BAKTAGenome Explorer: Phocaeicola plebeius (GCA_003438305.1)
Select a Genome:
|
BAKTA Annotations for GCA_003438305.1
|
Search & Sort all 7163 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1001 | QSTW01000002.1 | GCA003438305_01461 | CDS | open | 1087-1311 | _na 74_aa | DUF2007 domain-containing protein | |
| 1002 | QSTW01000002.1 | GCA003438305_01462 | CDS | open | 1459-2049 | _na 196_aa | Peptidyl-prolyl cis-trans isomerase | |
| 1003 | QSTW01000002.1 | GCA003438305_01463 | CDS | open | 2134-2988 | _na 284_aa | ATPase | |
| 1004 | QSTW01000002.1 | GCA003438305_01464 | CDS | open | 3183-3887 | _na 234_aa | SIMPL domain-containing protein | |
| 1005 | QSTW01000002.1 | GCA003438305_01465 | CDS | open | 4087-5871 | _na 594_aa | rpsA | 30S ribosomal protein S1 |
| 1006 | QSTW01000002.1 | GCA003438305_01466 | CDS | open | 5970-6245 | _na 91_aa | Antibiotic biosynthesis monooxygenase | |
| 1007 | QSTW01000002.1 | GCA003438305_01467 | CDS | open | 6377-7762 | _na 461_aa | Threonine/serine exporter-like N-terminal domain-containing protein | |
| 1008 | QSTW01000002.1 | GCA003438305_01468 | CDS | open | 7848-8153 | _na 101_aa | nitrous oxide-stimulated promoter family protein | |
| 1009 | QSTW01000002.1 | GCA003438305_01469 | CDS | open | 8333-9529 | _na 398_aa | RND efflux pump membrane fusion protein barrel-sandwich domain-containing protein | |
| 1010 | QSTW01000002.1 | GCA003438305_01470 | CDS | open | 9553-12657 | _na 1034_aa | SSD domain-containing protein | |
| 1011 | QSTW01000002.1 | GCA003438305_01471 | CDS | open | 12676-14058 | _na 460_aa | tolC | TolC family protein |
| 1012 | QSTW01000002.1 | GCA003438305_01472 | CDS | open | 14123-14659 | _na 178_aa | N-acetyltransferase domain-containing protein | |
| 1013 | QSTW01000002.1 | GCA003438305_01473 | CDS | open | 14681-15967 | _na 428_aa | Peptidase M64 N-terminal domain-containing protein | |
| 1014 | QSTW01000002.1 | GCA003438305_01474 | CDS | open | 16236-18518 | _na 760_aa | TonB-dependent receptor | |
| 1015 | QSTW01000002.1 | GCA003438305_01475 | CDS | open | 18568-18846 | _na 92_aa | hypothetical protein | |
| 1016 | QSTW01000002.1 | GCA003438305_01476 | CDS | open | 18955-20709 | _na 584_aa | 5'-Nucleotidase C-terminal domain-containing protein | |
| 1017 | QSTW01000002.1 | GCA003438305_01477 | CDS | open | 20872-23010 | _na 712_aa | S1 motif domain-containing protein | |
| 1018 | QSTW01000002.1 | GCA003438305_01478 | CDS | open | 23025-23822 | _na 265_aa | nudC | NAD(+) diphosphatase |
| 1019 | QSTW01000002.1 | GCA003438305_01479 | CDS | open | 23819-26221 | _na 800_aa | peptidoglycan glycosyltransferase | |
| 1020 | QSTW01000002.1 | GCA003438305_01480 | CDS | open | 26510-27766 | _na 418_aa | Phosphoglycerate kinase | |
| 1021 | QSTW01000002.1 | GCA003438305_01481 | CDS | open | 27747-27842 | _na 31_aa | hypothetical protein | |
| 1022 | QSTW01000002.1 | GCA003438305_01482 | CDS | open | 27909-31889 | _na 1326_aa | histidine kinase | |
| 1023 | QSTW01000002.1 | GCA003438305_01483 | CDS | open | 31900-32442 | _na 180_aa | Chromate transport protein | |
| 1024 | QSTW01000002.1 | GCA003438305_01484 | CDS | open | 32456-33025 | _na 189_aa | Chromate transport protein | |
| 1025 | QSTW01000002.1 | GCA003438305_01485 | CDS | open | 33034-33576 | _na 180_aa | ParB/Sulfiredoxin domain-containing protein | |
| 1026 | QSTW01000002.1 | GCA003438305_01486 | CDS | open | 33567-34865 | _na 432_aa | Phosphoadenosine phosphosulphate reductase domain-containing protein | |
| 1027 | QSTW01000002.1 | GCA003438305_01487 | CDS | open | 34852-35259 | _na 135_aa | N-acetyltransferase | |
| 1028 | QSTW01000002.1 | GCA003438305_01488 | CDS | open | 35335-36348 | _na 337_aa | ABC transporter domain-containing protein | |
| 1029 | QSTW01000002.1 | GCA003438305_01489 | CDS | open | 36348-37388 | _na 346_aa | Iron chelate uptake ABC transporter FeCT family permease protein | |
| 1030 | QSTW01000002.1 | GCA003438305_01490 | CDS | open | 37385-38521 | _na 378_aa | Fe/B12 periplasmic-binding domain-containing protein | |
| 1031 | QSTW01000002.1 | GCA003438305_01491 | CDS | open | 38527-39627 | _na 366_aa | yncE | YncE family protein |
| 1032 | QSTW01000002.1 | GCA003438305_01492 | CDS | open | 39645-41672 | _na 675_aa | TonB-dependent receptor | |
| 1033 | QSTW01000002.1 | GCA003438305_01493 | CDS | open | 41669-41935 | _na 88_aa | hypothetical protein | |
| 1034 | QSTW01000002.1 | GCA003438305_01494 | CDS | open | 42335-43795 | _na 486_aa | potassium/proton antiporter | |
| 1035 | QSTW01000002.1 | GCA003438305_01495 | CDS | open | 43792-45849 | _na 685_aa | RNA degradosome polyphosphate kinase | |
| 1036 | QSTW01000002.1 | GCA003438305_01496 | CDS | open | 45913-46404 | _na 163_aa | Phosphoesterase | |
| 1037 | QSTW01000002.1 | GCA003438305_01497 | CDS | open | 46468-47607 | _na 379_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 1038 | QSTW01000002.1 | GCA003438305_01498 | CDS | open | 47815-48855 | _na 346_aa | asnA | aspartate--ammonia ligase |
| 1039 | QSTW01000002.1 | GCA003438305_01499 | CDS | open | 48955-49617 | _na 220_aa | ung | uracil-DNA glycosylase |
| 1040 | QSTW01000002.1 | GCA003438305_01500 | CDS | open | 49636-52398 | _na 920_aa | metH | methionine synthase |
| 1041 | QSTW01000002.1 | GCA003438305_01501 | CDS | open | 52423-52881 | _na 152_aa | smpB | SsrA-binding protein SmpB |
| 1042 | QSTW01000002.1 | GCA003438305_01502 | CDS | open | 52881-53450 | _na 189_aa | DUF1282 domain-containing protein | |
| 1043 | QSTW01000002.1 | GCA003438305_01503 | CDS | open | 53846-54679 | _na 277_aa | NigD-like protein | |
| 1044 | QSTW01000002.1 | GCA003438305_01504 | CDS | open | 54807-55316 | _na 169_aa | DUF4375 domain-containing protein | |
| 1045 | QSTW01000002.1 | GCA003438305_01505 | CDS | open | 55346-55477 | _na 43_aa | hypothetical protein | |
| 1046 | QSTW01000002.1 | GCA003438305_01506 | CDS | open | 55608-56309 | _na 233_aa | iscU | NIF system FeS cluster assembly NifU N-terminal domain-containing protein |
| 1047 | QSTW01000002.1 | GCA003438305_01507 | CDS | open | 56330-57340 | _na 336_aa | GGGtGRT protein | |
| 1048 | QSTW01000002.1 | GCA003438305_01508 | CDS | open | 57387-57521 | _na 44_aa | hypothetical protein | |
| 1049 | QSTW01000002.1 | GCA003438305_01509 | CDS | open | 57709-58926 | _na 405_aa | Site-specific integrase | |
| 1050 | QSTW01000002.1 | GCA003438305_01510 | CDS | open | 59007-59849 | _na 280_aa | hypothetical protein | |
| 1051 | QSTW01000002.1 | GCA003438305_01511 | CDS | open | 59797-60012 | _na 71_aa | hypothetical protein | |
| 1052 | QSTW01000002.1 | GCA003438305_01512 | CDS | open | 60130-61044 | _na 304_aa | hypothetical protein | |
| 1053 | QSTW01000002.1 | GCA003438305_01513 | CDS | open | 61209-62819 | _na 536_aa | Helicase/UvrB N-terminal domain-containing protein | |
| 1054 | QSTW01000002.1 | GCA003438305_01514 | CDS | open | 63126-64145 | _na 339_aa | DUF3871 domain-containing protein | |
| 1055 | QSTW01000002.1 | GCA003438305_01515 | CDS | open | 64228-64674 | _na 148_aa | radC | DNA repair protein RadC |
| 1056 | QSTW01000002.1 | GCA003438305_01516 | CDS | open | 64830-65417 | _na 195_aa | xerD | Tyr recombinase domain-containing protein |
| 1057 | QSTW01000002.1 | GCA003438305_01517 | CDS | open | 65603-65713 | _na 36_aa | hypothetical protein | |
| 1058 | QSTW01000002.1 | GCA003438305_01518 | CDS | open | 65869-66189 | _na 106_aa | MORN repeat variant | |
| 1059 | QSTW01000002.1 | GCA003438305_01519 | CDS | open | 66213-67526 | _na 437_aa | DUF4595 domain-containing protein | |
| 1060 | QSTW01000002.1 | GCA003438305_01520 | CDS | open | 67717-67887 | _na 56_aa | hypothetical protein | |
| 1061 | QSTW01000002.1 | GCA003438305_01521 | CDS | open | 68523-69254 | _na 243_aa | hypothetical protein | |
| 1062 | QSTW01000002.1 | GCA003438305_01522 | CDS | open | 69343-70062 | _na 239_aa | hypothetical protein | |
| 1063 | QSTW01000002.1 | GCA003438305_01523 | CDS | open | 70050-70463 | _na 137_aa | hypothetical protein | |
| 1064 | QSTW01000002.1 | GCA003438305_01524 | CDS | open | 70910-71308 | _na 132_aa | hypothetical protein | |
| 1065 | QSTW01000002.1 | GCA003438305_01525 | CDS | open | 71762-72922 | _na 386_aa | oadB | Sodium ion-translocating decarboxylase beta subunit |
| 1066 | QSTW01000002.1 | GCA003438305_01526 | CDS | open | 72925-73353 | _na 142_aa | Glutaconyl-CoA decarboxylase subunit gamma | |
| 1067 | QSTW01000002.1 | GCA003438305_01527 | CDS | open | 73376-74308 | _na 310_aa | LTD domain-containing protein | |
| 1068 | QSTW01000002.1 | GCA003438305_01528 | CDS | open | 74331-75884 | _na 517_aa | mmdA | Acyl-CoA carboxylase subunit beta |
| 1069 | QSTW01000002.1 | GCA003438305_01529 | CDS | open | 75934-76338 | _na 134_aa | mce | methylmalonyl-CoA epimerase |
| 1070 | QSTW01000002.1 | GCA003438305_01530 | CDS | open | 76504-77478 | _na 324_aa | GNAT family N-acetyltransferase | |
| 1071 | QSTW01000002.1 | GCA003438305_01531 | CDS | open | 77554-78090 | _na 178_aa | Nitroreductase domain-containing protein | |
| 1072 | QSTW01000002.1 | GCA003438305_01532 | CDS | open | 78090-78425 | _na 111_aa | Transmembrane protein | |
| 1073 | QSTW01000002.1 | GCA003438305_01533 | CDS | open | 78422-79219 | _na 265_aa | DUF2520 domain-containing protein | |
| 1074 | QSTW01000002.1 | GCA003438305_01534 | CDS | open | 79238-79756 | _na 172_aa | yrbI | 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase YrbI family |
| 1075 | QSTW01000002.1 | GCA003438305_01535 | CDS | open | 79775-80362 | _na 195_aa | dTTP/UTP pyrophosphatase | |
| 1076 | QSTW01000002.1 | GCA003438305_01536 | CDS | open | 80359-81381 | _na 340_aa | Glycosyltransferase%2C group 2 family protein | |
| 1077 | QSTW01000002.1 | GCA003438305_01537 | CDS | open | 81378-82694 | _na 438_aa | mtaB | tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB |
| 1078 | QSTW01000002.1 | GCA003438305_01538 | CDS | open | 82997-83197 | _na 66_aa | Lipoprotein | |
| 1079 | QSTW01000002.1 | GCA003438305_01539 | CDS | open | 83553-84002 | _na 149_aa | rplI | 50S ribosomal protein L9 |
| 1080 | QSTW01000002.1 | GCA003438305_01540 | CDS | open | 84021-84290 | _na 89_aa | rpsR | 30S ribosomal protein S18 |
| 1081 | QSTW01000002.1 | GCA003438305_01541 | CDS | open | 84293-84640 | _na 115_aa | rpsF | 30S ribosomal protein S6 |
| 1082 | QSTW01000002.1 | GCA003438305_01542 | CDS | open | 84668-84802 | _na 44_aa | hypothetical protein | |
| 1083 | QSTW01000002.1 | GCA003438305_01543 | CDS | open | 84846-85292 | _na 148_aa | HTH marR-type domain-containing protein | |
| 1084 | QSTW01000002.1 | GCA003438305_01544 | CDS | open | 85483-85659 | _na 58_aa | ABC transporter permease | |
| 1085 | QSTW01000002.1 | GCA003438305_01545 | CDS | open | 85734-86432 | _na 232_aa | rprY | Transcriptional regulatory protein RprY |
| 1086 | QSTW01000002.1 | GCA003438305_01546 | CDS | open | 86436-87986 | _na 516_aa | histidine kinase | |
| 1087 | QSTW01000002.1 | GCA003438305_01547 | CDS | open | 88252-90411 | _na 719_aa | fusA | Tetracycline resistance protein TetQ |
| 1088 | QSTW01000002.1 | GCA003438305_01548 | CDS | open | 90534-91763 | _na 409_aa | hemW | radical SAM family heme chaperone HemW |
| 1089 | QSTW01000002.1 | GCA003438305_01549 | CDS | open | 91840-91998 | _na 52_aa | hypothetical protein | |
| 1090 | QSTW01000002.1 | GCA003438305_01550 | CDS | open | 92119-93507 | _na 462_aa | glmM | phosphoglucosamine mutase |
| 1091 | QSTW01000002.1 | GCA003438305_01551 | CDS | open | 93533-94252 | _na 239_aa | DUF4827 domain-containing protein | |
| 1092 | QSTW01000002.1 | GCA003438305_01552 | CDS | open | 94307-95344 | _na 345_aa | nrnA | Bifunctional oligoribonuclease and PAP phosphatase nrnA |
| 1093 | QSTW01000002.1 | GCA003438305_01553 | CDS | open | 95405-97345 | _na 646_aa | ComEC family competence protein | |
| 1094 | QSTW01000002.1 | GCA003438305_01554 | CDS | open | 97382-98038 | _na 218_aa | rpe | ribulose-phosphate 3-epimerase |
| 1095 | QSTW01000002.1 | GCA003438305_01555 | CDS | open | 98111-99403 | _na 430_aa | porT | PorT family protein |
| 1096 | QSTW01000002.1 | GCA003438305_01556 | CDS | open | 99407-99949 | _na 180_aa | sigM | RNA polymerase sigma factor sigM |
| 1097 | QSTW01000002.1 | GCA003438305_01557 | CDS | open | 100103-100822 | _na 239_aa | NigD-like C-terminal beta sandwich domain-containing protein | |
| 1098 | QSTW01000002.1 | GCA003438305_01558 | CDS | open | 100838-101809 | _na 323_aa | fmt | methionyl-tRNA formyltransferase |
| 1099 | QSTW01000002.1 | GCA003438305_01559 | CDS | open | 101825-103624 | _na 599_aa | CBS domain-containing protein | |
| 1100 | QSTW01000002.1 | GCA003438305_01560 | CDS | open | 103637-104200 | _na 187_aa | tsaC | L-threonylcarbamoyladenylate synthase |
| 1101 | QSTW01000002.1 | GCA003438305_01561 | CDS | open | 104328-105434 | _na 368_aa | dinB | DNA polymerase IV |
| 1102 | QSTW01000002.1 | GCA003438305_01562 | CDS | open | 105900-106997 | _na 365_aa | mrp | Iron-sulfur cluster carrier protein |
| 1103 | QSTW01000002.1 | GCA003438305_01563 | CDS | open | 107017-107808 | _na 263_aa | trmB | tRNA (guanosine(46)-N7)-methyltransferase TrmB |
| 1104 | QSTW01000002.1 | GCA003438305_01564 | CDS | open | 107909-109648 | _na 579_aa | Fimbrillin family protein | |
| 1105 | QSTW01000002.1 | GCA003438305_01565 | CDS | open | 109718-110587 | _na 289_aa | Chromosome segregation protein SMC | |
| 1106 | QSTW01000002.1 | GCA003438305_01566 | CDS | open | 110599-112014 | _na 471_aa | Tail specific protease domain-containing protein | |
| 1107 | QSTW01000002.1 | GCA003438305_01567 | CDS | open | 112152-113645 | _na 497_aa | Outer membrane efflux protein | |
| 1108 | QSTW01000002.1 | GCA003438305_01568 | CDS | open | 113655-114638 | _na 327_aa | Auxiliary transport protein%2C membrane fusion protein (MFP) family protein | |
| 1109 | QSTW01000002.1 | GCA003438305_01569 | CDS | open | 114645-115820 | _na 391_aa | ABC-2 type transporter | |
| 1110 | QSTW01000002.1 | GCA003438305_01570 | CDS | open | 115833-117089 | _na 418_aa | ABC-2 type transporter transmembrane domain-containing protein | |
| 1111 | QSTW01000002.1 | GCA003438305_01571 | CDS | open | 117218-118531 | _na 437_aa | tonB | TonB C-terminal domain-containing protein |
| 1112 | QSTW01000002.1 | GCA003438305_01572 | CDS | open | 118556-120754 | _na 732_aa | Peptidase S9A/B/C family catalytic domain protein | |
| 1113 | QSTW01000002.1 | GCA003438305_01573 | CDS | open | 120832-121680 | _na 282_aa | lipA | lipoyl synthase |
| 1114 | QSTW01000002.1 | GCA003438305_01574 | CDS | open | 121736-122725 | _na 329_aa | Transmembrane protein | |
| 1115 | QSTW01000002.1 | GCA003438305_01575 | CDS | open | 122729-123433 | _na 234_aa | Tetrapyrrole methylase domain-containing protein | |
| 1116 | QSTW01000002.1 | GCA003438305_01576 | CDS | open | 123453-124445 | _na 330_aa | gldB | Gliding motility lipoprotein GldB |
| 1117 | QSTW01000002.1 | GCA003438305_01577 | CDS | open | 124452-125309 | _na 285_aa | fabI | Enoyl-[acyl-carrier-protein] reductase [NADH] |
| 1118 | QSTW01000002.1 | GCA003438305_01578 | CDS | open | 125628-126851 | _na 407_aa | DUF4861 domain-containing protein | |
| 1119 | QSTW01000002.1 | GCA003438305_01579 | CDS | open | 126911-127885 | _na 324_aa | ROK family protein | |
| 1120 | QSTW01000002.1 | GCA003438305_01580 | CDS | open | 128034-128753 | _na 239_aa | ABC transporter domain-containing protein | |
| 1121 | QSTW01000002.1 | GCA003438305_01581 | CDS | open | 128764-130014 | _na 416_aa | macB | Macrolide export ATP-binding/permease protein MacB |
| 1122 | QSTW01000002.1 | GCA003438305_01582 | CDS | open | 130017-131261 | _na 414_aa | macB | Macrolide export ATP-binding/permease protein MacB |
| 1123 | QSTW01000002.1 | GCA003438305_01583 | CDS | open | 131297-132394 | _na 365_aa | RND efflux pump membrane fusion protein barrel-sandwich domain-containing protein | |
| 1124 | QSTW01000002.1 | GCA003438305_01584 | CDS | open | 132398-133732 | _na 444_aa | Outer membrane efflux protein | |
| 1125 | QSTW01000002.1 | GCA003438305_01585 | CDS | open | 133923-135335 | _na 470_aa | SAM-dependent MTase RsmB/NOP-type domain-containing protein | |
| 1126 | QSTW01000002.1 | GCA003438305_01586 | CDS | open | 135386-136204 | _na 272_aa | thymidylate synthase | |
| 1127 | QSTW01000002.1 | GCA003438305_01587 | CDS | open | 136223-136717 | _na 164_aa | Dihydrofolate reductase | |
| 1128 | QSTW01000002.1 | GCA003438305_01588 | CDS | open | 136729-137208 | _na 159_aa | HTH asnC-type domain-containing protein | |
| 1129 | QSTW01000002.1 | GCA003438305_01589 | CDS | open | 137399-141709 | _na 1436_aa | histidine kinase | |
| 1130 | QSTW01000002.1 | GCA003438305_01590 | CDS | open | 141808-142122 | _na 104_aa | rhaM | L-rhamnose mutarotase |
| 1131 | QSTW01000002.1 | GCA003438305_01591 | CDS | open | 142134-143765 | _na 543_aa | GDSL-like protein | |
| 1132 | QSTW01000002.1 | GCA003438305_01592 | CDS | open | 143998-145281 | _na 427_aa | rhgT | Putative rhamnogalacturonan acetylesterase RhgT |
| 1133 | QSTW01000002.1 | GCA003438305_01593 | CDS | open | 145465-146892 | _na 475_aa | Glycoside hydrolase family 28 protein | |
| 1134 | QSTW01000002.1 | GCA003438305_01594 | CDS | open | 146957-148177 | _na 406_aa | Porin | |
| 1135 | QSTW01000002.1 | GCA003438305_01595 | CDS | open | 148266-149696 | _na 476_aa | cstA | CstA N-terminal domain-containing protein |
| 1136 | QSTW01000002.1 | GCA003438305_01596 | CDS | open | 149874-151532 | _na 552_aa | Glycosyl hydrolase-like 10 domain-containing protein | |
| 1137 | QSTW01000002.1 | GCA003438305_01597 | CDS | open | 151615-152784 | _na 389_aa | purM | Phosphoribosylformylglycinamidine cyclo-ligase |
| 1138 | QSTW01000002.1 | GCA003438305_01598 | CDS | open | 153160-154269 | _na 369_aa | prfA | peptide chain release factor 1 |
| 1139 | QSTW01000002.1 | GCA003438305_01599 | CDS | open | 154340-155164 | _na 274_aa | pyrF | orotidine-5'-phosphate decarboxylase |
| 1140 | QSTW01000002.1 | GCA003438305_01600 | CDS | open | 155436-156476 | _na 346_aa | lpxD | UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase |
| 1141 | QSTW01000002.1 | GCA003438305_01601 | CDS | open | 156481-157866 | _na 461_aa | lpxC | bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase |
| 1142 | QSTW01000002.1 | GCA003438305_01602 | CDS | open | 157868-158635 | _na 255_aa | lpxA | acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase |
| 1143 | QSTW01000002.1 | GCA003438305_01603 | CDS | open | 158681-159238 | _na 185_aa | Plasmid pRiA4b Orf3-like domain-containing protein | |
| 1144 | QSTW01000002.1 | GCA003438305_01604 | CDS | open | 159307-160260 | _na 317_aa | miaA | tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA |
| 1145 | QSTW01000002.1 | GCA003438305_01605 | CDS | open | 160247-161263 | _na 338_aa | AI-2E family transporter | |
| 1146 | QSTW01000002.1 | GCA003438305_01606 | CDS | open | 161288-161629 | _na 113_aa | Transmembrane protein | |
| 1147 | QSTW01000002.1 | GCA003438305_01607 | CDS | open | 161629-161931 | _na 100_aa | Septum formation initiator | |
| 1148 | QSTW01000002.1 | GCA003438305_01608 | CDS | open | 162052-163890 | _na 612_aa | DNA polymerase III subunit gamma/tau | |
| 1149 | QSTW01000002.1 | GCA003438305_01609 | CDS | open | 163979-164437 | _na 152_aa | queF | preQ(1) synthase |
| 1150 | QSTW01000002.1 | GCA003438305_01610 | CDS | open | 164440-165105 | _na 221_aa | queC | 7-cyano-7-deazaguanine synthase QueC |
| 1151 | QSTW01000002.1 | GCA003438305_01611 | CDS | open | 165111-165797 | _na 228_aa | queuosine precursor transporter | |
| 1152 | QSTW01000002.1 | GCA003438305_01612 | CDS | open | 166193-167050 | _na 285_aa | 4Fe-4S ferredoxin-type domain-containing protein | |
| 1153 | QSTW01000002.1 | GCA003438305_01613 | CDS | open | 167063-168103 | _na 346_aa | corA | magnesium/cobalt transporter CorA |
| 1154 | QSTW01000002.1 | GCA003438305_01614 | CDS | open | 168138-168785 | _na 215_aa | nth | endonuclease III |
| 1155 | QSTW01000002.1 | GCA003438305_01615 | CDS | open | 168850-169197 | _na 115_aa | HTH merR-type domain-containing protein | |
| 1156 | QSTW01000002.1 | GCA003438305_01616 | CDS | open | 169213-170178 | _na 321_aa | Peptidase M23 domain-containing protein | |
| 1157 | QSTW01000002.1 | GCA003438305_01617 | CDS | open | 170312-172930 | _na 872_aa | alaS | alanine--tRNA ligase |
| 1158 | QSTW01000002.1 | GCA003438305_01618 | CDS | open | 173052-174419 | _na 455_aa | mepA | Multidrug export protein MepA |
| 1159 | QSTW01000002.1 | GCA003438305_01619 | CDS | open | 174432-174779 | _na 115_aa | helix-turn-helix domain-containing protein | |
| 1160 | QSTW01000002.1 | GCA003438305_01620 | CDS | open | 174827-175339 | _na 170_aa | hypothetical protein | |
| 1161 | QSTW01000002.1 | GCA003438305_01621 | CDS | open | 175503-176843 | _na 446_aa | tolC | TolC family protein |
| 1162 | QSTW01000002.1 | GCA003438305_01622 | CDS | open | 176858-177694 | _na 278_aa | ABC transporter domain-containing protein | |
| 1163 | QSTW01000002.1 | GCA003438305_01623 | CDS | open | 177927-178445 | _na 172_aa | ABC transporter permease | |
| 1164 | QSTW01000002.1 | GCA003438305_01624 | CDS | open | 178458-179045 | _na 195_aa | Transport permease protein | |
| 1165 | QSTW01000002.1 | GCA003438305_01625 | CDS | open | 179284-181929 | _na 881_aa | DNA gyrase/topoisomerase IV subunit A | |
| 1166 | QSTW01000002.1 | GCA003438305_01626 | CDS | open | 181936-182784 | _na 282_aa | DUF3316 domain-containing protein | |
| 1167 | QSTW01000002.1 | GCA003438305_01627 | CDS | open | 182786-183811 | _na 341_aa | Tail specific protease domain-containing protein | |
| 1168 | QSTW01000002.1 | GCA003438305_01629 | CDS | open | 184040-185398 | _na 452_aa | Multidrug-efflux transporter | |
| 1169 | QSTW01000002.1 | GCA003438305_01630 | CDS | open | 185610-186074 | _na 154_aa | exbD | Biopolymer transporter ExbD |
| 1170 | QSTW01000002.1 | GCA003438305_01631 | CDS | open | 186077-186664 | _na 195_aa | Biopolymer transport protein ExbD/TolR | |
| 1171 | QSTW01000002.1 | GCA003438305_01632 | CDS | open | 186707-187171 | _na 154_aa | MotA/TolQ/ExbB proton channel domain-containing protein | |
| 1172 | QSTW01000002.1 | GCA003438305_01633 | CDS | open | 187180-187980 | _na 266_aa | tolQ | Transporter MotA/TolQ/ExbB proton channel family protein |
| 1173 | QSTW01000002.1 | GCA003438305_01635 | CDS | open | 188269-189060 | _na 263_aa | tatD | Hydrolase TatD family |
| 1174 | QSTW01000002.1 | GCA003438305_01636 | CDS | open | 189065-190048 | _na 327_aa | Polyprenyl synthetase | |
| 1175 | QSTW01000002.1 | GCA003438305_01637 | CDS | open | 190126-190812 | _na 228_aa | tonB | TonB C-terminal domain-containing protein |
| 1176 | QSTW01000002.1 | GCA003438305_01638 | CDS | open | 191229-191927 | _na 232_aa | cmk | (d)CMP kinase |
| 1177 | QSTW01000002.1 | GCA003438305_01639 | CDS | open | 191914-192777 | _na 287_aa | 4-hydroxy-3-methylbut-2-enyl diphosphate reductase | |
| 1178 | QSTW01000002.1 | GCA003438305_01640 | CDS | open | 192856-193836 | _na 326_aa | pfkA | 6-phosphofructokinase |
| 1179 | QSTW01000002.1 | GCA003438305_01641 | CDS | open | 193922-195250 | _na 442_aa | ABC transporter solute-binding protein | |
| 1180 | QSTW01000002.1 | GCA003438305_01642 | CDS | open | 195259-196050 | _na 263_aa | ABC transmembrane type-1 domain-containing protein | |
| 1181 | QSTW01000002.1 | GCA003438305_01643 | CDS | open | 196044-196841 | _na 265_aa | ABC transmembrane type-1 domain-containing protein | |
| 1182 | QSTW01000002.1 | GCA003438305_01644 | CDS | open | 196838-198235 | _na 465_aa | potA | spermidine/putrescine ABC transporter ATP-binding protein |
| 1183 | QSTW01000002.1 | GCA003438305_01645 | CDS | open | 198359-199465 | _na 368_aa | meaB | methylmalonyl Co-A mutase-associated GTPase MeaB |
| 1184 | QSTW01000002.1 | GCA003438305_01646 | CDS | open | 199474-200478 | _na 334_aa | HYDIN/VesB/CFA65-like Ig-like domain-containing protein | |
| 1185 | QSTW01000002.1 | GCA003438305_01647 | CDS | open | 200701-206310 | _na 1869_aa | Alpha-2-macroglobulin domain-containing protein | |
| 1186 | QSTW01000002.1 | GCA003438305_01648 | CDS | open | 206497-207954 | _na 485_aa | Cytosol non-specific dipeptidase | |
| 1187 | QSTW01000002.1 | GCA003438305_01649 | CDS | open | 207990-208997 | _na 335_aa | Dolichol-P-glucose synthetase | |
| 1188 | QSTW01000002.1 | GCA003438305_01650 | CDS | open | 209073-209876 | _na 267_aa | rsmA | 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA |
| 1189 | QSTW01000002.1 | GCA003438305_01651 | CDS | open | 209932-211272 | _na 446_aa | mgtE | magnesium transporter |
| 1190 | QSTW01000002.1 | GCA003438305_01652 | CDS | open | 211579-213384 | _na 601_aa | DUF349 domain-containing protein | |
| 1191 | QSTW01000002.1 | GCA003438305_01653 | CDS | open | 213691-216024 | _na 777_aa | DUF5689 domain-containing protein | |
| 1192 | QSTW01000002.1 | GCA003438305_01654 | CDS | open | 216046-217242 | _na 398_aa | Endonuclease | |
| 1193 | QSTW01000002.1 | GCA003438305_01655 | CDS | open | 217255-218295 | _na 346_aa | Endonuclease/exonuclease/phosphatase family protein | |
| 1194 | QSTW01000002.1 | GCA003438305_01656 | CDS | open | 218313-221063 | _na 916_aa | TonB-dependent receptor | |
| 1195 | QSTW01000002.1 | GCA003438305_01657 | CDS | open | 221086-222069 | _na 327_aa | DUF5689 domain-containing protein | |
| 1196 | QSTW01000002.1 | GCA003438305_01658 | CDS | open | 222195-222914 | _na 239_aa | Metallo-beta-lactamase domain-containing protein | |
| 1197 | QSTW01000002.1 | GCA003438305_01659 | CDS | open | 223319-224041 | _na 240_aa | Nudix hydrolase domain-containing protein | |
| 1198 | QSTW01000002.1 | GCA003438305_01660 | CDS | open | 224062-225549 | _na 495_aa | Carbohydrate kinase FGGY family protein | |
| 1199 | QSTW01000002.1 | GCA003438305_01661 | CDS | open | 225586-226902 | _na 438_aa | xylA | xylose isomerase |
| 1200 | QSTW01000002.1 | GCA003438305_01662 | CDS | open | 227001-228482 | _na 493_aa | xylE | D-xylose transporter XylE |
| 1201 | QSTW01000002.1 | GCA003438305_01665 | CDS | open | 229055-229438 | _na 127_aa | START-like domain-containing protein | |
| 1202 | QSTW01000002.1 | GCA003438305_01666 | CDS | open | 229516-231408 | _na 630_aa | Permease YjgP/YjgQ family protein | |
| 1203 | QSTW01000002.1 | GCA003438305_01667 | CDS | open | 231425-232639 | _na 404_aa | bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II | |
| 1204 | QSTW01000002.1 | GCA003438305_01668 | CDS | open | 232652-233353 | _na 233_aa | BAX inhibitor (BI)-1/YccA family protein | |
| 1205 | QSTW01000002.1 | GCA003438305_01669 | CDS | open | 233439-234632 | _na 397_aa | aspB | Aminotransferase |
| 1206 | QSTW01000002.1 | GCA003438305_01670 | CDS | open | 234911-235078 | _na 55_aa | Ferredoxin | |
| 1207 | QSTW01000002.1 | GCA003438305_01671 | CDS | open | 235200-238169 | _na 989_aa | beta-N-acetylhexosaminidase | |
| 1208 | QSTW01000002.1 | GCA003438305_01672 | CDS | open | 238185-239045 | _na 286_aa | yfkN | Trifunctional nucleotide phosphoesterase protein YfkN |
| 1209 | QSTW01000002.1 | GCA003438305_01673 | CDS | open | 239042-239824 | _na 260_aa | 5'-Nucleotidase C-terminal domain-containing protein | |
| 1210 | QSTW01000002.1 | GCA003438305_01674 | CDS | open | 239868-240038 | _na 56_aa | hypothetical protein | |
| 1211 | QSTW01000002.1 | GCA003438305_01675 | CDS | open | 240052-240405 | _na 117_aa | rplS | 50S ribosomal protein L19 |
| 1212 | QSTW01000002.1 | GCA003438305_01677 | CDS | open | 240988-241329 | _na 113_aa | hypothetical protein | |
| 1213 | QSTW01000002.1 | GCA003438305_01678 | CDS | open | 241334-241642 | _na 102_aa | HEPN domain-containing protein | |
| 1214 | QSTW01000002.1 | GCA003438305_01679 | CDS | open | 242297-242743 | _na 148_aa | DNA repair protein | |
| 1215 | QSTW01000002.1 | GCA003438305_01680 | CDS | open | 242828-243853 | _na 341_aa | DUF3871 domain-containing protein | |
| 1216 | QSTW01000002.1 | GCA003438305_01681 | CDS | open | 243990-244145 | _na 51_aa | hypothetical protein | |
| 1217 | QSTW01000002.1 | GCA003438305_01682 | CDS | open | 244507-246363 | _na 618_aa | Helicase ATP-binding domain-containing protein | |
| 1218 | QSTW01000002.1 | GCA003438305_01683 | CDS | open | 246426-247307 | _na 293_aa | hypothetical protein | |
| 1219 | QSTW01000002.1 | GCA003438305_01684 | CDS | open | 247670-248482 | _na 270_aa | site-specific integrase | |
| 1220 | QSTW01000002.1 | GCA003438305_01460 | gene | open | 295-1056 | |||
| 1221 | QSTW01000002.1 | GCA003438305_01461 | gene | open | 1087-1311 | |||
| 1222 | QSTW01000002.1 | GCA003438305_01462 | gene | open | 1459-2049 | |||
| 1223 | QSTW01000002.1 | GCA003438305_01463 | gene | open | 2134-2988 | |||
| 1224 | QSTW01000002.1 | GCA003438305_01464 | gene | open | 3183-3887 | |||
| 1225 | QSTW01000002.1 | GCA003438305_01465 | gene | open | 4087-5871 | rpsA | ||
| 1226 | QSTW01000002.1 | GCA003438305_01466 | gene | open | 5970-6245 | |||
| 1227 | QSTW01000002.1 | GCA003438305_01467 | gene | open | 6377-7762 | |||
| 1228 | QSTW01000002.1 | GCA003438305_01468 | gene | open | 7848-8153 | |||
| 1229 | QSTW01000002.1 | GCA003438305_01469 | gene | open | 8333-9529 | |||
| 1230 | QSTW01000002.1 | GCA003438305_01470 | gene | open | 9553-12657 | |||
| 1231 | QSTW01000002.1 | GCA003438305_01471 | gene | open | 12676-14058 | tolC | ||
| 1232 | QSTW01000002.1 | GCA003438305_01472 | gene | open | 14123-14659 | |||
| 1233 | QSTW01000002.1 | GCA003438305_01473 | gene | open | 14681-15967 | |||
| 1234 | QSTW01000002.1 | GCA003438305_01474 | gene | open | 16236-18518 | |||
| 1235 | QSTW01000002.1 | GCA003438305_01475 | gene | open | 18568-18846 | |||
| 1236 | QSTW01000002.1 | GCA003438305_01476 | gene | open | 18955-20709 | |||
| 1237 | QSTW01000002.1 | GCA003438305_01477 | gene | open | 20872-23010 | |||
| 1238 | QSTW01000002.1 | GCA003438305_01478 | gene | open | 23025-23822 | nudC | ||
| 1239 | QSTW01000002.1 | GCA003438305_01479 | gene | open | 23819-26221 | |||
| 1240 | QSTW01000002.1 | GCA003438305_01480 | gene | open | 26510-27766 | |||
| 1241 | QSTW01000002.1 | GCA003438305_01481 | gene | open | 27747-27842 | |||
| 1242 | QSTW01000002.1 | GCA003438305_01482 | gene | open | 27909-31889 | |||
| 1243 | QSTW01000002.1 | GCA003438305_01483 | gene | open | 31900-32442 | |||
| 1244 | QSTW01000002.1 | GCA003438305_01484 | gene | open | 32456-33025 | |||
| 1245 | QSTW01000002.1 | GCA003438305_01485 | gene | open | 33034-33576 | |||
| 1246 | QSTW01000002.1 | GCA003438305_01486 | gene | open | 33567-34865 | |||
| 1247 | QSTW01000002.1 | GCA003438305_01487 | gene | open | 34852-35259 | |||
| 1248 | QSTW01000002.1 | GCA003438305_01488 | gene | open | 35335-36348 | |||
| 1249 | QSTW01000002.1 | GCA003438305_01489 | gene | open | 36348-37388 | |||
| 1250 | QSTW01000002.1 | GCA003438305_01490 | gene | open | 37385-38521 | |||
| 1251 | QSTW01000002.1 | GCA003438305_01491 | gene | open | 38527-39627 | yncE | ||
| 1252 | QSTW01000002.1 | GCA003438305_01492 | gene | open | 39645-41672 | |||
| 1253 | QSTW01000002.1 | GCA003438305_01493 | gene | open | 41669-41935 | |||
| 1254 | QSTW01000002.1 | GCA003438305_01494 | gene | open | 42335-43795 | |||
| 1255 | QSTW01000002.1 | GCA003438305_01495 | gene | open | 43792-45849 | |||
| 1256 | QSTW01000002.1 | GCA003438305_01496 | gene | open | 45913-46404 | |||
| 1257 | QSTW01000002.1 | GCA003438305_01497 | gene | open | 46468-47607 | rfbB | ||
| 1258 | QSTW01000002.1 | GCA003438305_01498 | gene | open | 47815-48855 | asnA | ||
| 1259 | QSTW01000002.1 | GCA003438305_01499 | gene | open | 48955-49617 | ung | ||
| 1260 | QSTW01000002.1 | GCA003438305_01500 | gene | open | 49636-52398 | metH | ||
| 1261 | QSTW01000002.1 | GCA003438305_01501 | gene | open | 52423-52881 | smpB | ||
| 1262 | QSTW01000002.1 | GCA003438305_01502 | gene | open | 52881-53450 | |||
| 1263 | QSTW01000002.1 | GCA003438305_01503 | gene | open | 53846-54679 | |||
| 1264 | QSTW01000002.1 | GCA003438305_01504 | gene | open | 54807-55316 | |||
| 1265 | QSTW01000002.1 | GCA003438305_01505 | gene | open | 55346-55477 | |||
| 1266 | QSTW01000002.1 | GCA003438305_01506 | gene | open | 55608-56309 | iscU | ||
| 1267 | QSTW01000002.1 | GCA003438305_01507 | gene | open | 56330-57340 | |||
| 1268 | QSTW01000002.1 | GCA003438305_01508 | gene | open | 57387-57521 | |||
| 1269 | QSTW01000002.1 | GCA003438305_01509 | gene | open | 57709-58926 | |||
| 1270 | QSTW01000002.1 | GCA003438305_01510 | gene | open | 59007-59849 | |||
| 1271 | QSTW01000002.1 | GCA003438305_01511 | gene | open | 59797-60012 | |||
| 1272 | QSTW01000002.1 | GCA003438305_01512 | gene | open | 60130-61044 | |||
| 1273 | QSTW01000002.1 | GCA003438305_01513 | gene | open | 61209-62819 | |||
| 1274 | QSTW01000002.1 | GCA003438305_01514 | gene | open | 63126-64145 | |||
| 1275 | QSTW01000002.1 | GCA003438305_01515 | gene | open | 64228-64674 | radC | ||
| 1276 | QSTW01000002.1 | GCA003438305_01516 | gene | open | 64830-65417 | xerD | ||
| 1277 | QSTW01000002.1 | GCA003438305_01517 | gene | open | 65603-65713 | |||
| 1278 | QSTW01000002.1 | GCA003438305_01518 | gene | open | 65869-66189 | |||
| 1279 | QSTW01000002.1 | GCA003438305_01519 | gene | open | 66213-67526 | |||
| 1280 | QSTW01000002.1 | GCA003438305_01520 | gene | open | 67717-67887 | |||
| 1281 | QSTW01000002.1 | GCA003438305_01521 | gene | open | 68523-69254 | |||
| 1282 | QSTW01000002.1 | GCA003438305_01522 | gene | open | 69343-70062 | |||
| 1283 | QSTW01000002.1 | GCA003438305_01523 | gene | open | 70050-70463 | |||
| 1284 | QSTW01000002.1 | GCA003438305_01524 | gene | open | 70910-71308 | |||
| 1285 | QSTW01000002.1 | GCA003438305_01525 | gene | open | 71762-72922 | oadB | ||
| 1286 | QSTW01000002.1 | GCA003438305_01526 | gene | open | 72925-73353 | |||
| 1287 | QSTW01000002.1 | GCA003438305_01527 | gene | open | 73376-74308 | |||
| 1288 | QSTW01000002.1 | GCA003438305_01528 | gene | open | 74331-75884 | mmdA | ||
| 1289 | QSTW01000002.1 | GCA003438305_01529 | gene | open | 75934-76338 | mce | ||
| 1290 | QSTW01000002.1 | GCA003438305_01530 | gene | open | 76504-77478 | |||
| 1291 | QSTW01000002.1 | GCA003438305_01531 | gene | open | 77554-78090 | |||
| 1292 | QSTW01000002.1 | GCA003438305_01532 | gene | open | 78090-78425 | |||
| 1293 | QSTW01000002.1 | GCA003438305_01533 | gene | open | 78422-79219 | |||
| 1294 | QSTW01000002.1 | GCA003438305_01534 | gene | open | 79238-79756 | yrbI | ||
| 1295 | QSTW01000002.1 | GCA003438305_01535 | gene | open | 79775-80362 | |||
| 1296 | QSTW01000002.1 | GCA003438305_01536 | gene | open | 80359-81381 | |||
| 1297 | QSTW01000002.1 | GCA003438305_01537 | gene | open | 81378-82694 | mtaB | ||
| 1298 | QSTW01000002.1 | GCA003438305_01538 | gene | open | 82997-83197 | |||
| 1299 | QSTW01000002.1 | GCA003438305_01539 | gene | open | 83553-84002 | rplI | ||
| 1300 | QSTW01000002.1 | GCA003438305_01540 | gene | open | 84021-84290 | rpsR | ||
| 1301 | QSTW01000002.1 | GCA003438305_01541 | gene | open | 84293-84640 | rpsF | ||
| 1302 | QSTW01000002.1 | GCA003438305_01542 | gene | open | 84668-84802 | |||
| 1303 | QSTW01000002.1 | GCA003438305_01543 | gene | open | 84846-85292 | |||
| 1304 | QSTW01000002.1 | GCA003438305_01544 | gene | open | 85483-85659 | |||
| 1305 | QSTW01000002.1 | GCA003438305_01545 | gene | open | 85734-86432 | rprY | ||
| 1306 | QSTW01000002.1 | GCA003438305_01546 | gene | open | 86436-87986 | |||
| 1307 | QSTW01000002.1 | GCA003438305_01547 | gene | open | 88252-90411 | fusA | ||
| 1308 | QSTW01000002.1 | GCA003438305_01548 | gene | open | 90534-91763 | hemW | ||
| 1309 | QSTW01000002.1 | GCA003438305_01549 | gene | open | 91840-91998 | |||
| 1310 | QSTW01000002.1 | GCA003438305_01550 | gene | open | 92119-93507 | glmM | ||
| 1311 | QSTW01000002.1 | GCA003438305_01551 | gene | open | 93533-94252 | |||
| 1312 | QSTW01000002.1 | GCA003438305_01552 | gene | open | 94307-95344 | nrnA | ||
| 1313 | QSTW01000002.1 | GCA003438305_01553 | gene | open | 95405-97345 | |||
| 1314 | QSTW01000002.1 | GCA003438305_01554 | gene | open | 97382-98038 | rpe | ||
| 1315 | QSTW01000002.1 | GCA003438305_01555 | gene | open | 98111-99403 | porT | ||
| 1316 | QSTW01000002.1 | GCA003438305_01556 | gene | open | 99407-99949 | sigM | ||
| 1317 | QSTW01000002.1 | GCA003438305_01557 | gene | open | 100103-100822 | |||
| 1318 | QSTW01000002.1 | GCA003438305_01558 | gene | open | 100838-101809 | fmt | ||
| 1319 | QSTW01000002.1 | GCA003438305_01559 | gene | open | 101825-103624 | |||
| 1320 | QSTW01000002.1 | GCA003438305_01560 | gene | open | 103637-104200 | tsaC | ||
| 1321 | QSTW01000002.1 | GCA003438305_01561 | gene | open | 104328-105434 | dinB | ||
| 1322 | QSTW01000002.1 | GCA003438305_01562 | gene | open | 105900-106997 | mrp | ||
| 1323 | QSTW01000002.1 | GCA003438305_01563 | gene | open | 107017-107808 | trmB | ||
| 1324 | QSTW01000002.1 | GCA003438305_01564 | gene | open | 107909-109648 | |||
| 1325 | QSTW01000002.1 | GCA003438305_01565 | gene | open | 109718-110587 | |||
| 1326 | QSTW01000002.1 | GCA003438305_01566 | gene | open | 110599-112014 | |||
| 1327 | QSTW01000002.1 | GCA003438305_01567 | gene | open | 112152-113645 | |||
| 1328 | QSTW01000002.1 | GCA003438305_01568 | gene | open | 113655-114638 | |||
| 1329 | QSTW01000002.1 | GCA003438305_01569 | gene | open | 114645-115820 | |||
| 1330 | QSTW01000002.1 | GCA003438305_01570 | gene | open | 115833-117089 | |||
| 1331 | QSTW01000002.1 | GCA003438305_01571 | gene | open | 117218-118531 | tonB | ||
| 1332 | QSTW01000002.1 | GCA003438305_01572 | gene | open | 118556-120754 | |||
| 1333 | QSTW01000002.1 | GCA003438305_01573 | gene | open | 120832-121680 | lipA | ||
| 1334 | QSTW01000002.1 | GCA003438305_01574 | gene | open | 121736-122725 | |||
| 1335 | QSTW01000002.1 | GCA003438305_01575 | gene | open | 122729-123433 | |||
| 1336 | QSTW01000002.1 | GCA003438305_01576 | gene | open | 123453-124445 | gldB | ||
| 1337 | QSTW01000002.1 | GCA003438305_01577 | gene | open | 124452-125309 | fabI | ||
| 1338 | QSTW01000002.1 | GCA003438305_01578 | gene | open | 125628-126851 | |||
| 1339 | QSTW01000002.1 | GCA003438305_01579 | gene | open | 126911-127885 | |||
| 1340 | QSTW01000002.1 | GCA003438305_01580 | gene | open | 128034-128753 | |||
| 1341 | QSTW01000002.1 | GCA003438305_01581 | gene | open | 128764-130014 | macB | ||
| 1342 | QSTW01000002.1 | GCA003438305_01582 | gene | open | 130017-131261 | macB | ||
| 1343 | QSTW01000002.1 | GCA003438305_01583 | gene | open | 131297-132394 | |||
| 1344 | QSTW01000002.1 | GCA003438305_01584 | gene | open | 132398-133732 | |||
| 1345 | QSTW01000002.1 | GCA003438305_01585 | gene | open | 133923-135335 | |||
| 1346 | QSTW01000002.1 | GCA003438305_01586 | gene | open | 135386-136204 | |||
| 1347 | QSTW01000002.1 | GCA003438305_01587 | gene | open | 136223-136717 | |||
| 1348 | QSTW01000002.1 | GCA003438305_01588 | gene | open | 136729-137208 | |||
| 1349 | QSTW01000002.1 | GCA003438305_01589 | gene | open | 137399-141709 | |||
| 1350 | QSTW01000002.1 | GCA003438305_01590 | gene | open | 141808-142122 | rhaM | ||
| 1351 | QSTW01000002.1 | GCA003438305_01591 | gene | open | 142134-143765 | |||
| 1352 | QSTW01000002.1 | GCA003438305_01592 | gene | open | 143998-145281 | rhgT | ||
| 1353 | QSTW01000002.1 | GCA003438305_01593 | gene | open | 145465-146892 | |||
| 1354 | QSTW01000002.1 | GCA003438305_01594 | gene | open | 146957-148177 | |||
| 1355 | QSTW01000002.1 | GCA003438305_01595 | gene | open | 148266-149696 | cstA | ||
| 1356 | QSTW01000002.1 | GCA003438305_01596 | gene | open | 149874-151532 | |||
| 1357 | QSTW01000002.1 | GCA003438305_01597 | gene | open | 151615-152784 | purM | ||
| 1358 | QSTW01000002.1 | GCA003438305_01598 | gene | open | 153160-154269 | prfA | ||
| 1359 | QSTW01000002.1 | GCA003438305_01599 | gene | open | 154340-155164 | pyrF | ||
| 1360 | QSTW01000002.1 | GCA003438305_01600 | gene | open | 155436-156476 | lpxD | ||
| 1361 | QSTW01000002.1 | GCA003438305_01601 | gene | open | 156481-157866 | lpxC | ||
| 1362 | QSTW01000002.1 | GCA003438305_01602 | gene | open | 157868-158635 | lpxA | ||
| 1363 | QSTW01000002.1 | GCA003438305_01603 | gene | open | 158681-159238 | |||
| 1364 | QSTW01000002.1 | GCA003438305_01604 | gene | open | 159307-160260 | miaA | ||
| 1365 | QSTW01000002.1 | GCA003438305_01605 | gene | open | 160247-161263 | |||
| 1366 | QSTW01000002.1 | GCA003438305_01606 | gene | open | 161288-161629 | |||
| 1367 | QSTW01000002.1 | GCA003438305_01607 | gene | open | 161629-161931 | |||
| 1368 | QSTW01000002.1 | GCA003438305_01608 | gene | open | 162052-163890 | |||
| 1369 | QSTW01000002.1 | GCA003438305_01609 | gene | open | 163979-164437 | queF | ||
| 1370 | QSTW01000002.1 | GCA003438305_01610 | gene | open | 164440-165105 | queC | ||
| 1371 | QSTW01000002.1 | GCA003438305_01611 | gene | open | 165111-165797 | |||
| 1372 | QSTW01000002.1 | GCA003438305_01612 | gene | open | 166193-167050 | |||
| 1373 | QSTW01000002.1 | GCA003438305_01613 | gene | open | 167063-168103 | corA | ||
| 1374 | QSTW01000002.1 | GCA003438305_01614 | gene | open | 168138-168785 | nth | ||
| 1375 | QSTW01000002.1 | GCA003438305_01615 | gene | open | 168850-169197 | |||
| 1376 | QSTW01000002.1 | GCA003438305_01616 | gene | open | 169213-170178 | |||
| 1377 | QSTW01000002.1 | GCA003438305_01617 | gene | open | 170312-172930 | alaS | ||
| 1378 | QSTW01000002.1 | GCA003438305_01618 | gene | open | 173052-174419 | mepA | ||
| 1379 | QSTW01000002.1 | GCA003438305_01619 | gene | open | 174432-174779 | |||
| 1380 | QSTW01000002.1 | GCA003438305_01620 | gene | open | 174827-175339 | |||
| 1381 | QSTW01000002.1 | GCA003438305_01621 | gene | open | 175503-176843 | tolC | ||
| 1382 | QSTW01000002.1 | GCA003438305_01622 | gene | open | 176858-177694 | |||
| 1383 | QSTW01000002.1 | GCA003438305_01623 | gene | open | 177927-178445 | |||
| 1384 | QSTW01000002.1 | GCA003438305_01624 | gene | open | 178458-179045 | |||
| 1385 | QSTW01000002.1 | GCA003438305_01625 | gene | open | 179284-181929 | |||
| 1386 | QSTW01000002.1 | GCA003438305_01626 | gene | open | 181936-182784 | |||
| 1387 | QSTW01000002.1 | GCA003438305_01627 | gene | open | 182786-183811 | |||
| 1388 | QSTW01000002.1 | GCA003438305_01629 | gene | open | 184040-185398 | |||
| 1389 | QSTW01000002.1 | GCA003438305_01630 | gene | open | 185610-186074 | exbD | ||
| 1390 | QSTW01000002.1 | GCA003438305_01631 | gene | open | 186077-186664 | |||
| 1391 | QSTW01000002.1 | GCA003438305_01632 | gene | open | 186707-187171 | |||
| 1392 | QSTW01000002.1 | GCA003438305_01633 | gene | open | 187180-187980 | tolQ | ||
| 1393 | QSTW01000002.1 | GCA003438305_01635 | gene | open | 188269-189060 | tatD | ||
| 1394 | QSTW01000002.1 | GCA003438305_01636 | gene | open | 189065-190048 | |||
| 1395 | QSTW01000002.1 | GCA003438305_01637 | gene | open | 190126-190812 | tonB | ||
| 1396 | QSTW01000002.1 | GCA003438305_01638 | gene | open | 191229-191927 | cmk | ||
| 1397 | QSTW01000002.1 | GCA003438305_01639 | gene | open | 191914-192777 | |||
| 1398 | QSTW01000002.1 | GCA003438305_01640 | gene | open | 192856-193836 | pfkA | ||
| 1399 | QSTW01000002.1 | GCA003438305_01641 | gene | open | 193922-195250 | |||
| 1400 | QSTW01000002.1 | GCA003438305_01642 | gene | open | 195259-196050 | |||
| 1401 | QSTW01000002.1 | GCA003438305_01643 | gene | open | 196044-196841 | |||
| 1402 | QSTW01000002.1 | GCA003438305_01644 | gene | open | 196838-198235 | potA | ||
| 1403 | QSTW01000002.1 | GCA003438305_01645 | gene | open | 198359-199465 | meaB | ||
| 1404 | QSTW01000002.1 | GCA003438305_01646 | gene | open | 199474-200478 | |||
| 1405 | QSTW01000002.1 | GCA003438305_01647 | gene | open | 200701-206310 | |||
| 1406 | QSTW01000002.1 | GCA003438305_01648 | gene | open | 206497-207954 | |||
| 1407 | QSTW01000002.1 | GCA003438305_01649 | gene | open | 207990-208997 | |||
| 1408 | QSTW01000002.1 | GCA003438305_01650 | gene | open | 209073-209876 | rsmA | ||
| 1409 | QSTW01000002.1 | GCA003438305_01651 | gene | open | 209932-211272 | mgtE | ||
| 1410 | QSTW01000002.1 | GCA003438305_01652 | gene | open | 211579-213384 | |||
| 1411 | QSTW01000002.1 | GCA003438305_01653 | gene | open | 213691-216024 | |||
| 1412 | QSTW01000002.1 | GCA003438305_01654 | gene | open | 216046-217242 | |||
| 1413 | QSTW01000002.1 | GCA003438305_01655 | gene | open | 217255-218295 | |||
| 1414 | QSTW01000002.1 | GCA003438305_01656 | gene | open | 218313-221063 | |||
| 1415 | QSTW01000002.1 | GCA003438305_01657 | gene | open | 221086-222069 | |||
| 1416 | QSTW01000002.1 | GCA003438305_01658 | gene | open | 222195-222914 | |||
| 1417 | QSTW01000002.1 | GCA003438305_01659 | gene | open | 223319-224041 | |||
| 1418 | QSTW01000002.1 | GCA003438305_01660 | gene | open | 224062-225549 | |||
| 1419 | QSTW01000002.1 | GCA003438305_01661 | gene | open | 225586-226902 | xylA | ||
| 1420 | QSTW01000002.1 | GCA003438305_01662 | gene | open | 227001-228482 | xylE | ||
| 1421 | QSTW01000002.1 | GCA003438305_01665 | gene | open | 229055-229438 | |||
| 1422 | QSTW01000002.1 | GCA003438305_01666 | gene | open | 229516-231408 | |||
| 1423 | QSTW01000002.1 | GCA003438305_01667 | gene | open | 231425-232639 | |||
| 1424 | QSTW01000002.1 | GCA003438305_01668 | gene | open | 232652-233353 | |||
| 1425 | QSTW01000002.1 | GCA003438305_01669 | gene | open | 233439-234632 | aspB | ||
| 1426 | QSTW01000002.1 | GCA003438305_01670 | gene | open | 234911-235078 | |||
| 1427 | QSTW01000002.1 | GCA003438305_01671 | gene | open | 235200-238169 | |||
| 1428 | QSTW01000002.1 | GCA003438305_01672 | gene | open | 238185-239045 | yfkN | ||
| 1429 | QSTW01000002.1 | GCA003438305_01673 | gene | open | 239042-239824 | |||
| 1430 | QSTW01000002.1 | GCA003438305_01674 | gene | open | 239868-240038 | |||
| 1431 | QSTW01000002.1 | GCA003438305_01675 | gene | open | 240052-240405 | rplS | ||
| 1432 | QSTW01000002.1 | GCA003438305_01677 | gene | open | 240988-241329 | |||
| 1433 | QSTW01000002.1 | GCA003438305_01678 | gene | open | 241334-241642 | |||
| 1434 | QSTW01000002.1 | GCA003438305_01679 | gene | open | 242297-242743 | |||
| 1435 | QSTW01000002.1 | GCA003438305_01680 | gene | open | 242828-243853 | |||
| 1436 | QSTW01000002.1 | GCA003438305_01681 | gene | open | 243990-244145 | |||
| 1437 | QSTW01000002.1 | GCA003438305_01682 | gene | open | 244507-246363 | |||
| 1438 | QSTW01000002.1 | GCA003438305_01683 | gene | open | 246426-247307 | |||
| 1439 | QSTW01000002.1 | GCA003438305_01684 | gene | open | 247670-248482 | |||
| 1440 | QSTW01000002.1 | GCA003438305_01628 | gene | open | 183885-183966 | trnL | ||
| 1441 | QSTW01000002.1 | GCA003438305_01634 | gene | open | 188043-188130 | trnS | ||
| 1442 | QSTW01000002.1 | GCA003438305_01663 | gene | open | 228530-228603 | trnM | ||
| 1443 | QSTW01000002.1 | GCA003438305_01664 | gene | open | 228662-228735 | trnM | ||
| 1444 | QSTW01000002.1 | GCA003438305_01676 | gene | open | 240539-240656 | trnK | ||
| 1445 | QSTW01000002.1 | GCA003438305_01628 | tRNA | open | 183885-183966 | trnL | tRNA-Leu(tag) | |
| 1446 | QSTW01000002.1 | GCA003438305_01634 | tRNA | open | 188043-188130 | trnS | tRNA-Ser(gga) | |
| 1447 | QSTW01000002.1 | GCA003438305_01663 | tRNA | open | 228530-228603 | trnM | tRNA-Met(cat) | |
| 1448 | QSTW01000002.1 | GCA003438305_01664 | tRNA | open | 228662-228735 | trnM | tRNA-Met(cat) | |
| 1449 | QSTW01000002.1 | GCA003438305_01676 | tRNA | open | 240539-240656 | trnK | tRNA-Lys(ttt) | |
| 1450 | QSTW01000003.1 | GCA003438305_02378 | gene | open | 168370-168806 | Bacteroidales-2 | ||
| 1451 | QSTW01000003.1 | GCA003438305_02378 | ncRNA | open | 168370-168806 | Bacteroidales-2 RNA | ||
| 1452 | QSTW01000003.1 | regulatory_region | open | 27189-27327 | Bacteroidete tryptophan peptide leader RNA | |||
| 1453 | QSTW01000003.1 | repeat_region | open | 104684-106143 | CRISPR array with 23 repeats of length 29%2C consensus sequence CTTTTAATCGTACCTTATGGAATTGAAAC and spacer length 35 | |||
| 1454 | QSTW01000003.1 | GCA003438305_02205 | CDS | open | 465-893 | _na 142_aa | Transcriptional repressor | |
| 1455 | QSTW01000003.1 | GCA003438305_02206 | CDS | open | 974-2161 | _na 395_aa | Aminopeptidase | |
| 1456 | QSTW01000003.1 | GCA003438305_02207 | CDS | open | 2202-3800 | _na 532_aa | Dipeptidase | |
| 1457 | QSTW01000003.1 | GCA003438305_02208 | CDS | open | 4177-5751 | _na 524_aa | cafA | Ribonuclease E/G |
| 1458 | QSTW01000003.1 | GCA003438305_02209 | CDS | open | 5996-6271 | _na 91_aa | hupA | DNA-binding protein HU |
| 1459 | QSTW01000003.1 | GCA003438305_02210 | CDS | open | 6479-7543 | _na 354_aa | mutY | A/G-specific adenine glycosylase |
| 1460 | QSTW01000003.1 | GCA003438305_02211 | CDS | open | 7548-7973 | _na 141_aa | Single-stranded DNA-binding protein | |
| 1461 | QSTW01000003.1 | GCA003438305_02212 | CDS | open | 8017-9378 | _na 453_aa | gldE | Gliding motility-associated protein GldE |
| 1462 | QSTW01000003.1 | GCA003438305_02213 | CDS | open | 9381-10043 | _na 220_aa | 4'-phosphopantetheinyl transferase domain-containing protein | |
| 1463 | QSTW01000003.1 | GCA003438305_02214 | CDS | open | 10066-13062 | _na 998_aa | asmA | AsmA family protein |
| 1464 | QSTW01000003.1 | GCA003438305_02215 | CDS | open | 13164-14681 | _na 505_aa | MFS transporter | |
| 1465 | QSTW01000003.1 | GCA003438305_02216 | CDS | open | 14808-14936 | _na 42_aa | hypothetical protein | |
| 1466 | QSTW01000003.1 | GCA003438305_02217 | CDS | open | 14908-15129 | _na 73_aa | HNH endonuclease | |
| 1467 | QSTW01000003.1 | GCA003438305_02218 | CDS | open | 15160-16101 | _na 313_aa | HNH endonuclease | |
| 1468 | QSTW01000003.1 | GCA003438305_02219 | CDS | open | 16272-16670 | _na 132_aa | Lipocalin-like domain-containing protein | |
| 1469 | QSTW01000003.1 | GCA003438305_02220 | CDS | open | 16975-18762 | _na 595_aa | histidine kinase | |
| 1470 | QSTW01000003.1 | GCA003438305_02221 | CDS | open | 18780-19466 | _na 228_aa | Response regulator receiver domain protein | |
| 1471 | QSTW01000003.1 | GCA003438305_02222 | CDS | open | 19570-20619 | _na 349_aa | ansA | asparaginase |
| 1472 | QSTW01000003.1 | GCA003438305_02223 | CDS | open | 20706-21485 | _na 259_aa | trpA | tryptophan synthase subunit alpha |
| 1473 | QSTW01000003.1 | GCA003438305_02224 | CDS | open | 21498-22121 | _na 207_aa | N-(5'-phosphoribosyl)anthranilate isomerase | |
| 1474 | QSTW01000003.1 | GCA003438305_02225 | CDS | open | 22118-22909 | _na 263_aa | trpC | indole-3-glycerol phosphate synthase TrpC |
| 1475 | QSTW01000003.1 | GCA003438305_02226 | CDS | open | 22914-23909 | _na 331_aa | Anthranilate phosphoribosyltransferase | |
| 1476 | QSTW01000003.1 | GCA003438305_02227 | CDS | open | 23952-24518 | _na 188_aa | Glutamine amidotransferase domain-containing protein | |
| 1477 | QSTW01000003.1 | GCA003438305_02228 | CDS | open | 24515-25924 | _na 469_aa | Anthranilate synthase component 1 | |
| 1478 | QSTW01000003.1 | GCA003438305_02229 | CDS | open | 25937-27133 | _na 398_aa | trpB | tryptophan synthase subunit beta |
| 1479 | QSTW01000003.1 | GCA003438305_02230 | CDS | open | 27445-28155 | _na 236_aa | DNA alkylation repair protein | |
| 1480 | QSTW01000003.1 | GCA003438305_02231 | CDS | open | 28185-29030 | _na 281_aa | prmA | 50S ribosomal protein L11 methyltransferase |
| 1481 | QSTW01000003.1 | GCA003438305_02232 | CDS | open | 29275-30258 | _na 327_aa | DUF4249 domain-containing protein | |
| 1482 | QSTW01000003.1 | GCA003438305_02233 | CDS | open | 30278-31477 | _na 399_aa | Acyloxyacyl hydrolase | |
| 1483 | QSTW01000003.1 | GCA003438305_02234 | CDS | open | 31497-32171 | _na 224_aa | tpx | thiol peroxidase |
| 1484 | QSTW01000003.1 | GCA003438305_02235 | CDS | open | 32311-32964 | _na 217_aa | Transcriptional regulator LacI/GalR-like sensor domain-containing protein | |
| 1485 | QSTW01000003.1 | GCA003438305_02236 | CDS | open | 33097-34998 | _na 633_aa | Thioredoxin domain-containing protein | |
| 1486 | QSTW01000003.1 | GCA003438305_02237 | CDS | open | 35285-35839 | _na 184_aa | Phosphoribosylformylglycinamidine synthase | |
| 1487 | QSTW01000003.1 | GCA003438305_02238 | CDS | open | 35919-37466 | _na 515_aa | Carboxypeptidase Q | |
| 1488 | QSTW01000003.1 | GCA003438305_02239 | CDS | open | 38034-38177 | _na 47_aa | hypothetical protein | |
| 1489 | QSTW01000003.1 | GCA003438305_02240 | CDS | open | 38197-38409 | _na 70_aa | DUF3873 domain-containing protein | |
| 1490 | QSTW01000003.1 | GCA003438305_02241 | CDS | open | 38406-38669 | _na 87_aa | DUF6956 domain-containing protein | |
| 1491 | QSTW01000003.1 | GCA003438305_02242 | CDS | open | 38721-38939 | _na 72_aa | hypothetical protein | |
| 1492 | QSTW01000003.1 | GCA003438305_02243 | CDS | open | 39063-39395 | _na 110_aa | hipA | HipA N-terminal subdomain 1 domain-containing protein |
| 1493 | QSTW01000003.1 | GCA003438305_02244 | CDS | open | 39565-40374 | _na 269_aa | HTH luxR-type domain-containing protein | |
| 1494 | QSTW01000003.1 | GCA003438305_02245 | CDS | open | 40315-40665 | _na 116_aa | hypothetical protein | |
| 1495 | QSTW01000003.1 | GCA003438305_02246 | CDS | open | 40669-42996 | _na 775_aa | TonB-dependent receptor | |
| 1496 | QSTW01000003.1 | GCA003438305_02247 | CDS | open | 43235-44506 | _na 423_aa | Tail specific protease domain-containing protein | |
| 1497 | QSTW01000003.1 | GCA003438305_02248 | CDS | open | 44634-47201 | _na 855_aa | TonB-dependent receptor plug domain-containing protein | |
| 1498 | QSTW01000003.1 | GCA003438305_02249 | CDS | open | 47211-48050 | _na 279_aa | GLPGLI family protein | |
| 1499 | QSTW01000003.1 | GCA003438305_02250 | CDS | open | 48410-48727 | _na 105_aa | lysozyme | |
| 1500 | QSTW01000003.1 | GCA003438305_02252 | CDS | open | 49287-49745 | _na 152_aa | Sensor of ECF-type sigma factor |

