HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Neisseria lactamica (GCA_003496665.1)

Select a Genome:
BAKTA Annotations for GCA_003496665.1
Genome Selected: Neisseria lactamica
ContigsBases CDSrRNA tmRNAtRNA
71 2182710 2045 3 1 57
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4241 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 4241 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 QQCF01000012.1 GCA003496665_01264 CDS open 33066-33713 _na     215_aa Putative lipoprotein NMB1124/NMB1162
2502 QQCF01000012.1 GCA003496665_01265 CDS open 33710-34078 _na     122_aa DUF4810 domain-containing protein
2503 QQCF01000012.1 GCA003496665_01266 CDS open 34088-34759 _na     223_aa csgG Membrane protein
2504 QQCF01000012.1 GCA003496665_01267 CDS open 34960-35679 _na     239_aa fabG SDR family oxidoreductase
2505 QQCF01000012.1 GCA003496665_01268 CDS open 35762-37075 _na     437_aa hpnE hydroxysqualene dehydroxylase HpnE
2506 QQCF01000012.1 GCA003496665_01269 CDS open 37154-38026 _na     290_aa hpnD presqualene diphosphate synthase HpnD
2507 QQCF01000012.1 GCA003496665_01270 CDS open 38197-40059 _na     620_aa hscA Fe-S protein assembly chaperone HscA
2508 QQCF01000012.1 GCA003496665_01271 CDS open 40328-40891 _na     187_aa Bacteriophage T5 Orf172 DNA-binding domain-containing protein
2509 QQCF01000012.1 GCA003496665_01272 CDS open 40930-41688 _na     252_aa yegJ Putative ankyrin repeat protein NMB1133/NMB1171
2510 QQCF01000012.1 GCA003496665_01273 CDS open 41744-42085 _na     113_aa fdx ISC system 2Fe-2S type ferredoxin
2511 QQCF01000012.1 GCA003496665_01274 CDS open 42202-42789 _na     195_aa Amino acid permease
2512 QQCF01000012.1 GCA003496665_01275 CDS open 42977-43174 _na     65_aa iscX Fe-S cluster assembly protein IscX
2513 QQCF01000012.1 GCA003496665_01276 CDS open 43238-43639 _na     133_aa RNA-binding S4 domain-containing protein
2514 QQCF01000012.1 GCA003496665_01277 CDS open 43841-44800 _na     319_aa accA acetyl-CoA carboxylase carboxyltransferase subunit alpha
2515 QQCF01000012.1 GCA003496665_01278 CDS open 44868-46178 _na     436_aa tRNA(Ile)-lysidine synthase
2516 QQCF01000012.1 GCA003496665_01279 CDS open 46229-47014 _na     261_aa spoU RNA methyltransferase
2517 QQCF01000012.1 GCA003496665_01280 CDS open 47024-47221 _na     65_aa Integral membrane protein
2518 QQCF01000012.1 GCA003496665_01281 CDS open 47234-47536 _na     100_aa DUF4124 domain-containing protein
2519 QQCF01000012.1 GCA003496665_01282 CDS open 47598-48974 _na     458_aa mpl UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase
2520 QQCF01000012.1 GCA003496665_01283 CDS open 49181-50233 _na     350_aa bioB biotin synthase BioB
2521 QQCF01000012.1 GCA003496665_01284 CDS open 50504-50779 _na     91_aa Integral membrane protein
2522 QQCF01000012.1 GCA003496665_01285 CDS open 50920-52152 _na     410_aa capA Capsule synthesis protein CapA domain-containing protein
2523 QQCF01000012.1 GCA003496665_01286 CDS open 52200-54059 _na     619_aa ilvD dihydroxy-acid dehydratase
2524 QQCF01000012.1 GCA003496665_01287 CDS open 54231-56000 _na     589_aa cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
2525 QQCF01000012.1 GCA003496665_01288 CDS open 56027-57841 _na     604_aa cysJ1 assimilatory sulfite reductase (NADPH) flavoprotein subunit
2526 QQCF01000012.1 GCA003496665_01289 CDS open 57838-59124 _na     428_aa cysN sulfate adenylyltransferase
2527 QQCF01000012.1 GCA003496665_01290 CDS open 59163-60086 _na     307_aa cysD sulfate adenylyltransferase subunit CysD
2528 QQCF01000012.1 GCA003496665_01291 CDS open 60124-60858 _na     244_aa cysH1 phosphoadenylyl-sulfate reductase
2529 QQCF01000012.1 GCA003496665_01292 CDS open 60874-62325 _na     483_aa cysG siroheme synthase CysG
2530 QQCF01000012.1 GCA003496665_01293 CDS open 62623-63279 _na     218_aa cytB Nickel-dependent hydrogenase%2C b-type cytochrome subunit
2531 QQCF01000012.1 GCA003496665_01294 CDS open 63344-64237 _na     297_aa nnrD1 ADP-dependent (S)-NAD(P)H-hydrate dehydratase
2532 QQCF01000012.1 GCA003496665_01295 CDS open 64517-66328 _na     603_aa typA translational GTPase TypA
2533 QQCF01000012.1 GCA003496665_01234 gene open 818-1423 smrB
2534 QQCF01000012.1 GCA003496665_01235 gene open 1567-2622 sbp
2535 QQCF01000012.1 GCA003496665_01236 gene open 2728-3210
2536 QQCF01000012.1 GCA003496665_01237 gene open 3257-4393 purK
2537 QQCF01000012.1 GCA003496665_01238 gene open 4390-4935
2538 QQCF01000012.1 GCA003496665_01239 gene open 4932-6407 trpE
2539 QQCF01000012.1 GCA003496665_01240 gene open 6617-8527 abc-f
2540 QQCF01000012.1 GCA003496665_01241 gene open 8546-9190 dedA
2541 QQCF01000012.1 GCA003496665_01242 gene open 9285-10535 glyA
2542 QQCF01000012.1 GCA003496665_01243 gene open 10746-10964
2543 QQCF01000012.1 GCA003496665_01244 gene open 11124-12098 fbp
2544 QQCF01000012.1 GCA003496665_01245 gene open 12449-13294 rlmJ
2545 QQCF01000012.1 GCA003496665_01246 gene open 13371-13973 plsY
2546 QQCF01000012.1 GCA003496665_01247 gene open 14029-14385 folB
2547 QQCF01000012.1 GCA003496665_01248 gene open 14419-14955 mutT
2548 QQCF01000012.1 GCA003496665_01249 gene open 15640-15999 fluC
2549 QQCF01000012.1 GCA003496665_01250 gene open 16028-16678
2550 QQCF01000012.1 GCA003496665_01251 gene open 16878-19895
2551 QQCF01000012.1 GCA003496665_01252 gene open 19966-21228 proA
2552 QQCF01000012.1 GCA003496665_01253 gene open 21241-22350 proB
2553 QQCF01000012.1 GCA003496665_01254 gene open 22596-24389 leuA
2554 QQCF01000012.1 GCA003496665_01255 gene open 24486-25148 yecA
2555 QQCF01000012.1 GCA003496665_01256 gene open 25219-26067 lgt
2556 QQCF01000012.1 GCA003496665_01257 gene open 26142-27272 mpaA
2557 QQCF01000012.1 GCA003496665_01258 gene open 27441-28337 argB
2558 QQCF01000012.1 GCA003496665_01259 gene open 28769-29017
2559 QQCF01000012.1 GCA003496665_01260 gene open 29334-29567
2560 QQCF01000012.1 GCA003496665_01261 gene open 29572-30240 serB
2561 QQCF01000012.1 GCA003496665_01262 gene open 30237-30905 hda
2562 QQCF01000012.1 GCA003496665_01263 gene open 31010-32779 yddA
2563 QQCF01000012.1 GCA003496665_01264 gene open 33066-33713
2564 QQCF01000012.1 GCA003496665_01265 gene open 33710-34078
2565 QQCF01000012.1 GCA003496665_01266 gene open 34088-34759 csgG
2566 QQCF01000012.1 GCA003496665_01267 gene open 34960-35679 fabG
2567 QQCF01000012.1 GCA003496665_01268 gene open 35762-37075 hpnE
2568 QQCF01000012.1 GCA003496665_01269 gene open 37154-38026 hpnD
2569 QQCF01000012.1 GCA003496665_01270 gene open 38197-40059 hscA
2570 QQCF01000012.1 GCA003496665_01271 gene open 40328-40891
2571 QQCF01000012.1 GCA003496665_01272 gene open 40930-41688 yegJ
2572 QQCF01000012.1 GCA003496665_01273 gene open 41744-42085 fdx
2573 QQCF01000012.1 GCA003496665_01274 gene open 42202-42789
2574 QQCF01000012.1 GCA003496665_01275 gene open 42977-43174 iscX
2575 QQCF01000012.1 GCA003496665_01276 gene open 43238-43639
2576 QQCF01000012.1 GCA003496665_01277 gene open 43841-44800 accA
2577 QQCF01000012.1 GCA003496665_01278 gene open 44868-46178
2578 QQCF01000012.1 GCA003496665_01279 gene open 46229-47014 spoU
2579 QQCF01000012.1 GCA003496665_01280 gene open 47024-47221
2580 QQCF01000012.1 GCA003496665_01281 gene open 47234-47536
2581 QQCF01000012.1 GCA003496665_01282 gene open 47598-48974 mpl
2582 QQCF01000012.1 GCA003496665_01283 gene open 49181-50233 bioB
2583 QQCF01000012.1 GCA003496665_01284 gene open 50504-50779
2584 QQCF01000012.1 GCA003496665_01285 gene open 50920-52152 capA
2585 QQCF01000012.1 GCA003496665_01286 gene open 52200-54059 ilvD
2586 QQCF01000012.1 GCA003496665_01287 gene open 54231-56000 cysI
2587 QQCF01000012.1 GCA003496665_01288 gene open 56027-57841 cysJ1
2588 QQCF01000012.1 GCA003496665_01289 gene open 57838-59124 cysN
2589 QQCF01000012.1 GCA003496665_01290 gene open 59163-60086 cysD
2590 QQCF01000012.1 GCA003496665_01291 gene open 60124-60858 cysH1
2591 QQCF01000012.1 GCA003496665_01292 gene open 60874-62325 cysG
2592 QQCF01000012.1 GCA003496665_01293 gene open 62623-63279 cytB
2593 QQCF01000012.1 GCA003496665_01294 gene open 63344-64237 nnrD1
2594 QQCF01000012.1 GCA003496665_01295 gene open 64517-66328 typA
2595 QQCF01000013.1 GCA003496665_01296 CDS open 190-405 _na     71_aa rpmE 50S ribosomal protein L31
2596 QQCF01000013.1 GCA003496665_01297 CDS open 913-1401 _na     162_aa bcp Thioredoxin
2597 QQCF01000013.1 GCA003496665_01298 CDS open 1398-1781 _na     127_aa fadM 4-hydroxybenzoyl-CoA thioesterase family active site
2598 QQCF01000013.1 GCA003496665_01299 CDS open 1781-2143 _na     120_aa vacJ VacJ
2599 QQCF01000013.1 GCA003496665_01300 CDS open 2268-3095 _na     275_aa mlaA Putative VacJ-like protein
2600 QQCF01000013.1 GCA003496665_01301 CDS open 3092-3370 _na     92_aa STAS domain-containing protein
2601 QQCF01000013.1 GCA003496665_01302 CDS open 3421-4011 _na     196_aa Toluene tolerance protein Ttg2D
2602 QQCF01000013.1 GCA003496665_01303 CDS open 4045-4542 _na     165_aa mlaD outer membrane lipid asymmetry maintenance protein MlaD
2603 QQCF01000013.1 GCA003496665_01304 CDS open 4593-5369 _na     258_aa mlaE lipid asymmetry maintenance ABC transporter permease subunit MlaE
2604 QQCF01000013.1 GCA003496665_01305 CDS open 5417-6250 _na     277_aa mlaF Phospholipid import ATP-binding protein MlaF
2605 QQCF01000013.1 GCA003496665_01306 CDS open 6390-7307 _na     305_aa araC Transcriptional regulator
2606 QQCF01000013.1 GCA003496665_01307 CDS open 7415-8857 _na     480_aa aldA aldehyde dehydrogenase
2607 QQCF01000013.1 GCA003496665_01308 CDS open 8939-9868 _na     309_aa ppk2 polyphosphate kinase 2
2608 QQCF01000013.1 GCA003496665_01309 CDS open 10037-11818 _na     593_aa trpE Para-aminobenzoate synthase component I / 4-amino-4-deoxychorismate lyase%2C putative
2609 QQCF01000013.1 GCA003496665_01310 CDS open 11878-13395 _na     505_aa Surface lipoprotein assembly modifier C-terminal beta-barrel domain-containing protein
2610 QQCF01000013.1 GCA003496665_01311 CDS open 13645-14664 _na     339_aa Slam-dependent surface lipoprotein
2611 QQCF01000013.1 GCA003496665_01312 CDS open 14692-17124 _na     810_aa hupB haemoglobin-haptoglobin-utilization protein HupB
2612 QQCF01000013.1 GCA003496665_01313 CDS open 18275-19621 _na     448_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
2613 QQCF01000013.1 GCA003496665_01314 CDS open 19752-19907 _na     51_aa ytxH YtxH domain-containing protein
2614 QQCF01000013.1 GCA003496665_01315 CDS open 19904-20335 _na     143_aa Inner membrane protein
2615 QQCF01000013.1 GCA003496665_01316 CDS open 20473-25497 _na     1674_aa app adhesion and penetration autotransporter App
2616 QQCF01000013.1 GCA003496665_01317 CDS open 25988-26179 _na     63_aa hypothetical protein
2617 QQCF01000013.1 GCA003496665_01318 CDS open 26179-28998 _na     939_aa polA DNA polymerase I
2618 QQCF01000013.1 GCA003496665_01319 CDS open 29164-29670 _na     168_aa luxS S-ribosylhomocysteine lyase
2619 QQCF01000013.1 GCA003496665_01320 CDS open 29692-30111 _na     139_aa DUF2251 domain-containing protein
2620 QQCF01000013.1 GCA003496665_01321 CDS open 30144-30467 _na     107_aa cyaY iron donor protein CyaY
2621 QQCF01000013.1 GCA003496665_01322 CDS open 30538-30708 _na     56_aa lptM LPS translocon maturation chaperone LptM
2622 QQCF01000013.1 GCA003496665_01323 CDS open 30719-31963 _na     414_aa lysA diaminopimelate decarboxylase
2623 QQCF01000013.1 GCA003496665_01324 CDS open 32146-32580 _na     144_aa ywqK Lipoprotein
2624 QQCF01000013.1 GCA003496665_01325 CDS open 32633-32725 _na     30_aa Membrane protein
2625 QQCF01000013.1 GCA003496665_01326 CDS open 32722-34257 _na     511_aa yocR Transporter
2626 QQCF01000013.1 GCA003496665_01327 CDS open 34708-36342 _na     544_aa groL chaperonin GroEL
2627 QQCF01000013.1 GCA003496665_01328 CDS open 36435-36725 _na     96_aa groES Co-chaperonin GroES
2628 QQCF01000013.1 GCA003496665_01329 CDS open 37611-39752 _na     713_aa cirA Iron-regulated outer membrane protein FrpB
2629 QQCF01000013.1 GCA003496665_01330 CDS open 39904-40869 _na     321_aa ceuA Periplasmic binding protein
2630 QQCF01000013.1 GCA003496665_01331 CDS open 41033-42001 _na     322_aa ceuB Iron ABC transporter permease
2631 QQCF01000013.1 GCA003496665_01332 CDS open 41991-42965 _na     324_aa ceuC ABC transporter permease%2C enterobactin
2632 QQCF01000013.1 GCA003496665_01333 CDS open 43010-43636 _na     208_aa fwdE Formylmethanofuran dehydrogenase subunit E domain-containing protein
2633 QQCF01000013.1 GCA003496665_01334 CDS open 43664-44482 _na     272_aa ABC transporter ATP-binding protein
2634 QQCF01000013.1 GCA003496665_01335 CDS open 44538-44876 _na     112_aa glnK Nitrogen regulatory protein P-II
2635 QQCF01000013.1 GCA003496665_01336 CDS open 45340-49296 _na     1318_aa purL phosphoribosylformylglycinamidine synthase
2636 QQCF01000013.1 GCA003496665_01337 CDS open 49390-50142 _na     250_aa gloB hydroxyacylglutathione hydrolase
2637 QQCF01000013.1 GCA003496665_01338 CDS open 50376-51830 _na     484_aa mgtE magnesium transporter
2638 QQCF01000013.1 GCA003496665_01339 CDS open 51916-52824 _na     302_aa hslO Hsp33 family molecular chaperone HslO
2639 QQCF01000013.1 GCA003496665_01340 CDS open 53045-53650 _na     201_aa Outer membrane protein GNA2001
2640 QQCF01000013.1 GCA003496665_01341 CDS open 53669-53887 _na     72_aa Phage associated protein
2641 QQCF01000013.1 GCA003496665_01342 CDS open 54027-54374 _na     115_aa CidA/LrgA family protein
2642 QQCF01000013.1 GCA003496665_01343 CDS open 54371-55063 _na     230_aa lrgB LrgA-associated membrane protein LrgB
2643 QQCF01000013.1 GCA003496665_01344 CDS open 55129-56349 _na     406_aa argJ bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ
2644 QQCF01000013.1 GCA003496665_01345 CDS open 56421-57830 _na     469_aa Chloride channel protein
2645 QQCF01000013.1 GCA003496665_01346 CDS open 58021-59412 _na     463_aa hrpA ATP-dependent RNA helicase HrpA
2646 QQCF01000013.1 GCA003496665_01347 CDS open 59470-59856 _na     128_aa HindVP restriction endonuclease
2647 QQCF01000013.1 GCA003496665_01348 CDS open 59825-60520 _na     231_aa Putative type II restriction-modification system enzyme Res
2648 QQCF01000013.1 GCA003496665_01349 CDS open 60517-61509 _na     330_aa Cytosine-specific methyltransferase
2649 QQCF01000013.1 GCA003496665_01350 CDS open 61614-64529 _na     971_aa hrpA ATP-dependent RNA helicase HrpA
2650 QQCF01000013.1 GCA003496665_01296 gene open 190-405 rpmE
2651 QQCF01000013.1 GCA003496665_01297 gene open 913-1401 bcp
2652 QQCF01000013.1 GCA003496665_01298 gene open 1398-1781 fadM
2653 QQCF01000013.1 GCA003496665_01299 gene open 1781-2143 vacJ
2654 QQCF01000013.1 GCA003496665_01300 gene open 2268-3095 mlaA
2655 QQCF01000013.1 GCA003496665_01301 gene open 3092-3370
2656 QQCF01000013.1 GCA003496665_01302 gene open 3421-4011
2657 QQCF01000013.1 GCA003496665_01303 gene open 4045-4542 mlaD
2658 QQCF01000013.1 GCA003496665_01304 gene open 4593-5369 mlaE
2659 QQCF01000013.1 GCA003496665_01305 gene open 5417-6250 mlaF
2660 QQCF01000013.1 GCA003496665_01306 gene open 6390-7307 araC
2661 QQCF01000013.1 GCA003496665_01307 gene open 7415-8857 aldA
2662 QQCF01000013.1 GCA003496665_01308 gene open 8939-9868 ppk2
2663 QQCF01000013.1 GCA003496665_01309 gene open 10037-11818 trpE
2664 QQCF01000013.1 GCA003496665_01310 gene open 11878-13395
2665 QQCF01000013.1 GCA003496665_01311 gene open 13645-14664
2666 QQCF01000013.1 GCA003496665_01312 gene open 14692-17124 hupB
2667 QQCF01000013.1 GCA003496665_01313 gene open 18275-19621 mnmE
2668 QQCF01000013.1 GCA003496665_01314 gene open 19752-19907 ytxH
2669 QQCF01000013.1 GCA003496665_01315 gene open 19904-20335
2670 QQCF01000013.1 GCA003496665_01316 gene open 20473-25497 app
2671 QQCF01000013.1 GCA003496665_01317 gene open 25988-26179
2672 QQCF01000013.1 GCA003496665_01318 gene open 26179-28998 polA
2673 QQCF01000013.1 GCA003496665_01319 gene open 29164-29670 luxS
2674 QQCF01000013.1 GCA003496665_01320 gene open 29692-30111
2675 QQCF01000013.1 GCA003496665_01321 gene open 30144-30467 cyaY
2676 QQCF01000013.1 GCA003496665_01322 gene open 30538-30708 lptM
2677 QQCF01000013.1 GCA003496665_01323 gene open 30719-31963 lysA
2678 QQCF01000013.1 GCA003496665_01324 gene open 32146-32580 ywqK
2679 QQCF01000013.1 GCA003496665_01325 gene open 32633-32725
2680 QQCF01000013.1 GCA003496665_01326 gene open 32722-34257 yocR
2681 QQCF01000013.1 GCA003496665_01327 gene open 34708-36342 groL
2682 QQCF01000013.1 GCA003496665_01328 gene open 36435-36725 groES
2683 QQCF01000013.1 GCA003496665_01329 gene open 37611-39752 cirA
2684 QQCF01000013.1 GCA003496665_01330 gene open 39904-40869 ceuA
2685 QQCF01000013.1 GCA003496665_01331 gene open 41033-42001 ceuB
2686 QQCF01000013.1 GCA003496665_01332 gene open 41991-42965 ceuC
2687 QQCF01000013.1 GCA003496665_01333 gene open 43010-43636 fwdE
2688 QQCF01000013.1 GCA003496665_01334 gene open 43664-44482
2689 QQCF01000013.1 GCA003496665_01335 gene open 44538-44876 glnK
2690 QQCF01000013.1 GCA003496665_01336 gene open 45340-49296 purL
2691 QQCF01000013.1 GCA003496665_01337 gene open 49390-50142 gloB
2692 QQCF01000013.1 GCA003496665_01338 gene open 50376-51830 mgtE
2693 QQCF01000013.1 GCA003496665_01339 gene open 51916-52824 hslO
2694 QQCF01000013.1 GCA003496665_01340 gene open 53045-53650
2695 QQCF01000013.1 GCA003496665_01341 gene open 53669-53887
2696 QQCF01000013.1 GCA003496665_01342 gene open 54027-54374
2697 QQCF01000013.1 GCA003496665_01343 gene open 54371-55063 lrgB
2698 QQCF01000013.1 GCA003496665_01344 gene open 55129-56349 argJ
2699 QQCF01000013.1 GCA003496665_01345 gene open 56421-57830
2700 QQCF01000013.1 GCA003496665_01346 gene open 58021-59412 hrpA
2701 QQCF01000013.1 GCA003496665_01347 gene open 59470-59856
2702 QQCF01000013.1 GCA003496665_01348 gene open 59825-60520
2703 QQCF01000013.1 GCA003496665_01349 gene open 60517-61509
2704 QQCF01000013.1 GCA003496665_01350 gene open 61614-64529 hrpA
2705 QQCF01000014.1 repeat_region open 15717-17210 CRISPR array with 23 repeats of length 32%2C consensus sequence GTTTCAACACACAGCCGCCTAGAGGCGGCTGA and spacer length 34
2706 QQCF01000014.1 GCA003496665_01351 CDS open 186-965 _na     259_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
2707 QQCF01000014.1 GCA003496665_01352 CDS open 980-1549 _na     189_aa RelA/SpoT domain-containing protein
2708 QQCF01000014.1 GCA003496665_01353 CDS open 1660-2115 _na     151_aa Lipoprotein
2709 QQCF01000014.1 GCA003496665_01354 CDS open 2148-2885 _na     245_aa glnQ Glutamine ABC transporter%2C ATP-binding protein GlnQ
2710 QQCF01000014.1 GCA003496665_01355 CDS open 2954-3313 _na     119_aa VacJ-like protein
2711 QQCF01000014.1 GCA003496665_01356 CDS open 3318-3764 _na     148_aa Putative transcriptional regulator
2712 QQCF01000014.1 GCA003496665_01357 CDS open 3796-5070 _na     424_aa folC bifunctional tetrahydrofolate synthase/dihydrofolate synthase
2713 QQCF01000014.1 GCA003496665_01358 CDS open 5083-6165 _na     360_aa ftsN cell division protein FtsN
2714 QQCF01000014.1 GCA003496665_01359 CDS open 6158-6655 _na     165_aa cvpA CvpA family protein
2715 QQCF01000014.1 GCA003496665_01360 CDS open 7061-8605 _na     514_aa purF amidophosphoribosyltransferase
2716 QQCF01000014.1 GCA003496665_01361 CDS open 8705-9196 _na     163_aa greB transcription elongation factor GreB
2717 QQCF01000014.1 GCA003496665_01362 CDS open 9255-9881 _na     208_aa trpF phosphoribosylanthranilate isomerase
2718 QQCF01000014.1 GCA003496665_01363 CDS open 10404-13247 _na     947_aa lactoferrin/transferrin family TonB-dependent receptor
2719 QQCF01000014.1 GCA003496665_01364 CDS open 13244-15493 _na     749_aa Slam-dependent surface lipoprotein
2720 QQCF01000014.1 GCA003496665_01365 CDS open 17390-17731 _na     113_aa cas2 CRISPR-associated endonuclease Cas2
2721 QQCF01000014.1 GCA003496665_01366 CDS open 17738-18751 _na     337_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
2722 QQCF01000014.1 GCA003496665_01367 CDS open 19973-20908 _na     311_aa era GTPase Era
2723 QQCF01000014.1 GCA003496665_01368 CDS open 20943-21662 _na     239_aa rnc ribonuclease III
2724 QQCF01000014.1 GCA003496665_01369 CDS open 21830-22153 _na     107_aa DUF2185 domain-containing protein
2725 QQCF01000014.1 GCA003496665_01370 CDS open 22199-22675 _na     158_aa ribH 6%2C7-dimethyl-8-ribityllumazine synthase
2726 QQCF01000014.1 GCA003496665_01371 CDS open 22753-23178 _na     141_aa nusB transcription antitermination factor NusB
2727 QQCF01000014.1 GCA003496665_01372 CDS open 23250-23795 _na     181_aa hypothetical protein
2728 QQCF01000014.1 GCA003496665_01373 CDS open 23814-24848 _na     344_aa pyrC dihydroorotase
2729 QQCF01000014.1 GCA003496665_01374 CDS open 25211-25435 _na     74_aa tusA Putative sulfur carrier protein NMB0681
2730 QQCF01000014.1 GCA003496665_01375 CDS open 25544-26137 _na     197_aa clpB Clp protease ClpB
2731 QQCF01000014.1 GCA003496665_01376 CDS open 26212-27084 _na     290_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
2732 QQCF01000014.1 GCA003496665_01377 CDS open 27122-27907 _na     261_aa trpA tryptophan synthase subunit alpha
2733 QQCF01000014.1 GCA003496665_01379 CDS open 28469-28984 _na     171_aa 3-deoxy-manno-octulosonate cytidylyltransferase
2734 QQCF01000014.1 GCA003496665_01380 CDS open 29007-29768 _na     253_aa kdsB 3-deoxy-manno-octulosonate cytidylyltransferase
2735 QQCF01000014.1 GCA003496665_01381 CDS open 29765-29947 _na     60_aa trm112 UPF0434 protein NMA0874
2736 QQCF01000014.1 GCA003496665_01382 CDS open 30169-30750 _na     193_aa DUF2059 domain-containing protein
2737 QQCF01000014.1 GCA003496665_01383 CDS open 30919-32028 _na     369_aa lpxK tetraacyldisaccharide 4'-kinase
2738 QQCF01000014.1 GCA003496665_01384 CDS open 32028-32294 _na     88_aa Integral membrane protein
2739 QQCF01000014.1 GCA003496665_01385 CDS open 32386-33666 _na     426_aa sfcA Malic enzyme
2740 QQCF01000014.1 GCA003496665_01386 CDS open 33927-34553 _na     208_aa tmk dTMP kinase
2741 QQCF01000014.1 GCA003496665_01387 CDS open 34839-35834 _na     331_aa Endolytic murein transglycosylase
2742 QQCF01000014.1 GCA003496665_01388 CDS open 35919-36491 _na     190_aa ampD 1%2C6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD
2743 QQCF01000014.1 GCA003496665_01389 CDS open 36481-36588 _na     35_aa hypothetical protein
2744 QQCF01000014.1 GCA003496665_01390 CDS open 36685-37947 _na     420_aa zipA Cell division protein ZipA
2745 QQCF01000014.1 GCA003496665_01391 CDS open 38057-40540 _na     827_aa ligA NAD-dependent DNA ligase LigA
2746 QQCF01000014.1 GCA003496665_01392 CDS open 40597-41772 _na     391_aa hemW radical SAM family heme chaperone HemW
2747 QQCF01000014.1 GCA003496665_01393 CDS open 42298-42825 _na     175_aa nspA outer membrane beta-barrel protein NspA
2748 QQCF01000014.1 GCA003496665_01394 CDS open 42962-43351 _na     129_aa ridA Ribonuclease%2C putative
2749 QQCF01000014.1 GCA003496665_01395 CDS open 43428-44258 _na     276_aa apaH symmetrical bis(5'-nucleosyl)-tetraphosphatase
2750 QQCF01000014.1 GCA003496665_01396 CDS open 44273-45730 _na     485_aa trkG Trk system potassium uptake protein
2751 QQCF01000014.1 GCA003496665_01397 CDS open 45772-46161 _na     129_aa hypothetical protein
2752 QQCF01000014.1 GCA003496665_01398 CDS open 46262-46651 _na     129_aa Phage associated protein
2753 QQCF01000014.1 GCA003496665_01399 CDS open 46977-47219 _na     80_aa Immunity protein 31
2754 QQCF01000014.1 GCA003496665_01400 CDS open 47216-48886 _na     556_aa MafB-related protein
2755 QQCF01000014.1 GCA003496665_01402 CDS open 49329-49787 _na     152_aa nudB dihydroneopterin triphosphate diphosphatase
2756 QQCF01000014.1 GCA003496665_01403 CDS open 49889-50422 _na     177_aa ppa Inorganic pyrophosphatase
2757 QQCF01000014.1 GCA003496665_01404 CDS open 50530-50763 _na     77_aa hypothetical protein
2758 QQCF01000014.1 GCA003496665_01405 CDS open 50756-51355 _na     199_aa rdgB RdgB/HAM1 family non-canonical purine NTP pyrophosphatase
2759 QQCF01000014.1 GCA003496665_01406 CDS open 51383-52252 _na     289_aa galU UTP--glucose-1-phosphate uridylyltransferase GalU
2760 QQCF01000014.1 GCA003496665_01407 CDS open 52271-53647 _na     458_aa argH argininosuccinate lyase
2761 QQCF01000014.1 GCA003496665_01408 CDS open 53705-54175 _na     156_aa DUF4375 domain-containing protein
2762 QQCF01000014.1 GCA003496665_01409 CDS open 54473-55468 _na     331_aa Major ferric iron binding protein
2763 QQCF01000014.1 GCA003496665_01410 CDS open 55533-57050 _na     505_aa fbpB heme ABC transporter permease FbpB
2764 QQCF01000014.1 GCA003496665_01411 CDS open 57071-58132 _na     353_aa Iron-uptake permease ATP-binding protein
2765 QQCF01000014.1 GCA003496665_01412 CDS open 58374-59876 _na     500_aa pta phosphate acetyltransferase
2766 QQCF01000014.1 GCA003496665_01413 CDS open 60007-60645 _na     212_aa hisH imidazole glycerol phosphate synthase subunit HisH
2767 QQCF01000014.1 GCA003496665_01414 CDS open 60678-61415 _na     245_aa hisA 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase
2768 QQCF01000014.1 GCA003496665_01415 CDS open 61428-62195 _na     255_aa hisF Imidazole glycerol phosphate synthase subunit HisF
2769 QQCF01000014.1 GCA003496665_01416 CDS open 62225-62620 _na     131_aa hisI phosphoribosyl-AMP cyclohydrolase
2770 QQCF01000014.1 GCA003496665_01417 CDS open 62727-64322 _na     531_aa prfC peptide chain release factor 3
2771 QQCF01000014.1 GCA003496665_01351 gene open 186-965 rsmA
2772 QQCF01000014.1 GCA003496665_01352 gene open 980-1549
2773 QQCF01000014.1 GCA003496665_01353 gene open 1660-2115
2774 QQCF01000014.1 GCA003496665_01354 gene open 2148-2885 glnQ
2775 QQCF01000014.1 GCA003496665_01355 gene open 2954-3313
2776 QQCF01000014.1 GCA003496665_01356 gene open 3318-3764
2777 QQCF01000014.1 GCA003496665_01357 gene open 3796-5070 folC
2778 QQCF01000014.1 GCA003496665_01358 gene open 5083-6165 ftsN
2779 QQCF01000014.1 GCA003496665_01359 gene open 6158-6655 cvpA
2780 QQCF01000014.1 GCA003496665_01360 gene open 7061-8605 purF
2781 QQCF01000014.1 GCA003496665_01361 gene open 8705-9196 greB
2782 QQCF01000014.1 GCA003496665_01362 gene open 9255-9881 trpF
2783 QQCF01000014.1 GCA003496665_01363 gene open 10404-13247
2784 QQCF01000014.1 GCA003496665_01364 gene open 13244-15493
2785 QQCF01000014.1 GCA003496665_01365 gene open 17390-17731 cas2
2786 QQCF01000014.1 GCA003496665_01366 gene open 17738-18751 cas1c
2787 QQCF01000014.1 GCA003496665_01367 gene open 19973-20908 era
2788 QQCF01000014.1 GCA003496665_01368 gene open 20943-21662 rnc
2789 QQCF01000014.1 GCA003496665_01369 gene open 21830-22153
2790 QQCF01000014.1 GCA003496665_01370 gene open 22199-22675 ribH
2791 QQCF01000014.1 GCA003496665_01371 gene open 22753-23178 nusB
2792 QQCF01000014.1 GCA003496665_01372 gene open 23250-23795
2793 QQCF01000014.1 GCA003496665_01373 gene open 23814-24848 pyrC
2794 QQCF01000014.1 GCA003496665_01374 gene open 25211-25435 tusA
2795 QQCF01000014.1 GCA003496665_01375 gene open 25544-26137 clpB
2796 QQCF01000014.1 GCA003496665_01376 gene open 26212-27084 accD
2797 QQCF01000014.1 GCA003496665_01377 gene open 27122-27907 trpA
2798 QQCF01000014.1 GCA003496665_01379 gene open 28469-28984
2799 QQCF01000014.1 GCA003496665_01380 gene open 29007-29768 kdsB
2800 QQCF01000014.1 GCA003496665_01381 gene open 29765-29947 trm112
2801 QQCF01000014.1 GCA003496665_01382 gene open 30169-30750
2802 QQCF01000014.1 GCA003496665_01383 gene open 30919-32028 lpxK
2803 QQCF01000014.1 GCA003496665_01384 gene open 32028-32294
2804 QQCF01000014.1 GCA003496665_01385 gene open 32386-33666 sfcA
2805 QQCF01000014.1 GCA003496665_01386 gene open 33927-34553 tmk
2806 QQCF01000014.1 GCA003496665_01387 gene open 34839-35834
2807 QQCF01000014.1 GCA003496665_01388 gene open 35919-36491 ampD
2808 QQCF01000014.1 GCA003496665_01389 gene open 36481-36588
2809 QQCF01000014.1 GCA003496665_01390 gene open 36685-37947 zipA
2810 QQCF01000014.1 GCA003496665_01391 gene open 38057-40540 ligA
2811 QQCF01000014.1 GCA003496665_01392 gene open 40597-41772 hemW
2812 QQCF01000014.1 GCA003496665_01393 gene open 42298-42825 nspA
2813 QQCF01000014.1 GCA003496665_01394 gene open 42962-43351 ridA
2814 QQCF01000014.1 GCA003496665_01395 gene open 43428-44258 apaH
2815 QQCF01000014.1 GCA003496665_01396 gene open 44273-45730 trkG
2816 QQCF01000014.1 GCA003496665_01397 gene open 45772-46161
2817 QQCF01000014.1 GCA003496665_01398 gene open 46262-46651
2818 QQCF01000014.1 GCA003496665_01399 gene open 46977-47219
2819 QQCF01000014.1 GCA003496665_01400 gene open 47216-48886
2820 QQCF01000014.1 GCA003496665_01402 gene open 49329-49787 nudB
2821 QQCF01000014.1 GCA003496665_01403 gene open 49889-50422 ppa
2822 QQCF01000014.1 GCA003496665_01404 gene open 50530-50763
2823 QQCF01000014.1 GCA003496665_01405 gene open 50756-51355 rdgB
2824 QQCF01000014.1 GCA003496665_01406 gene open 51383-52252 galU
2825 QQCF01000014.1 GCA003496665_01407 gene open 52271-53647 argH
2826 QQCF01000014.1 GCA003496665_01408 gene open 53705-54175
2827 QQCF01000014.1 GCA003496665_01409 gene open 54473-55468
2828 QQCF01000014.1 GCA003496665_01410 gene open 55533-57050 fbpB
2829 QQCF01000014.1 GCA003496665_01411 gene open 57071-58132
2830 QQCF01000014.1 GCA003496665_01412 gene open 58374-59876 pta
2831 QQCF01000014.1 GCA003496665_01413 gene open 60007-60645 hisH
2832 QQCF01000014.1 GCA003496665_01414 gene open 60678-61415 hisA
2833 QQCF01000014.1 GCA003496665_01415 gene open 61428-62195 hisF
2834 QQCF01000014.1 GCA003496665_01416 gene open 62225-62620 hisI
2835 QQCF01000014.1 GCA003496665_01417 gene open 62727-64322 prfC
2836 QQCF01000014.1 GCA003496665_01378 gene open 28216-28308 trnS
2837 QQCF01000014.1 GCA003496665_01401 gene open 49044-49120 trnP
2838 QQCF01000014.1 GCA003496665_01378 tRNA open 28216-28308 trnS tRNA-Ser(gct)
2839 QQCF01000014.1 GCA003496665_01401 tRNA open 49044-49120 trnP tRNA-Pro(ggg)
2840 QQCF01000015.1 rep_origin open 43996-46828
2841 QQCF01000015.1 GCA003496665_01482 gene open 63302-63661 RNaseP_bact_a
2842 QQCF01000015.1 GCA003496665_01482 ncRNA open 63302-63661 Bacterial RNase P class A
2843 QQCF01000015.1 GCA003496665_01418 CDS open 120-536 _na     138_aa dksA RNA polymerase-binding protein DksA
2844 QQCF01000015.1 GCA003496665_01419 CDS open 683-1474 _na     263_aa proC pyrroline-5-carboxylate reductase
2845 QQCF01000015.1 GCA003496665_01420 CDS open 1523-1924 _na     133_aa Lipoprotein
2846 QQCF01000015.1 GCA003496665_01421 CDS open 1912-2616 _na     234_aa yggS Pyridoxal phosphate homeostasis protein
2847 QQCF01000015.1 GCA003496665_01422 CDS open 2730-3773 _na     347_aa pilT twitching motility protein PilT
2848 QQCF01000015.1 GCA003496665_01423 CDS open 3879-5105 _na     408_aa pilU twitching motility protein PilU
2849 QQCF01000015.1 GCA003496665_01424 CDS open 5197-7347 _na     716_aa TIGR01666 family membrane protein
2850 QQCF01000015.1 GCA003496665_01425 CDS open 8245-8514 _na     89_aa DUF3079 domain-containing protein
2851 QQCF01000015.1 GCA003496665_01426 CDS open 8862-10325 _na     487_aa ftsY signal recognition particle-docking protein FtsY
2852 QQCF01000015.1 GCA003496665_01427 CDS open 10471-12039 _na     522_aa msrB bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB
2853 QQCF01000015.1 GCA003496665_01428 CDS open 12141-12626 _na     161_aa pncC CinA C-terminal domain-containing protein
2854 QQCF01000015.1 GCA003496665_01429 CDS open 12652-13500 _na     282_aa mscK Small-conductance mechanosensitive channel
2855 QQCF01000015.1 GCA003496665_01430 CDS open 13590-14591 _na     333_aa tbpA Solute-binding periplasmic protein
2856 QQCF01000015.1 GCA003496665_01431 CDS open 14790-15062 _na     90_aa Spore cortex protein
2857 QQCF01000015.1 GCA003496665_01432 CDS open 15117-16487 _na     456_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
2858 QQCF01000015.1 GCA003496665_01433 CDS open 16563-16892 _na     109_aa phnA Phosphonoacetate hydrolase
2859 QQCF01000015.1 GCA003496665_01434 CDS open 16963-18228 _na     421_aa efeB iron uptake transporter deferrochelatase/peroxidase subunit
2860 QQCF01000015.1 GCA003496665_01435 CDS open 18371-19537 _na     388_aa efeO iron uptake system protein EfeO
2861 QQCF01000015.1 GCA003496665_01436 CDS open 19534-20373 _na     279_aa efeU iron uptake transporter permease EfeU
2862 QQCF01000015.1 GCA003496665_01437 CDS open 20584-21909 _na     441_aa mltA peptidoglycan lytic exotransglycosylase
2863 QQCF01000015.1 GCA003496665_01438 CDS open 21776-22222 _na     148_aa Group II decarboxylase family protein
2864 QQCF01000015.1 GCA003496665_01439 CDS open 22189-22710 _na     173_aa Lipoprotein
2865 QQCF01000015.1 GCA003496665_01440 CDS open 22990-24828 _na     612_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
2866 QQCF01000015.1 GCA003496665_01441 CDS open 24944-26998 _na     684_aa metG methionine--tRNA ligase
2867 QQCF01000015.1 GCA003496665_01442 CDS open 27073-28026 _na     317_aa ldhA Glycerate dehydrogenase
2868 QQCF01000015.1 GCA003496665_01443 CDS open 28148-28375 _na     75_aa DUF2061 domain-containing protein
2869 QQCF01000015.1 GCA003496665_01444 CDS open 28546-28875 _na     109_aa fbp FK506-binding protein
2870 QQCF01000015.1 GCA003496665_01445 CDS open 29038-29961 _na     307_aa lpxC UDP-3-O-acyl-N-acetylglucosamine deacetylase
2871 QQCF01000015.1 GCA003496665_01446 CDS open 30702-32150 _na     482_aa gnd decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase
2872 QQCF01000015.1 GCA003496665_01447 CDS open 32212-33489 _na     425_aa waaA lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase
2873 QQCF01000015.1 GCA003496665_01448 CDS open 33527-33976 _na     149_aa Integral membrane protein
2874 QQCF01000015.1 GCA003496665_01449 CDS open 34009-34980 _na     323_aa terC Transmembrane transport protein
2875 QQCF01000015.1 GCA003496665_01451 CDS open 35348-36601 _na     417_aa UDP-N-acetylglucosamine 1-carboxyvinyltransferase
2876 QQCF01000015.1 GCA003496665_01452 CDS open 36682-37860 _na     392_aa pgk Phosphoglycerate kinase
2877 QQCF01000015.1 GCA003496665_01453 CDS open 37925-38173 _na     82_aa ibaG BolA family protein
2878 QQCF01000015.1 GCA003496665_01454 CDS open 38266-39183 _na     305_aa ftsX permease-like cell division protein FtsX
2879 QQCF01000015.1 GCA003496665_01455 CDS open 39180-39830 _na     216_aa ftsE Cell division ATP-binding protein FtsE
2880 QQCF01000015.1 GCA003496665_01456 CDS open 40033-40515 _na     160_aa trxA Redoxin family protein
2881 QQCF01000015.1 GCA003496665_01457 CDS open 40639-40992 _na     117_aa arsC arsenate reductase (glutaredoxin)
2882 QQCF01000015.1 GCA003496665_01458 CDS open 40989-41645 _na     218_aa elyC DUF218 domain-containing protein
2883 QQCF01000015.1 GCA003496665_01459 CDS open 41761-43155 _na     464_aa gltX glutamate--tRNA ligase
2884 QQCF01000015.1 GCA003496665_01460 CDS open 43176-43571 _na     131_aa Periplasmic protein
2885 QQCF01000015.1 GCA003496665_01461 CDS open 43814-46411 _na     865_aa mutS DNA mismatch repair protein MutS
2886 QQCF01000015.1 GCA003496665_01462 CDS open 46844-47848 _na     334_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
2887 QQCF01000015.1 GCA003496665_01463 CDS open 48001-48681 _na     226_aa tsaA tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO
2888 QQCF01000015.1 GCA003496665_01464 CDS open 48795-49430 _na     211_aa pncA nicotinamidase
2889 QQCF01000015.1 GCA003496665_01465 CDS open 49467-50465 _na     332_aa rfaC lipopolysaccharide heptosyltransferase I
2890 QQCF01000015.1 GCA003496665_01466 CDS open 50656-51405 _na     249_aa fixA Electron transfer flavoprotein subunit beta
2891 QQCF01000015.1 GCA003496665_01467 CDS open 51416-52351 _na     311_aa fixB Electron transfer flavoprotein%2C alpha subunit
2892 QQCF01000015.1 GCA003496665_01468 CDS open 52414-53025 _na     203_aa yIH1 Impact N-terminal domain-containing protein
2893 QQCF01000015.1 GCA003496665_01469 CDS open 53156-53395 _na     79_aa DUF4298 domain-containing protein
2894 QQCF01000015.1 GCA003496665_01470 CDS open 53554-54825 _na     423_aa purD Phosphoribosylamine--glycine ligase
2895 QQCF01000015.1 GCA003496665_01471 CDS open 54890-55459 _na     189_aa L-threonylcarbamoyladenylate synthase
2896 QQCF01000015.1 GCA003496665_01472 CDS open 55474-55989 _na     171_aa hypothetical protein
2897 QQCF01000015.1 GCA003496665_01473 CDS open 56155-56577 _na     140_aa surface-adhesin E family protein
2898 QQCF01000015.1 GCA003496665_01474 CDS open 57011-57598 _na     195_aa rpoE RNA polymerase sigma factor
2899 QQCF01000015.1 GCA003496665_01475 CDS open 57620-58366 _na     248_aa DUF2063 domain-containing protein
2900 QQCF01000015.1 GCA003496665_01476 CDS open 58356-59198 _na     280_aa UPF0276 protein NMB2142
2901 QQCF01000015.1 GCA003496665_01477 CDS open 59316-59624 _na     102_aa Periplasmic protein
2902 QQCF01000015.1 GCA003496665_01478 CDS open 59698-60147 _na     149_aa doxX Integral membrane protein
2903 QQCF01000015.1 GCA003496665_01479 CDS open 60422-60910 _na     162_aa Phage associated protein
2904 QQCF01000015.1 GCA003496665_01480 CDS open 61124-62017 _na     297_aa rssA PNPLA domain-containing protein
2905 QQCF01000015.1 GCA003496665_01481 CDS open 62120-63223 _na     367_aa prfB peptide chain release factor 2
2906 QQCF01000015.1 GCA003496665_01418 gene open 120-536 dksA
2907 QQCF01000015.1 GCA003496665_01419 gene open 683-1474 proC
2908 QQCF01000015.1 GCA003496665_01420 gene open 1523-1924
2909 QQCF01000015.1 GCA003496665_01421 gene open 1912-2616 yggS
2910 QQCF01000015.1 GCA003496665_01422 gene open 2730-3773 pilT
2911 QQCF01000015.1 GCA003496665_01423 gene open 3879-5105 pilU
2912 QQCF01000015.1 GCA003496665_01424 gene open 5197-7347
2913 QQCF01000015.1 GCA003496665_01425 gene open 8245-8514
2914 QQCF01000015.1 GCA003496665_01426 gene open 8862-10325 ftsY
2915 QQCF01000015.1 GCA003496665_01427 gene open 10471-12039 msrB
2916 QQCF01000015.1 GCA003496665_01428 gene open 12141-12626 pncC
2917 QQCF01000015.1 GCA003496665_01429 gene open 12652-13500 mscK
2918 QQCF01000015.1 GCA003496665_01430 gene open 13590-14591 tbpA
2919 QQCF01000015.1 GCA003496665_01431 gene open 14790-15062
2920 QQCF01000015.1 GCA003496665_01432 gene open 15117-16487 glmU
2921 QQCF01000015.1 GCA003496665_01433 gene open 16563-16892 phnA
2922 QQCF01000015.1 GCA003496665_01434 gene open 16963-18228 efeB
2923 QQCF01000015.1 GCA003496665_01435 gene open 18371-19537 efeO
2924 QQCF01000015.1 GCA003496665_01436 gene open 19534-20373 efeU
2925 QQCF01000015.1 GCA003496665_01437 gene open 20584-21909 mltA
2926 QQCF01000015.1 GCA003496665_01438 gene open 21776-22222
2927 QQCF01000015.1 GCA003496665_01439 gene open 22189-22710
2928 QQCF01000015.1 GCA003496665_01440 gene open 22990-24828 glmS
2929 QQCF01000015.1 GCA003496665_01441 gene open 24944-26998 metG
2930 QQCF01000015.1 GCA003496665_01442 gene open 27073-28026 ldhA
2931 QQCF01000015.1 GCA003496665_01443 gene open 28148-28375
2932 QQCF01000015.1 GCA003496665_01444 gene open 28546-28875 fbp
2933 QQCF01000015.1 GCA003496665_01445 gene open 29038-29961 lpxC
2934 QQCF01000015.1 GCA003496665_01446 gene open 30702-32150 gnd
2935 QQCF01000015.1 GCA003496665_01447 gene open 32212-33489 waaA
2936 QQCF01000015.1 GCA003496665_01448 gene open 33527-33976
2937 QQCF01000015.1 GCA003496665_01449 gene open 34009-34980 terC
2938 QQCF01000015.1 GCA003496665_01451 gene open 35348-36601
2939 QQCF01000015.1 GCA003496665_01452 gene open 36682-37860 pgk
2940 QQCF01000015.1 GCA003496665_01453 gene open 37925-38173 ibaG
2941 QQCF01000015.1 GCA003496665_01454 gene open 38266-39183 ftsX
2942 QQCF01000015.1 GCA003496665_01455 gene open 39180-39830 ftsE
2943 QQCF01000015.1 GCA003496665_01456 gene open 40033-40515 trxA
2944 QQCF01000015.1 GCA003496665_01457 gene open 40639-40992 arsC
2945 QQCF01000015.1 GCA003496665_01458 gene open 40989-41645 elyC
2946 QQCF01000015.1 GCA003496665_01459 gene open 41761-43155 gltX
2947 QQCF01000015.1 GCA003496665_01460 gene open 43176-43571
2948 QQCF01000015.1 GCA003496665_01461 gene open 43814-46411 mutS
2949 QQCF01000015.1 GCA003496665_01462 gene open 46844-47848 gap
2950 QQCF01000015.1 GCA003496665_01463 gene open 48001-48681 tsaA
2951 QQCF01000015.1 GCA003496665_01464 gene open 48795-49430 pncA
2952 QQCF01000015.1 GCA003496665_01465 gene open 49467-50465 rfaC
2953 QQCF01000015.1 GCA003496665_01466 gene open 50656-51405 fixA
2954 QQCF01000015.1 GCA003496665_01467 gene open 51416-52351 fixB
2955 QQCF01000015.1 GCA003496665_01468 gene open 52414-53025 yIH1
2956 QQCF01000015.1 GCA003496665_01469 gene open 53156-53395
2957 QQCF01000015.1 GCA003496665_01470 gene open 53554-54825 purD
2958 QQCF01000015.1 GCA003496665_01471 gene open 54890-55459
2959 QQCF01000015.1 GCA003496665_01472 gene open 55474-55989
2960 QQCF01000015.1 GCA003496665_01473 gene open 56155-56577
2961 QQCF01000015.1 GCA003496665_01474 gene open 57011-57598 rpoE
2962 QQCF01000015.1 GCA003496665_01475 gene open 57620-58366
2963 QQCF01000015.1 GCA003496665_01476 gene open 58356-59198
2964 QQCF01000015.1 GCA003496665_01477 gene open 59316-59624
2965 QQCF01000015.1 GCA003496665_01478 gene open 59698-60147 doxX
2966 QQCF01000015.1 GCA003496665_01479 gene open 60422-60910
2967 QQCF01000015.1 GCA003496665_01480 gene open 61124-62017 rssA
2968 QQCF01000015.1 GCA003496665_01481 gene open 62120-63223 prfB
2969 QQCF01000015.1 GCA003496665_01450 gene open 35054-35129 trnK
2970 QQCF01000015.1 GCA003496665_01450 tRNA open 35054-35129 trnK tRNA-Lys(ttt)
2971 QQCF01000016.1 regulatory_region open 49535-49579 PreQ1 (pre queuosine) riboswitch aptamer
2972 QQCF01000016.1 GCA003496665_01483 CDS open 170-319 _na     49_aa hypothetical protein
2973 QQCF01000016.1 GCA003496665_01484 CDS open 555-785 _na     76_aa mafI MafI family immunity protein
2974 QQCF01000016.1 GCA003496665_01485 CDS open 934-1611 _na     225_aa Hint domain-/BECR-fold containing toxin
2975 QQCF01000016.1 GCA003496665_01486 CDS open 1617-1994 _na     125_aa mafB MafB alternative C terminus
2976 QQCF01000016.1 GCA003496665_01487 CDS open 2299-2700 _na     133_aa mafB MafB silent cassette
2977 QQCF01000016.1 GCA003496665_01488 CDS open 2869-3312 _na     147_aa Phage associated protein
2978 QQCF01000016.1 GCA003496665_01489 CDS open 3502-4635 _na     377_aa Periplasmic protein
2979 QQCF01000016.1 GCA003496665_01490 CDS open 5180-5494 _na     104_aa colicin immunity domain-containing protein
2980 QQCF01000016.1 GCA003496665_01491 CDS open 5653-5928 _na     91_aa yhbQ UPF0213 protein NMA2126
2981 QQCF01000016.1 GCA003496665_01492 CDS open 5925-7208 _na     427_aa ampG AmpG protein
2982 QQCF01000016.1 GCA003496665_01493 CDS open 7363-8781 _na     472_aa glnA type I glutamate--ammonia ligase
2983 QQCF01000016.1 GCA003496665_01494 CDS open 9082-9891 _na     269_aa aroE shikimate dehydrogenase
2984 QQCF01000016.1 GCA003496665_01495 CDS open 9893-10594 _na     233_aa mtgA monofunctional biosynthetic peptidoglycan transglycosylase
2985 QQCF01000016.1 GCA003496665_01497 CDS open 11202-11936 _na     244_aa lptB LPS export ABC transporter ATP-binding protein
2986 QQCF01000016.1 GCA003496665_01498 CDS open 12009-12524 _na     171_aa lptA lipopolysaccharide transport periplasmic protein LptA
2987 QQCF01000016.1 GCA003496665_01499 CDS open 12505-13086 _na     193_aa lptC LPS export ABC transporter periplasmic protein LptC
2988 QQCF01000016.1 GCA003496665_01500 CDS open 13083-13619 _na     178_aa kdsC 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase
2989 QQCF01000016.1 GCA003496665_01501 CDS open 13837-14811 _na     324_aa kpsF KpsF
2990 QQCF01000016.1 GCA003496665_01502 CDS open 14908-15963 _na     351_aa tal transaldolase
2991 QQCF01000016.1 GCA003496665_01503 CDS open 16117-16407 _na     96_aa hypothetical protein
2992 QQCF01000016.1 GCA003496665_01504 CDS open 16424-17311 _na     295_aa gluQRS tRNA glutamyl-Q(34) synthetase GluQRS
2993 QQCF01000016.1 GCA003496665_01505 CDS open 17381-18391 _na     336_aa dusA tRNA dihydrouridine(20/20a) synthase DusA
2994 QQCF01000016.1 GCA003496665_01506 CDS open 18422-18913 _na     163_aa dtd D-aminoacyl-tRNA deacylase
2995 QQCF01000016.1 GCA003496665_01507 CDS open 18989-19744 _na     251_aa peptidylprolyl isomerase
2996 QQCF01000016.1 GCA003496665_01508 CDS open 19815-20681 _na     288_aa peptidylprolyl isomerase
2997 QQCF01000016.1 GCA003496665_01509 CDS open 20730-21008 _na     92_aa bolA BolA family transcriptional regulator
2998 QQCF01000016.1 GCA003496665_01510 CDS open 21008-21298 _na     96_aa yciI YciI family protein
2999 QQCF01000016.1 GCA003496665_01511 CDS open 21301-21831 _na     176_aa yciB septation protein A
3000 QQCF01000016.1 GCA003496665_01512 CDS open 22054-25362 _na     1102_aa tspA Putative Neisseria-specific antigen protein%2C TspA