HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Neisseria lactamica (GCA_003492425.1)

Select a Genome:
BAKTA Annotations for GCA_003492425.1
Genome Selected: Neisseria lactamica
ContigsBases CDSrRNA tmRNAtRNA
50 2303282 2179 3 1 54
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4507 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 4507 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 QQMH01000001.1 GCA003492425_00063 gene open 63728-64315
502 QQMH01000001.1 GCA003492425_00064 gene open 64503-64700 iscX
503 QQMH01000001.1 GCA003492425_00065 gene open 64764-65165
504 QQMH01000001.1 GCA003492425_00066 gene open 65367-66326 accA
505 QQMH01000001.1 GCA003492425_00067 gene open 66394-67704
506 QQMH01000001.1 GCA003492425_00068 gene open 67755-68540
507 QQMH01000001.1 GCA003492425_00069 gene open 68550-68747
508 QQMH01000001.1 GCA003492425_00070 gene open 68760-69062
509 QQMH01000001.1 GCA003492425_00071 gene open 69124-70500 mpl
510 QQMH01000001.1 GCA003492425_00072 gene open 70707-71759 bioB
511 QQMH01000001.1 GCA003492425_00073 gene open 72030-72305
512 QQMH01000001.1 GCA003492425_00074 gene open 72451-73683 capA
513 QQMH01000001.1 GCA003492425_00075 gene open 73735-75594 ilvD
514 QQMH01000001.1 GCA003492425_00076 gene open 75766-77535 cysI
515 QQMH01000001.1 GCA003492425_00077 gene open 77562-79376 cysJ
516 QQMH01000001.1 GCA003492425_00078 gene open 79373-80659 cysN
517 QQMH01000001.1 GCA003492425_00079 gene open 80698-81621 cysD
518 QQMH01000001.1 GCA003492425_00080 gene open 81659-82399 cysH1
519 QQMH01000001.1 GCA003492425_00081 gene open 82410-83852 cysG
520 QQMH01000001.1 GCA003492425_00082 gene open 84150-84806 cytB
521 QQMH01000001.1 GCA003492425_00083 gene open 84871-85761 nnrD1
522 QQMH01000001.1 GCA003492425_00084 gene open 85878-87689 typA
523 QQMH01000001.1 GCA003492425_00085 gene open 88163-94462
524 QQMH01000001.1 GCA003492425_00086 gene open 94603-94809 alpA
525 QQMH01000001.1 GCA003492425_00087 gene open 94929-95894
526 QQMH01000001.1 GCA003492425_00088 gene open 95866-96096
527 QQMH01000001.1 GCA003492425_00089 gene open 96093-96359
528 QQMH01000001.1 GCA003492425_00090 gene open 96341-97060
529 QQMH01000001.1 GCA003492425_00091 gene open 97285-98130 bet
530 QQMH01000001.1 GCA003492425_00092 gene open 98134-98775 tolB
531 QQMH01000001.1 GCA003492425_00093 gene open 98772-99194
532 QQMH01000001.1 GCA003492425_00094 gene open 99184-99510
533 QQMH01000001.1 GCA003492425_00095 gene open 99653-99853
534 QQMH01000001.1 GCA003492425_00096 gene open 100105-100593
535 QQMH01000001.1 GCA003492425_00097 gene open 100586-101728 higA
536 QQMH01000001.1 GCA003492425_00098 gene open 101725-102015
537 QQMH01000001.1 GCA003492425_00099 gene open 102098-102802
538 QQMH01000001.1 GCA003492425_00100 gene open 103213-104127
539 QQMH01000001.1 GCA003492425_00101 gene open 104140-104916 dnaC
540 QQMH01000001.1 GCA003492425_00102 gene open 104909-105154
541 QQMH01000001.1 GCA003492425_00103 gene open 105228-105632
542 QQMH01000001.1 GCA003492425_00104 gene open 105957-106106
543 QQMH01000001.1 GCA003492425_00105 gene open 106135-106596
544 QQMH01000001.1 GCA003492425_00106 gene open 106596-106973 rusA
545 QQMH01000001.1 GCA003492425_00107 gene open 106970-107368 ninB
546 QQMH01000001.1 GCA003492425_00108 gene open 107368-107892
547 QQMH01000001.1 GCA003492425_00109 gene open 108164-108574
548 QQMH01000001.1 GCA003492425_00110 gene open 108579-109745
549 QQMH01000001.1 GCA003492425_00111 gene open 109924-111897
550 QQMH01000001.1 GCA003492425_00112 gene open 111979-112263
551 QQMH01000001.1 GCA003492425_00113 gene open 112310-113125
552 QQMH01000001.1 GCA003492425_00114 gene open 113122-115251
553 QQMH01000001.1 GCA003492425_00115 gene open 115255-115734
554 QQMH01000001.1 GCA003492425_00116 gene open 115739-116737
555 QQMH01000001.1 GCA003492425_00117 gene open 117087-117329
556 QQMH01000001.1 GCA003492425_00118 gene open 117482-117775
557 QQMH01000001.1 GCA003492425_00119 gene open 117834-118166
558 QQMH01000001.1 GCA003492425_00120 gene open 118168-118566
559 QQMH01000001.1 GCA003492425_00121 gene open 118550-118990
560 QQMH01000001.1 GCA003492425_00122 gene open 118980-119360
561 QQMH01000001.1 GCA003492425_00123 gene open 119345-119824
562 QQMH01000001.1 GCA003492425_00124 gene open 119836-121311
563 QQMH01000001.1 GCA003492425_00125 gene open 121375-121683
564 QQMH01000001.1 GCA003492425_00127 gene open 121997-122779
565 QQMH01000001.1 GCA003492425_00128 gene open 122880-123320
566 QQMH01000001.1 GCA003492425_00129 gene open 123322-123768
567 QQMH01000001.1 GCA003492425_00130 gene open 123991-124167
568 QQMH01000001.1 GCA003492425_00131 gene open 124200-126872
569 QQMH01000001.1 GCA003492425_00132 gene open 126992-127099
570 QQMH01000001.1 GCA003492425_00133 gene open 127163-127822
571 QQMH01000001.1 GCA003492425_00134 gene open 127943-128047
572 QQMH01000001.1 GCA003492425_00135 gene open 128135-128284
573 QQMH01000001.1 GCA003492425_00136 gene open 128296-128592
574 QQMH01000001.1 GCA003492425_00137 gene open 128582-129469
575 QQMH01000001.1 GCA003492425_00138 gene open 129447-130154
576 QQMH01000001.1 GCA003492425_00139 gene open 130175-130969
577 QQMH01000001.1 GCA003492425_00141 gene open 131552-131710
578 QQMH01000001.1 GCA003492425_00142 gene open 131707-132081
579 QQMH01000001.1 GCA003492425_00143 gene open 132205-133383
580 QQMH01000001.1 GCA003492425_00144 gene open 133380-134012
581 QQMH01000001.1 GCA003492425_00145 gene open 134016-135755
582 QQMH01000001.1 GCA003492425_00146 gene open 136161-136463 brnA
583 QQMH01000001.1 GCA003492425_00147 gene open 136435-136722 brnT
584 QQMH01000001.1 GCA003492425_00148 gene open 136802-137395
585 QQMH01000001.1 GCA003492425_00149 gene open 137687-138166
586 QQMH01000001.1 GCA003492425_00150 gene open 138163-138363
587 QQMH01000001.1 GCA003492425_00151 gene open 138353-138727
588 QQMH01000001.1 GCA003492425_00152 gene open 138732-138995
589 QQMH01000001.1 GCA003492425_00153 gene open 139015-139554
590 QQMH01000001.1 GCA003492425_00154 gene open 139555-139896
591 QQMH01000001.1 GCA003492425_00155 gene open 139838-140053 lysC
592 QQMH01000001.1 GCA003492425_00156 gene open 140322-140453
593 QQMH01000001.1 GCA003492425_00157 gene open 140573-141418
594 QQMH01000001.1 GCA003492425_00158 gene open 141701-142123
595 QQMH01000001.1 GCA003492425_00159 gene open 142613-142780
596 QQMH01000001.1 GCA003492425_00160 gene open 143364-143540 copG
597 QQMH01000001.1 GCA003492425_00161 gene open 143544-143831 copG
598 QQMH01000001.1 GCA003492425_00162 gene open 143847-144227 yifN
599 QQMH01000001.1 GCA003492425_00163 gene open 144371-145582
600 QQMH01000001.1 GCA003492425_00167 gene open 146184-148559 rnr
601 QQMH01000001.1 GCA003492425_00168 gene open 148893-150356 guaB
602 QQMH01000001.1 GCA003492425_00169 gene open 150497-153055 glnD
603 QQMH01000001.1 GCA003492425_00170 gene open 153104-153424 hipB
604 QQMH01000001.1 GCA003492425_00172 gene open 153748-154221 bfr
605 QQMH01000001.1 GCA003492425_00173 gene open 154249-154713 bfr
606 QQMH01000001.1 GCA003492425_00174 gene open 155288-155755 hlyC
607 QQMH01000001.1 GCA003492425_00175 gene open 155909-156151
608 QQMH01000001.1 GCA003492425_00176 gene open 156148-156297
609 QQMH01000001.1 GCA003492425_00177 gene open 156294-156512
610 QQMH01000001.1 GCA003492425_00178 gene open 156509-158464
611 QQMH01000001.1 GCA003492425_00179 gene open 158489-158860
612 QQMH01000001.1 GCA003492425_00180 gene open 158702-163282
613 QQMH01000001.1 GCA003492425_00181 gene open 164022-164525
614 QQMH01000001.1 GCA003492425_00182 gene open 165161-165895
615 QQMH01000001.1 GCA003492425_00183 gene open 165846-166739 tniB
616 QQMH01000001.1 GCA003492425_00184 gene open 166736-167758 tniQ
617 QQMH01000001.1 GCA003492425_00185 gene open 167827-168099
618 QQMH01000001.1 GCA003492425_00186 gene open 168096-168563
619 QQMH01000001.1 GCA003492425_00187 gene open 168861-170594 tnsE
620 QQMH01000001.1 GCA003492425_00188 gene open 170673-171656 lipA
621 QQMH01000001.1 GCA003492425_00189 gene open 171649-172272 lipB
622 QQMH01000001.1 GCA003492425_00190 gene open 172274-172549 ybeD
623 QQMH01000001.1 GCA003492425_00191 gene open 172734-173804 perM
624 QQMH01000001.1 GCA003492425_00192 gene open 174100-174675
625 QQMH01000001.1 GCA003492425_00193 gene open 174777-175724
626 QQMH01000001.1 GCA003492425_00194 gene open 175739-176146 ybbJ
627 QQMH01000001.1 GCA003492425_00195 gene open 176227-176886 ung
628 QQMH01000001.1 GCA003492425_00196 gene open 176961-177320
629 QQMH01000001.1 GCA003492425_00197 gene open 177900-178415 tfpC
630 QQMH01000001.1 GCA003492425_00198 gene open 178872-180794 abc-f
631 QQMH01000001.1 GCA003492425_00199 gene open 180870-181241 rodA
632 QQMH01000001.1 GCA003492425_00200 gene open 181435-182742
633 QQMH01000001.1 GCA003492425_00201 gene open 182735-183169
634 QQMH01000001.1 GCA003492425_00202 gene open 183322-183591 hupB
635 QQMH01000001.1 GCA003492425_00203 gene open 183775-186225 lon
636 QQMH01000001.1 GCA003492425_00204 gene open 186709-187812
637 QQMH01000001.1 GCA003492425_00205 gene open 187840-189585 recD
638 QQMH01000001.1 GCA003492425_00206 gene open 189653-190348 lolD
639 QQMH01000001.1 GCA003492425_00207 gene open 190341-191588 lolC
640 QQMH01000001.1 GCA003492425_00208 gene open 191814-192092
641 QQMH01000001.1 GCA003492425_00209 gene open 192148-192765 recR
642 QQMH01000001.1 GCA003492425_00210 gene open 192832-194370 surA
643 QQMH01000001.1 GCA003492425_00211 gene open 194451-194870
644 QQMH01000001.1 GCA003492425_00212 gene open 194955-196583 uup
645 QQMH01000001.1 GCA003492425_00213 gene open 196663-197916 cca
646 QQMH01000001.1 GCA003492425_00214 gene open 198036-198344
647 QQMH01000001.1 GCA003492425_00215 gene open 198426-199457 ruvB
648 QQMH01000001.1 GCA003492425_00216 gene open 199533-200216 rpe
649 QQMH01000001.1 GCA003492425_00217 gene open 200362-200796 cpxP
650 QQMH01000001.1 GCA003492425_00218 gene open 200809-201672 atu1564
651 QQMH01000001.1 GCA003492425_00219 gene open 201680-202297
652 QQMH01000001.1 GCA003492425_00220 gene open 202465-203079 mobA
653 QQMH01000001.1 GCA003492425_00221 gene open 203288-205060
654 QQMH01000001.1 GCA003492425_00222 gene open 205057-205713 citB
655 QQMH01000001.1 GCA003492425_00223 gene open 205826-209218
656 QQMH01000001.1 GCA003492425_00224 gene open 209384-210418 purM
657 QQMH01000001.1 GCA003492425_00226 gene open 211170-211844
658 QQMH01000001.1 GCA003492425_00227 gene open 211837-212430 ribA
659 QQMH01000001.1 GCA003492425_00228 gene open 212758-213084
660 QQMH01000001.1 GCA003492425_00229 gene open 213116-213772
661 QQMH01000001.1 GCA003492425_00230 gene open 213989-215326 ribBA
662 QQMH01000001.1 GCA003492425_00231 gene open 215469-215627
663 QQMH01000001.1 GCA003492425_00232 gene open 215629-216000
664 QQMH01000001.1 GCA003492425_00233 gene open 216109-217419 rarA
665 QQMH01000001.1 GCA003492425_00234 gene open 217639-218199
666 QQMH01000001.1 GCA003492425_00235 gene open 218252-221680
667 QQMH01000001.1 GCA003492425_00236 gene open 221984-222355
668 QQMH01000001.1 GCA003492425_00237 gene open 222428-223837 thrC
669 QQMH01000001.1 GCA003492425_00238 gene open 223884-224678
670 QQMH01000001.1 GCA003492425_00239 gene open 224866-225642 fpr
671 QQMH01000001.1 GCA003492425_00240 gene open 226306-228786 zntA
672 QQMH01000001.1 GCA003492425_00241 gene open 228783-229961 hflX
673 QQMH01000001.1 GCA003492425_00242 gene open 229966-231246 ykwD
674 QQMH01000001.1 GCA003492425_00243 gene open 231399-232124 queH
675 QQMH01000001.1 GCA003492425_00244 gene open 232197-232874 radC
676 QQMH01000001.1 GCA003492425_00245 gene open 232998-234347 gshA
677 QQMH01000001.1 GCA003492425_00246 gene open 234607-236016 leuC
678 QQMH01000001.1 GCA003492425_00247 gene open 236112-236366
679 QQMH01000001.1 GCA003492425_00248 gene open 236308-237069 leuD
680 QQMH01000001.1 GCA003492425_00249 gene open 237141-237914
681 QQMH01000001.1 GCA003492425_00250 gene open 237911-239023
682 QQMH01000001.1 GCA003492425_00251 gene open 239101-240171 leuB
683 QQMH01000001.1 GCA003492425_00252 gene open 240334-240897 yceI
684 QQMH01000001.1 GCA003492425_00253 gene open 241239-242636 aspA
685 QQMH01000001.1 GCA003492425_00254 gene open 242708-243583
686 QQMH01000001.1 GCA003492425_00255 gene open 243585-244277
687 QQMH01000001.1 GCA003492425_00256 gene open 244299-244778 ybaK
688 QQMH01000001.1 GCA003492425_00257 gene open 244853-245215 ridA
689 QQMH01000001.1 GCA003492425_00258 gene open 245247-246113 ygfZ
690 QQMH01000001.1 GCA003492425_00259 gene open 246206-247165 ttcA
691 QQMH01000001.1 GCA003492425_00260 gene open 247259-250198 pM0699
692 QQMH01000001.1 GCA003492425_00261 gene open 250211-252154
693 QQMH01000001.1 GCA003492425_00262 gene open 252270-252827 ppiB
694 QQMH01000001.1 GCA003492425_00263 gene open 252892-253818 yejR
695 QQMH01000001.1 GCA003492425_00264 gene open 253806-254282 fur
696 QQMH01000001.1 GCA003492425_00265 gene open 254506-255018 wzb
697 QQMH01000001.1 GCA003492425_00266 gene open 255026-256132
698 QQMH01000001.1 GCA003492425_00267 gene open 256214-257842
699 QQMH01000001.1 GCA003492425_00268 gene open 258055-263280 recQ
700 QQMH01000001.1 GCA003492425_00269 gene open 263372-263584 copZ
701 QQMH01000001.1 GCA003492425_00270 gene open 263731-264888
702 QQMH01000001.1 GCA003492425_00271 gene open 265017-266453 dltB
703 QQMH01000001.1 GCA003492425_00272 gene open 266464-267450 patB
704 QQMH01000001.1 GCA003492425_00273 gene open 267447-268637 tesA
705 QQMH01000001.1 GCA003492425_00274 gene open 268842-270395 menE
706 QQMH01000001.1 GCA003492425_00275 gene open 270485-272512 betT
707 QQMH01000001.1 GCA003492425_00276 gene open 272810-274807
708 QQMH01000001.1 GCA003492425_00277 gene open 275034-276125 mltB
709 QQMH01000001.1 GCA003492425_00278 gene open 276265-277692 caiA
710 QQMH01000001.1 GCA003492425_00279 gene open 277986-278135 yhhA
711 QQMH01000001.1 GCA003492425_00280 gene open 278145-279254
712 QQMH01000001.1 GCA003492425_00281 gene open 279251-279838 yhhC
713 QQMH01000001.1 GCA003492425_00282 gene open 280299-283793 mfd
714 QQMH01000001.1 GCA003492425_00283 gene open 283865-284320
715 QQMH01000001.1 GCA003492425_00284 gene open 284482-284865 panD
716 QQMH01000001.1 GCA003492425_00285 gene open 284887-285729 kdsA
717 QQMH01000001.1 GCA003492425_00286 gene open 285744-286184
718 QQMH01000001.1 GCA003492425_00287 gene open 286229-287515 eno
719 QQMH01000001.1 GCA003492425_00288 gene open 287530-287808 ftsB
720 QQMH01000001.1 GCA003492425_00289 gene open 287849-288139 yfaE
721 QQMH01000001.1 GCA003492425_00290 gene open 288260-289414 nrdB
722 QQMH01000001.1 GCA003492425_00291 gene open 289608-290531
723 QQMH01000001.1 GCA003492425_00292 gene open 290567-292846 nrdA
724 QQMH01000001.1 GCA003492425_00293 gene open 293373-293699
725 QQMH01000001.1 GCA003492425_00294 gene open 293964-294731 plsC
726 QQMH01000001.1 GCA003492425_00295 gene open 294819-295646 mutM
727 QQMH01000001.1 GCA003492425_00296 gene open 295697-296362
728 QQMH01000001.1 GCA003492425_00297 gene open 296539-298500
729 QQMH01000001.1 GCA003492425_00298 gene open 298568-299260 rsuA
730 QQMH01000001.1 GCA003492425_00299 gene open 299800-301164 yocR
731 QQMH01000001.1 GCA003492425_00300 gene open 301409-302065 cmk
732 QQMH01000001.1 GCA003492425_00301 gene open 302221-303906 rpsA
733 QQMH01000001.1 GCA003492425_00302 gene open 303917-304231 ihfB
734 QQMH01000001.1 GCA003492425_00303 gene open 304429-304836 soxR
735 QQMH01000001.1 GCA003492425_00304 gene open 304957-306093 frmA
736 QQMH01000001.1 GCA003492425_00305 gene open 306102-306929 fghA
737 QQMH01000001.1 GCA003492425_00306 gene open 307469-308611 zapE
738 QQMH01000001.1 GCA003492425_00307 gene open 308670-309095 ndk
739 QQMH01000001.1 GCA003492425_00308 gene open 309231-310325 rlmN
740 QQMH01000001.1 GCA003492425_00309 gene open 310328-311089 pilW
741 QQMH01000001.1 GCA003492425_00310 gene open 311105-312370 ispG
742 QQMH01000001.1 GCA003492425_00311 gene open 312423-313043 clpP
743 QQMH01000001.1 GCA003492425_00312 gene open 313131-314441 tig
744 QQMH01000001.1 GCA003492425_00313 gene open 314647-317082
745 QQMH01000001.1 GCA003492425_00314 gene open 317283-318500 uraA
746 QQMH01000001.1 GCA003492425_00315 gene open 318672-319154
747 QQMH01000001.1 GCA003492425_00316 gene open 319718-320464 pssA
748 QQMH01000001.1 GCA003492425_00317 gene open 320465-321271
749 QQMH01000001.1 GCA003492425_00318 gene open 321461-321913 rplI
750 QQMH01000001.1 GCA003492425_00319 gene open 321930-322160 rpsR
751 QQMH01000001.1 GCA003492425_00320 gene open 322167-322469 priB
752 QQMH01000001.1 GCA003492425_00321 gene open 322470-322838 rpsF
753 QQMH01000001.1 GCA003492425_00322 gene open 322994-323944 trxB
754 QQMH01000001.1 GCA003492425_00323 gene open 324083-326260 zntA
755 QQMH01000001.1 GCA003492425_00324 gene open 326324-328210 uvrC
756 QQMH01000001.1 GCA003492425_00325 gene open 328327-329730 tPR
757 QQMH01000001.1 GCA003492425_00326 gene open 329712-330557 trmB
758 QQMH01000001.1 GCA003492425_00327 gene open 330795-331328
759 QQMH01000001.1 GCA003492425_00328 gene open 331492-331974
760 QQMH01000001.1 GCA003492425_00329 gene open 332012-334039 uvrB
761 QQMH01000001.1 GCA003492425_00330 gene open 334149-334970
762 QQMH01000001.1 GCA003492425_00331 gene open 335031-336506 ctpA
763 QQMH01000001.1 GCA003492425_00332 gene open 336642-338393
764 QQMH01000001.1 GCA003492425_00333 gene open 338588-339145 creA
765 QQMH01000001.1 GCA003492425_00334 gene open 339297-339845
766 QQMH01000001.1 GCA003492425_00335 gene open 339838-340293 ruvX
767 QQMH01000001.1 GCA003492425_00336 gene open 340303-340959 ycgM
768 QQMH01000001.1 GCA003492425_00337 gene open 341267-341965
769 QQMH01000001.1 GCA003492425_00338 gene open 342423-342662
770 QQMH01000001.1 GCA003492425_00339 gene open 342807-344675 proS
771 QQMH01000001.1 GCA003492425_00340 gene open 344852-345031
772 QQMH01000001.1 GCA003492425_00341 gene open 345215-347878 aceE
773 QQMH01000001.1 GCA003492425_00342 gene open 348028-349611 aceF
774 QQMH01000001.1 GCA003492425_00343 gene open 349688-351472 lpdA
775 QQMH01000001.1 GCA003492425_00344 gene open 351748-353298 ydgA
776 QQMH01000001.1 GCA003492425_00345 gene open 353422-355734
777 QQMH01000001.1 GCA003492425_00346 gene open 356320-357105 suhB
778 QQMH01000001.1 GCA003492425_00347 gene open 357281-358096 trmJ
779 QQMH01000001.1 GCA003492425_00348 gene open 358100-359011
780 QQMH01000001.1 GCA003492425_00349 gene open 359047-360303 rsmB
781 QQMH01000001.1 GCA003492425_00350 gene open 360799-361233
782 QQMH01000001.1 GCA003492425_00351 gene open 361282-362625 adhE
783 QQMH01000001.1 GCA003492425_00352 gene open 362630-363283 marC
784 QQMH01000001.1 GCA003492425_00353 gene open 363433-363723 gatC
785 QQMH01000001.1 GCA003492425_00354 gene open 363786-365231 gatA
786 QQMH01000001.1 GCA003492425_00355 gene open 365228-366160 virK
787 QQMH01000001.1 GCA003492425_00356 gene open 366203-367633 gatB
788 QQMH01000001.1 GCA003492425_00357 gene open 367725-368735 fdx
789 QQMH01000001.1 GCA003492425_00358 gene open 368765-369283
790 QQMH01000001.1 GCA003492425_00359 gene open 369394-369753
791 QQMH01000001.1 GCA003492425_00360 gene open 370129-370761 pdxH
792 QQMH01000001.1 GCA003492425_00361 gene open 371127-372176 rsuA
793 QQMH01000001.1 GCA003492425_00362 gene open 372245-373786
794 QQMH01000001.1 GCA003492425_00363 gene open 374492-375847 xseA
795 QQMH01000001.1 GCA003492425_00364 gene open 376074-376865 nadE
796 QQMH01000001.1 GCA003492425_00365 gene open 376934-377407 dnrN
797 QQMH01000001.1 GCA003492425_00366 gene open 377706-378038 trxA
798 QQMH01000001.1 GCA003492425_00367 gene open 378090-379037 rlmK
799 QQMH01000001.1 GCA003492425_00368 gene open 379365-380753 srmB
800 QQMH01000001.1 GCA003492425_00369 gene open 381319-381873
801 QQMH01000001.1 GCA003492425_00370 gene open 381958-382458
802 QQMH01000001.1 GCA003492425_00371 gene open 382861-384054 argD
803 QQMH01000001.1 GCA003492425_00372 gene open 384161-385405 clpX
804 QQMH01000001.1 GCA003492425_00373 gene open 385588-385959 rbfA
805 QQMH01000001.1 GCA003492425_00374 gene open 385970-386494
806 QQMH01000001.1 GCA003492425_00375 gene open 386552-387472 truB
807 QQMH01000001.1 GCA003492425_00376 gene open 387798-388286
808 QQMH01000001.1 GCA003492425_00377 gene open 388607-389890
809 QQMH01000001.1 GCA003492425_00378 gene open 389880-392651 resIII
810 QQMH01000001.1 GCA003492425_00379 gene open 392792-393964 lldD
811 QQMH01000001.1 GCA003492425_00380 gene open 394254-394700 iscR
812 QQMH01000001.1 GCA003492425_00381 gene open 394729-395943 iscS
813 QQMH01000001.1 GCA003492425_00382 gene open 396023-396151
814 QQMH01000001.1 GCA003492425_00383 gene open 396218-396604 iscU
815 QQMH01000001.1 GCA003492425_00384 gene open 396691-397011 iscA
816 QQMH01000001.1 GCA003492425_00385 gene open 396971-397192 arfA
817 QQMH01000001.1 GCA003492425_00386 gene open 397274-397774 hscB
818 QQMH01000001.1 GCA003492425_00387 gene open 397871-400609 gyrA
819 QQMH01000001.1 GCA003492425_00388 gene open 401089-403179
820 QQMH01000001.1 GCA003492425_00389 gene open 403820-415009
821 QQMH01000001.1 GCA003492425_00390 gene open 415369-415539 norV
822 QQMH01000001.1 GCA003492425_00391 gene open 416114-417205 caiA
823 QQMH01000001.1 GCA003492425_00392 gene open 417341-417889 yciW
824 QQMH01000001.1 GCA003492425_00393 gene open 418039-418410
825 QQMH01000001.1 GCA003492425_00394 gene open 418593-420284 dld
826 QQMH01000001.1 GCA003492425_00395 gene open 420381-420800
827 QQMH01000001.1 GCA003492425_00396 gene open 420915-421286
828 QQMH01000001.1 GCA003492425_00398 gene open 421283-425203 glcD
829 QQMH01000001.1 GCA003492425_00399 gene open 425433-426434
830 QQMH01000001.1 GCA003492425_00400 gene open 426561-426740
831 QQMH01000001.1 GCA003492425_00401 gene open 426914-427057
832 QQMH01000001.1 GCA003492425_00402 gene open 427193-427669 greA
833 QQMH01000001.1 GCA003492425_00403 gene open 428061-429362 aroA
834 QQMH01000001.1 GCA003492425_00404 gene open 429440-429979
835 QQMH01000001.1 GCA003492425_00405 gene open 430035-431558
836 QQMH01000001.1 GCA003492425_00406 gene open 431660-433066
837 QQMH01000001.1 GCA003492425_00407 gene open 433350-434129 glpC
838 QQMH01000001.1 GCA003492425_00408 gene open 434126-434827 lutC
839 QQMH01000001.1 GCA003492425_00409 gene open 434824-436278 lutB
840 QQMH01000001.1 GCA003492425_00410 gene open 436427-436846 vapC
841 QQMH01000001.1 GCA003492425_00411 gene open 436843-437082
842 QQMH01000001.1 GCA003492425_00412 gene open 437336-437779
843 QQMH01000001.1 GCA003492425_00413 gene open 437896-438381 purE
844 QQMH01000001.1 GCA003492425_00414 gene open 438430-439143 cpoB
845 QQMH01000001.1 GCA003492425_00415 gene open 439143-439811 trmR
846 QQMH01000001.1 GCA003492425_00416 gene open 439822-440007
847 QQMH01000001.1 GCA003492425_00417 gene open 440151-442127 mutL
848 QQMH01000001.1 GCA003492425_00418 gene open 442222-444342 dnaX
849 QQMH01000001.1 GCA003492425_00419 gene open 444422-444757 ybaB
850 QQMH01000001.1 GCA003492425_00420 gene open 445473-446249
851 QQMH01000001.1 GCA003492425_00421 gene open 446392-456468
852 QQMH01000001.1 GCA003492425_00422 gene open 457809-458855 recA
853 QQMH01000001.1 GCA003492425_00423 gene open 459109-459873 aroD
854 QQMH01000001.1 GCA003492425_00424 gene open 459896-461908 rep
855 QQMH01000001.1 GCA003492425_00425 gene open 461976-463034 dinB
856 QQMH01000001.1 GCA003492425_00426 gene open 463332-464777
857 QQMH01000001.1 GCA003492425_00427 gene open 465051-465830 fpr
858 QQMH01000001.1 GCA003492425_00428 gene open 466041-467426 dnaQ
859 QQMH01000001.1 GCA003492425_00431 gene open 467887-468150
860 QQMH01000001.1 GCA003492425_00432 gene open 468723-469898 yrpB
861 QQMH01000001.1 GCA003492425_00433 gene open 470241-470789 ccoH
862 QQMH01000001.1 GCA003492425_00434 gene open 470792-472288 ccoG
863 QQMH01000001.1 GCA003492425_00435 gene open 472817-474796 tkt
864 QQMH01000001.1 GCA003492425_00436 gene open 475174-475827
865 QQMH01000001.1 GCA003492425_00437 gene open 475799-477175
866 QQMH01000001.1 GCA003492425_00438 gene open 477316-478704 fumC
867 QQMH01000001.1 GCA003492425_00439 gene open 478769-479692 rhaT
868 QQMH01000001.1 GCA003492425_00440 gene open 480598-480840
869 QQMH01000001.1 GCA003492425_00164 gene open 145757-145847 trnS
870 QQMH01000001.1 GCA003492425_00165 gene open 145886-145972 trnL
871 QQMH01000001.1 GCA003492425_00166 gene open 146008-146094 trnL
872 QQMH01000001.1 GCA003492425_00225 gene open 210938-211022 trnL
873 QQMH01000001.1 GCA003492425_00429 gene open 467544-467620 trnR
874 QQMH01000001.1 GCA003492425_00430 gene open 467638-467712 trnE
875 QQMH01000001.1 GCA003492425_00164 tRNA open 145757-145847 trnS tRNA-Ser(gga)
876 QQMH01000001.1 GCA003492425_00165 tRNA open 145886-145972 trnL tRNA-Leu(cag)
877 QQMH01000001.1 GCA003492425_00166 tRNA open 146008-146094 trnL tRNA-Leu(cag)
878 QQMH01000001.1 GCA003492425_00225 tRNA open 210938-211022 trnL tRNA-Leu(tag)
879 QQMH01000001.1 GCA003492425_00429 tRNA open 467544-467620 trnR tRNA-Arg(acg)
880 QQMH01000001.1 GCA003492425_00430 tRNA open 467638-467712 trnE tRNA-Glu(ttc)
881 QQMH01000002.1 GCA003492425_00710 gene open 257548-257620 nse_sRNA
882 QQMH01000002.1 GCA003492425_00726 gene open 280418-280479 porB
883 QQMH01000002.1 GCA003492425_00806 gene open 363100-363285 IR_84
884 QQMH01000002.1 GCA003492425_00710 ncRNA open 257548-257620 Neisseria sigma-E sRNA
885 QQMH01000002.1 GCA003492425_00726 ncRNA open 280418-280479 porB porB RNA
886 QQMH01000002.1 GCA003492425_00806 ncRNA open 363100-363285 Neisseria sRNA 84
887 QQMH01000002.1 regulatory_region open 111839-111963 Ribosomal S15 leader
888 QQMH01000002.1 regulatory_region open 148705-148802 Glycine riboswitch aptamer
889 QQMH01000002.1 regulatory_region open 225173-225280 SAM-I/IV (S-adenosyl methionine) riboswitch aptamer
890 QQMH01000002.1 repeat_region open 6768-8335 CRISPR array with 24 repeats of length 32%2C consensus sequence GTTTCAACACACAGCCGCCTAGAGGCGGCTGA and spacer length 34
891 QQMH01000002.1 repeat_region open 266073-266317 CRISPR array with 4 repeats of length 37%2C consensus sequence AATTGTAGCACTGCGAAATGAGAAAGGGAGCTACAAC and spacer length 29
892 QQMH01000002.1 GCA003492425_00441 CDS open 294-1109 _na     271_aa hypothetical protein
893 QQMH01000002.1 GCA003492425_00442 CDS open 1428-4265 _na     945_aa lbpA lactoferrin/transferrin-binding protein LbpA
894 QQMH01000002.1 GCA003492425_00443 CDS open 4262-6481 _na     739_aa Slam-dependent surface lipoprotein
895 QQMH01000002.1 GCA003492425_00444 CDS open 8515-8856 _na     113_aa cas2 CRISPR-associated endonuclease Cas2
896 QQMH01000002.1 GCA003492425_00445 CDS open 8863-9876 _na     337_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
897 QQMH01000002.1 GCA003492425_00446 CDS open 11050-11985 _na     311_aa era GTPase Era
898 QQMH01000002.1 GCA003492425_00447 CDS open 12020-12739 _na     239_aa rnc ribonuclease III
899 QQMH01000002.1 GCA003492425_00448 CDS open 12906-13229 _na     107_aa DUF2185 domain-containing protein
900 QQMH01000002.1 GCA003492425_00449 CDS open 13275-13751 _na     158_aa ribH 6%2C7-dimethyl-8-ribityllumazine synthase
901 QQMH01000002.1 GCA003492425_00450 CDS open 13829-14254 _na     141_aa nusB transcription antitermination factor NusB
902 QQMH01000002.1 GCA003492425_00451 CDS open 14400-14876 _na     158_aa hypothetical protein
903 QQMH01000002.1 GCA003492425_00452 CDS open 14895-15929 _na     344_aa pyrC dihydroorotase
904 QQMH01000002.1 GCA003492425_00453 CDS open 16292-16516 _na     74_aa tusA Putative sulfur carrier protein NMB0681
905 QQMH01000002.1 GCA003492425_00454 CDS open 16625-17218 _na     197_aa CNP1-like family protein
906 QQMH01000002.1 GCA003492425_00455 CDS open 17293-18165 _na     290_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
907 QQMH01000002.1 GCA003492425_00456 CDS open 18203-18988 _na     261_aa trpA tryptophan synthase subunit alpha
908 QQMH01000002.1 GCA003492425_00457 CDS open 19325-19492 _na     55_aa hypothetical protein
909 QQMH01000002.1 GCA003492425_00458 CDS open 19434-20381 _na     315_aa SAM-dependent methyltransferase
910 QQMH01000002.1 GCA003492425_00459 CDS open 20353-20580 _na     75_aa Phage associated protein
911 QQMH01000002.1 GCA003492425_00460 CDS open 20601-20792 _na     63_aa Excisionase
912 QQMH01000002.1 GCA003492425_00461 CDS open 20808-23135 _na     775_aa replication endonuclease
913 QQMH01000002.1 GCA003492425_00462 CDS open 23178-23525 _na     115_aa hypothetical protein
914 QQMH01000002.1 GCA003492425_00463 CDS open 23522-23827 _na     101_aa Phage associated protein
915 QQMH01000002.1 GCA003492425_00464 CDS open 23829-24035 _na     68_aa hypothetical protein
916 QQMH01000002.1 GCA003492425_00465 CDS open 24028-24423 _na     131_aa DUF3310 domain-containing protein
917 QQMH01000002.1 GCA003492425_00466 CDS open 24483-24638 _na     51_aa hypothetical protein
918 QQMH01000002.1 GCA003492425_00467 CDS open 24635-25630 _na     331_aa hypothetical protein
919 QQMH01000002.1 GCA003492425_00468 CDS open 25652-25831 _na     59_aa hypothetical protein
920 QQMH01000002.1 GCA003492425_00469 CDS open 25828-26085 _na     85_aa hypothetical protein
921 QQMH01000002.1 GCA003492425_00470 CDS open 26082-26513 _na     143_aa hypothetical protein
922 QQMH01000002.1 GCA003492425_00471 CDS open 26510-26812 _na     100_aa hypothetical protein
923 QQMH01000002.1 GCA003492425_00472 CDS open 26803-26988 _na     61_aa Phage associated protein
924 QQMH01000002.1 GCA003492425_00473 CDS open 27086-27331 _na     81_aa hypothetical protein
925 QQMH01000002.1 GCA003492425_00474 CDS open 27324-27785 _na     153_aa DUF6948 domain-containing protein
926 QQMH01000002.1 GCA003492425_00475 CDS open 27932-28258 _na     108_aa hypothetical protein
927 QQMH01000002.1 GCA003492425_00476 CDS open 28385-28582 _na     65_aa putative protein conserved in bacteria%2C prophage-related
928 QQMH01000002.1 GCA003492425_00477 CDS open 28738-29400 _na     220_aa helix-turn-helix transcriptional regulator
929 QQMH01000002.1 GCA003492425_00478 CDS open 29591-29953 _na     120_aa hypothetical protein
930 QQMH01000002.1 GCA003492425_00479 CDS open 29999-30232 _na     77_aa hypothetical protein
931 QQMH01000002.1 GCA003492425_00480 CDS open 30229-30435 _na     68_aa DNA-binding transcriptional regulator
932 QQMH01000002.1 GCA003492425_00481 CDS open 30533-30760 _na     75_aa hypothetical protein
933 QQMH01000002.1 GCA003492425_00482 CDS open 30837-32015 _na     392_aa contractile injection system protein%2C VgrG/Pvc8 family
934 QQMH01000002.1 GCA003492425_00483 CDS open 32018-32470 _na     150_aa phage tail protein
935 QQMH01000002.1 GCA003492425_00484 CDS open 32476-35127 _na     883_aa phage tail tape measure protein
936 QQMH01000002.1 GCA003492425_00485 CDS open 35360-35713 _na     117_aa Phage tail assembly chaperone protein%2C E%2C or 41 or 14
937 QQMH01000002.1 GCA003492425_00486 CDS open 35753-36259 _na     168_aa phage major tail tube protein
938 QQMH01000002.1 GCA003492425_00487 CDS open 36285-37487 _na     400_aa phage tail sheath subtilisin-like domain-containing protein
939 QQMH01000002.1 GCA003492425_00488 CDS open 37612-38385 _na     257_aa DNA adenine methylase
940 QQMH01000002.1 GCA003492425_00489 CDS open 38479-38592 _na     37_aa Com family DNA-binding transcriptional regulator
941 QQMH01000002.1 GCA003492425_00490 CDS open 38784-39386 _na     200_aa phage tail protein
942 QQMH01000002.1 GCA003492425_00491 CDS open 39416-40711 _na     431_aa tail fiber protein
943 QQMH01000002.1 GCA003492425_00492 CDS open 40752-41333 _na     193_aa phage tail protein I
944 QQMH01000002.1 GCA003492425_00493 CDS open 41330-42217 _na     295_aa baseplate J/gp47 family protein
945 QQMH01000002.1 GCA003492425_00494 CDS open 42204-42545 _na     113_aa GPW/gp25 family protein
946 QQMH01000002.1 GCA003492425_00495 CDS open 42542-43159 _na     205_aa phage baseplate assembly protein V
947 QQMH01000002.1 GCA003492425_00496 CDS open 43283-43960 _na     225_aa phage virion morphogenesis protein
948 QQMH01000002.1 GCA003492425_00497 CDS open 43957-44403 _na     148_aa phage tail protein
949 QQMH01000002.1 GCA003492425_00498 CDS open 44404-44631 _na     75_aa TraR/DksA C4-type zinc finger protein
950 QQMH01000002.1 GCA003492425_00499 CDS open 44641-45138 _na     165_aa TIGR02594 family protein
951 QQMH01000002.1 GCA003492425_00500 CDS open 45152-45616 _na     154_aa Enoyl-CoA hydratase
952 QQMH01000002.1 GCA003492425_00501 CDS open 45613-46077 _na     154_aa DUF4376 domain-containing protein
953 QQMH01000002.1 GCA003492425_00502 CDS open 46087-46746 _na     219_aa Phage associated protein
954 QQMH01000002.1 GCA003492425_00503 CDS open 46790-47230 _na     146_aa Phage associated protein
955 QQMH01000002.1 GCA003492425_00504 CDS open 47338-47493 _na     51_aa hypothetical protein
956 QQMH01000002.1 GCA003492425_00505 CDS open 47497-47820 _na     107_aa hypothetical protein
957 QQMH01000002.1 GCA003492425_00506 CDS open 48113-48487 _na     124_aa putative holin
958 QQMH01000002.1 GCA003492425_00507 CDS open 48489-48704 _na     71_aa tail protein X
959 QQMH01000002.1 GCA003492425_00508 CDS open 48704-49183 _na     159_aa head completion/stabilization protein
960 QQMH01000002.1 GCA003492425_00509 CDS open 49282-49932 _na     216_aa phage terminase small subunit
961 QQMH01000002.1 GCA003492425_00510 CDS open 49975-51003 _na     342_aa phage major capsid protein%2C P2 family
962 QQMH01000002.1 GCA003492425_00511 CDS open 51043-51912 _na     289_aa GPO family capsid scaffolding protein
963 QQMH01000002.1 GCA003492425_00512 CDS open 52071-53873 _na     600_aa terminase large subunit domain-containing protein
964 QQMH01000002.1 GCA003492425_00513 CDS open 53890-54867 _na     325_aa phage portal protein
965 QQMH01000002.1 GCA003492425_00514 CDS open 55150-56382 _na     410_aa integrase arm-type DNA-binding domain-containing protein
966 QQMH01000002.1 GCA003492425_00516 CDS open 56815-57330 _na     171_aa 3-deoxy-manno-octulosonate cytidylyltransferase
967 QQMH01000002.1 GCA003492425_00517 CDS open 57353-58114 _na     253_aa kdsB 3-deoxy-manno-octulosonate cytidylyltransferase
968 QQMH01000002.1 GCA003492425_00518 CDS open 58111-58293 _na     60_aa trm112 UPF0434 protein NMA0874
969 QQMH01000002.1 GCA003492425_00519 CDS open 58516-59097 _na     193_aa DUF2059 domain-containing protein
970 QQMH01000002.1 GCA003492425_00520 CDS open 59266-60375 _na     369_aa lpxK tetraacyldisaccharide 4'-kinase
971 QQMH01000002.1 GCA003492425_00521 CDS open 60375-60641 _na     88_aa Integral membrane protein
972 QQMH01000002.1 GCA003492425_00522 CDS open 60733-62013 _na     426_aa sfcA Malic enzyme
973 QQMH01000002.1 GCA003492425_00523 CDS open 62274-62900 _na     208_aa tmk dTMP kinase
974 QQMH01000002.1 GCA003492425_00524 CDS open 63186-64181 _na     331_aa Endolytic murein transglycosylase
975 QQMH01000002.1 GCA003492425_00525 CDS open 64266-64838 _na     190_aa ampD 1%2C6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD
976 QQMH01000002.1 GCA003492425_00526 CDS open 64828-64935 _na     35_aa hypothetical protein
977 QQMH01000002.1 GCA003492425_00527 CDS open 65032-66294 _na     420_aa zipA Cell division protein ZipA
978 QQMH01000002.1 GCA003492425_00528 CDS open 66404-68899 _na     831_aa ligA NAD-dependent DNA ligase LigA
979 QQMH01000002.1 GCA003492425_00529 CDS open 68956-70131 _na     391_aa hemW radical SAM family heme chaperone HemW
980 QQMH01000002.1 GCA003492425_00530 CDS open 70657-71184 _na     175_aa nspA outer membrane beta-barrel protein NspA
981 QQMH01000002.1 GCA003492425_00531 CDS open 71321-71710 _na     129_aa ridA Ribonuclease%2C putative
982 QQMH01000002.1 GCA003492425_00532 CDS open 71787-72617 _na     276_aa apaH symmetrical bis(5'-nucleosyl)-tetraphosphatase
983 QQMH01000002.1 GCA003492425_00533 CDS open 72632-74089 _na     485_aa trkG Trk system potassium uptake protein
984 QQMH01000002.1 GCA003492425_00534 CDS open 74131-74520 _na     129_aa Phage associated protein
985 QQMH01000002.1 GCA003492425_00535 CDS open 74846-75088 _na     80_aa Immunity protein 31
986 QQMH01000002.1 GCA003492425_00536 CDS open 75085-76755 _na     556_aa MafB-related protein
987 QQMH01000002.1 GCA003492425_00538 CDS open 77198-77656 _na     152_aa nudB dihydroneopterin triphosphate diphosphatase
988 QQMH01000002.1 GCA003492425_00539 CDS open 77758-78291 _na     177_aa ppa Inorganic pyrophosphatase
989 QQMH01000002.1 GCA003492425_00540 CDS open 78399-78632 _na     77_aa hypothetical protein
990 QQMH01000002.1 GCA003492425_00541 CDS open 78625-79224 _na     199_aa rdgB RdgB/HAM1 family non-canonical purine NTP pyrophosphatase
991 QQMH01000002.1 GCA003492425_00542 CDS open 79252-80121 _na     289_aa galU UTP--glucose-1-phosphate uridylyltransferase GalU
992 QQMH01000002.1 GCA003492425_00543 CDS open 80140-81516 _na     458_aa argH argininosuccinate lyase
993 QQMH01000002.1 GCA003492425_00544 CDS open 81573-82043 _na     156_aa DUF4375 domain-containing protein
994 QQMH01000002.1 GCA003492425_00545 CDS open 82296-83291 _na     331_aa Major ferric iron binding protein
995 QQMH01000002.1 GCA003492425_00546 CDS open 83356-84873 _na     505_aa fbpB heme ABC transporter permease FbpB
996 QQMH01000002.1 GCA003492425_00547 CDS open 84894-85955 _na     353_aa Iron-uptake permease ATP-binding protein
997 QQMH01000002.1 GCA003492425_00548 CDS open 86197-87699 _na     500_aa pta phosphate acetyltransferase
998 QQMH01000002.1 GCA003492425_00549 CDS open 87830-88468 _na     212_aa hisH imidazole glycerol phosphate synthase subunit HisH
999 QQMH01000002.1 GCA003492425_00550 CDS open 88501-89238 _na     245_aa hisA 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase
1000 QQMH01000002.1 GCA003492425_00551 CDS open 89251-90018 _na     255_aa hisF Imidazole glycerol phosphate synthase subunit HisF