
3026 PPUH01000008.1 GCA003340105_03042 gene open 127684-129426 gGDEF
3027 PPUH01000008.1 GCA003340105_03044 gene open 129906-130502 acrR
3028 PPUH01000008.1 GCA003340105_02938 gene open 8753-8829 trnD
3029 PPUH01000008.1 GCA003340105_02939 gene open 8943-9019 trnD
3030 PPUH01000008.1 GCA003340105_02958 gene open 27987-28062 trnR
3031 PPUH01000008.1 GCA003340105_02965 gene open 40023-40097 trnE
3032 PPUH01000008.1 GCA003340105_03043 gene open 129634-129708 trnT
3033 PPUH01000008.1 GCA003340105_02938 tRNA open 8753-8829 trnD tRNA-Asp(gtc)
3034 PPUH01000008.1 GCA003340105_02939 tRNA open 8943-9019 trnD tRNA-Asp(gtc)
3035 PPUH01000008.1 GCA003340105_02958 tRNA open 27987-28062 trnR tRNA-Arg(ccg)
3036 PPUH01000008.1 GCA003340105_02965 tRNA open 40023-40097 trnE tRNA-Glu(ttc)
3037 PPUH01000008.1 GCA003340105_03043 tRNA open 129634-129708 trnT tRNA-Thr(tgt)
3038 PPUH01000009.1 GCA003340105_03058 gene open 11808-12176 ssrA
3039 PPUH01000009.1 GCA003340105_03058 tmRNA open 11808-12176 ssrA transfer-messenger RNA%2C SsrA
3040 PPUH01000009.1 repeat_region open 24424-25609 CRISPR array with 18 repeats of length 32%2C consensus sequence ATTTCAACCCGCACTCCCCATGCGGGGAGTGA and spacer length 35
3041 PPUH01000009.1 GCA003340105_03045 CDS open 77-970 _na     297_aa hypothetical protein
3042 PPUH01000009.1 GCA003340105_03047 CDS open 1568-1810 _na     80_aa grxC Glutathione S-transferase N-terminal domain-containing protein
3043 PPUH01000009.1 GCA003340105_03049 CDS open 2181-4649 _na     822_aa ligD DNA ligase D
3044 PPUH01000009.1 GCA003340105_03050 CDS open 4657-5220 _na     187_aa DUF4256 domain-containing protein
3045 PPUH01000009.1 GCA003340105_03052 CDS open 5690-6829 _na     379_aa DUF559 domain-containing protein
3046 PPUH01000009.1 GCA003340105_03053 CDS open 6958-7563 _na     201_aa rdgB RdgB/HAM1 family non-canonical purine NTP pyrophosphatase
3047 PPUH01000009.1 GCA003340105_03054 CDS open 7596-8507 _na     303_aa murI glutamate racemase
3048 PPUH01000009.1 GCA003340105_03055 CDS open 8623-9237 _na     204_aa wrbA NADPH-dependent FMN reductase
3049 PPUH01000009.1 GCA003340105_03056 CDS open 9256-9741 _na     161_aa ybaK Cys-tRNA(Pro) deacylase
3050 PPUH01000009.1 GCA003340105_03057 CDS open 9838-11334 _na     498_aa erfK L%2CD-TPase catalytic domain-containing protein
3051 PPUH01000009.1 GCA003340105_03059 CDS open 12286-12507 _na     73_aa hipB Transcriptional regulator%2C XRE family
3052 PPUH01000009.1 GCA003340105_03060 CDS open 12568-13554 _na     328_aa hypothetical protein
3053 PPUH01000009.1 GCA003340105_03061 CDS open 13581-14252 _na     223_aa hypothetical protein
3054 PPUH01000009.1 GCA003340105_03062 CDS open 14620-14850 _na     76_aa relB type II toxin-antitoxin system RelB family antitoxin
3055 PPUH01000009.1 GCA003340105_03063 CDS open 14847-15116 _na     89_aa relE Addiction module toxin%2C RelE/StbE family
3056 PPUH01000009.1 GCA003340105_03064 CDS open 15206-16018 _na     270_aa DNA primase
3057 PPUH01000009.1 GCA003340105_03065 CDS open 16081-16548 _na     155_aa smpB SsrA-binding protein SmpB
3058 PPUH01000009.1 GCA003340105_03066 CDS open 16557-17708 _na     383_aa frvX M42 family metallopeptidase
3059 PPUH01000009.1 GCA003340105_03067 CDS open 17878-18159 _na     93_aa Plasmid recombination enzyme
3060 PPUH01000009.1 GCA003340105_03068 CDS open 18352-20718 _na     788_aa otsB bifunctional alpha%2Calpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase
3061 PPUH01000009.1 GCA003340105_03069 CDS open 20715-21275 _na     186_aa hypothetical protein
3062 PPUH01000009.1 GCA003340105_03070 CDS open 21272-21637 _na     121_aa yhbQ GIY-YIG nuclease family protein
3063 PPUH01000009.1 GCA003340105_03071 CDS open 21643-22098 _na     151_aa nanQ YhcH/YjgK/YiaL family protein
3064 PPUH01000009.1 GCA003340105_03072 CDS open 22302-24107 _na     601_aa ade adenine deaminase
3065 PPUH01000009.1 GCA003340105_03073 CDS open 25756-26046 _na     96_aa cas2 CRISPR-associated endonuclease Cas2
3066 PPUH01000009.1 GCA003340105_03074 CDS open 26057-27088 _na     343_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
3067 PPUH01000009.1 GCA003340105_03075 CDS open 27085-27747 _na     220_aa cas4 CRISPR-associated protein Cas4
3068 PPUH01000009.1 GCA003340105_03076 CDS open 27750-28649 _na     299_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
3069 PPUH01000009.1 GCA003340105_03077 CDS open 28653-30401 _na     582_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
3070 PPUH01000009.1 GCA003340105_03078 CDS open 30398-31060 _na     220_aa cas5c type I-C CRISPR-associated protein Cas5c
3071 PPUH01000009.1 GCA003340105_03079 CDS open 31291-33489 _na     732_aa cas3 Metal dependent phosphohydrolase
3072 PPUH01000009.1 GCA003340105_03080 CDS open 33697-34317 _na     206_aa yjhB NUDIX hydrolase
3073 PPUH01000009.1 GCA003340105_03081 CDS open 34314-35378 _na     354_aa ybbK [ribosomal protein uS5]-alanine N-acetyltransferase
3074 PPUH01000009.1 GCA003340105_03082 CDS open 35437-36630 _na     397_aa Major facilitator superfamily MFS_1
3075 PPUH01000009.1 GCA003340105_03083 CDS open 36822-40091 _na     1089_aa sWIM Non-specific serine/threonine protein kinase
3076 PPUH01000009.1 GCA003340105_03084 CDS open 40100-42652 _na     850_aa accA acetyl-CoA carboxylase carboxyltransferase subunit alpha
3077 PPUH01000009.1 GCA003340105_03085 CDS open 42672-43121 _na     149_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
3078 PPUH01000009.1 GCA003340105_03086 CDS open 43140-44429 _na     429_aa fabF beta-ketoacyl-ACP synthase II
3079 PPUH01000009.1 GCA003340105_03087 CDS open 44426-45190 _na     254_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
3080 PPUH01000009.1 GCA003340105_03088 CDS open 45205-46269 _na     354_aa fabD Malonyl CoA-acyl carrier protein transacylase
3081 PPUH01000009.1 GCA003340105_03089 CDS open 46280-47257 _na     325_aa yrpB Nitronate monooxygenase
3082 PPUH01000009.1 GCA003340105_03090 CDS open 47338-47556 _na     72_aa acpP Acyl carrier protein
3083 PPUH01000009.1 GCA003340105_03091 CDS open 47859-48329 _na     156_aa marR HTH-type transcriptional regulator SarZ
3084 PPUH01000009.1 GCA003340105_03092 CDS open 48384-49199 _na     271_aa VanZ-like domain-containing protein
3085 PPUH01000009.1 GCA003340105_03093 CDS open 49209-51314 _na     701_aa vacB Ribonuclease R
3086 PPUH01000009.1 GCA003340105_03094 CDS open 51317-52531 _na     404_aa ctpA Peptidase
3087 PPUH01000009.1 GCA003340105_03095 CDS open 52609-53514 _na     301_aa ftsX permease-like cell division protein FtsX
3088 PPUH01000009.1 GCA003340105_03096 CDS open 53507-54349 _na     280_aa ftsE cell division ATP-binding protein FtsE
3089 PPUH01000009.1 GCA003340105_03097 CDS open 54405-55370 _na     321_aa tktA2 Transketolase central region
3090 PPUH01000009.1 GCA003340105_03098 CDS open 55363-56202 _na     279_aa tktA1 Transketolase
3091 PPUH01000009.1 GCA003340105_03099 CDS open 56375-57469 _na     364_aa prfB peptide chain release factor 2
3092 PPUH01000009.1 GCA003340105_03100 CDS open 57476-60280 _na     934_aa secA preprotein translocase subunit SecA
3093 PPUH01000009.1 GCA003340105_03101 CDS open 60476-60733 _na     85_aa brnA type II toxin-antitoxin system BrnA family antitoxin
3094 PPUH01000009.1 GCA003340105_03102 CDS open 60708-61013 _na     101_aa brnT BrnT family toxin
3095 PPUH01000009.1 GCA003340105_03103 CDS open 61061-63664 _na     867_aa dnrI Transcriptional regulator%2C SARP family
3096 PPUH01000009.1 GCA003340105_03104 CDS open 63821-64825 _na     334_aa dmpA Peptidase S58 DmpA
3097 PPUH01000009.1 GCA003340105_03105 CDS open 64838-66091 _na     417_aa clcA Chloride channel core
3098 PPUH01000009.1 GCA003340105_03106 CDS open 66159-66587 _na     142_aa rsfS ribosome silencing factor
3099 PPUH01000009.1 GCA003340105_03107 CDS open 66584-67207 _na     207_aa yqeK bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK
3100 PPUH01000009.1 GCA003340105_03108 CDS open 67204-67881 _na     225_aa nadD nicotinate-nucleotide adenylyltransferase
3101 PPUH01000009.1 GCA003340105_03109 CDS open 67881-69158 _na     425_aa proA glutamate-5-semialdehyde dehydrogenase
3102 PPUH01000009.1 GCA003340105_03110 CDS open 69168-70319 _na     383_aa proB Glutamate 5-kinase
3103 PPUH01000009.1 GCA003340105_03111 CDS open 70316-71710 _na     464_aa obgE GTPase ObgE
3104 PPUH01000009.1 GCA003340105_03112 CDS open 71863-72114 _na     83_aa rpmA 50S ribosomal protein L27
3105 PPUH01000009.1 GCA003340105_03113 CDS open 72133-72549 _na     138_aa rplU 50S ribosomal protein L21
3106 PPUH01000009.1 GCA003340105_03114 CDS open 72811-75438 _na     875_aa polA DNA polymerase I
3107 PPUH01000009.1 GCA003340105_03115 CDS open 75567-76241 _na     224_aa ompR DNA-binding response regulator
3108 PPUH01000009.1 GCA003340105_03116 CDS open 76260-77603 _na     447_aa glnA type I glutamate--ammonia ligase
3109 PPUH01000009.1 GCA003340105_03117 CDS open 77674-78504 _na     276_aa nlpA Lipoprotein
3110 PPUH01000009.1 GCA003340105_03118 CDS open 78560-79234 _na     224_aa metP Binding-protein-dependent transport systems inner membrane component
3111 PPUH01000009.1 GCA003340105_03119 CDS open 79236-80009 _na     257_aa abcC ABC transporter related
3112 PPUH01000009.1 GCA003340105_03120 CDS open 80380-80877 _na     165_aa uspA UspA domain protein
3113 PPUH01000009.1 GCA003340105_03121 CDS open 81025-82260 _na     411_aa rfaB Glycosyl transferase group 1
3114 PPUH01000009.1 GCA003340105_03122 CDS open 82378-83604 _na     408_aa wecE DegT/DnrJ/EryC1/StrS aminotransferase family protein
3115 PPUH01000009.1 GCA003340105_03123 CDS open 83604-84209 _na     201_aa wcaJ Undecaprenyl-phosphate galactose phosphotransferase
3116 PPUH01000009.1 GCA003340105_03124 CDS open 84324-84683 _na     119_aa hPtr Hpt protein
3117 PPUH01000009.1 GCA003340105_03125 CDS open 84711-85742 _na     343_aa afuA Extracellular solute-binding protein family 1
3118 PPUH01000009.1 GCA003340105_03126 CDS open 85989-87200 _na     403_aa eutH ethanolamine utilization protein EutH
3119 PPUH01000009.1 GCA003340105_03127 CDS open 87206-88975 _na     589_aa licC Aminoglycoside phosphotransferase
3120 PPUH01000009.1 GCA003340105_03128 CDS open 89153-90055 _na     300_aa licC CTP:phosphocholine cytidylyltransferase-like protein
3121 PPUH01000009.1 GCA003340105_03129 CDS open 90093-91694 _na     533_aa fbpB Binding-protein-dependent transport systems inner membrane component
3122 PPUH01000009.1 GCA003340105_03130 CDS open 91702-92496 _na     264_aa potA ABC transporter related
3123 PPUH01000009.1 GCA003340105_03131 CDS open 92520-93515 _na     331_aa afuA ABC-type transporter%2C periplasmic component
3124 PPUH01000009.1 GCA003340105_03132 CDS open 93646-94872 _na     408_aa rfbX Polysaccharide biosynthesis protein
3125 PPUH01000009.1 GCA003340105_03133 CDS open 94887-95741 _na     284_aa licD LicD family protein
3126 PPUH01000009.1 GCA003340105_03134 CDS open 95833-96630 _na     265_aa Glycosyl transferase family 2
3127 PPUH01000009.1 GCA003340105_03135 CDS open 96649-97509 _na     286_aa licD LicD family protein
3128 PPUH01000009.1 GCA003340105_03136 CDS open 97608-99695 _na     695_aa ATP-binding protein
3129 PPUH01000009.1 GCA003340105_03137 CDS open 99828-100937 _na     369_aa wcaA Glycosyl transferase family 2
3130 PPUH01000009.1 GCA003340105_03138 CDS open 100934-101956 _na     340_aa wcaA Glycosyl transferase family 2
3131 PPUH01000009.1 GCA003340105_03139 CDS open 101960-103060 _na     366_aa wcaA Glycosyl transferase family 2
3132 PPUH01000009.1 GCA003340105_03140 CDS open 103163-104323 _na     386_aa wcaA Glycosyl transferase family 2
3133 PPUH01000009.1 GCA003340105_03141 CDS open 104305-104499 _na     64_aa hypothetical protein
3134 PPUH01000009.1 GCA003340105_03142 CDS open 104496-106994 _na     832_aa wcaE Glycosyl transferase family 2
3135 PPUH01000009.1 GCA003340105_03143 CDS open 107008-107580 _na     190_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
3136 PPUH01000009.1 GCA003340105_03144 CDS open 107590-108591 _na     333_aa rfbB dTDP-glucose 4%2C6-dehydratase
3137 PPUH01000009.1 GCA003340105_03145 CDS open 108818-109618 _na     266_aa tagG Transport permease protein
3138 PPUH01000009.1 GCA003340105_03146 CDS open 109633-111477 _na     614_aa tagH ATP-binding cassette domain-containing protein
3139 PPUH01000009.1 GCA003340105_03147 CDS open 111514-112698 _na     394_aa DUF4422 domain-containing protein
3140 PPUH01000009.1 GCA003340105_03148 CDS open 112709-113611 _na     300_aa rfbD dTDP-4-dehydrorhamnose reductase
3141 PPUH01000009.1 GCA003340105_03149 CDS open 113614-114516 _na     300_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
3142 PPUH01000009.1 GCA003340105_03150 CDS open 114654-116744 _na     696_aa nlpC NLP/P60 protein
3143 PPUH01000009.1 GCA003340105_03151 CDS open 117059-118885 _na     608_aa Membrane protein-like protein
3144 PPUH01000009.1 GCA003340105_03152 CDS open 118973-121357 _na     794_aa wcaE Glycosyl transferase family 2
3145 PPUH01000009.1 GCA003340105_03153 CDS open 121551-126968 _na     1805_aa cotH Cell wall hydrolase/autolysin
3146 PPUH01000009.1 GCA003340105_03154 CDS open 127857-128570 _na     237_aa wcaA Glycosyl transferase family 2
3147 PPUH01000009.1 GCA003340105_03155 CDS open 128561-128941 _na     126_aa DUF2304 domain-containing protein
3148 PPUH01000009.1 GCA003340105_03045 gene open 77-970
3149 PPUH01000009.1 GCA003340105_03047 gene open 1568-1810 grxC
3150 PPUH01000009.1 GCA003340105_03049 gene open 2181-4649 ligD
3151 PPUH01000009.1 GCA003340105_03050 gene open 4657-5220
3152 PPUH01000009.1 GCA003340105_03052 gene open 5690-6829
3153 PPUH01000009.1 GCA003340105_03053 gene open 6958-7563 rdgB
3154 PPUH01000009.1 GCA003340105_03054 gene open 7596-8507 murI
3155 PPUH01000009.1 GCA003340105_03055 gene open 8623-9237 wrbA
3156 PPUH01000009.1 GCA003340105_03056 gene open 9256-9741 ybaK
3157 PPUH01000009.1 GCA003340105_03057 gene open 9838-11334 erfK
3158 PPUH01000009.1 GCA003340105_03059 gene open 12286-12507 hipB
3159 PPUH01000009.1 GCA003340105_03060 gene open 12568-13554
3160 PPUH01000009.1 GCA003340105_03061 gene open 13581-14252
3161 PPUH01000009.1 GCA003340105_03062 gene open 14620-14850 relB
3162 PPUH01000009.1 GCA003340105_03063 gene open 14847-15116 relE
3163 PPUH01000009.1 GCA003340105_03064 gene open 15206-16018
3164 PPUH01000009.1 GCA003340105_03065 gene open 16081-16548 smpB
3165 PPUH01000009.1 GCA003340105_03066 gene open 16557-17708 frvX
3166 PPUH01000009.1 GCA003340105_03067 gene open 17878-18159
3167 PPUH01000009.1 GCA003340105_03068 gene open 18352-20718 otsB
3168 PPUH01000009.1 GCA003340105_03069 gene open 20715-21275
3169 PPUH01000009.1 GCA003340105_03070 gene open 21272-21637 yhbQ
3170 PPUH01000009.1 GCA003340105_03071 gene open 21643-22098 nanQ
3171 PPUH01000009.1 GCA003340105_03072 gene open 22302-24107 ade
3172 PPUH01000009.1 GCA003340105_03073 gene open 25756-26046 cas2
3173 PPUH01000009.1 GCA003340105_03074 gene open 26057-27088 cas1c
3174 PPUH01000009.1 GCA003340105_03075 gene open 27085-27747 cas4
3175 PPUH01000009.1 GCA003340105_03076 gene open 27750-28649 cas7c
3176 PPUH01000009.1 GCA003340105_03077 gene open 28653-30401 cas8c
3177 PPUH01000009.1 GCA003340105_03078 gene open 30398-31060 cas5c
3178 PPUH01000009.1 GCA003340105_03079 gene open 31291-33489 cas3
3179 PPUH01000009.1 GCA003340105_03080 gene open 33697-34317 yjhB
3180 PPUH01000009.1 GCA003340105_03081 gene open 34314-35378 ybbK
3181 PPUH01000009.1 GCA003340105_03082 gene open 35437-36630
3182 PPUH01000009.1 GCA003340105_03083 gene open 36822-40091 sWIM
3183 PPUH01000009.1 GCA003340105_03084 gene open 40100-42652 accA
3184 PPUH01000009.1 GCA003340105_03085 gene open 42672-43121 fabZ
3185 PPUH01000009.1 GCA003340105_03086 gene open 43140-44429 fabF
3186 PPUH01000009.1 GCA003340105_03087 gene open 44426-45190 fabG
3187 PPUH01000009.1 GCA003340105_03088 gene open 45205-46269 fabD
3188 PPUH01000009.1 GCA003340105_03089 gene open 46280-47257 yrpB
3189 PPUH01000009.1 GCA003340105_03090 gene open 47338-47556 acpP
3190 PPUH01000009.1 GCA003340105_03091 gene open 47859-48329 marR
3191 PPUH01000009.1 GCA003340105_03092 gene open 48384-49199
3192 PPUH01000009.1 GCA003340105_03093 gene open 49209-51314 vacB
3193 PPUH01000009.1 GCA003340105_03094 gene open 51317-52531 ctpA
3194 PPUH01000009.1 GCA003340105_03095 gene open 52609-53514 ftsX
3195 PPUH01000009.1 GCA003340105_03096 gene open 53507-54349 ftsE
3196 PPUH01000009.1 GCA003340105_03097 gene open 54405-55370 tktA2
3197 PPUH01000009.1 GCA003340105_03098 gene open 55363-56202 tktA1
3198 PPUH01000009.1 GCA003340105_03099 gene open 56375-57469 prfB
3199 PPUH01000009.1 GCA003340105_03100 gene open 57476-60280 secA
3200 PPUH01000009.1 GCA003340105_03101 gene open 60476-60733 brnA
3201 PPUH01000009.1 GCA003340105_03102 gene open 60708-61013 brnT
3202 PPUH01000009.1 GCA003340105_03103 gene open 61061-63664 dnrI
3203 PPUH01000009.1 GCA003340105_03104 gene open 63821-64825 dmpA
3204 PPUH01000009.1 GCA003340105_03105 gene open 64838-66091 clcA
3205 PPUH01000009.1 GCA003340105_03106 gene open 66159-66587 rsfS
3206 PPUH01000009.1 GCA003340105_03107 gene open 66584-67207 yqeK
3207 PPUH01000009.1 GCA003340105_03108 gene open 67204-67881 nadD
3208 PPUH01000009.1 GCA003340105_03109 gene open 67881-69158 proA
3209 PPUH01000009.1 GCA003340105_03110 gene open 69168-70319 proB
3210 PPUH01000009.1 GCA003340105_03111 gene open 70316-71710 obgE
3211 PPUH01000009.1 GCA003340105_03112 gene open 71863-72114 rpmA
3212 PPUH01000009.1 GCA003340105_03113 gene open 72133-72549 rplU
3213 PPUH01000009.1 GCA003340105_03114 gene open 72811-75438 polA
3214 PPUH01000009.1 GCA003340105_03115 gene open 75567-76241 ompR
3215 PPUH01000009.1 GCA003340105_03116 gene open 76260-77603 glnA
3216 PPUH01000009.1 GCA003340105_03117 gene open 77674-78504 nlpA
3217 PPUH01000009.1 GCA003340105_03118 gene open 78560-79234 metP
3218 PPUH01000009.1 GCA003340105_03119 gene open 79236-80009 abcC
3219 PPUH01000009.1 GCA003340105_03120 gene open 80380-80877 uspA
3220 PPUH01000009.1 GCA003340105_03121 gene open 81025-82260 rfaB
3221 PPUH01000009.1 GCA003340105_03122 gene open 82378-83604 wecE
3222 PPUH01000009.1 GCA003340105_03123 gene open 83604-84209 wcaJ
3223 PPUH01000009.1 GCA003340105_03124 gene open 84324-84683 hPtr
3224 PPUH01000009.1 GCA003340105_03125 gene open 84711-85742 afuA
3225 PPUH01000009.1 GCA003340105_03126 gene open 85989-87200 eutH
3226 PPUH01000009.1 GCA003340105_03127 gene open 87206-88975 licC
3227 PPUH01000009.1 GCA003340105_03128 gene open 89153-90055 licC
3228 PPUH01000009.1 GCA003340105_03129 gene open 90093-91694 fbpB
3229 PPUH01000009.1 GCA003340105_03130 gene open 91702-92496 potA
3230 PPUH01000009.1 GCA003340105_03131 gene open 92520-93515 afuA
3231 PPUH01000009.1 GCA003340105_03132 gene open 93646-94872 rfbX
3232 PPUH01000009.1 GCA003340105_03133 gene open 94887-95741 licD
3233 PPUH01000009.1 GCA003340105_03134 gene open 95833-96630
3234 PPUH01000009.1 GCA003340105_03135 gene open 96649-97509 licD
3235 PPUH01000009.1 GCA003340105_03136 gene open 97608-99695
3236 PPUH01000009.1 GCA003340105_03137 gene open 99828-100937 wcaA
3237 PPUH01000009.1 GCA003340105_03138 gene open 100934-101956 wcaA
3238 PPUH01000009.1 GCA003340105_03139 gene open 101960-103060 wcaA
3239 PPUH01000009.1 GCA003340105_03140 gene open 103163-104323 wcaA
3240 PPUH01000009.1 GCA003340105_03141 gene open 104305-104499
3241 PPUH01000009.1 GCA003340105_03142 gene open 104496-106994 wcaE
3242 PPUH01000009.1 GCA003340105_03143 gene open 107008-107580 rfbC
3243 PPUH01000009.1 GCA003340105_03144 gene open 107590-108591 rfbB
3244 PPUH01000009.1 GCA003340105_03145 gene open 108818-109618 tagG
3245 PPUH01000009.1 GCA003340105_03146 gene open 109633-111477 tagH
3246 PPUH01000009.1 GCA003340105_03147 gene open 111514-112698
3247 PPUH01000009.1 GCA003340105_03148 gene open 112709-113611 rfbD
3248 PPUH01000009.1 GCA003340105_03149 gene open 113614-114516 rfbA
3249 PPUH01000009.1 GCA003340105_03150 gene open 114654-116744 nlpC
3250 PPUH01000009.1 GCA003340105_03151 gene open 117059-118885
3251 PPUH01000009.1 GCA003340105_03152 gene open 118973-121357 wcaE
3252 PPUH01000009.1 GCA003340105_03153 gene open 121551-126968 cotH
3253 PPUH01000009.1 GCA003340105_03154 gene open 127857-128570 wcaA
3254 PPUH01000009.1 GCA003340105_03155 gene open 128561-128941
3255 PPUH01000009.1 GCA003340105_03046 gene open 1205-1280 trnR
3256 PPUH01000009.1 GCA003340105_03048 gene open 2031-2104 trnG
3257 PPUH01000009.1 GCA003340105_03051 gene open 5498-5574 trnP
3258 PPUH01000009.1 GCA003340105_03046 tRNA open 1205-1280 trnR tRNA-Arg(tct)
3259 PPUH01000009.1 GCA003340105_03048 tRNA open 2031-2104 trnG tRNA-Gly(tcc)
3260 PPUH01000009.1 GCA003340105_03051 tRNA open 5498-5574 trnP tRNA-Pro(tgg)
3261 PPUH01000010.1 GCA003340105_00287 CDS open 52-993 _na     313_aa yobV Helix-turn-helix type 11 domain protein
3262 PPUH01000010.1 GCA003340105_00288 CDS open 1004-1645 _na     213_aa mnaT GCN5-related N-acetyltransferase
3263 PPUH01000010.1 GCA003340105_00289 CDS open 2162-2464 _na     100_aa xRE Transcriptional regulator%2C XRE family
3264 PPUH01000010.1 GCA003340105_00290 CDS open 2461-3021 _na     186_aa DUF4234 domain-containing protein
3265 PPUH01000010.1 GCA003340105_00291 CDS open 3179-4324 _na     381_aa penP Beta-lactamase class A catalytic domain-containing protein
3266 PPUH01000010.1 GCA003340105_00292 CDS open 4321-5496 _na     391_aa cwlO1 Peptidase
3267 PPUH01000010.1 GCA003340105_00293 CDS open 5882-6994 _na     370_aa pheS phenylalanine--tRNA ligase subunit alpha
3268 PPUH01000010.1 GCA003340105_00294 CDS open 7185-9623 _na     812_aa pheT phenylalanine--tRNA ligase subunit beta
3269 PPUH01000010.1 GCA003340105_00295 CDS open 9770-10072 _na     100_aa mJ0435 DNA polymerase beta domain protein region
3270 PPUH01000010.1 GCA003340105_00296 CDS open 10059-10409 _na     116_aa hEPN DUF86 domain-containing protein
3271 PPUH01000010.1 GCA003340105_00297 CDS open 10452-10580 _na     42_aa hypothetical protein
3272 PPUH01000010.1 GCA003340105_00298 CDS open 10709-11434 _na     241_aa tVP38 TVP38/TMEM64 family membrane protein
3273 PPUH01000010.1 GCA003340105_00299 CDS open 11680-12564 _na     294_aa map type I methionyl aminopeptidase
3274 PPUH01000010.1 GCA003340105_00300 CDS open 12748-14352 _na     534_aa SIR2-like domain-containing protein
3275 PPUH01000010.1 GCA003340105_00301 CDS open 14472-16127 _na     551_aa sdhA FAD-dependent oxidoreductase
3276 PPUH01000010.1 GCA003340105_00302 CDS open 16422-17972 _na     516_aa citB Helix-turn-helix transcriptional regulator
3277 PPUH01000010.1 GCA003340105_00303 CDS open 18165-18410 _na     81_aa Secreted protein
3278 PPUH01000010.1 GCA003340105_00304 CDS open 18397-19206 _na     269_aa hypothetical protein
3279 PPUH01000010.1 GCA003340105_00305 CDS open 19316-19744 _na     142_aa Peptidyl-prolyl cis-trans isomerase
3280 PPUH01000010.1 GCA003340105_00306 CDS open 19950-20366 _na     138_aa slpA Peptidyl-prolyl cis-trans isomerase
3281 PPUH01000010.1 GCA003340105_00307 CDS open 20381-21664 _na     427_aa gsh2 Glutamate--cysteine ligase
3282 PPUH01000010.1 GCA003340105_00308 CDS open 21802-23652 _na     616_aa flaA1 UDP-N-acetyl-alpha-D-glucosamine C6 dehydratase
3283 PPUH01000010.1 GCA003340105_00309 CDS open 23836-24111 _na     91_aa Antitoxin
3284 PPUH01000010.1 GCA003340105_00310 CDS open 24086-24409 _na     107_aa Plasmid stabilization system
3285 PPUH01000010.1 GCA003340105_00311 CDS open 24681-25745 _na     354_aa argC N-acetyl-gamma-glutamyl-phosphate reductase
3286 PPUH01000010.1 GCA003340105_00312 CDS open 25800-27077 _na     425_aa argJ bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ
3287 PPUH01000010.1 GCA003340105_00313 CDS open 27074-28060 _na     328_aa argB Acetylglutamate kinase
3288 PPUH01000010.1 GCA003340105_00314 CDS open 28082-29353 _na     423_aa argD Acetylornithine aminotransferase
3289 PPUH01000010.1 GCA003340105_00315 CDS open 29714-30142 _na     142_aa argR Arginine repressor
3290 PPUH01000010.1 GCA003340105_00316 CDS open 30408-31802 _na     464_aa argG argininosuccinate synthase
3291 PPUH01000010.1 GCA003340105_00317 CDS open 31813-33207 _na     464_aa argH argininosuccinate lyase
3292 PPUH01000010.1 GCA003340105_00318 CDS open 33490-35742 _na     750_aa mrcB peptidoglycan glycosyltransferase
3293 PPUH01000010.1 GCA003340105_00319 CDS open 35854-36360 _na     168_aa Lipoprotein
3294 PPUH01000010.1 GCA003340105_00320 CDS open 36586-37191 _na     201_aa HEAT repeat domain-containing protein
3295 PPUH01000010.1 GCA003340105_00321 CDS open 37291-38376 _na     361_aa leuB Isocitrate dehydrogenase [NADP]
3296 PPUH01000010.1 GCA003340105_00322 CDS open 38399-41062 _na     887_aa acnA aconitate hydratase AcnA
3297 PPUH01000010.1 GCA003340105_00323 CDS open 41159-43084 _na     641_aa Tat pathway signal sequence
3298 PPUH01000010.1 GCA003340105_00324 CDS open 43365-43886 _na     173_aa rplJ 50S ribosomal protein L10
3299 PPUH01000010.1 GCA003340105_00325 CDS open 43977-44354 _na     125_aa rplL 50S ribosomal protein L7/L12
3300 PPUH01000010.1 GCA003340105_00326 CDS open 44593-45525 _na     310_aa DUF4013 domain-containing protein
3301 PPUH01000010.1 GCA003340105_00327 CDS open 45628-47628 _na     666_aa ygiQ YgiQ family radical SAM protein
3302 PPUH01000010.1 GCA003340105_00328 CDS open 47732-49138 _na     468_aa uraA Uracil permease
3303 PPUH01000010.1 GCA003340105_00329 CDS open 49154-49528 _na     124_aa Glyoxalase/bleomycin resistance protein/dioxygenase
3304 PPUH01000010.1 GCA003340105_00330 CDS open 50134-52680 _na     848_aa feoB ferrous iron transport protein B
3305 PPUH01000010.1 GCA003340105_00331 CDS open 52743-54524 _na     593_aa mdlB ABC transporter related
3306 PPUH01000010.1 GCA003340105_00332 CDS open 54526-56559 _na     677_aa mdlB ABC transporter related
3307 PPUH01000010.1 GCA003340105_00333 CDS open 56788-57381 _na     197_aa acrR Transcriptional regulator%2C TetR family
3308 PPUH01000010.1 GCA003340105_00334 CDS open 57425-58378 _na     317_aa araC Transcriptional regulator%2C AraC family
3309 PPUH01000010.1 GCA003340105_00335 CDS open 58365-59909 _na     514_aa ecfA2 ABC transporter related
3310 PPUH01000010.1 GCA003340105_00336 CDS open 59911-60654 _na     247_aa ecfT Cobalt transport protein
3311 PPUH01000010.1 GCA003340105_00337 CDS open 60658-61287 _na     209_aa Trep-Strep domain-containing protein
3312 PPUH01000010.1 GCA003340105_00338 CDS open 61699-61920 _na     73_aa Transcriptional regulator
3313 PPUH01000010.1 GCA003340105_00339 CDS open 62024-62686 _na     220_aa acrR Transcriptional regulator%2C TetR family
3314 PPUH01000010.1 GCA003340105_00340 CDS open 62968-64794 _na     608_aa mdlB ABC transporter related
3315 PPUH01000010.1 GCA003340105_00341 CDS open 64804-66567 _na     587_aa mdlB ABC transporter related
3316 PPUH01000010.1 GCA003340105_00342 CDS open 66551-67324 _na     257_aa phnX phosphonoacetaldehyde hydrolase
3317 PPUH01000010.1 GCA003340105_00343 CDS open 67326-68432 _na     368_aa pucG 2-aminoethylphosphonate--pyruvate transaminase
3318 PPUH01000010.1 GCA003340105_00344 CDS open 68837-69544 _na     235_aa acrR Transcriptional regulator%2C TetR family
3319 PPUH01000010.1 GCA003340105_00345 CDS open 69541-69732 _na     63_aa Conjugal transfer protein
3320 PPUH01000010.1 GCA003340105_00346 CDS open 69865-71694 _na     609_aa mdlB ABC transporter related
3321 PPUH01000010.1 GCA003340105_00347 CDS open 71691-73430 _na     579_aa mdlB ABC transporter related
3322 PPUH01000010.1 GCA003340105_00348 CDS open 73512-74150 _na     212_aa mptD MptD family ECF transporter S component
3323 PPUH01000010.1 GCA003340105_00349 CDS open 74150-74923 _na     257_aa ecfT Cobalt transport protein
3324 PPUH01000010.1 GCA003340105_00350 CDS open 74917-76449 _na     510_aa ccmA heme ABC exporter ATP-binding protein CcmA
3325 PPUH01000010.1 GCA003340105_00351 CDS open 76453-78513 _na     686_aa zntA Heavy metal translocating P-type ATPase
3326 PPUH01000010.1 GCA003340105_00352 CDS open 78898-79161 _na     87_aa frmR Metal-sensitive transcriptional repressor
3327 PPUH01000010.1 GCA003340105_00353 CDS open 79212-80447 _na     411_aa araJ Inner membrane transport protein YdhP
3328 PPUH01000010.1 GCA003340105_00354 CDS open 80740-81303 _na     187_aa ahpC alkyl hydroperoxide reductase subunit C
3329 PPUH01000010.1 GCA003340105_00355 CDS open 81390-82046 _na     218_aa Reverse gyrase
3330 PPUH01000010.1 GCA003340105_00356 CDS open 82043-83425 _na     460_aa Phthiocerol/phthiodiolone dimycocerosyl transferase
3331 PPUH01000010.1 GCA003340105_00357 CDS open 83398-84420 _na     340_aa aes Alpha/beta hydrolase fold-3 domain protein
3332 PPUH01000010.1 GCA003340105_00358 CDS open 84536-85564 _na     342_aa cps2a Cell envelope-related transcriptional attenuator
3333 PPUH01000010.1 GCA003340105_00359 CDS open 85679-86149 _na     156_aa C_GCAxxG_C_C family protein
3334 PPUH01000010.1 GCA003340105_00360 CDS open 86271-86984 _na     237_aa ompR Two component transcriptional regulator%2C winged helix family
3335 PPUH01000010.1 GCA003340105_00361 CDS open 87094-88014 _na     306_aa rbbA ABC transporter related
3336 PPUH01000010.1 GCA003340105_00362 CDS open 88011-88784 _na     257_aa ABC transporter permease
3337 PPUH01000010.1 GCA003340105_00363 CDS open 88810-89739 _na     309_aa kdpD histidine kinase
3338 PPUH01000010.1 GCA003340105_00364 CDS open 89868-91565 _na     565_aa sdhA Fumarate reductase/succinate dehydrogenase flavoprotein domain protein
3339 PPUH01000010.1 GCA003340105_00365 CDS open 91728-93209 _na     493_aa citB Transcriptional regulator%2C LuxR family
3340 PPUH01000010.1 GCA003340105_00366 CDS open 93631-96168 _na     845_aa nrdD ribonucleoside-diphosphate reductase subunit alpha
3341 PPUH01000010.1 GCA003340105_00367 CDS open 96533-97576 _na     347_aa nrdB ribonucleotide-diphosphate reductase subunit beta
3342 PPUH01000010.1 GCA003340105_00368 CDS open 97916-99118 _na     400_aa DUF3810 domain-containing protein
3343 PPUH01000010.1 GCA003340105_00369 CDS open 99470-100399 _na     309_aa cysK cysteine synthase A
3344 PPUH01000010.1 GCA003340105_00287 gene open 52-993 yobV
3345 PPUH01000010.1 GCA003340105_00288 gene open 1004-1645 mnaT
3346 PPUH01000010.1 GCA003340105_00289 gene open 2162-2464 xRE
3347 PPUH01000010.1 GCA003340105_00290 gene open 2461-3021
3348 PPUH01000010.1 GCA003340105_00291 gene open 3179-4324 penP
3349 PPUH01000010.1 GCA003340105_00292 gene open 4321-5496 cwlO1
3350 PPUH01000010.1 GCA003340105_00293 gene open 5882-6994 pheS
3351 PPUH01000010.1 GCA003340105_00294 gene open 7185-9623 pheT
3352 PPUH01000010.1 GCA003340105_00295 gene open 9770-10072 mJ0435
3353 PPUH01000010.1 GCA003340105_00296 gene open 10059-10409 hEPN
3354 PPUH01000010.1 GCA003340105_00297 gene open 10452-10580
3355 PPUH01000010.1 GCA003340105_00298 gene open 10709-11434 tVP38
3356 PPUH01000010.1 GCA003340105_00299 gene open 11680-12564 map
3357 PPUH01000010.1 GCA003340105_00300 gene open 12748-14352
3358 PPUH01000010.1 GCA003340105_00301 gene open 14472-16127 sdhA
3359 PPUH01000010.1 GCA003340105_00302 gene open 16422-17972 citB
3360 PPUH01000010.1 GCA003340105_00303 gene open 18165-18410
3361 PPUH01000010.1 GCA003340105_00304 gene open 18397-19206
3362 PPUH01000010.1 GCA003340105_00305 gene open 19316-19744
3363 PPUH01000010.1 GCA003340105_00306 gene open 19950-20366 slpA
3364 PPUH01000010.1 GCA003340105_00307 gene open 20381-21664 gsh2
3365 PPUH01000010.1 GCA003340105_00308 gene open 21802-23652 flaA1
3366 PPUH01000010.1 GCA003340105_00309 gene open 23836-24111
3367 PPUH01000010.1 GCA003340105_00310 gene open 24086-24409
3368 PPUH01000010.1 GCA003340105_00311 gene open 24681-25745 argC
3369 PPUH01000010.1 GCA003340105_00312 gene open 25800-27077 argJ
3370 PPUH01000010.1 GCA003340105_00313 gene open 27074-28060 argB
3371 PPUH01000010.1 GCA003340105_00314 gene open 28082-29353 argD
3372 PPUH01000010.1 GCA003340105_00315 gene open 29714-30142 argR
3373 PPUH01000010.1 GCA003340105_00316 gene open 30408-31802 argG
3374 PPUH01000010.1 GCA003340105_00317 gene open 31813-33207 argH
3375 PPUH01000010.1 GCA003340105_00318 gene open 33490-35742 mrcB
3376 PPUH01000010.1 GCA003340105_00319 gene open 35854-36360
3377 PPUH01000010.1 GCA003340105_00320 gene open 36586-37191
3378 PPUH01000010.1 GCA003340105_00321 gene open 37291-38376 leuB
3379 PPUH01000010.1 GCA003340105_00322 gene open 38399-41062 acnA
3380 PPUH01000010.1 GCA003340105_00323 gene open 41159-43084
3381 PPUH01000010.1 GCA003340105_00324 gene open 43365-43886 rplJ
3382 PPUH01000010.1 GCA003340105_00325 gene open 43977-44354 rplL
3383 PPUH01000010.1 GCA003340105_00326 gene open 44593-45525
3384 PPUH01000010.1 GCA003340105_00327 gene open 45628-47628 ygiQ
3385 PPUH01000010.1 GCA003340105_00328 gene open 47732-49138 uraA
3386 PPUH01000010.1 GCA003340105_00329 gene open 49154-49528
3387 PPUH01000010.1 GCA003340105_00330 gene open 50134-52680 feoB
3388 PPUH01000010.1 GCA003340105_00331 gene open 52743-54524 mdlB
3389 PPUH01000010.1 GCA003340105_00332 gene open 54526-56559 mdlB
3390 PPUH01000010.1 GCA003340105_00333 gene open 56788-57381 acrR
3391 PPUH01000010.1 GCA003340105_00334 gene open 57425-58378 araC
3392 PPUH01000010.1 GCA003340105_00335 gene open 58365-59909 ecfA2
3393 PPUH01000010.1 GCA003340105_00336 gene open 59911-60654 ecfT
3394 PPUH01000010.1 GCA003340105_00337 gene open 60658-61287
3395 PPUH01000010.1 GCA003340105_00338 gene open 61699-61920
3396 PPUH01000010.1 GCA003340105_00339 gene open 62024-62686 acrR
3397 PPUH01000010.1 GCA003340105_00340 gene open 62968-64794 mdlB
3398 PPUH01000010.1 GCA003340105_00341 gene open 64804-66567 mdlB
3399 PPUH01000010.1 GCA003340105_00342 gene open 66551-67324 phnX
3400 PPUH01000010.1 GCA003340105_00343 gene open 67326-68432 pucG
3401 PPUH01000010.1 GCA003340105_00344 gene open 68837-69544 acrR
3402 PPUH01000010.1 GCA003340105_00345 gene open 69541-69732
3403 PPUH01000010.1 GCA003340105_00346 gene open 69865-71694 mdlB
3404 PPUH01000010.1 GCA003340105_00347 gene open 71691-73430 mdlB
3405 PPUH01000010.1 GCA003340105_00348 gene open 73512-74150 mptD
3406 PPUH01000010.1 GCA003340105_00349 gene open 74150-74923 ecfT
3407 PPUH01000010.1 GCA003340105_00350 gene open 74917-76449 ccmA
3408 PPUH01000010.1 GCA003340105_00351 gene open 76453-78513 zntA
3409 PPUH01000010.1 GCA003340105_00352 gene open 78898-79161 frmR
3410 PPUH01000010.1 GCA003340105_00353 gene open 79212-80447 araJ
3411 PPUH01000010.1 GCA003340105_00354 gene open 80740-81303 ahpC
3412 PPUH01000010.1 GCA003340105_00355 gene open 81390-82046
3413 PPUH01000010.1 GCA003340105_00356 gene open 82043-83425
3414 PPUH01000010.1 GCA003340105_00357 gene open 83398-84420 aes
3415 PPUH01000010.1 GCA003340105_00358 gene open 84536-85564 cps2a
3416 PPUH01000010.1 GCA003340105_00359 gene open 85679-86149
3417 PPUH01000010.1 GCA003340105_00360 gene open 86271-86984 ompR
3418 PPUH01000010.1 GCA003340105_00361 gene open 87094-88014 rbbA
3419 PPUH01000010.1 GCA003340105_00362 gene open 88011-88784
3420 PPUH01000010.1 GCA003340105_00363 gene open 88810-89739 kdpD
3421 PPUH01000010.1 GCA003340105_00364 gene open 89868-91565 sdhA
3422 PPUH01000010.1 GCA003340105_00365 gene open 91728-93209 citB
3423 PPUH01000010.1 GCA003340105_00366 gene open 93631-96168 nrdD
3424 PPUH01000010.1 GCA003340105_00367 gene open 96533-97576 nrdB
3425 PPUH01000010.1 GCA003340105_00368 gene open 97916-99118
3426 PPUH01000010.1 GCA003340105_00369 gene open 99470-100399 cysK
3427 PPUH01000011.1 GCA003340105_00370 CDS open 533-1408 _na     291_aa lysR Transcriptional regulator%2C LysR family
3428 PPUH01000011.1 GCA003340105_00371 CDS open 1654-2643 _na     329_aa tehA C4-dicarboxylate transporter/malic acid transport protein
3429 PPUH01000011.1 GCA003340105_00372 CDS open 2757-3500 _na     247_aa yjbM RelA/SpoT domain protein
3430 PPUH01000011.1 GCA003340105_00373 CDS open 3728-4045 _na     105_aa gGDEF Putative diguanylate cyclase YdaM
3431 PPUH01000011.1 GCA003340105_00374 CDS open 4082-7786 _na     1234_aa pAS PAS domain S-box protein
3432 PPUH01000011.1 GCA003340105_00375 CDS open 8067-9038 _na     323_aa mazG nucleoside triphosphate pyrophosphohydrolase
3433 PPUH01000011.1 GCA003340105_00376 CDS open 9126-9584 _na     152_aa DUF2809 domain-containing protein
3434 PPUH01000011.1 GCA003340105_00377 CDS open 9908-10810 _na     300_aa ccc1 Rubrerythrin family protein
3435 PPUH01000011.1 GCA003340105_00378 CDS open 11038-12633 _na     531_aa hcp hydroxylamine reductase
3436 PPUH01000011.1 GCA003340105_00379 CDS open 12821-13495 _na     224_aa crp Transcriptional regulator%2C Crp/Fnr family
3437 PPUH01000011.1 GCA003340105_00380 CDS open 13492-14139 _na     215_aa pncA Isochorismatase family protein
3438 PPUH01000011.1 GCA003340105_00381 CDS open 14136-14987 _na     283_aa spoU tRNA/rRNA methyltransferase (SpoU)
3439 PPUH01000011.1 GCA003340105_00382 CDS open 15002-16780 _na     592_aa araJ Drug resistance transporter%2C EmrB/QacA subfamily
3440 PPUH01000011.1 GCA003340105_00383 CDS open 17147-18610 _na     487_aa gerE Transcriptional regulator%2C LuxR family
3441 PPUH01000011.1 GCA003340105_00384 CDS open 18988-20592 _na     534_aa sdhA Fumarate reductase flavoprotein subunit
3442 PPUH01000011.1 GCA003340105_00385 CDS open 21260-21775 _na     171_aa pspE Rhodanese-like domain-containing protein
3443 PPUH01000011.1 GCA003340105_00386 CDS open 22121-22552 _na     143_aa uspA UspA domain protein
3444 PPUH01000011.1 GCA003340105_00387 CDS open 22793-24169 _na     458_aa lpd FAD-dependent pyridine nucleotide-disulphide oxidoreductase
3445 PPUH01000011.1 GCA003340105_00388 CDS open 24132-25094 _na     320_aa lysR Transcriptional regulator%2C LysR family
3446 PPUH01000011.1 GCA003340105_00389 CDS open 25914-26933 _na     339_aa DUF2229 domain-containing protein
3447 PPUH01000011.1 GCA003340105_00390 CDS open 26923-28149 _na     408_aa DUF2229 domain-containing protein
3448 PPUH01000011.1 GCA003340105_00391 CDS open 28146-29189 _na     347_aa yjiL CoA-substrate-specific enzyme activase
3449 PPUH01000011.1 GCA003340105_00392 CDS open 29356-29616 _na     86_aa Prevent-host-death family protein
3450 PPUH01000011.1 GCA003340105_00393 CDS open 29617-29898 _na     93_aa yafQ Addiction module toxin%2C RelE/StbE family
3451 PPUH01000011.1 GCA003340105_00394 CDS open 29908-30693 _na     261_aa fabG 3beta-hydroxysteroid dehydrogenase 1
3452 PPUH01000011.1 GCA003340105_00395 CDS open 30927-31448 _na     173_aa paaY Transferase hexapeptide protein
3453 PPUH01000011.1 GCA003340105_00396 CDS open 31510-32253 _na     247_aa yadH Transport permease protein
3454 PPUH01000011.1 GCA003340105_00397 CDS open 32240-33031 _na     263_aa rbbA Daunorubicin/doxorubicin resistance ATP-binding protein DrrA
3455 PPUH01000011.1 GCA003340105_00398 CDS open 33105-33863 _na     252_aa soxR Transcriptional regulator%2C MerR family
3456 PPUH01000011.1 GCA003340105_00399 CDS open 33984-35927 _na     647_aa ushA Trifunctional nucleotide phosphoesterase protein YfkN
3457 PPUH01000011.1 GCA003340105_00400 CDS open 36192-38132 _na     646_aa htpG molecular chaperone HtpG
3458 PPUH01000011.1 GCA003340105_00401 CDS open 38847-39542 _na     231_aa DUF559 domain-containing protein
3459 PPUH01000011.1 GCA003340105_00402 CDS open 40075-41952 _na     625_aa Drug resistance transporter%2C EmrB/QacA subfamily
3460 PPUH01000011.1 GCA003340105_00403 CDS open 42172-46515 _na     1447_aa rimI Cyclic di-GMP phosphodiesterase Gmr
3461 PPUH01000011.1 GCA003340105_00404 CDS open 46647-47555 _na     302_aa rbsK PfkB domain protein
3462 PPUH01000011.1 GCA003340105_00405 CDS open 47718-49118 _na     466_aa potE Amino acid permease-associated region
3463 PPUH01000011.1 GCA003340105_00406 CDS open 49331-50512 _na     393_aa aspB pyridoxal phosphate-dependent aminotransferase
3464 PPUH01000011.1 GCA003340105_00407 CDS open 50713-51141 _na     142_aa DUF2871 domain-containing protein
3465 PPUH01000011.1 GCA003340105_00408 CDS open 51718-53241 _na     507_aa luxR Transcriptional regulator%2C LuxR family
3466 PPUH01000011.1 GCA003340105_00409 CDS open 53483-55261 _na     592_aa sdhA FAD-dependent oxidoreductase
3467 PPUH01000011.1 GCA003340105_00410 CDS open 56269-58035 _na     588_aa sdhA Fumarate reductase flavoprotein subunit
3468 PPUH01000011.1 GCA003340105_00411 CDS open 58276-60078 _na     600_aa luxR Transcriptional regulator%2C LuxR family
3469 PPUH01000011.1 GCA003340105_00412 CDS open 60238-60678 _na     146_aa uspA UspA domain protein
3470 PPUH01000011.1 GCA003340105_00413 CDS open 60750-61463 _na     237_aa putative membrane transporter protein
3471 PPUH01000011.1 GCA003340105_00414 CDS open 61556-62284 _na     242_aa pxpB 5-oxoprolinase subunit PxpB
3472 PPUH01000011.1 GCA003340105_00415 CDS open 62286-63455 _na     389_aa pxpC Urea amidolyase related protein
3473 PPUH01000011.1 GCA003340105_00416 CDS open 63530-64003 _na     157_aa accB acetyl-CoA carboxylase biotin carboxyl carrier protein
3474 PPUH01000011.1 GCA003340105_00417 CDS open 64017-65366 _na     449_aa accC acetyl-CoA carboxylase biotin carboxylase subunit
3475 PPUH01000011.1 GCA003340105_00418 CDS open 66038-66877 _na     279_aa ycsI putative hydro-lyase
3476 PPUH01000011.1 GCA003340105_00419 CDS open 67001-67765 _na     254_aa pxpA 5-oxoprolinase subunit A
3477 PPUH01000011.1 GCA003340105_00420 CDS open 68110-69792 _na     560_aa sdhA Fumarate reductase flavoprotein subunit
3478 PPUH01000011.1 GCA003340105_00421 CDS open 70016-71470 _na     484_aa citB Transcriptional regulator%2C LuxR family
3479 PPUH01000011.1 GCA003340105_00422 CDS open 71540-72313 _na     257_aa yurZ Carboxymuconolactone decarboxylase
3480 PPUH01000011.1 GCA003340105_00423 CDS open 72377-73144 _na     255_aa ymdB protein-ADP-ribose hydrolase
3481 PPUH01000011.1 GCA003340105_00424 CDS open 73244-74494 _na     416_aa mntH Nramp family divalent metal transporter
3482 PPUH01000011.1 GCA003340105_00425 CDS open 74645-76126 _na     493_aa citB Transcriptional regulator%2C LuxR family
3483 PPUH01000011.1 GCA003340105_00426 CDS open 76422-78167 _na     581_aa sdhA Tat pathway signal sequence domain protein
3484 PPUH01000011.1 GCA003340105_00427 CDS open 78275-79066 _na     263_aa DMSO reductase
3485 PPUH01000011.1 GCA003340105_00428 CDS open 79077-79643 _na     188_aa hybA 4Fe-4S ferredoxin iron-sulfur binding domain protein
3486 PPUH01000011.1 GCA003340105_00429 CDS open 79655-82210 _na     851_aa bisC Molybdopterin oxidoreductase
3487 PPUH01000011.1 GCA003340105_00430 CDS open 82475-83632 _na     385_aa araJ MFS transporter
3488 PPUH01000011.1 GCA003340105_00431 CDS open 83642-84343 _na     233_aa crp Transcriptional regulator%2C Crp/Fnr family
3489 PPUH01000011.1 GCA003340105_00432 CDS open 84416-86308 _na     630_aa yhgE Methyl-accepting chemotaxis protein
3490 PPUH01000011.1 GCA003340105_00433 CDS open 86295-88415 _na     706_aa mMPL Membrane transport protein MMPL domain-containing protein
3491 PPUH01000011.1 GCA003340105_00434 CDS open 88614-89300 _na     228_aa acrR Transcriptional regulator%2C TetR family
3492 PPUH01000011.1 GCA003340105_00435 CDS open 89343-90308 _na     321_aa luxR Transcriptional regulator%2C LuxR family
3493 PPUH01000011.1 GCA003340105_00436 CDS open 90558-91991 _na     477_aa potE Amino acid permease-associated region
3494 PPUH01000011.1 GCA003340105_00437 CDS open 92035-93153 _na     372_aa aspB aminotransferase
3495 PPUH01000011.1 GCA003340105_00438 CDS open 93187-94149 _na     320_aa luxR Transcriptional regulator%2C LuxR family
3496 PPUH01000011.1 GCA003340105_00439 CDS open 94188-94277 _na     29_aa hypothetical protein
3497 PPUH01000011.1 GCA003340105_00440 CDS open 94831-95016 _na     61_aa hypothetical protein
3498 PPUH01000011.1 GCA003340105_00370 gene open 533-1408 lysR
3499 PPUH01000011.1 GCA003340105_00371 gene open 1654-2643 tehA
3500 PPUH01000011.1 GCA003340105_00372 gene open 2757-3500 yjbM