HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Neisseria lactamica (GCA_003495575.1)

Select a Genome:
BAKTA Annotations for GCA_003495575.1
Genome Selected: Neisseria lactamica
ContigsBases CDSrRNA tmRNAtRNA
40 2137233 1975 3 1 54
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4095 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 4095 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 QQEH01000003.1 GCA003495575_01111 gene open 219660-220706 recA
1502 QQEH01000003.1 GCA003495575_01112 gene open 220963-221727 aroD
1503 QQEH01000003.1 GCA003495575_01113 gene open 221747-223762 rep
1504 QQEH01000003.1 GCA003495575_01114 gene open 223832-224890 dinB
1505 QQEH01000003.1 GCA003495575_01115 gene open 225203-225619
1506 QQEH01000003.1 GCA003495575_01116 gene open 225793-226572 fpr
1507 QQEH01000003.1 GCA003495575_01117 gene open 226778-228163 dnaQ
1508 QQEH01000003.1 GCA003495575_01120 gene open 229007-230182 yrpB
1509 QQEH01000003.1 GCA003495575_01121 gene open 231086-231634 ccoH
1510 QQEH01000003.1 GCA003495575_01122 gene open 231637-233133 ccoG
1511 QQEH01000003.1 GCA003495575_01123 gene open 233657-235636 tkt
1512 QQEH01000003.1 GCA003495575_01124 gene open 235919-236596
1513 QQEH01000003.1 GCA003495575_01125 gene open 236545-237921
1514 QQEH01000003.1 GCA003495575_01126 gene open 238061-239449 fumC
1515 QQEH01000003.1 GCA003495575_01127 gene open 239514-240437 rhaT
1516 QQEH01000003.1 GCA003495575_01128 gene open 241126-241359
1517 QQEH01000003.1 GCA003495575_01129 gene open 241343-241585
1518 QQEH01000003.1 GCA003495575_01118 gene open 228281-228357 trnR
1519 QQEH01000003.1 GCA003495575_01119 gene open 228375-228449 trnE
1520 QQEH01000003.1 GCA003495575_01118 tRNA open 228281-228357 trnR tRNA-Arg(acg)
1521 QQEH01000003.1 GCA003495575_01119 tRNA open 228375-228449 trnE tRNA-Glu(ttc)
1522 QQEH01000004.1 GCA003495575_01322 gene open 206118-206205 NmsRb
1523 QQEH01000004.1 GCA003495575_01323 gene open 206319-206409 NmsRb
1524 QQEH01000004.1 GCA003495575_01322 ncRNA open 206118-206205 Neisseria metabolic switch regulator b (RcoF1/NgncR163)
1525 QQEH01000004.1 GCA003495575_01323 ncRNA open 206319-206409 Neisseria metabolic switch regulator b (RcoF1/NgncR163)
1526 QQEH01000004.1 GCA003495575_01130 CDS open 448-582 _na     44_aa hypothetical protein
1527 QQEH01000004.1 GCA003495575_01131 CDS open 998-1546 _na     182_aa HNH/Endo VII superfamily nuclease toxins
1528 QQEH01000004.1 GCA003495575_01132 CDS open 1543-1983 _na     146_aa hypothetical protein
1529 QQEH01000004.1 GCA003495575_01133 CDS open 2132-3088 _na     318_aa VENN motif-containing domain-containing protein
1530 QQEH01000004.1 GCA003495575_01134 CDS open 3103-3351 _na     82_aa Transcription factor zinc-finger domain-containing protein
1531 QQEH01000004.1 GCA003495575_01135 CDS open 3517-4377 _na     286_aa hypothetical protein
1532 QQEH01000004.1 GCA003495575_01136 CDS open 4513-4731 _na     72_aa hypothetical protein
1533 QQEH01000004.1 GCA003495575_01137 CDS open 4868-5128 _na     86_aa ESPR domain-containing protein
1534 QQEH01000004.1 GCA003495575_01138 CDS open 5170-5508 _na     112_aa Transposase IS4-like domain-containing protein
1535 QQEH01000004.1 GCA003495575_01139 CDS open 5496-5864 _na     122_aa Transposase
1536 QQEH01000004.1 GCA003495575_01140 CDS open 5807-6175 _na     122_aa insH Transposase InsH N-terminal domain-containing protein
1537 QQEH01000004.1 GCA003495575_01141 CDS open 6290-6949 _na     219_aa Ser/Thr phosphatase family protein
1538 QQEH01000004.1 GCA003495575_01142 CDS open 7061-7909 _na     282_aa Nudix hydrolase domain-containing protein
1539 QQEH01000004.1 GCA003495575_01143 CDS open 8374-9060 _na     228_aa Tyr recombinase domain-containing protein
1540 QQEH01000004.1 GCA003495575_01144 CDS open 9221-9859 _na     212_aa integrase
1541 QQEH01000004.1 GCA003495575_01145 CDS open 9852-10484 _na     210_aa Tyr recombinase domain-containing protein
1542 QQEH01000004.1 GCA003495575_01146 CDS open 10539-10973 _na     144_aa hypothetical protein
1543 QQEH01000004.1 GCA003495575_01147 CDS open 11866-12390 _na     174_aa ssb Single-stranded DNA-binding protein
1544 QQEH01000004.1 GCA003495575_01148 CDS open 12394-13779 _na     461_aa araJ Drug resistance translocase family protein
1545 QQEH01000004.1 GCA003495575_01149 CDS open 13884-14504 _na     206_aa mltE Transglycosylase
1546 QQEH01000004.1 GCA003495575_01150 CDS open 14710-15078 _na     122_aa HTH cro/C1-type domain-containing protein
1547 QQEH01000004.1 GCA003495575_01151 CDS open 15241-16122 _na     293_aa factor H binding protein domain-containing protein
1548 QQEH01000004.1 GCA003495575_01152 CDS open 16236-17903 _na     555_aa Surface lipoprotein assembly modifier C-terminal beta-barrel domain-containing protein
1549 QQEH01000004.1 GCA003495575_01153 CDS open 18064-19572 _na     502_aa ppx exopolyphosphatase
1550 QQEH01000004.1 GCA003495575_01154 CDS open 19390-19842 _na     150_aa hypothetical protein
1551 QQEH01000004.1 GCA003495575_01155 CDS open 19927-20472 _na     181_aa Lipoprotein
1552 QQEH01000004.1 GCA003495575_01156 CDS open 20553-21563 _na     336_aa trpS tryptophan--tRNA ligase
1553 QQEH01000004.1 GCA003495575_01157 CDS open 21824-24403 _na     859_aa clpB ATP-dependent chaperone ClpB
1554 QQEH01000004.1 GCA003495575_01158 CDS open 24475-25689 _na     404_aa aspB Putative 8-amino-7-oxononanoate synthase
1555 QQEH01000004.1 GCA003495575_01159 CDS open 25778-25987 _na     69_aa pptA Tautomerase
1556 QQEH01000004.1 GCA003495575_01160 CDS open 26338-27603 _na     421_aa gdhA Glutamate dehydrogenase
1557 QQEH01000004.1 GCA003495575_01161 CDS open 28000-28707 _na     235_aa gph phosphoglycolate phosphatase
1558 QQEH01000004.1 GCA003495575_01162 CDS open 28764-29225 _na     153_aa recX recombination regulator RecX
1559 QQEH01000004.1 GCA003495575_01163 CDS open 29299-29460 _na     53_aa Cytochrome c oxidase subunit 2A
1560 QQEH01000004.1 GCA003495575_01164 CDS open 29613-30095 _na     160_aa yciA Acyl-CoA hydrolase
1561 QQEH01000004.1 GCA003495575_01165 CDS open 30494-31507 _na     337_aa nlpD Membrane peptidase
1562 QQEH01000004.1 GCA003495575_01166 CDS open 31610-32356 _na     248_aa surE 5'/3'-nucleotidase SurE
1563 QQEH01000004.1 GCA003495575_01167 CDS open 32370-33926 _na     518_aa mpfA CBS domain-containing protein
1564 QQEH01000004.1 GCA003495575_01168 CDS open 34035-34820 _na     261_aa Fimbrial assembly protein%2C serogroup E1 family protein
1565 QQEH01000004.1 GCA003495575_01169 CDS open 34930-36363 _na     477_aa adhE Putative succinate-semialdehyde dehydrogenase
1566 QQEH01000004.1 GCA003495575_01170 CDS open 36697-37191 _na     164_aa DUF1436 domain-containing protein
1567 QQEH01000004.1 GCA003495575_01171 CDS open 37349-37975 _na     208_aa hypothetical protein
1568 QQEH01000004.1 GCA003495575_01172 CDS open 38320-38700 _na     126_aa mliC Membrane-bound lysozyme-inhibitor of c-type lysozyme family protein
1569 QQEH01000004.1 GCA003495575_01173 CDS open 39307-41388 _na     693_aa cstA Carbon starvation protein A
1570 QQEH01000004.1 GCA003495575_01174 CDS open 41378-41572 _na     64_aa ybdD Small protein yjiX
1571 QQEH01000004.1 GCA003495575_01175 CDS open 41810-42370 _na     186_aa rsuA Pseudouridine synthase
1572 QQEH01000004.1 GCA003495575_01176 CDS open 42654-45419 _na     921_aa cirA putative TonB-dependent receptor NMB1497
1573 QQEH01000004.1 GCA003495575_01177 CDS open 45822-47039 _na     405_aa metL1 aspartate kinase
1574 QQEH01000004.1 GCA003495575_01178 CDS open 47241-47969 _na     242_aa rph ribonuclease PH
1575 QQEH01000004.1 GCA003495575_01179 CDS open 48188-48652 _na     154_aa Universal stress protein
1576 QQEH01000004.1 GCA003495575_01180 CDS open 48870-49661 _na     263_aa THIF-type NAD/FAD binding fold domain-containing protein
1577 QQEH01000004.1 GCA003495575_01181 CDS open 49785-49991 _na     68_aa hypothetical protein
1578 QQEH01000004.1 GCA003495575_01182 CDS open 50116-50931 _na     271_aa hypothetical protein
1579 QQEH01000004.1 GCA003495575_01183 CDS open 51102-51956 _na     284_aa Segregation and condensation protein A
1580 QQEH01000004.1 GCA003495575_01184 CDS open 51997-53205 _na     402_aa pncB nicotinate phosphoribosyltransferase
1581 QQEH01000004.1 GCA003495575_01185 CDS open 53297-55015 _na     572_aa argS arginine--tRNA ligase
1582 QQEH01000004.1 GCA003495575_01186 CDS open 55565-56983 _na     472_aa mdoB Sulfatase N-terminal domain-containing protein
1583 QQEH01000004.1 GCA003495575_01187 CDS open 58197-58943 _na     248_aa hisM ABC transporter permease%2C amino acid
1584 QQEH01000004.1 GCA003495575_01188 CDS open 59122-59796 _na     224_aa yncB Nuclease
1585 QQEH01000004.1 GCA003495575_01189 CDS open 59865-60536 _na     223_aa rpiA ribose-5-phosphate isomerase RpiA
1586 QQEH01000004.1 GCA003495575_01190 CDS open 60613-61095 _na     160_aa ispF 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase
1587 QQEH01000004.1 GCA003495575_01191 CDS open 61127-61816 _na     229_aa ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
1588 QQEH01000004.1 GCA003495575_01192 CDS open 61813-62547 _na     244_aa dnaQ DNA polymerase III subunit epsilon
1589 QQEH01000004.1 GCA003495575_01193 CDS open 62702-64012 _na     436_aa MFS transporter
1590 QQEH01000004.1 GCA003495575_01194 CDS open 64002-64187 _na     61_aa ccoS cbb3-type cytochrome oxidase assembly protein CcoS
1591 QQEH01000004.1 GCA003495575_01195 CDS open 64187-64486 _na     99_aa HLGFF motif protein
1592 QQEH01000004.1 GCA003495575_01196 CDS open 64826-66022 _na     398_aa ackA1 Acetate kinase 1
1593 QQEH01000004.1 GCA003495575_01197 CDS open 66433-68238 _na     601_aa dsbD Thiol:disulfide interchange protein DsbD
1594 QQEH01000004.1 GCA003495575_01198 CDS open 68365-68835 _na     156_aa DUF1841 domain-containing protein
1595 QQEH01000004.1 GCA003495575_01199 CDS open 68908-69720 _na     270_aa hpnC squalene synthase HpnC
1596 QQEH01000004.1 GCA003495575_01200 CDS open 69805-70287 _na     160_aa slpA peptidylprolyl isomerase
1597 QQEH01000004.1 GCA003495575_01201 CDS open 70422-70736 _na     104_aa hypothetical protein
1598 QQEH01000004.1 GCA003495575_01202 CDS open 70749-71120 _na     123_aa hypothetical protein
1599 QQEH01000004.1 GCA003495575_01203 CDS open 71315-72682 _na     455_aa glcD FAD-binding PCMH-type domain-containing protein
1600 QQEH01000004.1 GCA003495575_01204 CDS open 72717-73223 _na     168_aa DUF1877 domain-containing protein
1601 QQEH01000004.1 GCA003495575_01205 CDS open 73314-73544 _na     76_aa Phage associated protein
1602 QQEH01000004.1 GCA003495575_01206 CDS open 73650-74096 _na     148_aa smpB SsrA-binding protein SmpB
1603 QQEH01000004.1 GCA003495575_01207 CDS open 74151-75161 _na     336_aa rfaF lipopolysaccharide heptosyltransferase II
1604 QQEH01000004.1 GCA003495575_01209 CDS open 75558-76310 _na     250_aa methylated-DNA--[protein]-cysteine S-methyltransferase
1605 QQEH01000004.1 GCA003495575_01210 CDS open 76661-77218 _na     185_aa ybhB Hypothetical outer membrane protein
1606 QQEH01000004.1 GCA003495575_01211 CDS open 77196-78044 _na     282_aa araC AraC family transcriptional regulator
1607 QQEH01000004.1 GCA003495575_01212 CDS open 78426-79571 _na     381_aa dapE succinyl-diaminopimelate desuccinylase
1608 QQEH01000004.1 GCA003495575_01213 CDS open 79685-80305 _na     206_aa Diadenosine tetraphosphatase
1609 QQEH01000004.1 GCA003495575_01214 CDS open 80330-80839 _na     169_aa Hemerythrin-like domain-containing protein
1610 QQEH01000004.1 GCA003495575_01215 CDS open 80925-81506 _na     193_aa azu azurin
1611 QQEH01000004.1 GCA003495575_01216 CDS open 81765-82199 _na     144_aa DUF721 domain-containing protein
1612 QQEH01000004.1 GCA003495575_01217 CDS open 82332-85082 _na     916_aa secA preprotein translocase subunit SecA
1613 QQEH01000004.1 GCA003495575_01218 CDS open 85226-86998 _na     590_aa dnaG DNA primase
1614 QQEH01000004.1 GCA003495575_01219 CDS open 87186-89114 _na     642_aa rpoD RNA polymerase sigma factor RpoD
1615 QQEH01000004.1 GCA003495575_01220 CDS open 89156-89698 _na     180_aa cas4 CRISPR-associated protein Cas4
1616 QQEH01000004.1 GCA003495575_01221 CDS open 89728-89970 _na     80_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
1617 QQEH01000004.1 GCA003495575_01222 CDS open 90079-90954 _na     291_aa TIR domain-containing protein
1618 QQEH01000004.1 GCA003495575_01223 CDS open 91040-91690 _na     216_aa cas4 CRISPR-associated protein Cas4
1619 QQEH01000004.1 GCA003495575_01224 CDS open 91693-92544 _na     283_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
1620 QQEH01000004.1 GCA003495575_01225 CDS open 92557-94314 _na     585_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
1621 QQEH01000004.1 GCA003495575_01226 CDS open 94311-94955 _na     214_aa cas5c type I-C CRISPR-associated protein Cas5c
1622 QQEH01000004.1 GCA003495575_01227 CDS open 95186-96079 _na     297_aa hypothetical protein
1623 QQEH01000004.1 GCA003495575_01228 CDS open 96019-97683 _na     554_aa CRISPR-associated endonuclease Cas3''
1624 QQEH01000004.1 GCA003495575_01229 CDS open 97818-98372 _na     184_aa CRISPR-associated endonuclease Cas3-HD
1625 QQEH01000004.1 GCA003495575_01230 CDS open 98677-100311 _na     544_aa pyrG CTP synthase
1626 QQEH01000004.1 GCA003495575_01231 CDS open 100423-102093 _na     556_aa menE Long-chain-fatty-acid--CoA ligase
1627 QQEH01000004.1 GCA003495575_01232 CDS open 102164-103267 _na     367_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
1628 QQEH01000004.1 GCA003495575_01233 CDS open 103393-103866 _na     157_aa Copper chaperone PCu(A)C
1629 QQEH01000004.1 GCA003495575_01234 CDS open 104003-104386 _na     127_aa dgkA Diacylglycerol kinase
1630 QQEH01000004.1 GCA003495575_01235 CDS open 104548-105504 _na     318_aa gshB glutathione synthase
1631 QQEH01000004.1 GCA003495575_01236 CDS open 105597-107318 _na     573_aa Glutamine--tRNA ligase
1632 QQEH01000004.1 GCA003495575_01237 CDS open 107397-108170 _na     257_aa glpR DeoR family transcriptional regulator
1633 QQEH01000004.1 GCA003495575_01238 CDS open 108213-109115 _na     300_aa lysO Surface protein
1634 QQEH01000004.1 GCA003495575_01239 CDS open 109269-109985 _na     238_aa gntR Transcriptional regulator%2C GntR family
1635 QQEH01000004.1 GCA003495575_01240 CDS open 110393-110815 _na     140_aa yhfA OsmC family protein
1636 QQEH01000004.1 GCA003495575_01241 CDS open 110911-111579 _na     222_aa DUF3108 domain-containing protein
1637 QQEH01000004.1 GCA003495575_01242 CDS open 111598-112284 _na     228_aa purN phosphoribosylglycinamide formyltransferase
1638 QQEH01000004.1 GCA003495575_01243 CDS open 112331-113152 _na     273_aa fkpA putative FKBP-type peptidyl-prolyl cis-trans isomerase FkpA
1639 QQEH01000004.1 GCA003495575_01244 CDS open 113261-113701 _na     146_aa DNA polymerase III%2C chi subunit
1640 QQEH01000004.1 GCA003495575_01245 CDS open 113764-115170 _na     468_aa pepA leucyl aminopeptidase
1641 QQEH01000004.1 GCA003495575_01246 CDS open 115327-116442 _na     371_aa lptF LPS export ABC transporter permease LptF
1642 QQEH01000004.1 GCA003495575_01247 CDS open 116439-117509 _na     356_aa lptG LPS export ABC transporter permease LptG
1643 QQEH01000004.1 GCA003495575_01248 CDS open 117719-120304 _na     861_aa acnB bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase
1644 QQEH01000004.1 GCA003495575_01249 CDS open 120446-121441 _na     331_aa ornithine carbamoyltransferase
1645 QQEH01000004.1 GCA003495575_01250 CDS open 121667-122056 _na     129_aa hypothetical protein
1646 QQEH01000004.1 GCA003495575_01251 CDS open 122275-123288 _na     337_aa ilvC ketol-acid reductoisomerase
1647 QQEH01000004.1 GCA003495575_01252 CDS open 123351-123644 _na     97_aa ABM domain-containing protein
1648 QQEH01000004.1 GCA003495575_01253 CDS open 123709-124200 _na     163_aa ilvN acetolactate synthase small subunit
1649 QQEH01000004.1 GCA003495575_01254 CDS open 124211-125938 _na     575_aa ilvB biosynthetic-type acetolactate synthase large subunit
1650 QQEH01000004.1 GCA003495575_01256 CDS open 126913-127575 _na     220_aa Lipoprotein
1651 QQEH01000004.1 GCA003495575_01257 CDS open 127647-128300 _na     217_aa hisG ATP phosphoribosyltransferase
1652 QQEH01000004.1 GCA003495575_01258 CDS open 128404-129294 _na     296_aa GIY-YIG domain-containing protein
1653 QQEH01000004.1 GCA003495575_01259 CDS open 129291-130580 _na     429_aa hisD Histidinol dehydrogenase
1654 QQEH01000004.1 GCA003495575_01260 CDS open 130626-131705 _na     359_aa hisC histidinol-phosphate transaminase
1655 QQEH01000004.1 GCA003495575_01261 CDS open 131722-132624 _na     300_aa hisB imidazoleglycerol-phosphate dehydratase HisB
1656 QQEH01000004.1 GCA003495575_01262 CDS open 132700-133572 _na     290_aa 3-hydroxyacid dehydrogenase
1657 QQEH01000004.1 GCA003495575_01263 CDS open 133644-134696 _na     350_aa sohB protease SohB
1658 QQEH01000004.1 GCA003495575_01271 CDS open 135881-136444 _na     187_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
1659 QQEH01000004.1 GCA003495575_01272 CDS open 136550-137020 _na     156_aa Secreted protein
1660 QQEH01000004.1 GCA003495575_01273 CDS open 137149-137484 _na     111_aa yurZ Carboxymuconolactone decarboxylase-like domain-containing protein
1661 QQEH01000004.1 GCA003495575_01274 CDS open 137613-138518 _na     301_aa mtrA HTH-type transcriptional regulator MtrA
1662 QQEH01000004.1 GCA003495575_01275 CDS open 138580-139077 _na     165_aa Lipoprotein
1663 QQEH01000004.1 GCA003495575_01276 CDS open 139215-140117 _na     300_aa rhaT EamA domain-containing protein
1664 QQEH01000004.1 GCA003495575_01277 CDS open 140158-141288 _na     376_aa potD Putrescine-binding periplasmic protein
1665 QQEH01000004.1 GCA003495575_01278 CDS open 141459-144116 _na     885_aa Alanine--tRNA ligase
1666 QQEH01000004.1 GCA003495575_01279 CDS open 145205-145888 _na     227_aa gpmA 2%2C3-diphosphoglycerate-dependent phosphoglycerate mutase
1667 QQEH01000004.1 GCA003495575_01280 CDS open 146191-148488 _na     765_aa parC DNA topoisomerase IV subunit A
1668 QQEH01000004.1 GCA003495575_01281 CDS open 148508-150100 _na     530_aa histidine kinase
1669 QQEH01000004.1 GCA003495575_01282 CDS open 150093-151610 _na     505_aa Sigma-54 interaction domain protein
1670 QQEH01000004.1 GCA003495575_01283 CDS open 151715-152467 _na     250_aa rsmJ Ribosomal RNA small subunit methyltransferase J
1671 QQEH01000004.1 GCA003495575_01284 CDS open 152542-152748 _na     68_aa DUF2788 domain-containing protein
1672 QQEH01000004.1 GCA003495575_01285 CDS open 152834-154003 _na     389_aa metZ O-succinylhomoserine sulfhydrylase
1673 QQEH01000004.1 GCA003495575_01286 CDS open 154148-154918 _na     256_aa DUF2894 domain-containing protein
1674 QQEH01000004.1 GCA003495575_01287 CDS open 155018-155269 _na     83_aa NGO1151 family protein
1675 QQEH01000004.1 GCA003495575_01288 CDS open 155321-156127 _na     268_aa hisJ putative histidine-binding protein
1676 QQEH01000004.1 GCA003495575_01289 CDS open 156785-159661 _na     958_aa autotransporter outer membrane beta-barrel domain-containing protein
1677 QQEH01000004.1 GCA003495575_01290 CDS open 160117-160401 _na     94_aa yhbQ GIY-YIG domain-containing protein
1678 QQEH01000004.1 GCA003495575_01291 CDS open 160950-162401 _na     483_aa citT Integral membrane transport protein
1679 QQEH01000004.1 GCA003495575_01292 CDS open 163055-164308 _na     417_aa nuoF NADH dehydrogenase
1680 QQEH01000004.1 GCA003495575_01293 CDS open 164305-165933 _na     542_aa nadB FAD-dependent oxidoreductase 2 FAD binding domain-containing protein
1681 QQEH01000004.1 GCA003495575_01294 CDS open 165933-166571 _na     212_aa forC 2Fe-2S iron-sulfur cluster binding domain protein
1682 QQEH01000004.1 GCA003495575_01295 CDS open 167351-168874 _na     507_aa ttdA Fumarate hydratase class I
1683 QQEH01000004.1 GCA003495575_01296 CDS open 168972-170384 _na     470_aa trkA Trk system potassium transporter TrkA
1684 QQEH01000004.1 GCA003495575_01297 CDS open 170918-171202 _na     94_aa yhbQ GIY-YIG domain-containing protein
1685 QQEH01000004.1 GCA003495575_01298 CDS open 171976-174663 _na     895_aa brkA BrkA autotransporter
1686 QQEH01000004.1 GCA003495575_01300 CDS open 175817-176623 _na     268_aa thiD hydroxymethylpyrimidine kinase
1687 QQEH01000004.1 GCA003495575_01301 CDS open 176681-177535 _na     284_aa tehB SAM-dependent methyltransferase TehB
1688 QQEH01000004.1 GCA003495575_01302 CDS open 177576-178100 _na     174_aa rnhA ribonuclease HI
1689 QQEH01000004.1 GCA003495575_01303 CDS open 178853-179257 _na     134_aa hinT HIT domain-containing protein
1690 QQEH01000004.1 GCA003495575_01304 CDS open 179297-180481 _na     394_aa ldcA Putative muramoyltetrapeptide carboxypeptidase (LD-carboxypeptidase A)
1691 QQEH01000004.1 GCA003495575_01305 CDS open 180583-182838 _na     751_aa norB Nitric oxide reductase
1692 QQEH01000004.1 GCA003495575_01306 CDS open 183210-184388 _na     392_aa nirK copper-containing nitrite reductase
1693 QQEH01000004.1 GCA003495575_01307 CDS open 184566-185321 _na     251_aa yfmG Serine/threonine-protein kinase pkn1
1694 QQEH01000004.1 GCA003495575_01308 CDS open 185653-186210 _na     185_aa nfnB Putative NAD(P)H nitroreductase
1695 QQEH01000004.1 GCA003495575_01309 CDS open 186286-187920 _na     544_aa opgE Arylsulfatase
1696 QQEH01000004.1 GCA003495575_01310 CDS open 188311-189417 _na     368_aa serC phosphoserine transaminase
1697 QQEH01000004.1 GCA003495575_01311 CDS open 189761-190192 _na     143_aa rimP ribosome maturation factor RimP
1698 QQEH01000004.1 GCA003495575_01312 CDS open 190220-191722 _na     500_aa nusA Transcription termination/antitermination protein NusA
1699 QQEH01000004.1 GCA003495575_01313 CDS open 191735-194623 _na     962_aa infB translation initiation factor IF-2
1700 QQEH01000004.1 GCA003495575_01314 CDS open 194774-196114 _na     446_aa Integral membrane protein
1701 QQEH01000004.1 GCA003495575_01315 CDS open 196176-197525 _na     449_aa DUF2868 domain-containing protein
1702 QQEH01000004.1 GCA003495575_01316 CDS open 197765-197908 _na     47_aa hypothetical protein
1703 QQEH01000004.1 GCA003495575_01317 CDS open 197915-200953 _na     1012_aa beta-galactosidase
1704 QQEH01000004.1 GCA003495575_01318 CDS open 200964-202226 _na     420_aa Galactoside permease
1705 QQEH01000004.1 GCA003495575_01319 CDS open 202685-204103 _na     472_aa alsT Amino acid carrier protein
1706 QQEH01000004.1 GCA003495575_01320 CDS open 204430-205158 _na     242_aa tACO1 YebC/PmpR family DNA-binding transcriptional regulator
1707 QQEH01000004.1 GCA003495575_01321 CDS open 205217-205705 _na     162_aa dsbB Disulfide bond formation protein B
1708 QQEH01000004.1 GCA003495575_01324 CDS open 206490-206954 _na     154_aa lrp Leucine-responsive regulatory protein
1709 QQEH01000004.1 GCA003495575_01325 CDS open 207176-208234 _na     352_aa alr alanine racemase
1710 QQEH01000004.1 GCA003495575_01326 CDS open 208298-209653 _na     451_aa UPF0210 protein NMA1908
1711 QQEH01000004.1 GCA003495575_01327 CDS open 209668-209940 _na     90_aa aCT ACT domain-containing protein
1712 QQEH01000004.1 GCA003495575_01328 CDS open 210066-210929 _na     287_aa ywqK Periplasmic protein
1713 QQEH01000004.1 GCA003495575_01329 CDS open 210941-211858 _na     305_aa prmB 50S ribosomal protein L3 N(5)-glutamine methyltransferase
1714 QQEH01000004.1 GCA003495575_01130 gene open 448-582
1715 QQEH01000004.1 GCA003495575_01131 gene open 998-1546
1716 QQEH01000004.1 GCA003495575_01132 gene open 1543-1983
1717 QQEH01000004.1 GCA003495575_01133 gene open 2132-3088
1718 QQEH01000004.1 GCA003495575_01134 gene open 3103-3351
1719 QQEH01000004.1 GCA003495575_01135 gene open 3517-4377
1720 QQEH01000004.1 GCA003495575_01136 gene open 4513-4731
1721 QQEH01000004.1 GCA003495575_01137 gene open 4868-5128
1722 QQEH01000004.1 GCA003495575_01138 gene open 5170-5508
1723 QQEH01000004.1 GCA003495575_01139 gene open 5496-5864
1724 QQEH01000004.1 GCA003495575_01140 gene open 5807-6175 insH
1725 QQEH01000004.1 GCA003495575_01141 gene open 6290-6949
1726 QQEH01000004.1 GCA003495575_01142 gene open 7061-7909
1727 QQEH01000004.1 GCA003495575_01143 gene open 8374-9060
1728 QQEH01000004.1 GCA003495575_01144 gene open 9221-9859
1729 QQEH01000004.1 GCA003495575_01145 gene open 9852-10484
1730 QQEH01000004.1 GCA003495575_01146 gene open 10539-10973
1731 QQEH01000004.1 GCA003495575_01147 gene open 11866-12390 ssb
1732 QQEH01000004.1 GCA003495575_01148 gene open 12394-13779 araJ
1733 QQEH01000004.1 GCA003495575_01149 gene open 13884-14504 mltE
1734 QQEH01000004.1 GCA003495575_01150 gene open 14710-15078
1735 QQEH01000004.1 GCA003495575_01151 gene open 15241-16122
1736 QQEH01000004.1 GCA003495575_01152 gene open 16236-17903
1737 QQEH01000004.1 GCA003495575_01153 gene open 18064-19572 ppx
1738 QQEH01000004.1 GCA003495575_01154 gene open 19390-19842
1739 QQEH01000004.1 GCA003495575_01155 gene open 19927-20472
1740 QQEH01000004.1 GCA003495575_01156 gene open 20553-21563 trpS
1741 QQEH01000004.1 GCA003495575_01157 gene open 21824-24403 clpB
1742 QQEH01000004.1 GCA003495575_01158 gene open 24475-25689 aspB
1743 QQEH01000004.1 GCA003495575_01159 gene open 25778-25987 pptA
1744 QQEH01000004.1 GCA003495575_01160 gene open 26338-27603 gdhA
1745 QQEH01000004.1 GCA003495575_01161 gene open 28000-28707 gph
1746 QQEH01000004.1 GCA003495575_01162 gene open 28764-29225 recX
1747 QQEH01000004.1 GCA003495575_01163 gene open 29299-29460
1748 QQEH01000004.1 GCA003495575_01164 gene open 29613-30095 yciA
1749 QQEH01000004.1 GCA003495575_01165 gene open 30494-31507 nlpD
1750 QQEH01000004.1 GCA003495575_01166 gene open 31610-32356 surE
1751 QQEH01000004.1 GCA003495575_01167 gene open 32370-33926 mpfA
1752 QQEH01000004.1 GCA003495575_01168 gene open 34035-34820
1753 QQEH01000004.1 GCA003495575_01169 gene open 34930-36363 adhE
1754 QQEH01000004.1 GCA003495575_01170 gene open 36697-37191
1755 QQEH01000004.1 GCA003495575_01171 gene open 37349-37975
1756 QQEH01000004.1 GCA003495575_01172 gene open 38320-38700 mliC
1757 QQEH01000004.1 GCA003495575_01173 gene open 39307-41388 cstA
1758 QQEH01000004.1 GCA003495575_01174 gene open 41378-41572 ybdD
1759 QQEH01000004.1 GCA003495575_01175 gene open 41810-42370 rsuA
1760 QQEH01000004.1 GCA003495575_01176 gene open 42654-45419 cirA
1761 QQEH01000004.1 GCA003495575_01177 gene open 45822-47039 metL1
1762 QQEH01000004.1 GCA003495575_01178 gene open 47241-47969 rph
1763 QQEH01000004.1 GCA003495575_01179 gene open 48188-48652
1764 QQEH01000004.1 GCA003495575_01180 gene open 48870-49661
1765 QQEH01000004.1 GCA003495575_01181 gene open 49785-49991
1766 QQEH01000004.1 GCA003495575_01182 gene open 50116-50931
1767 QQEH01000004.1 GCA003495575_01183 gene open 51102-51956
1768 QQEH01000004.1 GCA003495575_01184 gene open 51997-53205 pncB
1769 QQEH01000004.1 GCA003495575_01185 gene open 53297-55015 argS
1770 QQEH01000004.1 GCA003495575_01186 gene open 55565-56983 mdoB
1771 QQEH01000004.1 GCA003495575_01187 gene open 58197-58943 hisM
1772 QQEH01000004.1 GCA003495575_01188 gene open 59122-59796 yncB
1773 QQEH01000004.1 GCA003495575_01189 gene open 59865-60536 rpiA
1774 QQEH01000004.1 GCA003495575_01190 gene open 60613-61095 ispF
1775 QQEH01000004.1 GCA003495575_01191 gene open 61127-61816 ispD
1776 QQEH01000004.1 GCA003495575_01192 gene open 61813-62547 dnaQ
1777 QQEH01000004.1 GCA003495575_01193 gene open 62702-64012
1778 QQEH01000004.1 GCA003495575_01194 gene open 64002-64187 ccoS
1779 QQEH01000004.1 GCA003495575_01195 gene open 64187-64486
1780 QQEH01000004.1 GCA003495575_01196 gene open 64826-66022 ackA1
1781 QQEH01000004.1 GCA003495575_01197 gene open 66433-68238 dsbD
1782 QQEH01000004.1 GCA003495575_01198 gene open 68365-68835
1783 QQEH01000004.1 GCA003495575_01199 gene open 68908-69720 hpnC
1784 QQEH01000004.1 GCA003495575_01200 gene open 69805-70287 slpA
1785 QQEH01000004.1 GCA003495575_01201 gene open 70422-70736
1786 QQEH01000004.1 GCA003495575_01202 gene open 70749-71120
1787 QQEH01000004.1 GCA003495575_01203 gene open 71315-72682 glcD
1788 QQEH01000004.1 GCA003495575_01204 gene open 72717-73223
1789 QQEH01000004.1 GCA003495575_01205 gene open 73314-73544
1790 QQEH01000004.1 GCA003495575_01206 gene open 73650-74096 smpB
1791 QQEH01000004.1 GCA003495575_01207 gene open 74151-75161 rfaF
1792 QQEH01000004.1 GCA003495575_01209 gene open 75558-76310
1793 QQEH01000004.1 GCA003495575_01210 gene open 76661-77218 ybhB
1794 QQEH01000004.1 GCA003495575_01211 gene open 77196-78044 araC
1795 QQEH01000004.1 GCA003495575_01212 gene open 78426-79571 dapE
1796 QQEH01000004.1 GCA003495575_01213 gene open 79685-80305
1797 QQEH01000004.1 GCA003495575_01214 gene open 80330-80839
1798 QQEH01000004.1 GCA003495575_01215 gene open 80925-81506 azu
1799 QQEH01000004.1 GCA003495575_01216 gene open 81765-82199
1800 QQEH01000004.1 GCA003495575_01217 gene open 82332-85082 secA
1801 QQEH01000004.1 GCA003495575_01218 gene open 85226-86998 dnaG
1802 QQEH01000004.1 GCA003495575_01219 gene open 87186-89114 rpoD
1803 QQEH01000004.1 GCA003495575_01220 gene open 89156-89698 cas4
1804 QQEH01000004.1 GCA003495575_01221 gene open 89728-89970 cas1c
1805 QQEH01000004.1 GCA003495575_01222 gene open 90079-90954
1806 QQEH01000004.1 GCA003495575_01223 gene open 91040-91690 cas4
1807 QQEH01000004.1 GCA003495575_01224 gene open 91693-92544 cas7c
1808 QQEH01000004.1 GCA003495575_01225 gene open 92557-94314 cas8c
1809 QQEH01000004.1 GCA003495575_01226 gene open 94311-94955 cas5c
1810 QQEH01000004.1 GCA003495575_01227 gene open 95186-96079
1811 QQEH01000004.1 GCA003495575_01228 gene open 96019-97683
1812 QQEH01000004.1 GCA003495575_01229 gene open 97818-98372
1813 QQEH01000004.1 GCA003495575_01230 gene open 98677-100311 pyrG
1814 QQEH01000004.1 GCA003495575_01231 gene open 100423-102093 menE
1815 QQEH01000004.1 GCA003495575_01232 gene open 102164-103267 mnmA
1816 QQEH01000004.1 GCA003495575_01233 gene open 103393-103866
1817 QQEH01000004.1 GCA003495575_01234 gene open 104003-104386 dgkA
1818 QQEH01000004.1 GCA003495575_01235 gene open 104548-105504 gshB
1819 QQEH01000004.1 GCA003495575_01236 gene open 105597-107318
1820 QQEH01000004.1 GCA003495575_01237 gene open 107397-108170 glpR
1821 QQEH01000004.1 GCA003495575_01238 gene open 108213-109115 lysO
1822 QQEH01000004.1 GCA003495575_01239 gene open 109269-109985 gntR
1823 QQEH01000004.1 GCA003495575_01240 gene open 110393-110815 yhfA
1824 QQEH01000004.1 GCA003495575_01241 gene open 110911-111579
1825 QQEH01000004.1 GCA003495575_01242 gene open 111598-112284 purN
1826 QQEH01000004.1 GCA003495575_01243 gene open 112331-113152 fkpA
1827 QQEH01000004.1 GCA003495575_01244 gene open 113261-113701
1828 QQEH01000004.1 GCA003495575_01245 gene open 113764-115170 pepA
1829 QQEH01000004.1 GCA003495575_01246 gene open 115327-116442 lptF
1830 QQEH01000004.1 GCA003495575_01247 gene open 116439-117509 lptG
1831 QQEH01000004.1 GCA003495575_01248 gene open 117719-120304 acnB
1832 QQEH01000004.1 GCA003495575_01249 gene open 120446-121441
1833 QQEH01000004.1 GCA003495575_01250 gene open 121667-122056
1834 QQEH01000004.1 GCA003495575_01251 gene open 122275-123288 ilvC
1835 QQEH01000004.1 GCA003495575_01252 gene open 123351-123644
1836 QQEH01000004.1 GCA003495575_01253 gene open 123709-124200 ilvN
1837 QQEH01000004.1 GCA003495575_01254 gene open 124211-125938 ilvB
1838 QQEH01000004.1 GCA003495575_01256 gene open 126913-127575
1839 QQEH01000004.1 GCA003495575_01257 gene open 127647-128300 hisG
1840 QQEH01000004.1 GCA003495575_01258 gene open 128404-129294
1841 QQEH01000004.1 GCA003495575_01259 gene open 129291-130580 hisD
1842 QQEH01000004.1 GCA003495575_01260 gene open 130626-131705 hisC
1843 QQEH01000004.1 GCA003495575_01261 gene open 131722-132624 hisB
1844 QQEH01000004.1 GCA003495575_01262 gene open 132700-133572
1845 QQEH01000004.1 GCA003495575_01263 gene open 133644-134696 sohB
1846 QQEH01000004.1 GCA003495575_01271 gene open 135881-136444 pgsA
1847 QQEH01000004.1 GCA003495575_01272 gene open 136550-137020
1848 QQEH01000004.1 GCA003495575_01273 gene open 137149-137484 yurZ
1849 QQEH01000004.1 GCA003495575_01274 gene open 137613-138518 mtrA
1850 QQEH01000004.1 GCA003495575_01275 gene open 138580-139077
1851 QQEH01000004.1 GCA003495575_01276 gene open 139215-140117 rhaT
1852 QQEH01000004.1 GCA003495575_01277 gene open 140158-141288 potD
1853 QQEH01000004.1 GCA003495575_01278 gene open 141459-144116
1854 QQEH01000004.1 GCA003495575_01279 gene open 145205-145888 gpmA
1855 QQEH01000004.1 GCA003495575_01280 gene open 146191-148488 parC
1856 QQEH01000004.1 GCA003495575_01281 gene open 148508-150100
1857 QQEH01000004.1 GCA003495575_01282 gene open 150093-151610
1858 QQEH01000004.1 GCA003495575_01283 gene open 151715-152467 rsmJ
1859 QQEH01000004.1 GCA003495575_01284 gene open 152542-152748
1860 QQEH01000004.1 GCA003495575_01285 gene open 152834-154003 metZ
1861 QQEH01000004.1 GCA003495575_01286 gene open 154148-154918
1862 QQEH01000004.1 GCA003495575_01287 gene open 155018-155269
1863 QQEH01000004.1 GCA003495575_01288 gene open 155321-156127 hisJ
1864 QQEH01000004.1 GCA003495575_01289 gene open 156785-159661
1865 QQEH01000004.1 GCA003495575_01290 gene open 160117-160401 yhbQ
1866 QQEH01000004.1 GCA003495575_01291 gene open 160950-162401 citT
1867 QQEH01000004.1 GCA003495575_01292 gene open 163055-164308 nuoF
1868 QQEH01000004.1 GCA003495575_01293 gene open 164305-165933 nadB
1869 QQEH01000004.1 GCA003495575_01294 gene open 165933-166571 forC
1870 QQEH01000004.1 GCA003495575_01295 gene open 167351-168874 ttdA
1871 QQEH01000004.1 GCA003495575_01296 gene open 168972-170384 trkA
1872 QQEH01000004.1 GCA003495575_01297 gene open 170918-171202 yhbQ
1873 QQEH01000004.1 GCA003495575_01298 gene open 171976-174663 brkA
1874 QQEH01000004.1 GCA003495575_01300 gene open 175817-176623 thiD
1875 QQEH01000004.1 GCA003495575_01301 gene open 176681-177535 tehB
1876 QQEH01000004.1 GCA003495575_01302 gene open 177576-178100 rnhA
1877 QQEH01000004.1 GCA003495575_01303 gene open 178853-179257 hinT
1878 QQEH01000004.1 GCA003495575_01304 gene open 179297-180481 ldcA
1879 QQEH01000004.1 GCA003495575_01305 gene open 180583-182838 norB
1880 QQEH01000004.1 GCA003495575_01306 gene open 183210-184388 nirK
1881 QQEH01000004.1 GCA003495575_01307 gene open 184566-185321 yfmG
1882 QQEH01000004.1 GCA003495575_01308 gene open 185653-186210 nfnB
1883 QQEH01000004.1 GCA003495575_01309 gene open 186286-187920 opgE
1884 QQEH01000004.1 GCA003495575_01310 gene open 188311-189417 serC
1885 QQEH01000004.1 GCA003495575_01311 gene open 189761-190192 rimP
1886 QQEH01000004.1 GCA003495575_01312 gene open 190220-191722 nusA
1887 QQEH01000004.1 GCA003495575_01313 gene open 191735-194623 infB
1888 QQEH01000004.1 GCA003495575_01314 gene open 194774-196114
1889 QQEH01000004.1 GCA003495575_01315 gene open 196176-197525
1890 QQEH01000004.1 GCA003495575_01316 gene open 197765-197908
1891 QQEH01000004.1 GCA003495575_01317 gene open 197915-200953
1892 QQEH01000004.1 GCA003495575_01318 gene open 200964-202226
1893 QQEH01000004.1 GCA003495575_01319 gene open 202685-204103 alsT
1894 QQEH01000004.1 GCA003495575_01320 gene open 204430-205158 tACO1
1895 QQEH01000004.1 GCA003495575_01321 gene open 205217-205705 dsbB
1896 QQEH01000004.1 GCA003495575_01324 gene open 206490-206954 lrp
1897 QQEH01000004.1 GCA003495575_01325 gene open 207176-208234 alr
1898 QQEH01000004.1 GCA003495575_01326 gene open 208298-209653
1899 QQEH01000004.1 GCA003495575_01327 gene open 209668-209940 aCT
1900 QQEH01000004.1 GCA003495575_01328 gene open 210066-210929 ywqK
1901 QQEH01000004.1 GCA003495575_01329 gene open 210941-211858 prmB
1902 QQEH01000004.1 GCA003495575_01208 gene open 75292-75367 trnN
1903 QQEH01000004.1 GCA003495575_01255 gene open 126552-126636 trnL
1904 QQEH01000004.1 GCA003495575_01264 gene open 135137-135226 trnL
1905 QQEH01000004.1 GCA003495575_01265 gene open 135239-135316 trnA
1906 QQEH01000004.1 GCA003495575_01266 gene open 135329-135402 trnC
1907 QQEH01000004.1 GCA003495575_01267 gene open 135428-135503 trnG
1908 QQEH01000004.1 GCA003495575_01268 gene open 135525-135600 trnG
1909 QQEH01000004.1 GCA003495575_01269 gene open 135624-135699 trnG
1910 QQEH01000004.1 GCA003495575_01270 gene open 135725-135800 trnG
1911 QQEH01000004.1 GCA003495575_01299 gene open 174875-174950 trnE
1912 QQEH01000004.1 GCA003495575_01208 tRNA open 75292-75367 trnN tRNA-Asn(gtt)
1913 QQEH01000004.1 GCA003495575_01255 tRNA open 126552-126636 trnL tRNA-Leu(caa)
1914 QQEH01000004.1 GCA003495575_01264 tRNA open 135137-135226 trnL tRNA-Leu(taa)
1915 QQEH01000004.1 GCA003495575_01265 tRNA open 135239-135316 trnA tRNA-Ala(tgc)
1916 QQEH01000004.1 GCA003495575_01266 tRNA open 135329-135402 trnC tRNA-Cys(gca)
1917 QQEH01000004.1 GCA003495575_01267 tRNA open 135428-135503 trnG tRNA-Gly(gcc)
1918 QQEH01000004.1 GCA003495575_01268 tRNA open 135525-135600 trnG tRNA-Gly(gcc)
1919 QQEH01000004.1 GCA003495575_01269 tRNA open 135624-135699 trnG tRNA-Gly(gcc)
1920 QQEH01000004.1 GCA003495575_01270 tRNA open 135725-135800 trnG tRNA-Gly(gcc)
1921 QQEH01000004.1 GCA003495575_01299 tRNA open 174875-174950 trnE tRNA-Glu(ttc)
1922 QQEH01000005.1 regulatory_region open 22806-22913 SAM-I/IV (S-adenosyl methionine) riboswitch aptamer
1923 QQEH01000005.1 regulatory_region open 96864-96961 Glycine riboswitch aptamer
1924 QQEH01000005.1 regulatory_region open 134048-134172 Ribosomal S15 leader
1925 QQEH01000005.1 repeat_region open 201121-204794 CRISPR array with 56 repeats of length 32%2C consensus sequence TCAGCCGCCTCTAGGCGGCTGTGTGTTGAAAC and spacer length 34
1926 QQEH01000005.1 GCA003495575_00170 CDS open 507-1928 _na     473_aa rfbX Lipopolysaccharide biosynthesis translocase
1927 QQEH01000005.1 GCA003495575_00171 CDS open 2123-3232 _na     369_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
1928 QQEH01000005.1 GCA003495575_00172 CDS open 3264-3728 _na     154_aa nrdR Transcriptional repressor NrdR
1929 QQEH01000005.1 GCA003495575_00173 CDS open 3758-4600 _na     280_aa yafJ Class II glutamine amidotransferase domain protein
1930 QQEH01000005.1 GCA003495575_00174 CDS open 5509-6588 _na     359_aa aroB 3-dehydroquinate synthase
1931 QQEH01000005.1 GCA003495575_00175 CDS open 6673-7185 _na     170_aa aroK Putative shikimate kinase
1932 QQEH01000005.1 GCA003495575_00176 CDS open 7997-10174 _na     725_aa pilQ Type IV pilus biogenesis and competence protein PilQ
1933 QQEH01000005.1 GCA003495575_00177 CDS open 10192-10737 _na     181_aa Pilus assembly protein
1934 QQEH01000005.1 GCA003495575_00178 CDS open 10755-11417 _na     220_aa Pilus assembly protein
1935 QQEH01000005.1 GCA003495575_00179 CDS open 11418-12017 _na     199_aa pilN type IV pilus inner membrane platform protein PilN
1936 QQEH01000005.1 GCA003495575_00180 CDS open 12020-13135 _na     371_aa gspL type IV pilus inner membrane platform protein PilM
1937 QQEH01000005.1 GCA003495575_00181 CDS open 13286-15682 _na     798_aa mrcA Penicillin-binding protein 1A
1938 QQEH01000005.1 GCA003495575_00182 CDS open 15806-16429 _na     207_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
1939 QQEH01000005.1 GCA003495575_00183 CDS open 16640-17263 _na     207_aa cytC553 Cytochrome C
1940 QQEH01000005.1 GCA003495575_00184 CDS open 17461-19485 _na     674_aa resB Cytochrome biogenesis protein
1941 QQEH01000005.1 GCA003495575_00185 CDS open 19469-20656 _na     395_aa ccsB c-type cytochrome biogenesis protein CcsB
1942 QQEH01000005.1 GCA003495575_00186 CDS open 20745-21809 _na     354_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
1943 QQEH01000005.1 GCA003495575_00187 CDS open 21853-22704 _na     283_aa lysophospholipid acyltransferase family protein
1944 QQEH01000005.1 GCA003495575_00188 CDS open 23101-24270 _na     389_aa metK methionine adenosyltransferase
1945 QQEH01000005.1 GCA003495575_00189 CDS open 24334-25743 _na     469_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
1946 QQEH01000005.1 GCA003495575_00190 CDS open 25908-26474 _na     188_aa ssuE NADPH-dependent FMN reductase-like domain-containing protein
1947 QQEH01000005.1 GCA003495575_00191 CDS open 26803-27072 _na     89_aa Carboxylate/amino acid/amine transporter
1948 QQEH01000005.1 GCA003495575_00192 CDS open 27042-27254 _na     70_aa eamA EamA family transporter
1949 QQEH01000005.1 GCA003495575_00193 CDS open 27480-28265 _na     261_aa ygiD 4%2C5-DOPA dioxygenase extradiol
1950 QQEH01000005.1 GCA003495575_00194 CDS open 28348-28767 _na     139_aa hypothetical protein
1951 QQEH01000005.1 GCA003495575_00195 CDS open 28885-29259 _na     124_aa SnoaL-like domain-containing protein
1952 QQEH01000005.1 GCA003495575_00196 CDS open 29397-29627 _na     76_aa MoaF-like domain-containing protein
1953 QQEH01000005.1 GCA003495575_00197 CDS open 29673-30050 _na     125_aa Putative membrane protein
1954 QQEH01000005.1 GCA003495575_00198 CDS open 29909-30463 _na     184_aa Insertion element IS1106 transposase
1955 QQEH01000005.1 GCA003495575_00199 CDS open 30406-30774 _na     122_aa insH Transposase InsH N-terminal domain-containing protein
1956 QQEH01000005.1 GCA003495575_00200 CDS open 30917-32410 _na     497_aa rng ribonuclease G
1957 QQEH01000005.1 GCA003495575_00201 CDS open 32624-32881 _na     85_aa grxC glutaredoxin 3
1958 QQEH01000005.1 GCA003495575_00202 CDS open 32902-33345 _na     147_aa secB protein-export chaperone SecB
1959 QQEH01000005.1 GCA003495575_00203 CDS open 33431-35473 _na     680_aa recG ATP-dependent DNA helicase RecG
1960 QQEH01000005.1 GCA003495575_00204 CDS open 35982-37025 _na     347_aa argC N-acetyl-gamma-glutamyl-phosphate reductase
1961 QQEH01000005.1 GCA003495575_00205 CDS open 37099-37548 _na     149_aa Secreted protein
1962 QQEH01000005.1 GCA003495575_00206 CDS open 37553-38773 _na     406_aa Ribonuclease BN
1963 QQEH01000005.1 GCA003495575_00207 CDS open 39290-39949 _na     219_aa queC 7-cyano-7-deazaguanine synthase QueC
1964 QQEH01000005.1 GCA003495575_00208 CDS open 39977-40498 _na     173_aa DUF1543 domain-containing protein
1965 QQEH01000005.1 GCA003495575_00209 CDS open 40505-40927 _na     140_aa queD 6-carboxytetrahydropterin synthase QueD
1966 QQEH01000005.1 GCA003495575_00210 CDS open 41300-41671 _na     123_aa DUF1304 domain-containing protein
1967 QQEH01000005.1 GCA003495575_00211 CDS open 41668-42306 _na     212_aa queE 7-carboxy-7-deazaguanine synthase
1968 QQEH01000005.1 GCA003495575_00213 CDS open 42943-44028 _na     361_aa nagZ beta-N-acetylhexosaminidase
1969 QQEH01000005.1 GCA003495575_00214 CDS open 44085-45605 _na     506_aa nhaC Na+/H+ antiporter NhaC-like C-terminal domain-containing protein
1970 QQEH01000005.1 GCA003495575_00215 CDS open 45803-47302 _na     499_aa degQ putative periplasmic serine endoprotease DegP-like
1971 QQEH01000005.1 GCA003495575_00216 CDS open 47440-48069 _na     209_aa nth endonuclease III
1972 QQEH01000005.1 GCA003495575_00217 CDS open 48115-48528 _na     137_aa ygaA DedA family protein
1973 QQEH01000005.1 GCA003495575_00218 CDS open 48931-50310 _na     459_aa nhaC Na+/H+ antiporter NhaC
1974 QQEH01000005.1 GCA003495575_00219 CDS open 50439-51263 _na     274_aa corC Magnesium and cobalt efflux protein CorC
1975 QQEH01000005.1 GCA003495575_00220 CDS open 51265-51780 _na     171_aa ybeY rRNA maturation RNase YbeY
1976 QQEH01000005.1 GCA003495575_00221 CDS open 51856-52836 _na     326_aa hemC hydroxymethylbilane synthase
1977 QQEH01000005.1 GCA003495575_00222 CDS open 52926-54119 _na     397_aa tyrB Aminotransferase
1978 QQEH01000005.1 GCA003495575_00223 CDS open 54338-54541 _na     67_aa Zinc finger CHCC-type domain-containing protein
1979 QQEH01000005.1 GCA003495575_00224 CDS open 54709-56295 _na     528_aa lldP L-lactate permease
1980 QQEH01000005.1 GCA003495575_00225 CDS open 56564-57286 _na     240_aa lpxH UDP-2%2C3-diacylglucosamine diphosphatase
1981 QQEH01000005.1 GCA003495575_00226 CDS open 57535-61020 _na     1161_aa smc chromosome segregation protein SMC
1982 QQEH01000005.1 GCA003495575_00227 CDS open 61289-62335 _na     348_aa adhP alcohol dehydrogenase AdhP
1983 QQEH01000005.1 GCA003495575_00228 CDS open 62771-63160 _na     129_aa Prepilin-type cleavage/methylation N-terminal domain protein
1984 QQEH01000005.1 GCA003495575_00229 CDS open 63281-64561 _na     426_aa acrA Putative membrane fusion protein
1985 QQEH01000005.1 GCA003495575_00230 CDS open 64632-66566 _na     644_aa macB Macrolide export ATP-binding/permease protein MacB
1986 QQEH01000005.1 GCA003495575_00231 CDS open 66662-67444 _na     260_aa dsbG Thiol:disulfide interchange protein
1987 QQEH01000005.1 GCA003495575_00232 CDS open 67701-68366 _na     221_aa ardA Antirestriction protein ArdA
1988 QQEH01000005.1 GCA003495575_00233 CDS open 68408-70597 _na     729_aa priA primosomal protein N'
1989 QQEH01000005.1 GCA003495575_00234 CDS open 70643-71740 _na     365_aa nnrS Integral membrane protein
1990 QQEH01000005.1 GCA003495575_00235 CDS open 72018-72710 _na     230_aa tauB ABC transporter ATP-binding protein
1991 QQEH01000005.1 GCA003495575_00236 CDS open 72710-73507 _na     265_aa tauC ABC transmembrane type-1 domain-containing protein
1992 QQEH01000005.1 GCA003495575_00237 CDS open 73956-74933 _na     325_aa tauA SsuA/THI5-like domain-containing protein
1993 QQEH01000005.1 GCA003495575_00238 CDS open 74990-76909 _na     639_aa TonB-dependent receptor
1994 QQEH01000005.1 GCA003495575_00239 CDS open 77280-79208 _na     642_aa dnaK molecular chaperone DnaK
1995 QQEH01000005.1 GCA003495575_00240 CDS open 79416-79688 _na     90_aa Secreted protein
1996 QQEH01000005.1 GCA003495575_00241 CDS open 79875-80561 _na     228_aa Repressor protein
1997 QQEH01000005.1 GCA003495575_00242 CDS open 80692-81030 _na     112_aa erpA iron-sulfur cluster insertion protein ErpA
1998 QQEH01000005.1 GCA003495575_00243 CDS open 81190-81654 _na     154_aa Peptidase
1999 QQEH01000005.1 GCA003495575_00244 CDS open 81689-83200 _na     503_aa ubiB ubiquinone biosynthesis regulatory protein kinase UbiB
2000 QQEH01000005.1 GCA003495575_00245 CDS open 83557-84375 _na     272_aa cysE serine O-acetyltransferase