HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Neisseria lactamica (GCA_003496665.1)

Select a Genome:
BAKTA Annotations for GCA_003496665.1
Genome Selected: Neisseria lactamica
ContigsBases CDSrRNA tmRNAtRNA
71 2182710 2045 3 1 57
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4241 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4241 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 QQCF01000001.1 GCA003496665_00148 gene open 134855-134927 nse_sRNA
2 QQCF01000001.1 GCA003496665_00164 gene open 158001-158062 porB
3 QQCF01000001.1 GCA003496665_00148 ncRNA open 134855-134927 Neisseria sigma-E sRNA
4 QQCF01000001.1 GCA003496665_00164 ncRNA open 158001-158062 porB porB RNA
5 QQCF01000001.1 regulatory_region open 102246-102353 SAM-I/IV (S-adenosyl methionine) riboswitch aptamer
6 QQCF01000001.1 repeat_region open 143377-143818 CRISPR array with 7 repeats of length 36%2C consensus sequence ATTGTAGCACTGCGAAATGAGAAAGGGAGCTACAAC and spacer length 30
7 QQCF01000001.1 GCA003496665_00001 CDS open 222-800 _na     192_aa grpE nucleotide exchange factor GrpE
8 QQCF01000001.1 GCA003496665_00002 CDS open 983-1801 _na     272_aa cysE serine O-acetyltransferase
9 QQCF01000001.1 GCA003496665_00003 CDS open 2005-3516 _na     503_aa ubiB ubiquinone biosynthesis regulatory protein kinase UbiB
10 QQCF01000001.1 GCA003496665_00004 CDS open 3551-4015 _na     154_aa Peptidase
11 QQCF01000001.1 GCA003496665_00005 CDS open 4175-4513 _na     112_aa erpA iron-sulfur cluster insertion protein ErpA
12 QQCF01000001.1 GCA003496665_00006 CDS open 4644-5330 _na     228_aa Repressor protein
13 QQCF01000001.1 GCA003496665_00007 CDS open 5517-5789 _na     90_aa Secreted protein
14 QQCF01000001.1 GCA003496665_00008 CDS open 5997-7925 _na     642_aa dnaK molecular chaperone DnaK
15 QQCF01000001.1 GCA003496665_00009 CDS open 8150-8464 _na     104_aa hypothetical protein
16 QQCF01000001.1 GCA003496665_00010 CDS open 8566-10065 _na     499_aa TonB-dependent receptor
17 QQCF01000001.1 GCA003496665_00011 CDS open 10122-11099 _na     325_aa tauA SsuA/THI5-like domain-containing protein
18 QQCF01000001.1 GCA003496665_00012 CDS open 11548-12345 _na     265_aa tauC ABC transmembrane type-1 domain-containing protein
19 QQCF01000001.1 GCA003496665_00013 CDS open 12345-13037 _na     230_aa tauB ABC transporter ATP-binding protein
20 QQCF01000001.1 GCA003496665_00014 CDS open 13323-13937 _na     204_aa cadD Cadmium resistance transporter family protein
21 QQCF01000001.1 GCA003496665_00015 CDS open 14232-15329 _na     365_aa nnrS Integral membrane protein
22 QQCF01000001.1 GCA003496665_00016 CDS open 15376-17565 _na     729_aa priA primosomal protein N'
23 QQCF01000001.1 GCA003496665_00017 CDS open 17611-18276 _na     221_aa ardA Antirestriction protein ArdA
24 QQCF01000001.1 GCA003496665_00018 CDS open 18532-19314 _na     260_aa dsbG Thiol:disulfide interchange protein
25 QQCF01000001.1 GCA003496665_00019 CDS open 19409-21343 _na     644_aa macB Macrolide export ATP-binding/permease protein MacB
26 QQCF01000001.1 GCA003496665_00020 CDS open 21409-22692 _na     427_aa acrA Putative membrane fusion protein
27 QQCF01000001.1 GCA003496665_00021 CDS open 22813-23202 _na     129_aa Prepilin-type cleavage/methylation N-terminal domain protein
28 QQCF01000001.1 GCA003496665_00022 CDS open 23484-24530 _na     348_aa adhP alcohol dehydrogenase AdhP
29 QQCF01000001.1 GCA003496665_00023 CDS open 24606-28091 _na     1161_aa smc chromosome segregation protein SMC
30 QQCF01000001.1 GCA003496665_00024 CDS open 28277-29668 _na     463_aa YadA-like family protein
31 QQCF01000001.1 GCA003496665_00025 CDS open 29868-30590 _na     240_aa lpxH UDP-2%2C3-diacylglucosamine diphosphatase
32 QQCF01000001.1 GCA003496665_00026 CDS open 30858-32444 _na     528_aa lldP L-lactate permease
33 QQCF01000001.1 GCA003496665_00027 CDS open 32612-32815 _na     67_aa Zinc-finger domain-containing protein
34 QQCF01000001.1 GCA003496665_00028 CDS open 33034-34227 _na     397_aa tyrB Aminotransferase
35 QQCF01000001.1 GCA003496665_00029 CDS open 34317-35297 _na     326_aa hemC hydroxymethylbilane synthase
36 QQCF01000001.1 GCA003496665_00030 CDS open 35373-35888 _na     171_aa ybeY rRNA maturation RNase YbeY
37 QQCF01000001.1 GCA003496665_00031 CDS open 35890-36714 _na     274_aa corC Magnesium and cobalt efflux protein CorC
38 QQCF01000001.1 GCA003496665_00032 CDS open 36844-38223 _na     459_aa nhaC Na+/H+ antiporter NhaC
39 QQCF01000001.1 GCA003496665_00033 CDS open 38667-38948 _na     93_aa hypothetical protein
40 QQCF01000001.1 GCA003496665_00034 CDS open 39103-39516 _na     137_aa ygaA DedA family protein
41 QQCF01000001.1 GCA003496665_00035 CDS open 39562-40191 _na     209_aa nth endonuclease III
42 QQCF01000001.1 GCA003496665_00036 CDS open 40329-41828 _na     499_aa degQ putative periplasmic serine endoprotease DegP-like
43 QQCF01000001.1 GCA003496665_00037 CDS open 42026-43546 _na     506_aa nhaC Na+/H+ antiporter NhaC-like C-terminal domain-containing protein
44 QQCF01000001.1 GCA003496665_00038 CDS open 43603-44688 _na     361_aa nagZ beta-N-acetylhexosaminidase
45 QQCF01000001.1 GCA003496665_00040 CDS open 45433-45738 _na     101_aa uvrD DNA helicase UvrD
46 QQCF01000001.1 GCA003496665_00041 CDS open 45717-46322 _na     201_aa Phage associated protein
47 QQCF01000001.1 GCA003496665_00042 CDS open 46365-48326 _na     653_aa pyocin knob domain-containing protein
48 QQCF01000001.1 GCA003496665_00043 CDS open 48337-48900 _na     187_aa Phage tail protein
49 QQCF01000001.1 GCA003496665_00044 CDS open 48897-49952 _na     351_aa Baseplate protein J-like domain-containing protein
50 QQCF01000001.1 GCA003496665_00045 CDS open 49949-50356 _na     135_aa Phage protein GP46
51 QQCF01000001.1 GCA003496665_00046 CDS open 50414-51043 _na     209_aa Bacteriophage Mu Gp45 protein
52 QQCF01000001.1 GCA003496665_00047 CDS open 51044-52183 _na     379_aa putative protein rth43
53 QQCF01000001.1 GCA003496665_00048 CDS open 52167-53534 _na     455_aa DNA circulation%2C N-terminal domain protein
54 QQCF01000001.1 GCA003496665_00049 CDS open 53544-55676 _na     710_aa Phage tail tape measure protein domain-containing protein
55 QQCF01000001.1 GCA003496665_00050 CDS open 55882-56268 _na     128_aa Phage tail assembly chaperone
56 QQCF01000001.1 GCA003496665_00051 CDS open 56362-56736 _na     124_aa Phage tail protein
57 QQCF01000001.1 GCA003496665_00052 CDS open 56749-58176 _na     475_aa Bacteriophage Mu tail sheath protein (GpL)
58 QQCF01000001.1 GCA003496665_00053 CDS open 58173-58355 _na     60_aa DUF2635 domain-containing protein
59 QQCF01000001.1 GCA003496665_00054 CDS open 58348-58953 _na     201_aa DUF1834 domain-containing protein
60 QQCF01000001.1 GCA003496665_00055 CDS open 58994-59419 _na     141_aa DUF1320 domain-containing protein
61 QQCF01000001.1 GCA003496665_00056 CDS open 59419-59844 _na     141_aa putative protein rth32
62 QQCF01000001.1 GCA003496665_00057 CDS open 59886-60788 _na     300_aa Bacteriophage Mu GpT domain-containing protein
63 QQCF01000001.1 GCA003496665_00058 CDS open 60811-61884 _na     357_aa Mu-like prophage I protein
64 QQCF01000001.1 GCA003496665_00059 CDS open 62084-62578 _na     164_aa phage virion morphogenesis protein
65 QQCF01000001.1 GCA003496665_00060 CDS open 62805-64151 _na     448_aa phage minor head protein
66 QQCF01000001.1 GCA003496665_00061 CDS open 64144-65697 _na     517_aa DUF935 domain-containing protein
67 QQCF01000001.1 GCA003496665_00062 CDS open 65775-67397 _na     540_aa Phage putative protein domain protein
68 QQCF01000001.1 GCA003496665_00063 CDS open 67412-67915 _na     167_aa Phage associated protein
69 QQCF01000001.1 GCA003496665_00064 CDS open 68205-68711 _na     168_aa DNA-binding protein
70 QQCF01000001.1 GCA003496665_00065 CDS open 68714-68911 _na     65_aa Phage protein
71 QQCF01000001.1 GCA003496665_00066 CDS open 68908-69174 _na     88_aa Phage protein
72 QQCF01000001.1 GCA003496665_00067 CDS open 69186-69527 _na     113_aa Phage protein
73 QQCF01000001.1 GCA003496665_00068 CDS open 69524-69718 _na     64_aa hypothetical protein
74 QQCF01000001.1 GCA003496665_00069 CDS open 69738-70157 _na     139_aa Phage related protein
75 QQCF01000001.1 GCA003496665_00070 CDS open 70129-70365 _na     78_aa Phage protein
76 QQCF01000001.1 GCA003496665_00071 CDS open 70368-70532 _na     54_aa Phage protein
77 QQCF01000001.1 GCA003496665_00072 CDS open 70535-70708 _na     57_aa hypothetical protein
78 QQCF01000001.1 GCA003496665_00073 CDS open 70705-71250 _na     181_aa amiC N-acetylmuramoyl-L-alanine amidase
79 QQCF01000001.1 GCA003496665_00074 CDS open 71394-72029 _na     211_aa Lipoprotein
80 QQCF01000001.1 GCA003496665_00075 CDS open 72076-72516 _na     146_aa Mor transcription activator family protein
81 QQCF01000001.1 GCA003496665_00076 CDS open 72516-72917 _na     133_aa gemA Regulatory protein GemA
82 QQCF01000001.1 GCA003496665_00077 CDS open 73341-73526 _na     61_aa Phage associated protein
83 QQCF01000001.1 GCA003496665_00078 CDS open 73677-74267 _na     196_aa Toxin-antitoxin system%2C toxin component%2C Bro family
84 QQCF01000001.1 GCA003496665_00079 CDS open 74271-74486 _na     71_aa hypothetical protein
85 QQCF01000001.1 GCA003496665_00080 CDS open 74646-75164 _na     172_aa Bacteriophage Mu Gam like protein
86 QQCF01000001.1 GCA003496665_00081 CDS open 75157-75303 _na     48_aa hypothetical protein
87 QQCF01000001.1 GCA003496665_00082 CDS open 75300-75815 _na     171_aa hypothetical protein
88 QQCF01000001.1 GCA003496665_00083 CDS open 75812-76297 _na     161_aa DUF2752 domain-containing protein
89 QQCF01000001.1 GCA003496665_00084 CDS open 76294-76650 _na     118_aa ABC transmembrane type-1 domain-containing protein
90 QQCF01000001.1 GCA003496665_00085 CDS open 76647-76844 _na     65_aa pyrophosphate-energized proton pump
91 QQCF01000001.1 GCA003496665_00086 CDS open 76844-77011 _na     55_aa Phage associated protein
92 QQCF01000001.1 GCA003496665_00087 CDS open 77100-77255 _na     51_aa Phage associated protein
93 QQCF01000001.1 GCA003496665_00088 CDS open 77252-77371 _na     39_aa DNA polymerase IV
94 QQCF01000001.1 GCA003496665_00089 CDS open 77364-77630 _na     88_aa Lipoprotein
95 QQCF01000001.1 GCA003496665_00090 CDS open 77719-78633 _na     304_aa HTH cro/C1-type domain-containing protein
96 QQCF01000001.1 GCA003496665_00091 CDS open 78669-80651 _na     660_aa Mu transposase C-terminal domain-containing protein
97 QQCF01000001.1 GCA003496665_00092 CDS open 80659-80835 _na     58_aa DNA-binding protein
98 QQCF01000001.1 GCA003496665_00093 CDS open 80942-81301 _na     119_aa Helix-turn-helix domain-containing protein
99 QQCF01000001.1 GCA003496665_00094 CDS open 81463-81816 _na     117_aa helix-turn-helix domain-containing protein
100 QQCF01000001.1 GCA003496665_00095 CDS open 81874-82278 _na     134_aa Repressor
101 QQCF01000001.1 GCA003496665_00096 CDS open 82670-83308 _na     212_aa queE 7-carboxy-7-deazaguanine synthase
102 QQCF01000001.1 GCA003496665_00097 CDS open 83305-83676 _na     123_aa DUF1304 domain-containing protein
103 QQCF01000001.1 GCA003496665_00098 CDS open 84049-84471 _na     140_aa queD 6-carboxytetrahydropterin synthase QueD
104 QQCF01000001.1 GCA003496665_00099 CDS open 84478-84999 _na     173_aa DUF1543 domain-containing protein
105 QQCF01000001.1 GCA003496665_00100 CDS open 85134-85790 _na     218_aa queC 7-cyano-7-deazaguanine synthase QueC
106 QQCF01000001.1 GCA003496665_00101 CDS open 86307-87527 _na     406_aa Ribonuclease BN
107 QQCF01000001.1 GCA003496665_00102 CDS open 87532-87981 _na     149_aa Secreted protein
108 QQCF01000001.1 GCA003496665_00103 CDS open 88055-89098 _na     347_aa argC N-acetyl-gamma-glutamyl-phosphate reductase
109 QQCF01000001.1 GCA003496665_00104 CDS open 89536-91578 _na     680_aa recG ATP-dependent DNA helicase RecG
110 QQCF01000001.1 GCA003496665_00105 CDS open 91664-92107 _na     147_aa secB protein-export chaperone SecB
111 QQCF01000001.1 GCA003496665_00106 CDS open 92128-92385 _na     85_aa grxC glutaredoxin 3
112 QQCF01000001.1 GCA003496665_00107 CDS open 92599-94092 _na     497_aa rng ribonuclease G
113 QQCF01000001.1 GCA003496665_00108 CDS open 94236-94604 _na     122_aa insH Transposase InsH N-terminal domain-containing protein
114 QQCF01000001.1 GCA003496665_00109 CDS open 94961-95338 _na     125_aa Putative membrane protein
115 QQCF01000001.1 GCA003496665_00110 CDS open 95384-95707 _na     107_aa MoaF-like domain-containing protein
116 QQCF01000001.1 GCA003496665_00111 CDS open 95747-96121 _na     124_aa SnoaL-like domain-containing protein
117 QQCF01000001.1 GCA003496665_00112 CDS open 96239-96658 _na     139_aa hypothetical protein
118 QQCF01000001.1 GCA003496665_00113 CDS open 96741-97526 _na     261_aa ygiD 4%2C5-DOPA dioxygenase extradiol
119 QQCF01000001.1 GCA003496665_00114 CDS open 97752-97964 _na     70_aa eamA EamA family transporter
120 QQCF01000001.1 GCA003496665_00115 CDS open 97934-98203 _na     89_aa Carboxylate/amino acid/amine transporter
121 QQCF01000001.1 GCA003496665_00116 CDS open 98532-99098 _na     188_aa ssuE NADPH-dependent FMN reductase-like domain-containing protein
122 QQCF01000001.1 GCA003496665_00117 CDS open 99146-99445 _na     99_aa hypothetical protein
123 QQCF01000001.1 GCA003496665_00118 CDS open 99442-100674 _na     410_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
124 QQCF01000001.1 GCA003496665_00119 CDS open 100889-102058 _na     389_aa metK methionine adenosyltransferase
125 QQCF01000001.1 GCA003496665_00120 CDS open 102358-103305 _na     315_aa lysophospholipid acyltransferase family protein
126 QQCF01000001.1 GCA003496665_00121 CDS open 103349-104413 _na     354_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
127 QQCF01000001.1 GCA003496665_00122 CDS open 104502-105689 _na     395_aa ccsB c-type cytochrome biogenesis protein CcsB
128 QQCF01000001.1 GCA003496665_00123 CDS open 105673-107697 _na     674_aa resB Cytochrome biogenesis protein
129 QQCF01000001.1 GCA003496665_00124 CDS open 107895-108518 _na     207_aa cytC553 Cytochrome C
130 QQCF01000001.1 GCA003496665_00125 CDS open 108729-109352 _na     207_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
131 QQCF01000001.1 GCA003496665_00126 CDS open 109476-111872 _na     798_aa mrcA Penicillin-binding protein 1A
132 QQCF01000001.1 GCA003496665_00127 CDS open 112023-113138 _na     371_aa gspL type IV pilus inner membrane platform protein PilM
133 QQCF01000001.1 GCA003496665_00128 CDS open 113141-113740 _na     199_aa pilN type IV pilus inner membrane platform protein PilN
134 QQCF01000001.1 GCA003496665_00129 CDS open 113741-114403 _na     220_aa Pilus assembly protein
135 QQCF01000001.1 GCA003496665_00130 CDS open 114421-114966 _na     181_aa Pilus assembly protein
136 QQCF01000001.1 GCA003496665_00131 CDS open 114984-117161 _na     725_aa pilQ Type IV pilus biogenesis and competence protein PilQ
137 QQCF01000001.1 GCA003496665_00132 CDS open 118799-119311 _na     170_aa aroK Putative shikimate kinase
138 QQCF01000001.1 GCA003496665_00133 CDS open 119396-120475 _na     359_aa aroB 3-dehydroquinate synthase
139 QQCF01000001.1 GCA003496665_00134 CDS open 121005-121847 _na     280_aa yafJ Class II glutamine amidotransferase domain protein
140 QQCF01000001.1 GCA003496665_00135 CDS open 121877-122341 _na     154_aa nrdR Transcriptional repressor NrdR
141 QQCF01000001.1 GCA003496665_00136 CDS open 122373-123482 _na     369_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
142 QQCF01000001.1 GCA003496665_00137 CDS open 123585-125006 _na     473_aa rfbX Lipopolysaccharide biosynthesis translocase
143 QQCF01000001.1 GCA003496665_00138 CDS open 125003-126076 _na     357_aa rfaB Glycosyl transferase
144 QQCF01000001.1 GCA003496665_00139 CDS open 126096-127265 _na     389_aa glycosyltransferase
145 QQCF01000001.1 GCA003496665_00140 CDS open 127258-128499 _na     413_aa wcaJ Lipid carrier: UDP-N-acetylgalactosaminyltransferase
146 QQCF01000001.1 GCA003496665_00141 CDS open 128600-129805 _na     401_aa wecE Putative 8-amino-7-oxononanoate synthase
147 QQCF01000001.1 GCA003496665_00142 CDS open 129853-131763 _na     636_aa flaA1 Pilin glycosylation protein
148 QQCF01000001.1 GCA003496665_00143 CDS open 131823-133115 _na     430_aa avtA valine--pyruvate transaminase
149 QQCF01000001.1 GCA003496665_00144 CDS open 133167-134003 _na     278_aa yciV S-adenosylmethionine:tRNA ribosyltransferase-isomerase
150 QQCF01000001.1 GCA003496665_00145 CDS open 134140-134349 _na     69_aa Oxidoreductase-like domain-containing protein
151 QQCF01000001.1 GCA003496665_00146 CDS open 134327-134560 _na     77_aa ybcJ Ribosome-associated protein YbcJ%2C S4-like RNA-binding protein
152 QQCF01000001.1 GCA003496665_00147 CDS open 134664-134813 _na     49_aa hypothetical protein
153 QQCF01000001.1 GCA003496665_00149 CDS open 135056-138490 _na     1144_aa dnaE DNA polymerase III subunit alpha
154 QQCF01000001.1 GCA003496665_00150 CDS open 138769-142014 _na     1081_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
155 QQCF01000001.1 GCA003496665_00151 CDS open 142080-142994 _na     304_aa cas1 type II CRISPR-associated endonuclease Cas1
156 QQCF01000001.1 GCA003496665_00152 CDS open 143005-143313 _na     102_aa cas2 CRISPR-associated endonuclease Cas2
157 QQCF01000001.1 GCA003496665_00153 CDS open 143954-144046 _na     30_aa hypothetical protein
158 QQCF01000001.1 GCA003496665_00154 CDS open 144557-145489 _na     310_aa ybbA Esterase
159 QQCF01000001.1 GCA003496665_00155 CDS open 145559-147676 _na     705_aa Putative TonB-dependent receptor
160 QQCF01000001.1 GCA003496665_00156 CDS open 147836-148495 _na     219_aa gph HAD hydrolase%2C IA family
161 QQCF01000001.1 GCA003496665_00157 CDS open 148582-149550 _na     322_aa ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
162 QQCF01000001.1 GCA003496665_00158 CDS open 149580-150074 _na     164_aa lspA signal peptidase II
163 QQCF01000001.1 GCA003496665_00159 CDS open 150831-153620 _na     929_aa ileS isoleucine--tRNA ligase
164 QQCF01000001.1 GCA003496665_00160 CDS open 153763-154683 _na     306_aa ribF bifunctional riboflavin kinase/FAD synthetase
165 QQCF01000001.1 GCA003496665_00161 CDS open 155092-155838 _na     248_aa Opa protein
166 QQCF01000001.1 GCA003496665_00162 CDS open 156230-156427 _na     65_aa hypothetical protein
167 QQCF01000001.1 GCA003496665_00163 CDS open 156937-157950 _na     337_aa porB trimeric porin PorB
168 QQCF01000001.1 GCA003496665_00165 CDS open 158288-159091 _na     267_aa truA tRNA pseudouridine(38-40) synthase TruA
169 QQCF01000001.1 GCA003496665_00166 CDS open 159620-160915 _na     431_aa tyrS tyrosine--tRNA ligase
170 QQCF01000001.1 GCA003496665_00167 CDS open 160977-162614 _na     545_aa LipO-oligosaccharide acyltransferase
171 QQCF01000001.1 GCA003496665_00168 CDS open 162647-162880 _na     77_aa acyltransferase
172 QQCF01000001.1 GCA003496665_00169 CDS open 163120-164211 _na     363_aa ychF redox-regulated ATPase YchF
173 QQCF01000001.1 GCA003496665_00170 CDS open 164419-165336 _na     305_aa Bestrophin
174 QQCF01000001.1 GCA003496665_00171 CDS open 165393-167069 _na     558_aa fhs formate--tetrahydrofolate ligase
175 QQCF01000001.1 GCA003496665_00172 CDS open 167244-167675 _na     143_aa ribN EamA domain-containing protein
176 QQCF01000001.1 GCA003496665_00173 CDS open 167709-168404 _na     231_aa murU N-acetylmuramate alpha-1-phosphate uridylyltransferase MurU
177 QQCF01000001.1 GCA003496665_00174 CDS open 168421-168921 _na     166_aa hpaC 4-hydroxyphenylacetate 3-monooxygenase%2C reductase component
178 QQCF01000001.1 GCA003496665_00175 CDS open 169036-169476 _na     146_aa hpaR homoprotocatechuate degradation operon regulator HpaR
179 QQCF01000001.1 GCA003496665_00176 CDS open 169785-170294 _na     169_aa trxA Thiosulfate sulfurtransferase%2C rhodanese
180 QQCF01000001.1 GCA003496665_00178 CDS open 170660-171739 _na     359_aa apbC iron-sulfur cluster carrier protein ApbC
181 QQCF01000001.1 GCA003496665_00179 CDS open 171569-172093 _na     174_aa hypothetical protein
182 QQCF01000001.1 GCA003496665_00180 CDS open 172663-172893 _na     76_aa hypothetical protein
183 QQCF01000001.1 GCA003496665_00181 CDS open 173243-176254 _na     1003_aa pilC PilC family type IV pilus tip adhesin
184 QQCF01000001.1 GCA003496665_00182 CDS open 177373-178503 _na     376_aa carA carbamoyl phosphate synthase small subunit
185 QQCF01000001.1 GCA003496665_00183 CDS open 178565-178822 _na     85_aa Transmembrane protein
186 QQCF01000001.1 GCA003496665_00184 CDS open 178964-179359 _na     131_aa ycjD DNA (Cytosine-5-)-methyltransferase
187 QQCF01000001.1 GCA003496665_00185 CDS open 180095-180733 _na     212_aa Phage associated protein
188 QQCF01000001.1 GCA003496665_00186 CDS open 180763-183978 _na     1071_aa carB carbamoyl-phosphate synthase large subunit
189 QQCF01000001.1 GCA003496665_00187 CDS open 184141-184356 _na     71_aa hypothetical protein
190 QQCF01000001.1 GCA003496665_00188 CDS open 184353-185702 _na     449_aa Replication initiation protein-like C-terminal domain-containing protein
191 QQCF01000001.1 GCA003496665_00189 CDS open 185723-186034 _na     103_aa Phage associated protein
192 QQCF01000001.1 GCA003496665_00190 CDS open 186052-186255 _na     67_aa Phage associated protein
193 QQCF01000001.1 GCA003496665_00191 CDS open 186338-186556 _na     72_aa Phage associated protein
194 QQCF01000001.1 GCA003496665_00192 CDS open 186567-186842 _na     91_aa Integral membrane protein
195 QQCF01000001.1 GCA003496665_00193 CDS open 186971-187282 _na     103_aa Phage associated protein
196 QQCF01000001.1 GCA003496665_00194 CDS open 187221-188774 _na     517_aa tspB IgG-binding virulence factor TspB family protein
197 QQCF01000001.1 GCA003496665_00195 CDS open 188776-189063 _na     95_aa Integral membrane protein
198 QQCF01000001.1 GCA003496665_00196 CDS open 189066-190121 _na     351_aa Zona occludens toxin N-terminal domain-containing protein
199 QQCF01000001.1 GCA003496665_00197 CDS open 190211-190303 _na     30_aa hypothetical protein
200 QQCF01000001.1 GCA003496665_00198 CDS open 190982-191947 _na     321_aa IS110 family transposase
201 QQCF01000001.1 GCA003496665_00199 CDS open 192192-193232 _na     346_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
202 QQCF01000001.1 GCA003496665_00200 CDS open 193588-194040 _na     150_aa accB acetyl-CoA carboxylase biotin carboxyl carrier protein
203 QQCF01000001.1 GCA003496665_00201 CDS open 194157-195518 _na     453_aa accC acetyl-CoA carboxylase biotin carboxylase subunit
204 QQCF01000001.1 GCA003496665_00202 CDS open 195688-196188 _na     166_aa Secreted protein
205 QQCF01000001.1 GCA003496665_00203 CDS open 196412-197299 _na     295_aa prmA 50S ribosomal protein L11 methyltransferase
206 QQCF01000001.1 GCA003496665_00204 CDS open 197317-197880 _na     187_aa orn oligoribonuclease
207 QQCF01000001.1 GCA003496665_00205 CDS open 198377-199660 _na     427_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
208 QQCF01000001.1 GCA003496665_00206 CDS open 199724-200137 _na     137_aa Secreted protein
209 QQCF01000001.1 GCA003496665_00207 CDS open 200340-201668 _na     442_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
210 QQCF01000001.1 GCA003496665_00208 CDS open 201763-203688 _na     641_aa dxs 1-deoxy-D-xylulose-5-phosphate synthase
211 QQCF01000001.1 GCA003496665_00209 CDS open 203771-204775 _na     334_aa xerC tyrosine recombinase XerC
212 QQCF01000001.1 GCA003496665_00210 CDS open 204839-205903 _na     354_aa fba class II fructose-bisphosphate aldolase
213 QQCF01000001.1 GCA003496665_00211 CDS open 206011-206688 _na     225_aa Putative opacity protein
214 QQCF01000001.1 GCA003496665_00212 CDS open 206971-207648 _na     225_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
215 QQCF01000001.1 GCA003496665_00213 CDS open 207645-208085 _na     146_aa rimI ribosomal protein S18-alanine N-acetyltransferase
216 QQCF01000001.1 GCA003496665_00214 CDS open 208079-208816 _na     245_aa Uracil-DNA glycosylase-like domain-containing protein
217 QQCF01000001.1 GCA003496665_00215 CDS open 208878-209519 _na     213_aa pyrE Orotate phosphoribosyltransferase
218 QQCF01000001.1 GCA003496665_00216 CDS open 209593-210027 _na     144_aa MJ0042 family finger-like domain protein
219 QQCF01000001.1 GCA003496665_00217 CDS open 210024-211334 _na     436_aa argA amino-acid N-acetyltransferase
220 QQCF01000001.1 GCA003496665_00218 CDS open 211430-213448 _na     672_aa preP Prolyl endopeptidase
221 QQCF01000001.1 GCA003496665_00219 CDS open 213503-213826 _na     107_aa Putative thiosulfate sulfurtransferase
222 QQCF01000001.1 GCA003496665_00220 CDS open 213903-214559 _na     218_aa pcm Protein-L-isoaspartate O-methyltransferase
223 QQCF01000001.1 GCA003496665_00221 CDS open 214662-215165 _na     167_aa msrC GAF domain-containing protein
224 QQCF01000001.1 GCA003496665_00222 CDS open 215345-216118 _na     257_aa tpiA triose-phosphate isomerase
225 QQCF01000001.1 GCA003496665_00223 CDS open 216125-216487 _na     120_aa secG preprotein translocase subunit SecG
226 QQCF01000001.1 GCA003496665_00225 CDS open 216686-217009 _na     107_aa Propanediol utilization protein
227 QQCF01000001.1 GCA003496665_00226 CDS open 217278-218012 _na     244_aa htpX Peptidase M48 domain-containing protein
228 QQCF01000001.1 GCA003496665_00227 CDS open 218249-218380 _na     43_aa Leucyl-tRNA synthetase
229 QQCF01000001.1 GCA003496665_00228 CDS open 218373-219302 _na     309_aa clpB ATP-dependent Clp protease%2C ATP-binding subunit ClpB
230 QQCF01000001.1 GCA003496665_00001 gene open 222-800 grpE
231 QQCF01000001.1 GCA003496665_00002 gene open 983-1801 cysE
232 QQCF01000001.1 GCA003496665_00003 gene open 2005-3516 ubiB
233 QQCF01000001.1 GCA003496665_00004 gene open 3551-4015
234 QQCF01000001.1 GCA003496665_00005 gene open 4175-4513 erpA
235 QQCF01000001.1 GCA003496665_00006 gene open 4644-5330
236 QQCF01000001.1 GCA003496665_00007 gene open 5517-5789
237 QQCF01000001.1 GCA003496665_00008 gene open 5997-7925 dnaK
238 QQCF01000001.1 GCA003496665_00009 gene open 8150-8464
239 QQCF01000001.1 GCA003496665_00010 gene open 8566-10065
240 QQCF01000001.1 GCA003496665_00011 gene open 10122-11099 tauA
241 QQCF01000001.1 GCA003496665_00012 gene open 11548-12345 tauC
242 QQCF01000001.1 GCA003496665_00013 gene open 12345-13037 tauB
243 QQCF01000001.1 GCA003496665_00014 gene open 13323-13937 cadD
244 QQCF01000001.1 GCA003496665_00015 gene open 14232-15329 nnrS
245 QQCF01000001.1 GCA003496665_00016 gene open 15376-17565 priA
246 QQCF01000001.1 GCA003496665_00017 gene open 17611-18276 ardA
247 QQCF01000001.1 GCA003496665_00018 gene open 18532-19314 dsbG
248 QQCF01000001.1 GCA003496665_00019 gene open 19409-21343 macB
249 QQCF01000001.1 GCA003496665_00020 gene open 21409-22692 acrA
250 QQCF01000001.1 GCA003496665_00021 gene open 22813-23202
251 QQCF01000001.1 GCA003496665_00022 gene open 23484-24530 adhP
252 QQCF01000001.1 GCA003496665_00023 gene open 24606-28091 smc
253 QQCF01000001.1 GCA003496665_00024 gene open 28277-29668
254 QQCF01000001.1 GCA003496665_00025 gene open 29868-30590 lpxH
255 QQCF01000001.1 GCA003496665_00026 gene open 30858-32444 lldP
256 QQCF01000001.1 GCA003496665_00027 gene open 32612-32815
257 QQCF01000001.1 GCA003496665_00028 gene open 33034-34227 tyrB
258 QQCF01000001.1 GCA003496665_00029 gene open 34317-35297 hemC
259 QQCF01000001.1 GCA003496665_00030 gene open 35373-35888 ybeY
260 QQCF01000001.1 GCA003496665_00031 gene open 35890-36714 corC
261 QQCF01000001.1 GCA003496665_00032 gene open 36844-38223 nhaC
262 QQCF01000001.1 GCA003496665_00033 gene open 38667-38948
263 QQCF01000001.1 GCA003496665_00034 gene open 39103-39516 ygaA
264 QQCF01000001.1 GCA003496665_00035 gene open 39562-40191 nth
265 QQCF01000001.1 GCA003496665_00036 gene open 40329-41828 degQ
266 QQCF01000001.1 GCA003496665_00037 gene open 42026-43546 nhaC
267 QQCF01000001.1 GCA003496665_00038 gene open 43603-44688 nagZ
268 QQCF01000001.1 GCA003496665_00040 gene open 45433-45738 uvrD
269 QQCF01000001.1 GCA003496665_00041 gene open 45717-46322
270 QQCF01000001.1 GCA003496665_00042 gene open 46365-48326
271 QQCF01000001.1 GCA003496665_00043 gene open 48337-48900
272 QQCF01000001.1 GCA003496665_00044 gene open 48897-49952
273 QQCF01000001.1 GCA003496665_00045 gene open 49949-50356
274 QQCF01000001.1 GCA003496665_00046 gene open 50414-51043
275 QQCF01000001.1 GCA003496665_00047 gene open 51044-52183
276 QQCF01000001.1 GCA003496665_00048 gene open 52167-53534
277 QQCF01000001.1 GCA003496665_00049 gene open 53544-55676
278 QQCF01000001.1 GCA003496665_00050 gene open 55882-56268
279 QQCF01000001.1 GCA003496665_00051 gene open 56362-56736
280 QQCF01000001.1 GCA003496665_00052 gene open 56749-58176
281 QQCF01000001.1 GCA003496665_00053 gene open 58173-58355
282 QQCF01000001.1 GCA003496665_00054 gene open 58348-58953
283 QQCF01000001.1 GCA003496665_00055 gene open 58994-59419
284 QQCF01000001.1 GCA003496665_00056 gene open 59419-59844
285 QQCF01000001.1 GCA003496665_00057 gene open 59886-60788
286 QQCF01000001.1 GCA003496665_00058 gene open 60811-61884
287 QQCF01000001.1 GCA003496665_00059 gene open 62084-62578
288 QQCF01000001.1 GCA003496665_00060 gene open 62805-64151
289 QQCF01000001.1 GCA003496665_00061 gene open 64144-65697
290 QQCF01000001.1 GCA003496665_00062 gene open 65775-67397
291 QQCF01000001.1 GCA003496665_00063 gene open 67412-67915
292 QQCF01000001.1 GCA003496665_00064 gene open 68205-68711
293 QQCF01000001.1 GCA003496665_00065 gene open 68714-68911
294 QQCF01000001.1 GCA003496665_00066 gene open 68908-69174
295 QQCF01000001.1 GCA003496665_00067 gene open 69186-69527
296 QQCF01000001.1 GCA003496665_00068 gene open 69524-69718
297 QQCF01000001.1 GCA003496665_00069 gene open 69738-70157
298 QQCF01000001.1 GCA003496665_00070 gene open 70129-70365
299 QQCF01000001.1 GCA003496665_00071 gene open 70368-70532
300 QQCF01000001.1 GCA003496665_00072 gene open 70535-70708
301 QQCF01000001.1 GCA003496665_00073 gene open 70705-71250 amiC
302 QQCF01000001.1 GCA003496665_00074 gene open 71394-72029
303 QQCF01000001.1 GCA003496665_00075 gene open 72076-72516
304 QQCF01000001.1 GCA003496665_00076 gene open 72516-72917 gemA
305 QQCF01000001.1 GCA003496665_00077 gene open 73341-73526
306 QQCF01000001.1 GCA003496665_00078 gene open 73677-74267
307 QQCF01000001.1 GCA003496665_00079 gene open 74271-74486
308 QQCF01000001.1 GCA003496665_00080 gene open 74646-75164
309 QQCF01000001.1 GCA003496665_00081 gene open 75157-75303
310 QQCF01000001.1 GCA003496665_00082 gene open 75300-75815
311 QQCF01000001.1 GCA003496665_00083 gene open 75812-76297
312 QQCF01000001.1 GCA003496665_00084 gene open 76294-76650
313 QQCF01000001.1 GCA003496665_00085 gene open 76647-76844
314 QQCF01000001.1 GCA003496665_00086 gene open 76844-77011
315 QQCF01000001.1 GCA003496665_00087 gene open 77100-77255
316 QQCF01000001.1 GCA003496665_00088 gene open 77252-77371
317 QQCF01000001.1 GCA003496665_00089 gene open 77364-77630
318 QQCF01000001.1 GCA003496665_00090 gene open 77719-78633
319 QQCF01000001.1 GCA003496665_00091 gene open 78669-80651
320 QQCF01000001.1 GCA003496665_00092 gene open 80659-80835
321 QQCF01000001.1 GCA003496665_00093 gene open 80942-81301
322 QQCF01000001.1 GCA003496665_00094 gene open 81463-81816
323 QQCF01000001.1 GCA003496665_00095 gene open 81874-82278
324 QQCF01000001.1 GCA003496665_00096 gene open 82670-83308 queE
325 QQCF01000001.1 GCA003496665_00097 gene open 83305-83676
326 QQCF01000001.1 GCA003496665_00098 gene open 84049-84471 queD
327 QQCF01000001.1 GCA003496665_00099 gene open 84478-84999
328 QQCF01000001.1 GCA003496665_00100 gene open 85134-85790 queC
329 QQCF01000001.1 GCA003496665_00101 gene open 86307-87527
330 QQCF01000001.1 GCA003496665_00102 gene open 87532-87981
331 QQCF01000001.1 GCA003496665_00103 gene open 88055-89098 argC
332 QQCF01000001.1 GCA003496665_00104 gene open 89536-91578 recG
333 QQCF01000001.1 GCA003496665_00105 gene open 91664-92107 secB
334 QQCF01000001.1 GCA003496665_00106 gene open 92128-92385 grxC
335 QQCF01000001.1 GCA003496665_00107 gene open 92599-94092 rng
336 QQCF01000001.1 GCA003496665_00108 gene open 94236-94604 insH
337 QQCF01000001.1 GCA003496665_00109 gene open 94961-95338
338 QQCF01000001.1 GCA003496665_00110 gene open 95384-95707
339 QQCF01000001.1 GCA003496665_00111 gene open 95747-96121
340 QQCF01000001.1 GCA003496665_00112 gene open 96239-96658
341 QQCF01000001.1 GCA003496665_00113 gene open 96741-97526 ygiD
342 QQCF01000001.1 GCA003496665_00114 gene open 97752-97964 eamA
343 QQCF01000001.1 GCA003496665_00115 gene open 97934-98203
344 QQCF01000001.1 GCA003496665_00116 gene open 98532-99098 ssuE
345 QQCF01000001.1 GCA003496665_00117 gene open 99146-99445
346 QQCF01000001.1 GCA003496665_00118 gene open 99442-100674 dacB
347 QQCF01000001.1 GCA003496665_00119 gene open 100889-102058 metK
348 QQCF01000001.1 GCA003496665_00120 gene open 102358-103305
349 QQCF01000001.1 GCA003496665_00121 gene open 103349-104413 tsaD
350 QQCF01000001.1 GCA003496665_00122 gene open 104502-105689 ccsB
351 QQCF01000001.1 GCA003496665_00123 gene open 105673-107697 resB
352 QQCF01000001.1 GCA003496665_00124 gene open 107895-108518 cytC553
353 QQCF01000001.1 GCA003496665_00125 gene open 108729-109352 yihA
354 QQCF01000001.1 GCA003496665_00126 gene open 109476-111872 mrcA
355 QQCF01000001.1 GCA003496665_00127 gene open 112023-113138 gspL
356 QQCF01000001.1 GCA003496665_00128 gene open 113141-113740 pilN
357 QQCF01000001.1 GCA003496665_00129 gene open 113741-114403
358 QQCF01000001.1 GCA003496665_00130 gene open 114421-114966
359 QQCF01000001.1 GCA003496665_00131 gene open 114984-117161 pilQ
360 QQCF01000001.1 GCA003496665_00132 gene open 118799-119311 aroK
361 QQCF01000001.1 GCA003496665_00133 gene open 119396-120475 aroB
362 QQCF01000001.1 GCA003496665_00134 gene open 121005-121847 yafJ
363 QQCF01000001.1 GCA003496665_00135 gene open 121877-122341 nrdR
364 QQCF01000001.1 GCA003496665_00136 gene open 122373-123482 ribD
365 QQCF01000001.1 GCA003496665_00137 gene open 123585-125006 rfbX
366 QQCF01000001.1 GCA003496665_00138 gene open 125003-126076 rfaB
367 QQCF01000001.1 GCA003496665_00139 gene open 126096-127265
368 QQCF01000001.1 GCA003496665_00140 gene open 127258-128499 wcaJ
369 QQCF01000001.1 GCA003496665_00141 gene open 128600-129805 wecE
370 QQCF01000001.1 GCA003496665_00142 gene open 129853-131763 flaA1
371 QQCF01000001.1 GCA003496665_00143 gene open 131823-133115 avtA
372 QQCF01000001.1 GCA003496665_00144 gene open 133167-134003 yciV
373 QQCF01000001.1 GCA003496665_00145 gene open 134140-134349
374 QQCF01000001.1 GCA003496665_00146 gene open 134327-134560 ybcJ
375 QQCF01000001.1 GCA003496665_00147 gene open 134664-134813
376 QQCF01000001.1 GCA003496665_00149 gene open 135056-138490 dnaE
377 QQCF01000001.1 GCA003496665_00150 gene open 138769-142014 cas9
378 QQCF01000001.1 GCA003496665_00151 gene open 142080-142994 cas1
379 QQCF01000001.1 GCA003496665_00152 gene open 143005-143313 cas2
380 QQCF01000001.1 GCA003496665_00153 gene open 143954-144046
381 QQCF01000001.1 GCA003496665_00154 gene open 144557-145489 ybbA
382 QQCF01000001.1 GCA003496665_00155 gene open 145559-147676
383 QQCF01000001.1 GCA003496665_00156 gene open 147836-148495 gph
384 QQCF01000001.1 GCA003496665_00157 gene open 148582-149550 ispH
385 QQCF01000001.1 GCA003496665_00158 gene open 149580-150074 lspA
386 QQCF01000001.1 GCA003496665_00159 gene open 150831-153620 ileS
387 QQCF01000001.1 GCA003496665_00160 gene open 153763-154683 ribF
388 QQCF01000001.1 GCA003496665_00161 gene open 155092-155838
389 QQCF01000001.1 GCA003496665_00162 gene open 156230-156427
390 QQCF01000001.1 GCA003496665_00163 gene open 156937-157950 porB
391 QQCF01000001.1 GCA003496665_00165 gene open 158288-159091 truA
392 QQCF01000001.1 GCA003496665_00166 gene open 159620-160915 tyrS
393 QQCF01000001.1 GCA003496665_00167 gene open 160977-162614
394 QQCF01000001.1 GCA003496665_00168 gene open 162647-162880
395 QQCF01000001.1 GCA003496665_00169 gene open 163120-164211 ychF
396 QQCF01000001.1 GCA003496665_00170 gene open 164419-165336
397 QQCF01000001.1 GCA003496665_00171 gene open 165393-167069 fhs
398 QQCF01000001.1 GCA003496665_00172 gene open 167244-167675 ribN
399 QQCF01000001.1 GCA003496665_00173 gene open 167709-168404 murU
400 QQCF01000001.1 GCA003496665_00174 gene open 168421-168921 hpaC
401 QQCF01000001.1 GCA003496665_00175 gene open 169036-169476 hpaR
402 QQCF01000001.1 GCA003496665_00176 gene open 169785-170294 trxA
403 QQCF01000001.1 GCA003496665_00178 gene open 170660-171739 apbC
404 QQCF01000001.1 GCA003496665_00179 gene open 171569-172093
405 QQCF01000001.1 GCA003496665_00180 gene open 172663-172893
406 QQCF01000001.1 GCA003496665_00181 gene open 173243-176254 pilC
407 QQCF01000001.1 GCA003496665_00182 gene open 177373-178503 carA
408 QQCF01000001.1 GCA003496665_00183 gene open 178565-178822
409 QQCF01000001.1 GCA003496665_00184 gene open 178964-179359 ycjD
410 QQCF01000001.1 GCA003496665_00185 gene open 180095-180733
411 QQCF01000001.1 GCA003496665_00186 gene open 180763-183978 carB
412 QQCF01000001.1 GCA003496665_00187 gene open 184141-184356
413 QQCF01000001.1 GCA003496665_00188 gene open 184353-185702
414 QQCF01000001.1 GCA003496665_00189 gene open 185723-186034
415 QQCF01000001.1 GCA003496665_00190 gene open 186052-186255
416 QQCF01000001.1 GCA003496665_00191 gene open 186338-186556
417 QQCF01000001.1 GCA003496665_00192 gene open 186567-186842
418 QQCF01000001.1 GCA003496665_00193 gene open 186971-187282
419 QQCF01000001.1 GCA003496665_00194 gene open 187221-188774 tspB
420 QQCF01000001.1 GCA003496665_00195 gene open 188776-189063
421 QQCF01000001.1 GCA003496665_00196 gene open 189066-190121
422 QQCF01000001.1 GCA003496665_00197 gene open 190211-190303
423 QQCF01000001.1 GCA003496665_00198 gene open 190982-191947
424 QQCF01000001.1 GCA003496665_00199 gene open 192192-193232 queA
425 QQCF01000001.1 GCA003496665_00200 gene open 193588-194040 accB
426 QQCF01000001.1 GCA003496665_00201 gene open 194157-195518 accC
427 QQCF01000001.1 GCA003496665_00202 gene open 195688-196188
428 QQCF01000001.1 GCA003496665_00203 gene open 196412-197299 prmA
429 QQCF01000001.1 GCA003496665_00204 gene open 197317-197880 orn
430 QQCF01000001.1 GCA003496665_00205 gene open 198377-199660 hemL
431 QQCF01000001.1 GCA003496665_00206 gene open 199724-200137
432 QQCF01000001.1 GCA003496665_00207 gene open 200340-201668 miaB
433 QQCF01000001.1 GCA003496665_00208 gene open 201763-203688 dxs
434 QQCF01000001.1 GCA003496665_00209 gene open 203771-204775 xerC
435 QQCF01000001.1 GCA003496665_00210 gene open 204839-205903 fba
436 QQCF01000001.1 GCA003496665_00211 gene open 206011-206688
437 QQCF01000001.1 GCA003496665_00212 gene open 206971-207648 tsaB
438 QQCF01000001.1 GCA003496665_00213 gene open 207645-208085 rimI
439 QQCF01000001.1 GCA003496665_00214 gene open 208079-208816
440 QQCF01000001.1 GCA003496665_00215 gene open 208878-209519 pyrE
441 QQCF01000001.1 GCA003496665_00216 gene open 209593-210027
442 QQCF01000001.1 GCA003496665_00217 gene open 210024-211334 argA
443 QQCF01000001.1 GCA003496665_00218 gene open 211430-213448 preP
444 QQCF01000001.1 GCA003496665_00219 gene open 213503-213826
445 QQCF01000001.1 GCA003496665_00220 gene open 213903-214559 pcm
446 QQCF01000001.1 GCA003496665_00221 gene open 214662-215165 msrC
447 QQCF01000001.1 GCA003496665_00222 gene open 215345-216118 tpiA
448 QQCF01000001.1 GCA003496665_00223 gene open 216125-216487 secG
449 QQCF01000001.1 GCA003496665_00225 gene open 216686-217009
450 QQCF01000001.1 GCA003496665_00226 gene open 217278-218012 htpX
451 QQCF01000001.1 GCA003496665_00227 gene open 218249-218380
452 QQCF01000001.1 GCA003496665_00228 gene open 218373-219302 clpB
453 QQCF01000001.1 GCA003496665_00039 gene open 44914-44990 trnP
454 QQCF01000001.1 GCA003496665_00177 gene open 170374-170449 trnK
455 QQCF01000001.1 GCA003496665_00224 gene open 216501-216586 trnL
456 QQCF01000001.1 GCA003496665_00039 tRNA open 44914-44990 trnP tRNA-Pro(cgg)
457 QQCF01000001.1 GCA003496665_00177 tRNA open 170374-170449 trnK tRNA-Lys(ttt)
458 QQCF01000001.1 GCA003496665_00224 tRNA open 216501-216586 trnL tRNA-Leu(gag)
459 QQCF01000002.1 GCA003496665_00229 CDS open 16-1098 _na     360_aa lyase family protein
460 QQCF01000002.1 GCA003496665_00230 CDS open 1294-2169 _na     291_aa Integral membrane protein
461 QQCF01000002.1 GCA003496665_00231 CDS open 2171-2818 _na     215_aa DnaJ-family protein
462 QQCF01000002.1 GCA003496665_00232 CDS open 2840-3319 _na     159_aa ybaK Cys-tRNA(Pro) deacylase
463 QQCF01000002.1 GCA003496665_00233 CDS open 3394-3756 _na     120_aa ridA Endoribonuclease L-PSP
464 QQCF01000002.1 GCA003496665_00234 CDS open 3788-4654 _na     288_aa ygfZ folate-binding protein YgfZ
465 QQCF01000002.1 GCA003496665_00235 CDS open 4747-5706 _na     319_aa ttcA tRNA 2-thiocytidine(32) synthetase TtcA
466 QQCF01000002.1 GCA003496665_00236 CDS open 5800-8739 _na     979_aa pM0699 type III restriction-modification system endonuclease
467 QQCF01000002.1 GCA003496665_00237 CDS open 8752-10725 _na     657_aa site-specific DNA-methyltransferase (adenine-specific)
468 QQCF01000002.1 GCA003496665_00238 CDS open 10841-11398 _na     185_aa ppiB Peptidyl-prolyl cis-trans isomerase
469 QQCF01000002.1 GCA003496665_00239 CDS open 11462-12388 _na     308_aa yejR Zinc-binding GTPase YeiR
470 QQCF01000002.1 GCA003496665_00240 CDS open 12376-12852 _na     158_aa fur Ferric uptake regulation protein
471 QQCF01000002.1 GCA003496665_00241 CDS open 13082-13594 _na     170_aa wzb protein-tyrosine-phosphatase
472 QQCF01000002.1 GCA003496665_00242 CDS open 13602-14708 _na     368_aa ABC-type transporter%2C periplasmic component
473 QQCF01000002.1 GCA003496665_00243 CDS open 14790-16418 _na     542_aa Methyltransferase domain protein
474 QQCF01000002.1 GCA003496665_00244 CDS open 16632-21857 _na     1741_aa recQ ATP-dependent DNA helicase RecQ
475 QQCF01000002.1 GCA003496665_00245 CDS open 21948-22160 _na     70_aa copZ HMA domain-containing protein
476 QQCF01000002.1 GCA003496665_00246 CDS open 22307-23464 _na     385_aa sugar transporter
477 QQCF01000002.1 GCA003496665_00247 CDS open 23593-25029 _na     478_aa dltB putative alginate O-acetylase AlgI
478 QQCF01000002.1 GCA003496665_00248 CDS open 25040-26026 _na     328_aa patB peptidoglycan O-acetyltransferase PatB
479 QQCF01000002.1 GCA003496665_00249 CDS open 26023-27213 _na     396_aa tesA Periplasmic protein
480 QQCF01000002.1 GCA003496665_00250 CDS open 27418-28971 _na     517_aa menE Long-chain-fatty-acid--CoA ligase
481 QQCF01000002.1 GCA003496665_00251 CDS open 29063-31090 _na     675_aa betT Transporter%2C betaine/carnitine/choline family
482 QQCF01000002.1 GCA003496665_00252 CDS open 31379-33385 _na     668_aa Site-specific recombinase
483 QQCF01000002.1 GCA003496665_00253 CDS open 33612-34703 _na     363_aa mltB lytic murein transglycosylase B
484 QQCF01000002.1 GCA003496665_00254 CDS open 34906-36333 _na     475_aa caiA Acyl-Coenzyme A dehydrogenase%2C very long chain
485 QQCF01000002.1 GCA003496665_00255 CDS open 36625-36774 _na     49_aa yhhA YhhA family cyclophane-containing RiPP
486 QQCF01000002.1 GCA003496665_00256 CDS open 36784-37893 _na     369_aa Radical SAM core domain-containing protein
487 QQCF01000002.1 GCA003496665_00257 CDS open 37890-38477 _na     195_aa yhhC cyclophane-containing peptide 2OG-Fe(II) oxygenase YhhC
488 QQCF01000002.1 GCA003496665_00258 CDS open 38938-42432 _na     1164_aa mfd transcription-repair coupling factor
489 QQCF01000002.1 GCA003496665_00259 CDS open 42504-42959 _na     151_aa DUF2004 domain-containing protein
490 QQCF01000002.1 GCA003496665_00260 CDS open 43121-43504 _na     127_aa panD aspartate 1-decarboxylase
491 QQCF01000002.1 GCA003496665_00261 CDS open 43526-44368 _na     280_aa kdsA 3-deoxy-8-phosphooctulonate synthase
492 QQCF01000002.1 GCA003496665_00262 CDS open 44383-44823 _na     146_aa TMEM205-like domain-containing protein
493 QQCF01000002.1 GCA003496665_00263 CDS open 44868-46154 _na     428_aa eno phosphopyruvate hydratase
494 QQCF01000002.1 GCA003496665_00264 CDS open 46169-46447 _na     92_aa ftsB cell division protein FtsB
495 QQCF01000002.1 GCA003496665_00265 CDS open 46908-48062 _na     384_aa nrdB class Ia ribonucleoside-diphosphate reductase subunit beta
496 QQCF01000002.1 GCA003496665_00266 CDS open 48256-49179 _na     307_aa Abi-like protein
497 QQCF01000002.1 GCA003496665_00267 CDS open 49215-51494 _na     759_aa nrdA class 1a ribonucleoside-diphosphate reductase subunit alpha
498 QQCF01000002.1 GCA003496665_00268 CDS open 52009-52335 _na     108_aa stress response protein
499 QQCF01000002.1 GCA003496665_00269 CDS open 52599-53366 _na     255_aa plsC 1-acyl-sn-glycerol-3-phosphate acyltransferase
500 QQCF01000002.1 GCA003496665_00270 CDS open 53454-54281 _na     275_aa mutM DNA-formamidopyrimidine glycosylase