BAKTAGenome Explorer: Phocaeicola plebeius (GCA_003471645.1)
Select a Genome:
|
BAKTA Annotations for GCA_003471645.1
|
Search & Sort all 6158 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | QRJS01000018.1 | GCA003471645_00757 | CDS | open | 26447-28843 | _na 798_aa | Peptidase S9A/B/C family catalytic domain protein | |
| 3502 | QRJS01000018.1 | GCA003471645_00758 | CDS | open | 28951-30291 | _na 446_aa | rseP | RIP metalloprotease RseP |
| 3503 | QRJS01000018.1 | GCA003471645_00759 | CDS | open | 30331-31488 | _na 385_aa | 1-deoxy-D-xylulose-5-phosphate reductoisomerase | |
| 3504 | QRJS01000018.1 | GCA003471645_00760 | CDS | open | 31494-32351 | _na 285_aa | Peptidase M23 domain-containing protein | |
| 3505 | QRJS01000018.1 | GCA003471645_00761 | CDS | open | 32366-32878 | _na 170_aa | rimM | ribosome maturation factor RimM |
| 3506 | QRJS01000018.1 | GCA003471645_00762 | CDS | open | 32881-34188 | _na 435_aa | murA | UDP-N-acetylglucosamine 1-carboxyvinyltransferase |
| 3507 | QRJS01000018.1 | GCA003471645_00763 | CDS | open | 34204-34806 | _na 200_aa | DUF4290 domain-containing protein | |
| 3508 | QRJS01000018.1 | GCA003471645_00764 | CDS | open | 34864-35553 | _na 229_aa | tsaB | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB |
| 3509 | QRJS01000018.1 | GCA003471645_00765 | CDS | open | 35758-36633 | _na 291_aa | TIGR00255 family protein | |
| 3510 | QRJS01000018.1 | GCA003471645_00766 | CDS | open | 36642-37208 | _na 188_aa | gmk | guanylate kinase |
| 3511 | QRJS01000018.1 | GCA003471645_00767 | CDS | open | 37219-37404 | _na 61_aa | hypothetical protein | |
| 3512 | QRJS01000018.1 | GCA003471645_00768 | CDS | open | 37383-37976 | _na 197_aa | nadD | nicotinate (nicotinamide) nucleotide adenylyltransferase |
| 3513 | QRJS01000018.1 | GCA003471645_00769 | CDS | open | 37977-38813 | _na 278_aa | Calcineurin-like phosphoesterase domain-containing protein | |
| 3514 | QRJS01000018.1 | GCA003471645_00770 | CDS | open | 38905-39795 | _na 296_aa | menA | 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase |
| 3515 | QRJS01000018.1 | GCA003471645_00771 | CDS | open | 39797-40279 | _na 160_aa | N-acetyltransferase domain-containing protein | |
| 3516 | QRJS01000018.1 | GCA003471645_00772 | CDS | open | 40353-42689 | _na 778_aa | Beta-galactosidase | |
| 3517 | QRJS01000018.1 | GCA003471645_00773 | CDS | open | 42870-42983 | _na 37_aa | hypothetical protein | |
| 3518 | QRJS01000018.1 | GCA003471645_00774 | CDS | open | 42997-45096 | _na 699_aa | recG | ATP-dependent DNA helicase RecG |
| 3519 | QRJS01000018.1 | GCA003471645_00775 | CDS | open | 45096-45764 | _na 222_aa | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase | |
| 3520 | QRJS01000018.1 | GCA003471645_00776 | CDS | open | 45764-46312 | _na 182_aa | DJ-1 family glyoxalase III | |
| 3521 | QRJS01000018.1 | GCA003471645_00777 | CDS | open | 46339-47175 | _na 278_aa | tonB | TonB family C-terminal domain |
| 3522 | QRJS01000018.1 | GCA003471645_00778 | CDS | open | 47188-47604 | _na 138_aa | exbD | Biopolymer transport protein ExbD/TolR |
| 3523 | QRJS01000018.1 | GCA003471645_00779 | CDS | open | 47611-48327 | _na 238_aa | MotA/TolQ/ExbB proton channel domain-containing protein | |
| 3524 | QRJS01000018.1 | GCA003471645_00780 | CDS | open | 48334-49047 | _na 237_aa | pyridoxine 5'-phosphate synthase | |
| 3525 | QRJS01000018.1 | GCA003471645_00781 | CDS | open | 49053-49208 | _na 51_aa | hypothetical protein | |
| 3526 | QRJS01000018.1 | GCA003471645_00782 | CDS | open | 49156-50040 | _na 294_aa | NAD kinase | |
| 3527 | QRJS01000018.1 | GCA003471645_00783 | CDS | open | 50121-51776 | _na 551_aa | acs | AMP-binding enzyme |
| 3528 | QRJS01000018.1 | GCA003471645_00784 | CDS | open | 51798-52352 | _na 184_aa | Cupin domain protein | |
| 3529 | QRJS01000018.1 | GCA003471645_00785 | CDS | open | 52446-52835 | _na 129_aa | hypothetical protein | |
| 3530 | QRJS01000018.1 | GCA003471645_00786 | CDS | open | 52870-54006 | _na 378_aa | Oxidoreductase%2C NAD-binding domain protein | |
| 3531 | QRJS01000018.1 | GCA003471645_00787 | CDS | open | 54018-55109 | _na 363_aa | Glutamate 5-kinase | |
| 3532 | QRJS01000018.1 | GCA003471645_00788 | CDS | open | 55563-56345 | _na 260_aa | Cof-like hydrolase | |
| 3533 | QRJS01000018.1 | GCA003471645_00789 | CDS | open | 56525-57400 | _na 291_aa | carboxypeptidase-like regulatory domain-containing protein | |
| 3534 | QRJS01000018.1 | GCA003471645_00735 | gene | open | 385-1215 | |||
| 3535 | QRJS01000018.1 | GCA003471645_00736 | gene | open | 1524-1634 | |||
| 3536 | QRJS01000018.1 | GCA003471645_00737 | gene | open | 1648-3054 | |||
| 3537 | QRJS01000018.1 | GCA003471645_00738 | gene | open | 3136-4200 | hlyD | ||
| 3538 | QRJS01000018.1 | GCA003471645_00739 | gene | open | 4205-5845 | |||
| 3539 | QRJS01000018.1 | GCA003471645_00740 | gene | open | 5883-6755 | araC | ||
| 3540 | QRJS01000018.1 | GCA003471645_00741 | gene | open | 6768-6872 | |||
| 3541 | QRJS01000018.1 | GCA003471645_00742 | gene | open | 6887-7696 | |||
| 3542 | QRJS01000018.1 | GCA003471645_00744 | gene | open | 8122-9165 | |||
| 3543 | QRJS01000018.1 | GCA003471645_00745 | gene | open | 9249-11624 | |||
| 3544 | QRJS01000018.1 | GCA003471645_00746 | gene | open | 11738-12145 | |||
| 3545 | QRJS01000018.1 | GCA003471645_00747 | gene | open | 12199-12654 | greA | ||
| 3546 | QRJS01000018.1 | GCA003471645_00748 | gene | open | 12950-14095 | |||
| 3547 | QRJS01000018.1 | GCA003471645_00749 | gene | open | 14342-16525 | pnp | ||
| 3548 | QRJS01000018.1 | GCA003471645_00750 | gene | open | 16682-17854 | |||
| 3549 | QRJS01000018.1 | GCA003471645_00751 | gene | open | 17925-19208 | |||
| 3550 | QRJS01000018.1 | GCA003471645_00752 | gene | open | 19329-19778 | |||
| 3551 | QRJS01000018.1 | GCA003471645_00753 | gene | open | 19826-20650 | |||
| 3552 | QRJS01000018.1 | GCA003471645_00754 | gene | open | 20979-22409 | |||
| 3553 | QRJS01000018.1 | GCA003471645_00755 | gene | open | 22889-25273 | |||
| 3554 | QRJS01000018.1 | GCA003471645_00756 | gene | open | 25291-25752 | nrdG | ||
| 3555 | QRJS01000018.1 | GCA003471645_00757 | gene | open | 26447-28843 | |||
| 3556 | QRJS01000018.1 | GCA003471645_00758 | gene | open | 28951-30291 | rseP | ||
| 3557 | QRJS01000018.1 | GCA003471645_00759 | gene | open | 30331-31488 | |||
| 3558 | QRJS01000018.1 | GCA003471645_00760 | gene | open | 31494-32351 | |||
| 3559 | QRJS01000018.1 | GCA003471645_00761 | gene | open | 32366-32878 | rimM | ||
| 3560 | QRJS01000018.1 | GCA003471645_00762 | gene | open | 32881-34188 | murA | ||
| 3561 | QRJS01000018.1 | GCA003471645_00763 | gene | open | 34204-34806 | |||
| 3562 | QRJS01000018.1 | GCA003471645_00764 | gene | open | 34864-35553 | tsaB | ||
| 3563 | QRJS01000018.1 | GCA003471645_00765 | gene | open | 35758-36633 | |||
| 3564 | QRJS01000018.1 | GCA003471645_00766 | gene | open | 36642-37208 | gmk | ||
| 3565 | QRJS01000018.1 | GCA003471645_00767 | gene | open | 37219-37404 | |||
| 3566 | QRJS01000018.1 | GCA003471645_00768 | gene | open | 37383-37976 | nadD | ||
| 3567 | QRJS01000018.1 | GCA003471645_00769 | gene | open | 37977-38813 | |||
| 3568 | QRJS01000018.1 | GCA003471645_00770 | gene | open | 38905-39795 | menA | ||
| 3569 | QRJS01000018.1 | GCA003471645_00771 | gene | open | 39797-40279 | |||
| 3570 | QRJS01000018.1 | GCA003471645_00772 | gene | open | 40353-42689 | |||
| 3571 | QRJS01000018.1 | GCA003471645_00773 | gene | open | 42870-42983 | |||
| 3572 | QRJS01000018.1 | GCA003471645_00774 | gene | open | 42997-45096 | recG | ||
| 3573 | QRJS01000018.1 | GCA003471645_00775 | gene | open | 45096-45764 | |||
| 3574 | QRJS01000018.1 | GCA003471645_00776 | gene | open | 45764-46312 | |||
| 3575 | QRJS01000018.1 | GCA003471645_00777 | gene | open | 46339-47175 | tonB | ||
| 3576 | QRJS01000018.1 | GCA003471645_00778 | gene | open | 47188-47604 | exbD | ||
| 3577 | QRJS01000018.1 | GCA003471645_00779 | gene | open | 47611-48327 | |||
| 3578 | QRJS01000018.1 | GCA003471645_00780 | gene | open | 48334-49047 | |||
| 3579 | QRJS01000018.1 | GCA003471645_00781 | gene | open | 49053-49208 | |||
| 3580 | QRJS01000018.1 | GCA003471645_00782 | gene | open | 49156-50040 | |||
| 3581 | QRJS01000018.1 | GCA003471645_00783 | gene | open | 50121-51776 | acs | ||
| 3582 | QRJS01000018.1 | GCA003471645_00784 | gene | open | 51798-52352 | |||
| 3583 | QRJS01000018.1 | GCA003471645_00785 | gene | open | 52446-52835 | |||
| 3584 | QRJS01000018.1 | GCA003471645_00786 | gene | open | 52870-54006 | |||
| 3585 | QRJS01000018.1 | GCA003471645_00787 | gene | open | 54018-55109 | |||
| 3586 | QRJS01000018.1 | GCA003471645_00788 | gene | open | 55563-56345 | |||
| 3587 | QRJS01000018.1 | GCA003471645_00789 | gene | open | 56525-57400 | |||
| 3588 | QRJS01000018.1 | GCA003471645_00743 | gene | open | 7872-7955 | trnL | ||
| 3589 | QRJS01000018.1 | GCA003471645_00743 | tRNA | open | 7872-7955 | trnL | tRNA-Leu(caa) | |
| 3590 | QRJS01000019.1 | repeat_region | open | 29836-31501 | CRISPR array with 22 repeats of length 47%2C consensus sequence GTTGTTTCTAATGGTTCAAAGATACTAAAATGAAAGCAAATCACAAC and spacer length 29 | |||
| 3591 | QRJS01000019.1 | repeat_region | open | 31522-31979 | CRISPR array with 6 repeats of length 47%2C consensus sequence GTTGTTTCTAATGGTTCAAAGATACTAAAATGAAAGCAAATCACAAC and spacer length 29 | |||
| 3592 | QRJS01000019.1 | GCA003471645_00790 | CDS | open | 174-4958 | _na 1594_aa | Phage tail tape measure protein | |
| 3593 | QRJS01000019.1 | GCA003471645_00791 | CDS | open | 4955-5377 | _na 140_aa | Phage tail protein | |
| 3594 | QRJS01000019.1 | GCA003471645_00792 | CDS | open | 5455-6819 | _na 454_aa | Tip attachment protein J domain-containing protein | |
| 3595 | QRJS01000019.1 | GCA003471645_00793 | CDS | open | 6930-8738 | _na 602_aa | Prophage tail endopeptidase domain-containing protein | |
| 3596 | QRJS01000019.1 | GCA003471645_00794 | CDS | open | 8741-9001 | _na 86_aa | hypothetical protein | |
| 3597 | QRJS01000019.1 | GCA003471645_00795 | CDS | open | 9055-9567 | _na 170_aa | CBS domain-containing protein | |
| 3598 | QRJS01000019.1 | GCA003471645_00796 | CDS | open | 9701-9940 | _na 79_aa | hypothetical protein | |
| 3599 | QRJS01000019.1 | GCA003471645_00797 | CDS | open | 10298-10702 | _na 134_aa | hypothetical protein | |
| 3600 | QRJS01000019.1 | GCA003471645_00798 | CDS | open | 10702-11196 | _na 164_aa | Holin | |
| 3601 | QRJS01000019.1 | GCA003471645_00799 | CDS | open | 11272-11757 | _na 161_aa | hypothetical protein | |
| 3602 | QRJS01000019.1 | GCA003471645_00800 | CDS | open | 11770-13884 | _na 704_aa | Cell surface protein | |
| 3603 | QRJS01000019.1 | GCA003471645_00801 | CDS | open | 13932-14354 | _na 140_aa | Phage protein | |
| 3604 | QRJS01000019.1 | GCA003471645_00802 | CDS | open | 14354-14569 | _na 71_aa | hypothetical protein | |
| 3605 | QRJS01000019.1 | GCA003471645_00803 | CDS | open | 14670-15161 | _na 163_aa | N-acetylmuramoyl-L-alanine amidase | |
| 3606 | QRJS01000019.1 | GCA003471645_00804 | CDS | open | 15158-15652 | _na 164_aa | Lipoprotein | |
| 3607 | QRJS01000019.1 | GCA003471645_00805 | CDS | open | 16198-17472 | _na 424_aa | Recombinase | |
| 3608 | QRJS01000019.1 | GCA003471645_00808 | CDS | open | 17963-19024 | _na 353_aa | Alpha-N-arabinofuranosidase | |
| 3609 | QRJS01000019.1 | GCA003471645_00809 | CDS | open | 19035-19154 | _na 39_aa | hypothetical protein | |
| 3610 | QRJS01000019.1 | GCA003471645_00810 | CDS | open | 19372-20448 | _na 358_aa | carA | carbamoyl phosphate synthase small subunit |
| 3611 | QRJS01000019.1 | GCA003471645_00811 | CDS | open | 20472-23699 | _na 1075_aa | carB | carbamoyl-phosphate synthase large subunit |
| 3612 | QRJS01000019.1 | GCA003471645_00812 | CDS | open | 23976-28472 | _na 1498_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 3613 | QRJS01000019.1 | GCA003471645_00813 | CDS | open | 28469-29395 | _na 308_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 3614 | QRJS01000019.1 | GCA003471645_00814 | CDS | open | 29395-29727 | _na 110_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 3615 | QRJS01000019.1 | GCA003471645_00815 | CDS | open | 32114-33292 | _na 392_aa | BT-3987-like N-terminal domain-containing protein | |
| 3616 | QRJS01000019.1 | GCA003471645_00816 | CDS | open | 33303-34406 | _na 367_aa | Endoglycosidase | |
| 3617 | QRJS01000019.1 | GCA003471645_00817 | CDS | open | 34444-36054 | _na 536_aa | SusD/RagB family nutrient-binding outer membrane lipoprotein | |
| 3618 | QRJS01000019.1 | GCA003471645_00818 | CDS | open | 36080-39166 | _na 1028_aa | TonB-dependent receptor plug domain-containing protein | |
| 3619 | QRJS01000019.1 | GCA003471645_00821 | CDS | open | 40187-43414 | _na 1075_aa | DNA 3'-5' helicase | |
| 3620 | QRJS01000019.1 | GCA003471645_00822 | CDS | open | 43453-46326 | _na 957_aa | PD-(D/E)XK endonuclease-like domain-containing protein | |
| 3621 | QRJS01000019.1 | GCA003471645_00823 | CDS | open | 46545-47696 | _na 383_aa | Transmembrane protein | |
| 3622 | QRJS01000019.1 | GCA003471645_00824 | CDS | open | 47708-49720 | _na 670_aa | glgB | 1%2C4-alpha-glucan branching enzyme |
| 3623 | QRJS01000019.1 | GCA003471645_00825 | CDS | open | 49739-50182 | _na 147_aa | YhcH/YjgK/YiaL family protein | |
| 3624 | QRJS01000019.1 | GCA003471645_00826 | CDS | open | 50211-50876 | _na 221_aa | TIGR02453 family protein | |
| 3625 | QRJS01000019.1 | GCA003471645_00827 | CDS | open | 50950-51729 | _na 259_aa | Inositol-1-monophosphatase | |
| 3626 | QRJS01000019.1 | GCA003471645_00828 | CDS | open | 51732-52889 | _na 385_aa | hypothetical protein | |
| 3627 | QRJS01000019.1 | GCA003471645_00829 | CDS | open | 52925-54217 | _na 430_aa | Peptidase M16 inactive domain protein | |
| 3628 | QRJS01000019.1 | GCA003471645_00830 | CDS | open | 54214-54975 | _na 253_aa | kdsB | 3-deoxy-manno-octulosonate cytidylyltransferase |
| 3629 | QRJS01000019.1 | GCA003471645_00831 | CDS | open | 55044-55697 | _na 217_aa | DUF4276 domain-containing protein | |
| 3630 | QRJS01000019.1 | GCA003471645_00832 | CDS | open | 55694-56788 | _na 364_aa | DUF2813 domain-containing protein | |
| 3631 | QRJS01000019.1 | GCA003471645_00790 | gene | open | 174-4958 | |||
| 3632 | QRJS01000019.1 | GCA003471645_00791 | gene | open | 4955-5377 | |||
| 3633 | QRJS01000019.1 | GCA003471645_00792 | gene | open | 5455-6819 | |||
| 3634 | QRJS01000019.1 | GCA003471645_00793 | gene | open | 6930-8738 | |||
| 3635 | QRJS01000019.1 | GCA003471645_00794 | gene | open | 8741-9001 | |||
| 3636 | QRJS01000019.1 | GCA003471645_00795 | gene | open | 9055-9567 | |||
| 3637 | QRJS01000019.1 | GCA003471645_00796 | gene | open | 9701-9940 | |||
| 3638 | QRJS01000019.1 | GCA003471645_00797 | gene | open | 10298-10702 | |||
| 3639 | QRJS01000019.1 | GCA003471645_00798 | gene | open | 10702-11196 | |||
| 3640 | QRJS01000019.1 | GCA003471645_00799 | gene | open | 11272-11757 | |||
| 3641 | QRJS01000019.1 | GCA003471645_00800 | gene | open | 11770-13884 | |||
| 3642 | QRJS01000019.1 | GCA003471645_00801 | gene | open | 13932-14354 | |||
| 3643 | QRJS01000019.1 | GCA003471645_00802 | gene | open | 14354-14569 | |||
| 3644 | QRJS01000019.1 | GCA003471645_00803 | gene | open | 14670-15161 | |||
| 3645 | QRJS01000019.1 | GCA003471645_00804 | gene | open | 15158-15652 | |||
| 3646 | QRJS01000019.1 | GCA003471645_00805 | gene | open | 16198-17472 | |||
| 3647 | QRJS01000019.1 | GCA003471645_00808 | gene | open | 17963-19024 | |||
| 3648 | QRJS01000019.1 | GCA003471645_00809 | gene | open | 19035-19154 | |||
| 3649 | QRJS01000019.1 | GCA003471645_00810 | gene | open | 19372-20448 | carA | ||
| 3650 | QRJS01000019.1 | GCA003471645_00811 | gene | open | 20472-23699 | carB | ||
| 3651 | QRJS01000019.1 | GCA003471645_00812 | gene | open | 23976-28472 | cas9 | ||
| 3652 | QRJS01000019.1 | GCA003471645_00813 | gene | open | 28469-29395 | cas1 | ||
| 3653 | QRJS01000019.1 | GCA003471645_00814 | gene | open | 29395-29727 | cas2 | ||
| 3654 | QRJS01000019.1 | GCA003471645_00815 | gene | open | 32114-33292 | |||
| 3655 | QRJS01000019.1 | GCA003471645_00816 | gene | open | 33303-34406 | |||
| 3656 | QRJS01000019.1 | GCA003471645_00817 | gene | open | 34444-36054 | |||
| 3657 | QRJS01000019.1 | GCA003471645_00818 | gene | open | 36080-39166 | |||
| 3658 | QRJS01000019.1 | GCA003471645_00821 | gene | open | 40187-43414 | |||
| 3659 | QRJS01000019.1 | GCA003471645_00822 | gene | open | 43453-46326 | |||
| 3660 | QRJS01000019.1 | GCA003471645_00823 | gene | open | 46545-47696 | |||
| 3661 | QRJS01000019.1 | GCA003471645_00824 | gene | open | 47708-49720 | glgB | ||
| 3662 | QRJS01000019.1 | GCA003471645_00825 | gene | open | 49739-50182 | |||
| 3663 | QRJS01000019.1 | GCA003471645_00826 | gene | open | 50211-50876 | |||
| 3664 | QRJS01000019.1 | GCA003471645_00827 | gene | open | 50950-51729 | |||
| 3665 | QRJS01000019.1 | GCA003471645_00828 | gene | open | 51732-52889 | |||
| 3666 | QRJS01000019.1 | GCA003471645_00829 | gene | open | 52925-54217 | |||
| 3667 | QRJS01000019.1 | GCA003471645_00830 | gene | open | 54214-54975 | kdsB | ||
| 3668 | QRJS01000019.1 | GCA003471645_00831 | gene | open | 55044-55697 | |||
| 3669 | QRJS01000019.1 | GCA003471645_00832 | gene | open | 55694-56788 | |||
| 3670 | QRJS01000019.1 | GCA003471645_00806 | gene | open | 17582-17647 | trnT | ||
| 3671 | QRJS01000019.1 | GCA003471645_00807 | gene | open | 17650-17722 | trnT | ||
| 3672 | QRJS01000019.1 | GCA003471645_00819 | gene | open | 39629-39702 | trnR | ||
| 3673 | QRJS01000019.1 | GCA003471645_00820 | gene | open | 39729-39802 | trnR | ||
| 3674 | QRJS01000019.1 | GCA003471645_00806 | tRNA | open | 17582-17647 | trnT | tRNA-Thr(cgt) | |
| 3675 | QRJS01000019.1 | GCA003471645_00807 | tRNA | open | 17650-17722 | trnT | tRNA-Thr(cgt) | |
| 3676 | QRJS01000019.1 | GCA003471645_00819 | tRNA | open | 39629-39702 | trnR | tRNA-Arg(tct) | |
| 3677 | QRJS01000019.1 | GCA003471645_00820 | tRNA | open | 39729-39802 | trnR | tRNA-Arg(tct) | |
| 3678 | QRJS01000020.1 | GCA003471645_01014 | gene | open | 32263-32625 | RNaseP_bact_a | ||
| 3679 | QRJS01000020.1 | GCA003471645_01014 | ncRNA | open | 32263-32625 | Bacterial RNase P class A | ||
| 3680 | QRJS01000020.1 | GCA003471645_00987 | CDS | open | 39-452 | _na 137_aa | hypothetical protein | |
| 3681 | QRJS01000020.1 | GCA003471645_00988 | CDS | open | 567-2186 | _na 539_aa | yheS | putative ABC transporter ATP-binding protein YheS |
| 3682 | QRJS01000020.1 | GCA003471645_00989 | CDS | open | 2305-3195 | _na 296_aa | Two-component system response regulator | |
| 3683 | QRJS01000020.1 | GCA003471645_00990 | CDS | open | 3152-4258 | _na 368_aa | hypothetical protein | |
| 3684 | QRJS01000020.1 | GCA003471645_00991 | CDS | open | 5227-5832 | _na 201_aa | grpE | nucleotide exchange factor GrpE |
| 3685 | QRJS01000020.1 | GCA003471645_00992 | CDS | open | 5848-7032 | _na 394_aa | dnaJ | molecular chaperone DnaJ |
| 3686 | QRJS01000020.1 | GCA003471645_00993 | CDS | open | 7315-7962 | _na 215_aa | yjbH | YjbH domain-containing protein |
| 3687 | QRJS01000020.1 | GCA003471645_00994 | CDS | open | 8036-9322 | _na 428_aa | tetrahydrofolate synthase | |
| 3688 | QRJS01000020.1 | GCA003471645_00995 | CDS | open | 9417-10511 | _na 364_aa | Aldose 1-epimerase | |
| 3689 | QRJS01000020.1 | GCA003471645_00996 | CDS | open | 10561-11844 | _na 427_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 3690 | QRJS01000020.1 | GCA003471645_00997 | CDS | open | 11932-13086 | _na 384_aa | galK | galactokinase |
| 3691 | QRJS01000020.1 | GCA003471645_00998 | CDS | open | 13160-14329 | _na 389_aa | DUF3843 domain-containing protein | |
| 3692 | QRJS01000020.1 | GCA003471645_00999 | CDS | open | 14347-15522 | _na 391_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 3693 | QRJS01000020.1 | GCA003471645_01000 | CDS | open | 15942-19118 | _na 1058_aa | TonB-dependent receptor | |
| 3694 | QRJS01000020.1 | GCA003471645_01001 | CDS | open | 19204-20391 | _na 395_aa | Alkaline phosphatase family protein | |
| 3695 | QRJS01000020.1 | GCA003471645_01002 | CDS | open | 20563-22251 | _na 562_aa | ettA | energy-dependent translational throttle protein EttA |
| 3696 | QRJS01000020.1 | GCA003471645_01003 | CDS | open | 22271-23425 | _na 384_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 3697 | QRJS01000020.1 | GCA003471645_01004 | CDS | open | 23500-24321 | _na 273_aa | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase |
| 3698 | QRJS01000020.1 | GCA003471645_01005 | CDS | open | 24386-25033 | _na 215_aa | HAD hydrolase family IA variant 3 | |
| 3699 | QRJS01000020.1 | GCA003471645_01006 | CDS | open | 25205-25360 | _na 51_aa | hypothetical protein | |
| 3700 | QRJS01000020.1 | GCA003471645_01007 | CDS | open | 25488-26162 | _na 224_aa | MATE family efflux transporter | |
| 3701 | QRJS01000020.1 | GCA003471645_01008 | CDS | open | 26159-27421 | _na 420_aa | Nramp family divalent metal transporter | |
| 3702 | QRJS01000020.1 | GCA003471645_01009 | CDS | open | 27499-28767 | _na 422_aa | Clostripain | |
| 3703 | QRJS01000020.1 | GCA003471645_01010 | CDS | open | 28773-29180 | _na 135_aa | Lipoprotein | |
| 3704 | QRJS01000020.1 | GCA003471645_01011 | CDS | open | 29194-29301 | _na 35_aa | hypothetical protein | |
| 3705 | QRJS01000020.1 | GCA003471645_01012 | CDS | open | 29346-30206 | _na 286_aa | rpoD | RNA polymerase sigma-70 domain-containing protein |
| 3706 | QRJS01000020.1 | GCA003471645_01013 | CDS | open | 30463-31959 | _na 498_aa | PDZ domain-containing protein | |
| 3707 | QRJS01000020.1 | GCA003471645_01015 | CDS | open | 32649-33965 | _na 438_aa | brkB | YihY/virulence factor BrkB family protein |
| 3708 | QRJS01000020.1 | GCA003471645_01016 | CDS | open | 34036-34641 | _na 201_aa | riboflavin synthase | |
| 3709 | QRJS01000020.1 | GCA003471645_01017 | CDS | open | 34672-34887 | _na 71_aa | DUF2188 domain-containing protein | |
| 3710 | QRJS01000020.1 | GCA003471645_01031 | CDS | open | 36664-37830 | _na 388_aa | nspC | carboxynorspermidine decarboxylase |
| 3711 | QRJS01000020.1 | GCA003471645_01032 | CDS | open | 37843-40197 | _na 784_aa | DNA 3'-5' helicase | |
| 3712 | QRJS01000020.1 | GCA003471645_01033 | CDS | open | 40412-41776 | _na 454_aa | UPF0210 protein DW204_09185 | |
| 3713 | QRJS01000020.1 | GCA003471645_01034 | CDS | open | 41793-42068 | _na 91_aa | ACT domain-containing protein | |
| 3714 | QRJS01000020.1 | GCA003471645_01035 | CDS | open | 42208-42993 | _na 261_aa | mazG | nucleoside triphosphate pyrophosphohydrolase |
| 3715 | QRJS01000020.1 | GCA003471645_01036 | CDS | open | 43046-43594 | _na 182_aa | DUF4412 domain-containing protein | |
| 3716 | QRJS01000020.1 | GCA003471645_01037 | CDS | open | 43602-45881 | _na 759_aa | Alpha-1 2-mannosidase | |
| 3717 | QRJS01000020.1 | GCA003471645_01038 | CDS | open | 46010-47683 | _na 557_aa | Calcineurin-like phosphoesterase domain-containing protein | |
| 3718 | QRJS01000020.1 | GCA003471645_01039 | CDS | open | 47950-48327 | _na 125_aa | Dinitrogenase iron-molybdenum cofactor biosynthesis domain-containing protein | |
| 3719 | QRJS01000020.1 | GCA003471645_01040 | CDS | open | 48500-51178 | _na 892_aa | valine--tRNA ligase | |
| 3720 | QRJS01000020.1 | GCA003471645_01041 | CDS | open | 51254-52132 | _na 292_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 3721 | QRJS01000020.1 | GCA003471645_01042 | CDS | open | 52169-52615 | _na 148_aa | DUF4252 domain-containing protein | |
| 3722 | QRJS01000020.1 | GCA003471645_01043 | CDS | open | 52628-53095 | _na 155_aa | Tat pathway signal sequence domain protein | |
| 3723 | QRJS01000020.1 | GCA003471645_01044 | CDS | open | 53092-53598 | _na 168_aa | Sigma-70 region 2 | |
| 3724 | QRJS01000020.1 | GCA003471645_01045 | CDS | open | 54158-54253 | _na 31_aa | hypothetical protein | |
| 3725 | QRJS01000020.1 | GCA003471645_00987 | gene | open | 39-452 | |||
| 3726 | QRJS01000020.1 | GCA003471645_00988 | gene | open | 567-2186 | yheS | ||
| 3727 | QRJS01000020.1 | GCA003471645_00989 | gene | open | 2305-3195 | |||
| 3728 | QRJS01000020.1 | GCA003471645_00990 | gene | open | 3152-4258 | |||
| 3729 | QRJS01000020.1 | GCA003471645_00991 | gene | open | 5227-5832 | grpE | ||
| 3730 | QRJS01000020.1 | GCA003471645_00992 | gene | open | 5848-7032 | dnaJ | ||
| 3731 | QRJS01000020.1 | GCA003471645_00993 | gene | open | 7315-7962 | yjbH | ||
| 3732 | QRJS01000020.1 | GCA003471645_00994 | gene | open | 8036-9322 | |||
| 3733 | QRJS01000020.1 | GCA003471645_00995 | gene | open | 9417-10511 | |||
| 3734 | QRJS01000020.1 | GCA003471645_00996 | gene | open | 10561-11844 | |||
| 3735 | QRJS01000020.1 | GCA003471645_00997 | gene | open | 11932-13086 | galK | ||
| 3736 | QRJS01000020.1 | GCA003471645_00998 | gene | open | 13160-14329 | |||
| 3737 | QRJS01000020.1 | GCA003471645_00999 | gene | open | 14347-15522 | |||
| 3738 | QRJS01000020.1 | GCA003471645_01000 | gene | open | 15942-19118 | |||
| 3739 | QRJS01000020.1 | GCA003471645_01001 | gene | open | 19204-20391 | |||
| 3740 | QRJS01000020.1 | GCA003471645_01002 | gene | open | 20563-22251 | ettA | ||
| 3741 | QRJS01000020.1 | GCA003471645_01003 | gene | open | 22271-23425 | |||
| 3742 | QRJS01000020.1 | GCA003471645_01004 | gene | open | 23500-24321 | panB | ||
| 3743 | QRJS01000020.1 | GCA003471645_01005 | gene | open | 24386-25033 | |||
| 3744 | QRJS01000020.1 | GCA003471645_01006 | gene | open | 25205-25360 | |||
| 3745 | QRJS01000020.1 | GCA003471645_01007 | gene | open | 25488-26162 | |||
| 3746 | QRJS01000020.1 | GCA003471645_01008 | gene | open | 26159-27421 | |||
| 3747 | QRJS01000020.1 | GCA003471645_01009 | gene | open | 27499-28767 | |||
| 3748 | QRJS01000020.1 | GCA003471645_01010 | gene | open | 28773-29180 | |||
| 3749 | QRJS01000020.1 | GCA003471645_01011 | gene | open | 29194-29301 | |||
| 3750 | QRJS01000020.1 | GCA003471645_01012 | gene | open | 29346-30206 | rpoD | ||
| 3751 | QRJS01000020.1 | GCA003471645_01013 | gene | open | 30463-31959 | |||
| 3752 | QRJS01000020.1 | GCA003471645_01015 | gene | open | 32649-33965 | brkB | ||
| 3753 | QRJS01000020.1 | GCA003471645_01016 | gene | open | 34036-34641 | |||
| 3754 | QRJS01000020.1 | GCA003471645_01017 | gene | open | 34672-34887 | |||
| 3755 | QRJS01000020.1 | GCA003471645_01031 | gene | open | 36664-37830 | nspC | ||
| 3756 | QRJS01000020.1 | GCA003471645_01032 | gene | open | 37843-40197 | |||
| 3757 | QRJS01000020.1 | GCA003471645_01033 | gene | open | 40412-41776 | |||
| 3758 | QRJS01000020.1 | GCA003471645_01034 | gene | open | 41793-42068 | |||
| 3759 | QRJS01000020.1 | GCA003471645_01035 | gene | open | 42208-42993 | mazG | ||
| 3760 | QRJS01000020.1 | GCA003471645_01036 | gene | open | 43046-43594 | |||
| 3761 | QRJS01000020.1 | GCA003471645_01037 | gene | open | 43602-45881 | |||
| 3762 | QRJS01000020.1 | GCA003471645_01038 | gene | open | 46010-47683 | |||
| 3763 | QRJS01000020.1 | GCA003471645_01039 | gene | open | 47950-48327 | |||
| 3764 | QRJS01000020.1 | GCA003471645_01040 | gene | open | 48500-51178 | |||
| 3765 | QRJS01000020.1 | GCA003471645_01041 | gene | open | 51254-52132 | |||
| 3766 | QRJS01000020.1 | GCA003471645_01042 | gene | open | 52169-52615 | |||
| 3767 | QRJS01000020.1 | GCA003471645_01043 | gene | open | 52628-53095 | |||
| 3768 | QRJS01000020.1 | GCA003471645_01044 | gene | open | 53092-53598 | |||
| 3769 | QRJS01000020.1 | GCA003471645_01045 | gene | open | 54158-54253 | |||
| 3770 | QRJS01000020.1 | GCA003471645_01018 | gene | open | 35021-35093 | trnG | ||
| 3771 | QRJS01000020.1 | GCA003471645_01019 | gene | open | 35112-35187 | trnG | ||
| 3772 | QRJS01000020.1 | GCA003471645_01020 | gene | open | 35206-35281 | trnG | ||
| 3773 | QRJS01000020.1 | GCA003471645_01021 | gene | open | 35300-35375 | trnG | ||
| 3774 | QRJS01000020.1 | GCA003471645_01022 | gene | open | 35394-35469 | trnG | ||
| 3775 | QRJS01000020.1 | GCA003471645_01023 | gene | open | 35479-35559 | trnL | ||
| 3776 | QRJS01000020.1 | GCA003471645_01024 | gene | open | 35593-35668 | trnG | ||
| 3777 | QRJS01000020.1 | GCA003471645_01025 | gene | open | 35677-35760 | trnL | ||
| 3778 | QRJS01000020.1 | GCA003471645_01026 | gene | open | 35784-35867 | trnL | ||
| 3779 | QRJS01000020.1 | GCA003471645_01027 | gene | open | 35901-35973 | trnG | ||
| 3780 | QRJS01000020.1 | GCA003471645_01028 | gene | open | 35982-36065 | trnL | ||
| 3781 | QRJS01000020.1 | GCA003471645_01029 | gene | open | 36089-36172 | trnL | ||
| 3782 | QRJS01000020.1 | GCA003471645_01030 | gene | open | 36206-36278 | trnG | ||
| 3783 | QRJS01000020.1 | GCA003471645_01018 | tRNA | open | 35021-35093 | trnG | tRNA-Gly(gcc) | |
| 3784 | QRJS01000020.1 | GCA003471645_01019 | tRNA | open | 35112-35187 | trnG | tRNA-Gly(gcc) | |
| 3785 | QRJS01000020.1 | GCA003471645_01020 | tRNA | open | 35206-35281 | trnG | tRNA-Gly(gcc) | |
| 3786 | QRJS01000020.1 | GCA003471645_01021 | tRNA | open | 35300-35375 | trnG | tRNA-Gly(gcc) | |
| 3787 | QRJS01000020.1 | GCA003471645_01022 | tRNA | open | 35394-35469 | trnG | tRNA-Gly(gcc) | |
| 3788 | QRJS01000020.1 | GCA003471645_01023 | tRNA | open | 35479-35559 | trnL | tRNA-Leu(cag) | |
| 3789 | QRJS01000020.1 | GCA003471645_01024 | tRNA | open | 35593-35668 | trnG | tRNA-Gly(gcc) | |
| 3790 | QRJS01000020.1 | GCA003471645_01025 | tRNA | open | 35677-35760 | trnL | tRNA-Leu(gag) | |
| 3791 | QRJS01000020.1 | GCA003471645_01026 | tRNA | open | 35784-35867 | trnL | tRNA-Leu(cag) | |
| 3792 | QRJS01000020.1 | GCA003471645_01027 | tRNA | open | 35901-35973 | trnG | tRNA-Gly(gcc) | |
| 3793 | QRJS01000020.1 | GCA003471645_01028 | tRNA | open | 35982-36065 | trnL | tRNA-Leu(gag) | |
| 3794 | QRJS01000020.1 | GCA003471645_01029 | tRNA | open | 36089-36172 | trnL | tRNA-Leu(cag) | |
| 3795 | QRJS01000020.1 | GCA003471645_01030 | tRNA | open | 36206-36278 | trnG | tRNA-Gly(gcc) | |
| 3796 | QRJS01000021.1 | GCA003471645_01046 | CDS | open | 58-171 | _na 37_aa | hypothetical protein | |
| 3797 | QRJS01000021.1 | GCA003471645_01047 | CDS | open | 236-1855 | _na 539_aa | rluA | Pseudouridine synthase%2C RluA family |
| 3798 | QRJS01000021.1 | GCA003471645_01048 | CDS | open | 2190-3395 | _na 401_aa | fucP | L-fucose:H+ symporter permease |
| 3799 | QRJS01000021.1 | GCA003471645_01049 | CDS | open | 3409-4131 | _na 240_aa | yfnB | Putative HAD-hydrolase yfnB |
| 3800 | QRJS01000021.1 | GCA003471645_01050 | CDS | open | 4124-5131 | _na 335_aa | Transmembrane protein | |
| 3801 | QRJS01000021.1 | GCA003471645_01051 | CDS | open | 5131-6078 | _na 315_aa | CDP-alcohol phosphatidyltransferase family protein | |
| 3802 | QRJS01000021.1 | GCA003471645_01052 | CDS | open | 6078-6944 | _na 288_aa | ATP-grasp domain-containing protein | |
| 3803 | QRJS01000021.1 | GCA003471645_01053 | CDS | open | 7007-7714 | _na 235_aa | MobA-like NTP transferase domain-containing protein | |
| 3804 | QRJS01000021.1 | GCA003471645_01054 | CDS | open | 7716-8810 | _na 364_aa | pdxA | 4-hydroxythreonine-4-phosphate dehydrogenase PdxA |
| 3805 | QRJS01000021.1 | GCA003471645_01055 | CDS | open | 8813-9877 | _na 354_aa | DUF4837 domain-containing protein | |
| 3806 | QRJS01000021.1 | GCA003471645_01056 | CDS | open | 9891-10946 | _na 351_aa | rlmN | 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN |
| 3807 | QRJS01000021.1 | GCA003471645_01057 | CDS | open | 11036-13468 | _na 810_aa | Glycosyltransferase%2C group 2 family protein | |
| 3808 | QRJS01000021.1 | GCA003471645_01058 | CDS | open | 13474-14784 | _na 436_aa | lytB | Sporulation stage II protein D amidase enhancer LytB N-terminal domain-containing protein |
| 3809 | QRJS01000021.1 | GCA003471645_01059 | CDS | open | 14797-16065 | _na 422_aa | Beta-lactamase induction signal transducer | |
| 3810 | QRJS01000021.1 | GCA003471645_01060 | CDS | open | 16088-16984 | _na 298_aa | HTH lysR-type domain-containing protein | |
| 3811 | QRJS01000021.1 | GCA003471645_01061 | CDS | open | 16997-17578 | _na 193_aa | L-selectin | |
| 3812 | QRJS01000021.1 | GCA003471645_01062 | CDS | open | 17618-17998 | _na 126_aa | AAA-ATPase-like domain-containing protein | |
| 3813 | QRJS01000021.1 | GCA003471645_01063 | CDS | open | 17995-18120 | _na 41_aa | hypothetical protein | |
| 3814 | QRJS01000021.1 | GCA003471645_01064 | CDS | open | 18407-20995 | _na 862_aa | clpB | ATP-dependent chaperone ClpB |
| 3815 | QRJS01000021.1 | GCA003471645_01065 | CDS | open | 21109-22023 | _na 304_aa | Lysozyme M1 | |
| 3816 | QRJS01000021.1 | GCA003471645_01066 | CDS | open | 22185-23828 | _na 547_aa | diphosphate--fructose-6-phosphate 1-phosphotransferase | |
| 3817 | QRJS01000021.1 | GCA003471645_01067 | CDS | open | 23933-24169 | _na 78_aa | DUF6965 domain-containing protein | |
| 3818 | QRJS01000021.1 | GCA003471645_01068 | CDS | open | 24186-26540 | _na 784_aa | Bacterial surface antigen (D15) domain-containing protein | |
| 3819 | QRJS01000021.1 | GCA003471645_01069 | CDS | open | 26600-27358 | _na 252_aa | RNA methyltransferase | |
| 3820 | QRJS01000021.1 | GCA003471645_01070 | CDS | open | 27353-27679 | _na 108_aa | hypothetical protein | |
| 3821 | QRJS01000021.1 | GCA003471645_01071 | CDS | open | 27685-28545 | _na 286_aa | DUF4296 domain-containing protein | |
| 3822 | QRJS01000021.1 | GCA003471645_01072 | CDS | open | 28542-29180 | _na 212_aa | lipoprotein signal peptidase | |
| 3823 | QRJS01000021.1 | GCA003471645_01073 | CDS | open | 29301-29681 | _na 126_aa | dksA | Zinc finger DksA/TraR C4-type domain-containing protein |
| 3824 | QRJS01000021.1 | GCA003471645_01074 | CDS | open | 29745-33233 | _na 1162_aa | ileS | isoleucine--tRNA ligase |
| 3825 | QRJS01000021.1 | GCA003471645_01075 | CDS | open | 33361-33825 | _na 154_aa | Arsenate reductase | |
| 3826 | QRJS01000021.1 | GCA003471645_01076 | CDS | open | 33857-34060 | _na 67_aa | Sulfite exporter TauE/SafE family protein | |
| 3827 | QRJS01000021.1 | GCA003471645_01077 | CDS | open | 34073-34534 | _na 153_aa | Thioredoxin | |
| 3828 | QRJS01000021.1 | GCA003471645_01078 | CDS | open | 34597-34923 | _na 108_aa | Transcriptional regulator | |
| 3829 | QRJS01000021.1 | GCA003471645_01079 | CDS | open | 35272-36648 | _na 458_aa | Solute-binding protein family 3/N-terminal domain-containing protein | |
| 3830 | QRJS01000021.1 | GCA003471645_01080 | CDS | open | 36645-37256 | _na 203_aa | udk | uridine kinase |
| 3831 | QRJS01000021.1 | GCA003471645_01081 | CDS | open | 37327-37626 | _na 99_aa | Stress-response A/B barrel domain-containing protein | |
| 3832 | QRJS01000021.1 | GCA003471645_01082 | CDS | open | 37639-38124 | _na 161_aa | Thioesterase domain-containing protein | |
| 3833 | QRJS01000021.1 | GCA003471645_01083 | CDS | open | 38380-39231 | _na 283_aa | hisG | ATP phosphoribosyltransferase |
| 3834 | QRJS01000021.1 | GCA003471645_01084 | CDS | open | 39263-40540 | _na 425_aa | Histidinol dehydrogenase | |
| 3835 | QRJS01000021.1 | GCA003471645_01085 | CDS | open | 40543-41592 | _na 349_aa | hisC | histidinol-phosphate transaminase |
| 3836 | QRJS01000021.1 | GCA003471645_01086 | CDS | open | 41589-42710 | _na 373_aa | hisB | bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB |
| 3837 | QRJS01000021.1 | GCA003471645_01087 | CDS | open | 42778-43392 | _na 204_aa | DUF4923 domain-containing protein | |
| 3838 | QRJS01000021.1 | GCA003471645_01088 | CDS | open | 43460-44314 | _na 284_aa | nadC | carboxylating nicotinate-nucleotide diphosphorylase |
| 3839 | QRJS01000021.1 | GCA003471645_01089 | CDS | open | 44471-45322 | _na 283_aa | Putative membrane protein | |
| 3840 | QRJS01000021.1 | GCA003471645_01090 | CDS | open | 45355-45828 | _na 157_aa | rlmH | 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH |
| 3841 | QRJS01000021.1 | GCA003471645_01091 | CDS | open | 45834-46724 | _na 296_aa | Peptidoglycan hydrolase | |
| 3842 | QRJS01000021.1 | GCA003471645_01092 | CDS | open | 46866-47345 | _na 159_aa | cytidine deaminase | |
| 3843 | QRJS01000021.1 | GCA003471645_01093 | CDS | open | 47352-48167 | _na 271_aa | acyltransferase family protein | |
| 3844 | QRJS01000021.1 | GCA003471645_01046 | gene | open | 58-171 | |||
| 3845 | QRJS01000021.1 | GCA003471645_01047 | gene | open | 236-1855 | rluA | ||
| 3846 | QRJS01000021.1 | GCA003471645_01048 | gene | open | 2190-3395 | fucP | ||
| 3847 | QRJS01000021.1 | GCA003471645_01049 | gene | open | 3409-4131 | yfnB | ||
| 3848 | QRJS01000021.1 | GCA003471645_01050 | gene | open | 4124-5131 | |||
| 3849 | QRJS01000021.1 | GCA003471645_01051 | gene | open | 5131-6078 | |||
| 3850 | QRJS01000021.1 | GCA003471645_01052 | gene | open | 6078-6944 | |||
| 3851 | QRJS01000021.1 | GCA003471645_01053 | gene | open | 7007-7714 | |||
| 3852 | QRJS01000021.1 | GCA003471645_01054 | gene | open | 7716-8810 | pdxA | ||
| 3853 | QRJS01000021.1 | GCA003471645_01055 | gene | open | 8813-9877 | |||
| 3854 | QRJS01000021.1 | GCA003471645_01056 | gene | open | 9891-10946 | rlmN | ||
| 3855 | QRJS01000021.1 | GCA003471645_01057 | gene | open | 11036-13468 | |||
| 3856 | QRJS01000021.1 | GCA003471645_01058 | gene | open | 13474-14784 | lytB | ||
| 3857 | QRJS01000021.1 | GCA003471645_01059 | gene | open | 14797-16065 | |||
| 3858 | QRJS01000021.1 | GCA003471645_01060 | gene | open | 16088-16984 | |||
| 3859 | QRJS01000021.1 | GCA003471645_01061 | gene | open | 16997-17578 | |||
| 3860 | QRJS01000021.1 | GCA003471645_01062 | gene | open | 17618-17998 | |||
| 3861 | QRJS01000021.1 | GCA003471645_01063 | gene | open | 17995-18120 | |||
| 3862 | QRJS01000021.1 | GCA003471645_01064 | gene | open | 18407-20995 | clpB | ||
| 3863 | QRJS01000021.1 | GCA003471645_01065 | gene | open | 21109-22023 | |||
| 3864 | QRJS01000021.1 | GCA003471645_01066 | gene | open | 22185-23828 | |||
| 3865 | QRJS01000021.1 | GCA003471645_01067 | gene | open | 23933-24169 | |||
| 3866 | QRJS01000021.1 | GCA003471645_01068 | gene | open | 24186-26540 | |||
| 3867 | QRJS01000021.1 | GCA003471645_01069 | gene | open | 26600-27358 | |||
| 3868 | QRJS01000021.1 | GCA003471645_01070 | gene | open | 27353-27679 | |||
| 3869 | QRJS01000021.1 | GCA003471645_01071 | gene | open | 27685-28545 | |||
| 3870 | QRJS01000021.1 | GCA003471645_01072 | gene | open | 28542-29180 | |||
| 3871 | QRJS01000021.1 | GCA003471645_01073 | gene | open | 29301-29681 | dksA | ||
| 3872 | QRJS01000021.1 | GCA003471645_01074 | gene | open | 29745-33233 | ileS | ||
| 3873 | QRJS01000021.1 | GCA003471645_01075 | gene | open | 33361-33825 | |||
| 3874 | QRJS01000021.1 | GCA003471645_01076 | gene | open | 33857-34060 | |||
| 3875 | QRJS01000021.1 | GCA003471645_01077 | gene | open | 34073-34534 | |||
| 3876 | QRJS01000021.1 | GCA003471645_01078 | gene | open | 34597-34923 | |||
| 3877 | QRJS01000021.1 | GCA003471645_01079 | gene | open | 35272-36648 | |||
| 3878 | QRJS01000021.1 | GCA003471645_01080 | gene | open | 36645-37256 | udk | ||
| 3879 | QRJS01000021.1 | GCA003471645_01081 | gene | open | 37327-37626 | |||
| 3880 | QRJS01000021.1 | GCA003471645_01082 | gene | open | 37639-38124 | |||
| 3881 | QRJS01000021.1 | GCA003471645_01083 | gene | open | 38380-39231 | hisG | ||
| 3882 | QRJS01000021.1 | GCA003471645_01084 | gene | open | 39263-40540 | |||
| 3883 | QRJS01000021.1 | GCA003471645_01085 | gene | open | 40543-41592 | hisC | ||
| 3884 | QRJS01000021.1 | GCA003471645_01086 | gene | open | 41589-42710 | hisB | ||
| 3885 | QRJS01000021.1 | GCA003471645_01087 | gene | open | 42778-43392 | |||
| 3886 | QRJS01000021.1 | GCA003471645_01088 | gene | open | 43460-44314 | nadC | ||
| 3887 | QRJS01000021.1 | GCA003471645_01089 | gene | open | 44471-45322 | |||
| 3888 | QRJS01000021.1 | GCA003471645_01090 | gene | open | 45355-45828 | rlmH | ||
| 3889 | QRJS01000021.1 | GCA003471645_01091 | gene | open | 45834-46724 | |||
| 3890 | QRJS01000021.1 | GCA003471645_01092 | gene | open | 46866-47345 | |||
| 3891 | QRJS01000021.1 | GCA003471645_01093 | gene | open | 47352-48167 | |||
| 3892 | QRJS01000022.1 | GCA003471645_01094 | CDS | open | 56-2341 | _na 761_aa | TonB-dependent receptor | |
| 3893 | QRJS01000022.1 | GCA003471645_01096 | CDS | open | 2724-4367 | _na 547_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 3894 | QRJS01000022.1 | GCA003471645_01097 | CDS | open | 4430-5389 | _na 319_aa | Zinc ribbon domain-containing protein | |
| 3895 | QRJS01000022.1 | GCA003471645_01098 | CDS | open | 5386-7227 | _na 613_aa | yhbU | putative protease yhbU |
| 3896 | QRJS01000022.1 | GCA003471645_01099 | CDS | open | 7227-8150 | _na 307_aa | metA | homoserine O-succinyltransferase |
| 3897 | QRJS01000022.1 | GCA003471645_01100 | CDS | open | 8252-9145 | _na 297_aa | HTH lysR-type domain-containing protein | |
| 3898 | QRJS01000022.1 | GCA003471645_01101 | CDS | open | 9699-10619 | _na 306_aa | hypothetical protein | |
| 3899 | QRJS01000022.1 | GCA003471645_01102 | CDS | open | 10698-11873 | _na 391_aa | Outer membrane efflux protein | |
| 3900 | QRJS01000022.1 | GCA003471645_01103 | CDS | open | 11870-14983 | _na 1037_aa | czcA | Heavy metal efflux pump%2C CzcA family |
| 3901 | QRJS01000022.1 | GCA003471645_01104 | CDS | open | 14996-16150 | _na 384_aa | Efflux transporter%2C RND family%2C MFP subunit | |
| 3902 | QRJS01000022.1 | GCA003471645_01105 | CDS | open | 16232-16654 | _na 140_aa | Secreted protein | |
| 3903 | QRJS01000022.1 | GCA003471645_01106 | CDS | open | 17063-17737 | _na 224_aa | Peptidyl-prolyl cis-trans isomerase | |
| 3904 | QRJS01000022.1 | GCA003471645_01107 | CDS | open | 17752-19293 | _na 513_aa | gRS1 | glycine--tRNA ligase |
| 3905 | QRJS01000022.1 | GCA003471645_01108 | CDS | open | 19402-20199 | _na 265_aa | MBL fold metallo-hydrolase | |
| 3906 | QRJS01000022.1 | GCA003471645_01109 | CDS | open | 20196-21221 | _na 341_aa | murB | UDP-N-acetylmuramate dehydrogenase |
| 3907 | QRJS01000022.1 | GCA003471645_01110 | CDS | open | 21228-22055 | _na 275_aa | DUF4348 domain-containing protein | |
| 3908 | QRJS01000022.1 | GCA003471645_01111 | CDS | open | 22228-23247 | _na 339_aa | pheS | phenylalanine--tRNA ligase subunit alpha |
| 3909 | QRJS01000022.1 | GCA003471645_01112 | CDS | open | 23361-24560 | _na 399_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 3910 | QRJS01000022.1 | GCA003471645_01113 | CDS | open | 24567-25706 | _na 379_aa | DUF3352 domain-containing protein | |
| 3911 | QRJS01000022.1 | GCA003471645_01114 | CDS | open | 25785-26606 | _na 273_aa | Tetratricopeptide repeat protein | |
| 3912 | QRJS01000022.1 | GCA003471645_01115 | CDS | open | 26938-27747 | _na 269_aa | DUF4238 domain-containing protein | |
| 3913 | QRJS01000022.1 | GCA003471645_01116 | CDS | open | 27749-28909 | _na 386_aa | hypothetical protein | |
| 3914 | QRJS01000022.1 | GCA003471645_01117 | CDS | open | 28932-31817 | _na 961_aa | PD-(D/E)XK endonuclease-like domain-containing protein | |
| 3915 | QRJS01000022.1 | GCA003471645_01118 | CDS | open | 32102-33409 | _na 435_aa | mobV | MobV family relaxase |
| 3916 | QRJS01000022.1 | GCA003471645_01119 | CDS | open | 33676-34647 | _na 323_aa | dnaG | Zinc finger CHC2-type domain-containing protein |
| 3917 | QRJS01000022.1 | GCA003471645_01120 | CDS | open | 34689-35087 | _na 132_aa | hypothetical protein | |
| 3918 | QRJS01000022.1 | GCA003471645_01121 | CDS | open | 34899-36140 | _na 413_aa | SF3 helicase domain-containing protein | |
| 3919 | QRJS01000022.1 | GCA003471645_01122 | CDS | open | 36418-36801 | _na 127_aa | HTH crp-type domain-containing protein | |
| 3920 | QRJS01000022.1 | GCA003471645_01123 | CDS | open | 36814-38034 | _na 406_aa | xerD | Tyr recombinase domain-containing protein |
| 3921 | QRJS01000022.1 | GCA003471645_01124 | CDS | open | 38335-38820 | _na 161_aa | msrA | Peptide methionine sulfoxide reductase MsrA |
| 3922 | QRJS01000022.1 | GCA003471645_01125 | CDS | open | 38882-39943 | _na 353_aa | leuB | 3-isopropylmalate dehydrogenase |
| 3923 | QRJS01000022.1 | GCA003471645_01126 | CDS | open | 39956-41488 | _na 510_aa | Pyruvate carboxyltransferase domain-containing protein | |
| 3924 | QRJS01000022.1 | GCA003471645_01127 | CDS | open | 41507-42103 | _na 198_aa | 3-isopropylmalate dehydratase | |
| 3925 | QRJS01000022.1 | GCA003471645_01128 | CDS | open | 42116-43513 | _na 465_aa | leuC | 3-isopropylmalate dehydratase large subunit |
| 3926 | QRJS01000022.1 | GCA003471645_01129 | CDS | open | 43533-45029 | _na 498_aa | 2-isopropylmalate synthase | |
| 3927 | QRJS01000022.1 | GCA003471645_01130 | CDS | open | 45340-46512 | _na 390_aa | pncB | nicotinate phosphoribosyltransferase |
| 3928 | QRJS01000022.1 | GCA003471645_01131 | CDS | open | 46610-47932 | _na 440_aa | Alpha-L-fucosidase | |
| 3929 | QRJS01000022.1 | GCA003471645_01094 | gene | open | 56-2341 | |||
| 3930 | QRJS01000022.1 | GCA003471645_01096 | gene | open | 2724-4367 | abc-f | ||
| 3931 | QRJS01000022.1 | GCA003471645_01097 | gene | open | 4430-5389 | |||
| 3932 | QRJS01000022.1 | GCA003471645_01098 | gene | open | 5386-7227 | yhbU | ||
| 3933 | QRJS01000022.1 | GCA003471645_01099 | gene | open | 7227-8150 | metA | ||
| 3934 | QRJS01000022.1 | GCA003471645_01100 | gene | open | 8252-9145 | |||
| 3935 | QRJS01000022.1 | GCA003471645_01101 | gene | open | 9699-10619 | |||
| 3936 | QRJS01000022.1 | GCA003471645_01102 | gene | open | 10698-11873 | |||
| 3937 | QRJS01000022.1 | GCA003471645_01103 | gene | open | 11870-14983 | czcA | ||
| 3938 | QRJS01000022.1 | GCA003471645_01104 | gene | open | 14996-16150 | |||
| 3939 | QRJS01000022.1 | GCA003471645_01105 | gene | open | 16232-16654 | |||
| 3940 | QRJS01000022.1 | GCA003471645_01106 | gene | open | 17063-17737 | |||
| 3941 | QRJS01000022.1 | GCA003471645_01107 | gene | open | 17752-19293 | gRS1 | ||
| 3942 | QRJS01000022.1 | GCA003471645_01108 | gene | open | 19402-20199 | |||
| 3943 | QRJS01000022.1 | GCA003471645_01109 | gene | open | 20196-21221 | murB | ||
| 3944 | QRJS01000022.1 | GCA003471645_01110 | gene | open | 21228-22055 | |||
| 3945 | QRJS01000022.1 | GCA003471645_01111 | gene | open | 22228-23247 | pheS | ||
| 3946 | QRJS01000022.1 | GCA003471645_01112 | gene | open | 23361-24560 | |||
| 3947 | QRJS01000022.1 | GCA003471645_01113 | gene | open | 24567-25706 | |||
| 3948 | QRJS01000022.1 | GCA003471645_01114 | gene | open | 25785-26606 | |||
| 3949 | QRJS01000022.1 | GCA003471645_01115 | gene | open | 26938-27747 | |||
| 3950 | QRJS01000022.1 | GCA003471645_01116 | gene | open | 27749-28909 | |||
| 3951 | QRJS01000022.1 | GCA003471645_01117 | gene | open | 28932-31817 | |||
| 3952 | QRJS01000022.1 | GCA003471645_01118 | gene | open | 32102-33409 | mobV | ||
| 3953 | QRJS01000022.1 | GCA003471645_01119 | gene | open | 33676-34647 | dnaG | ||
| 3954 | QRJS01000022.1 | GCA003471645_01120 | gene | open | 34689-35087 | |||
| 3955 | QRJS01000022.1 | GCA003471645_01121 | gene | open | 34899-36140 | |||
| 3956 | QRJS01000022.1 | GCA003471645_01122 | gene | open | 36418-36801 | |||
| 3957 | QRJS01000022.1 | GCA003471645_01123 | gene | open | 36814-38034 | xerD | ||
| 3958 | QRJS01000022.1 | GCA003471645_01124 | gene | open | 38335-38820 | msrA | ||
| 3959 | QRJS01000022.1 | GCA003471645_01125 | gene | open | 38882-39943 | leuB | ||
| 3960 | QRJS01000022.1 | GCA003471645_01126 | gene | open | 39956-41488 | |||
| 3961 | QRJS01000022.1 | GCA003471645_01127 | gene | open | 41507-42103 | |||
| 3962 | QRJS01000022.1 | GCA003471645_01128 | gene | open | 42116-43513 | leuC | ||
| 3963 | QRJS01000022.1 | GCA003471645_01129 | gene | open | 43533-45029 | |||
| 3964 | QRJS01000022.1 | GCA003471645_01130 | gene | open | 45340-46512 | pncB | ||
| 3965 | QRJS01000022.1 | GCA003471645_01131 | gene | open | 46610-47932 | |||
| 3966 | QRJS01000022.1 | GCA003471645_01095 | gene | open | 2527-2599 | trnK | ||
| 3967 | QRJS01000022.1 | GCA003471645_01095 | tRNA | open | 2527-2599 | trnK | tRNA-Lys(ttt) | |
| 3968 | QRJS01000023.1 | GCA003471645_01132 | CDS | open | 57-2090 | _na 677_aa | rho | transcription termination factor Rho |
| 3969 | QRJS01000023.1 | GCA003471645_01133 | CDS | open | 2383-2766 | _na 127_aa | Enamine/imine deaminase | |
| 3970 | QRJS01000023.1 | GCA003471645_01134 | CDS | open | 2843-4051 | _na 402_aa | Transglutaminase-like domain-containing protein | |
| 3971 | QRJS01000023.1 | GCA003471645_01135 | CDS | open | 4064-4810 | _na 248_aa | MBL fold metallo-hydrolase | |
| 3972 | QRJS01000023.1 | GCA003471645_01136 | CDS | open | 4823-5200 | _na 125_aa | Aldoketomutase | |
| 3973 | QRJS01000023.1 | GCA003471645_01137 | CDS | open | 5235-6059 | _na 274_aa | DUF3805 domain-containing protein | |
| 3974 | QRJS01000023.1 | GCA003471645_01138 | CDS | open | 6100-7965 | _na 621_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 3975 | QRJS01000023.1 | GCA003471645_01139 | CDS | open | 8110-9828 | _na 572_aa | AMP-binding enzyme | |
| 3976 | QRJS01000023.1 | GCA003471645_01140 | CDS | open | 10000-11304 | _na 434_aa | Na+/H+ antiporter NhaC-like C-terminal domain-containing protein | |
| 3977 | QRJS01000023.1 | GCA003471645_01141 | CDS | open | 11360-11665 | _na 101_aa | DUF4286 domain-containing protein | |
| 3978 | QRJS01000023.1 | GCA003471645_01142 | CDS | open | 11662-12231 | _na 189_aa | ruvC | crossover junction endodeoxyribonuclease RuvC |
| 3979 | QRJS01000023.1 | GCA003471645_01143 | CDS | open | 12238-14244 | _na 668_aa | pulA | type I pullulanase |
| 3980 | QRJS01000023.1 | GCA003471645_01144 | CDS | open | 14294-15745 | _na 483_aa | ABC transporter domain-containing protein | |
| 3981 | QRJS01000023.1 | GCA003471645_01145 | CDS | open | 15828-16370 | _na 180_aa | Helix-turn-helix domain-containing protein | |
| 3982 | QRJS01000023.1 | GCA003471645_01146 | CDS | open | 16575-18395 | _na 606_aa | Fimbrillin family protein | |
| 3983 | QRJS01000023.1 | GCA003471645_01147 | CDS | open | 18521-19471 | _na 316_aa | Nitronate monooxygenase domain-containing protein | |
| 3984 | QRJS01000023.1 | GCA003471645_01148 | CDS | open | 19481-21190 | _na 569_aa | Serine protease | |
| 3985 | QRJS01000023.1 | GCA003471645_01149 | CDS | open | 21214-21963 | _na 249_aa | rlmB | 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB |
| 3986 | QRJS01000023.1 | GCA003471645_01150 | CDS | open | 21982-23649 | _na 555_aa | recN | DNA repair protein RecN |
| 3987 | QRJS01000023.1 | GCA003471645_01151 | CDS | open | 23656-24861 | _na 401_aa | coaBC | bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC |
| 3988 | QRJS01000023.1 | GCA003471645_01152 | CDS | open | 24874-25650 | _na 258_aa | dnaQ | Exonuclease |
| 3989 | QRJS01000023.1 | GCA003471645_01153 | CDS | open | 25675-26799 | _na 374_aa | dnaN | DNA polymerase III subunit beta |
| 3990 | QRJS01000023.1 | GCA003471645_01154 | CDS | open | 26976-27347 | _na 123_aa | DUF3127 domain-containing protein | |
| 3991 | QRJS01000023.1 | GCA003471645_01155 | CDS | open | 27638-27919 | _na 93_aa | hypothetical protein | |
| 3992 | QRJS01000023.1 | GCA003471645_01156 | CDS | open | 28022-28960 | _na 312_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 3993 | QRJS01000023.1 | GCA003471645_01157 | CDS | open | 28957-29787 | _na 276_aa | Type-2 restriction enzyme | |
| 3994 | QRJS01000023.1 | GCA003471645_01158 | CDS | open | 29791-31116 | _na 441_aa | HD domain-containing protein | |
| 3995 | QRJS01000023.1 | GCA003471645_01159 | CDS | open | 31131-32024 | _na 297_aa | Methyltransferase | |
| 3996 | QRJS01000023.1 | GCA003471645_01160 | CDS | open | 32199-32573 | _na 124_aa | Transcriptional regulator BlaI/MecI/CopY family | |
| 3997 | QRJS01000023.1 | GCA003471645_01161 | CDS | open | 32587-34482 | _na 631_aa | tonB | TonB C-terminal domain-containing protein |
| 3998 | QRJS01000023.1 | GCA003471645_01162 | CDS | open | 34564-36057 | _na 497_aa | SAF domain-containing protein | |
| 3999 | QRJS01000023.1 | GCA003471645_01163 | CDS | open | 36079-37155 | _na 358_aa | HTH lacI-type domain-containing protein | |
| 4000 | QRJS01000023.1 | GCA003471645_01164 | CDS | open | 37373-38395 | _na 340_aa | rbsK | 2-dehydro-3-deoxygluconokinase |

