BAKTAGenome Explorer: Moraxella catarrhalis (GCA_003626375.1)
Select a Genome:
|
BAKTA Annotations for GCA_003626375.1
|
Search & Sort all 3540 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | QZHM01000001.1 | rep_origin | open | 33974-34570 | ||||
| 2 | QZHM01000001.1 | GCA003626375_00159 | gene | open | 19457-19560 | V_AS9 | ||
| 3 | QZHM01000001.1 | GCA003626375_00159 | ncRNA | open | 19457-19560 | Vibrio RNA AS9 | ||
| 4 | QZHM01000001.1 | repeat_region | open | 61368-62366 | CRISPR array with 17 repeats of length 28%2C consensus sequence TTTCTAAGCGACCTGTGCGGTCGTGAAG and spacer length 32 | |||
| 5 | QZHM01000001.1 | GCA003626375_00138 | CDS | open | 466-723 | _na 85_aa | hypothetical protein | |
| 6 | QZHM01000001.1 | GCA003626375_00139 | CDS | open | 720-875 | _na 51_aa | hypothetical protein | |
| 7 | QZHM01000001.1 | GCA003626375_00140 | CDS | open | 1396-2322 | _na 308_aa | znuA | Manganese ABC transporter%2C periplasmic-binding protein SitA |
| 8 | QZHM01000001.1 | GCA003626375_00141 | CDS | open | 2322-3227 | _na 301_aa | znuC | Manganese ABC transporter%2C ATP-binding protein SitB |
| 9 | QZHM01000001.1 | GCA003626375_00142 | CDS | open | 3224-4066 | _na 280_aa | znuB | Iron ABC transporter permease |
| 10 | QZHM01000001.1 | GCA003626375_00143 | CDS | open | 4241-4945 | _na 234_aa | znuB | Manganese ABC transporter%2C inner membrane permease protein SitD |
| 11 | QZHM01000001.1 | GCA003626375_00144 | CDS | open | 5451-6671 | _na 406_aa | tyrS | tyrosine--tRNA ligase |
| 12 | QZHM01000001.1 | GCA003626375_00145 | CDS | open | 6833-8068 | _na 411_aa | anmK | anhydro-N-acetylmuramic acid kinase |
| 13 | QZHM01000001.1 | GCA003626375_00146 | CDS | open | 8318-9097 | _na 259_aa | Protein NO VEIN C-terminal domain-containing protein | |
| 14 | QZHM01000001.1 | GCA003626375_00147 | CDS | open | 9091-9339 | _na 82_aa | hypothetical protein | |
| 15 | QZHM01000001.1 | GCA003626375_00148 | CDS | open | 9460-9657 | _na 65_aa | Restriction endonuclease | |
| 16 | QZHM01000001.1 | GCA003626375_00149 | CDS | open | 9828-10628 | _na 266_aa | czcD | Cadmium%2C cobalt and zinc/H(+)-K(+) antiporter |
| 17 | QZHM01000001.1 | GCA003626375_00150 | CDS | open | 10899-11375 | _na 158_aa | Hemerythrin | |
| 18 | QZHM01000001.1 | GCA003626375_00151 | CDS | open | 11545-12798 | _na 417_aa | rocD | ornithine--oxo-acid transaminase |
| 19 | QZHM01000001.1 | GCA003626375_00152 | CDS | open | 12839-13771 | _na 310_aa | rocF | arginase |
| 20 | QZHM01000001.1 | GCA003626375_00153 | CDS | open | 14344-14511 | _na 55_aa | Methylitaconate delta2-delta3-isomerase | |
| 21 | QZHM01000001.1 | GCA003626375_00154 | CDS | open | 14714-16495 | _na 593_aa | aF0785 | DUF389 domain-containing protein |
| 22 | QZHM01000001.1 | GCA003626375_00155 | CDS | open | 16728-17336 | _na 202_aa | rsmC | Ribosomal RNA small subunit methyltransferase C |
| 23 | QZHM01000001.1 | GCA003626375_00156 | CDS | open | 17429-17851 | _na 140_aa | Putative vgr related protein | |
| 24 | QZHM01000001.1 | GCA003626375_00157 | CDS | open | 18007-19245 | _na 412_aa | rarA | Replication-associated recombination protein A |
| 25 | QZHM01000001.1 | GCA003626375_00158 | CDS | open | 19360-20454 | _na 364_aa | ribBA | bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II |
| 26 | QZHM01000001.1 | GCA003626375_00160 | CDS | open | 20621-20881 | _na 86_aa | yeaQ | Transglycosylase |
| 27 | QZHM01000001.1 | GCA003626375_00161 | CDS | open | 20949-21563 | _na 204_aa | tsaC | Threonylcarbamoyl-AMP synthase |
| 28 | QZHM01000001.1 | GCA003626375_00162 | CDS | open | 21550-22761 | _na 403_aa | dprA | DNA-processing protein DprA |
| 29 | QZHM01000001.1 | GCA003626375_00163 | CDS | open | 22798-24213 | _na 471_aa | thrC | threonine synthase |
| 30 | QZHM01000001.1 | GCA003626375_00164 | CDS | open | 24531-25877 | _na 448_aa | rsmB | 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB |
| 31 | QZHM01000001.1 | GCA003626375_00165 | CDS | open | 25867-26892 | _na 341_aa | fmt | methionyl-tRNA formyltransferase |
| 32 | QZHM01000001.1 | GCA003626375_00166 | CDS | open | 27023-27691 | _na 222_aa | ribC | riboflavin synthase |
| 33 | QZHM01000001.1 | GCA003626375_00167 | CDS | open | 27974-29026 | _na 350_aa | ribD | bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD |
| 34 | QZHM01000001.1 | GCA003626375_00168 | CDS | open | 29023-29493 | _na 156_aa | nrdR | transcriptional regulator NrdR |
| 35 | QZHM01000001.1 | GCA003626375_00169 | CDS | open | 29597-30997 | _na 466_aa | mnmE | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE |
| 36 | QZHM01000001.1 | GCA003626375_00170 | CDS | open | 31164-32837 | _na 557_aa | yidC | membrane protein insertase YidC |
| 37 | QZHM01000001.1 | GCA003626375_00171 | CDS | open | 32976-33296 | _na 106_aa | yidD | membrane protein insertion efficiency factor YidD |
| 38 | QZHM01000001.1 | GCA003626375_00172 | CDS | open | 33314-33727 | _na 137_aa | rnpA | ribonuclease P protein component |
| 39 | QZHM01000001.1 | GCA003626375_00173 | CDS | open | 33839-33973 | _na 44_aa | rpmH | 50S ribosomal protein L34 |
| 40 | QZHM01000001.1 | GCA003626375_00174 | CDS | open | 34571-35974 | _na 467_aa | dnaA | chromosomal replication initiator protein DnaA |
| 41 | QZHM01000001.1 | GCA003626375_00175 | CDS | open | 36011-37168 | _na 385_aa | dnaN | DNA polymerase III subunit beta |
| 42 | QZHM01000001.1 | GCA003626375_00176 | CDS | open | 37172-38380 | _na 402_aa | recF | DNA replication/repair protein RecF |
| 43 | QZHM01000001.1 | GCA003626375_00177 | CDS | open | 38517-40976 | _na 819_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 44 | QZHM01000001.1 | GCA003626375_00178 | CDS | open | 41150-42709 | _na 519_aa | guaA | glutamine-hydrolyzing GMP synthase |
| 45 | QZHM01000001.1 | GCA003626375_00179 | CDS | open | 42862-44079 | _na 405_aa | Esterase-like activity of phytase family protein | |
| 46 | QZHM01000001.1 | GCA003626375_00180 | CDS | open | 44346-44840 | _na 164_aa | rlpA | RlpA-like protein double-psi beta-barrel domain-containing protein |
| 47 | QZHM01000001.1 | GCA003626375_00181 | CDS | open | 44854-45213 | _na 119_aa | fkpA | Peptidyl-prolyl cis-trans isomerase |
| 48 | QZHM01000001.1 | GCA003626375_00182 | CDS | open | 45355-46530 | _na 391_aa | lysA | Ornithine decarboxylase |
| 49 | QZHM01000001.1 | GCA003626375_00183 | CDS | open | 46967-47848 | _na 293_aa | aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme | |
| 50 | QZHM01000001.1 | GCA003626375_00184 | CDS | open | 47886-48242 | _na 118_aa | ridA | Aminoacrylate peracid reductase |
| 51 | QZHM01000001.1 | GCA003626375_00185 | CDS | open | 48251-49507 | _na 418_aa | dadA | D-amino acid dehydrogenase |
| 52 | QZHM01000001.1 | GCA003626375_00186 | CDS | open | 49849-51720 | _na 623_aa | thiC | phosphomethylpyrimidine synthase ThiC |
| 53 | QZHM01000001.1 | GCA003626375_00187 | CDS | open | 51837-53678 | _na 613_aa | mdlB | ABC transporter%2C ATP-binding protein |
| 54 | QZHM01000001.1 | GCA003626375_00188 | CDS | open | 53860-55260 | _na 466_aa | argH | argininosuccinate lyase |
| 55 | QZHM01000001.1 | GCA003626375_00189 | CDS | open | 55484-56449 | _na 321_aa | hemC | hydroxymethylbilane synthase |
| 56 | QZHM01000001.1 | GCA003626375_00190 | CDS | open | 56449-57204 | _na 251_aa | hemD | Uroporphyrinogen-III synthase |
| 57 | QZHM01000001.1 | GCA003626375_00191 | CDS | open | 57276-58148 | _na 290_aa | rlmB | 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB |
| 58 | QZHM01000001.1 | GCA003626375_00192 | CDS | open | 58214-58471 | _na 85_aa | nqrM | (Na+)-NQR maturation NqrM |
| 59 | QZHM01000001.1 | GCA003626375_00193 | CDS | open | 58625-60532 | _na 635_aa | dnaK | molecular chaperone DnaK |
| 60 | QZHM01000001.1 | GCA003626375_00194 | CDS | open | 60734-61255 | _na 173_aa | grpE | nucleotide exchange factor GrpE |
| 61 | QZHM01000001.1 | GCA003626375_00195 | CDS | open | 62667-63617 | _na 316_aa | cas1f | type I-F CRISPR-associated endonuclease Cas1f |
| 62 | QZHM01000001.1 | GCA003626375_00196 | CDS | open | 63619-67032 | _na 1137_aa | cas3f | type I-F CRISPR-associated helicase Cas3f |
| 63 | QZHM01000001.1 | GCA003626375_00197 | CDS | open | 67211-68584 | _na 457_aa | csy1 | type I-F CRISPR-associated protein Csy1 |
| 64 | QZHM01000001.1 | GCA003626375_00198 | CDS | open | 68581-69516 | _na 311_aa | csy2 | type I-F CRISPR-associated protein Csy2 |
| 65 | QZHM01000001.1 | GCA003626375_00199 | CDS | open | 69551-70558 | _na 335_aa | csy3 | type I-F CRISPR-associated protein Csy3 |
| 66 | QZHM01000001.1 | GCA003626375_00200 | CDS | open | 70555-71145 | _na 196_aa | cas6f | type I-F CRISPR-associated endoribonuclease Cas6/Csy4 |
| 67 | QZHM01000001.1 | GCA003626375_00201 | CDS | open | 71323-71613 | _na 96_aa | yggX | oxidative damage protection protein |
| 68 | QZHM01000001.1 | GCA003626375_00202 | CDS | open | 71687-72163 | _na 158_aa | fadM | Thioesterase-like superfamily protein |
| 69 | QZHM01000001.1 | GCA003626375_00203 | CDS | open | 72482-73864 | _na 460_aa | mpl | UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase |
| 70 | QZHM01000001.1 | GCA003626375_00204 | CDS | open | 73956-74465 | _na 169_aa | dsbB | Disulfide bond formation protein B |
| 71 | QZHM01000001.1 | GCA003626375_00205 | CDS | open | 74571-76121 | _na 516_aa | gshA | glutamate--cysteine ligase |
| 72 | QZHM01000001.1 | GCA003626375_00206 | CDS | open | 76271-76603 | _na 110_aa | erpA | iron-sulfur cluster insertion protein ErpA |
| 73 | QZHM01000001.1 | GCA003626375_00207 | CDS | open | 76750-77610 | _na 286_aa | tauB | Cyanate ABC transporter%2C ATP-binding protein |
| 74 | QZHM01000001.1 | GCA003626375_00208 | CDS | open | 77600-78484 | _na 294_aa | ntrB | nitrate ABC transporter permease |
| 75 | QZHM01000001.1 | GCA003626375_00209 | CDS | open | 78474-79889 | _na 471_aa | tauA | Cyanate ABC transporter%2C substrate binding protein |
| 76 | QZHM01000001.1 | GCA003626375_00210 | CDS | open | 79972-81360 | _na 462_aa | norV | Rubredoxin-NAD+ reductase |
| 77 | QZHM01000001.1 | GCA003626375_00211 | CDS | open | 81357-82529 | _na 390_aa | caiA | Butyryl-CoA dehydrogenase |
| 78 | QZHM01000001.1 | GCA003626375_00212 | CDS | open | 82787-83332 | _na 181_aa | yciW | Carboxymuconolactone decarboxylase-like domain-containing protein |
| 79 | QZHM01000001.1 | GCA003626375_00213 | CDS | open | 83551-85500 | _na 649_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 80 | QZHM01000001.1 | GCA003626375_00214 | CDS | open | 85508-86347 | _na 279_aa | dnaJ | DnaJ-class molecular chaperone CbpA |
| 81 | QZHM01000001.1 | GCA003626375_00215 | CDS | open | 86432-87412 | _na 326_aa | yheT | Hydrolase%2C alpha/beta fold family functionally coupled to Phosphoribulokinase |
| 82 | QZHM01000001.1 | GCA003626375_00216 | CDS | open | 87472-88269 | _na 265_aa | dapB | 4-hydroxy-tetrahydrodipicolinate reductase |
| 83 | QZHM01000001.1 | GCA003626375_00217 | CDS | open | 88314-89507 | _na 397_aa | metC | Cystathionine beta-lyase |
| 84 | QZHM01000001.1 | GCA003626375_00218 | CDS | open | 89525-90472 | _na 315_aa | yfeH | Sodium-dependent transporter |
| 85 | QZHM01000001.1 | GCA003626375_00219 | CDS | open | 90634-91785 | _na 383_aa | dnaJ | molecular chaperone DnaJ |
| 86 | QZHM01000001.1 | GCA003626375_00220 | CDS | open | 92029-93030 | _na 333_aa | dsbG | Thiol:disulfide interchange protein |
| 87 | QZHM01000001.1 | GCA003626375_00221 | CDS | open | 93044-93748 | _na 234_aa | rsuA | Pseudouridine synthase |
| 88 | QZHM01000001.1 | GCA003626375_00222 | CDS | open | 93917-94510 | _na 197_aa | yIH1 | Putative translation regulator%2C IMPACT (imprinted ancient) protein family |
| 89 | QZHM01000001.1 | GCA003626375_00223 | CDS | open | 94965-95291 | _na 108_aa | dksA | Conjugal transfer protein TraR |
| 90 | QZHM01000001.1 | GCA003626375_00224 | CDS | open | 95291-96187 | _na 298_aa | rluA | Pseudouridylate synthase |
| 91 | QZHM01000001.1 | GCA003626375_00225 | CDS | open | 96525-96818 | _na 97_aa | SHOCT domain-containing protein | |
| 92 | QZHM01000001.1 | GCA003626375_00226 | CDS | open | 96868-98079 | _na 403_aa | sstT | serine/threonine transporter SstT |
| 93 | QZHM01000001.1 | GCA003626375_00227 | CDS | open | 98184-99173 | _na 329_aa | yejR | Cobalamin biosynthesis protein P47K |
| 94 | QZHM01000001.1 | GCA003626375_00228 | CDS | open | 99240-99974 | _na 244_aa | ompR | two-component system response regulator OmpR |
| 95 | QZHM01000001.1 | GCA003626375_00229 | CDS | open | 100237-102603 | _na 788_aa | tex | Transcription accessory protein S1 RNA-binding domain |
| 96 | QZHM01000001.1 | GCA003626375_00230 | CDS | open | 102664-103362 | _na 232_aa | DUF305 domain-containing protein | |
| 97 | QZHM01000001.1 | GCA003626375_00231 | CDS | open | 103570-104847 | _na 425_aa | gltA | citrate synthase |
| 98 | QZHM01000001.1 | GCA003626375_00232 | CDS | open | 105654-106034 | _na 126_aa | sdhC | succinate dehydrogenase%2C cytochrome b556 subunit |
| 99 | QZHM01000001.1 | GCA003626375_00233 | CDS | open | 106034-106387 | _na 117_aa | sdhD | succinate dehydrogenase%2C hydrophobic membrane anchor protein |
| 100 | QZHM01000001.1 | GCA003626375_00234 | CDS | open | 106446-108296 | _na 616_aa | sdhA | succinate dehydrogenase flavoprotein subunit |
| 101 | QZHM01000001.1 | GCA003626375_00235 | CDS | open | 108367-109077 | _na 236_aa | sdhB | Fumarate reductase iron-sulfur subunit |
| 102 | QZHM01000001.1 | GCA003626375_00236 | CDS | open | 109465-112320 | _na 951_aa | sucA | 2-oxoglutarate dehydrogenase E1 component |
| 103 | QZHM01000001.1 | GCA003626375_00237 | CDS | open | 112414-113652 | _na 412_aa | odhB | 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase |
| 104 | QZHM01000001.1 | GCA003626375_00238 | CDS | open | 113742-115190 | _na 482_aa | lpdA | dihydrolipoyl dehydrogenase |
| 105 | QZHM01000001.1 | GCA003626375_00239 | CDS | open | 115391-116161 | _na 256_aa | hypothetical protein | |
| 106 | QZHM01000001.1 | GCA003626375_00240 | CDS | open | 116752-119493 | _na 913_aa | cirA | TonB-dependent Receptor Plug domain protein |
| 107 | QZHM01000001.1 | GCA003626375_00241 | CDS | open | 119545-119640 | _na 31_aa | hypothetical protein | |
| 108 | QZHM01000001.1 | GCA003626375_00242 | CDS | open | 119909-121126 | _na 405_aa | Porin | |
| 109 | QZHM01000001.1 | GCA003626375_00243 | CDS | open | 121225-122457 | _na 410_aa | Porin | |
| 110 | QZHM01000001.1 | GCA003626375_00244 | CDS | open | 122693-125380 | _na 895_aa | preP | prolyl oligopeptidase |
| 111 | QZHM01000001.1 | GCA003626375_00245 | CDS | open | 125569-125802 | _na 77_aa | Metal-binding protein | |
| 112 | QZHM01000001.1 | GCA003626375_00246 | CDS | open | 125807-127930 | _na 707_aa | dcp | oligopeptidase A |
| 113 | QZHM01000001.1 | GCA003626375_00247 | CDS | open | 128147-128896 | _na 249_aa | elsH | Endonuclease/exonuclease/phosphatase domain-containing protein |
| 114 | QZHM01000001.1 | GCA003626375_00248 | CDS | open | 129030-129641 | _na 203_aa | rdgB | RdgB/HAM1 family non-canonical purine NTP pyrophosphatase |
| 115 | QZHM01000001.1 | GCA003626375_00249 | CDS | open | 129826-131160 | _na 444_aa | tig | trigger factor |
| 116 | QZHM01000001.1 | GCA003626375_00250 | CDS | open | 131325-131978 | _na 217_aa | clpP | ATP-dependent Clp endopeptidase proteolytic subunit ClpP |
| 117 | QZHM01000001.1 | GCA003626375_00251 | CDS | open | 131988-133304 | _na 438_aa | clpX | ATP-dependent protease ATP-binding subunit ClpX |
| 118 | QZHM01000001.1 | GCA003626375_00252 | CDS | open | 133467-134591 | _na 374_aa | dnaJ | J domain-containing protein |
| 119 | QZHM01000001.1 | GCA003626375_00253 | CDS | open | 134941-137094 | _na 717_aa | fadB | fatty acid oxidation complex subunit alpha FadB |
| 120 | QZHM01000001.1 | GCA003626375_00254 | CDS | open | 137124-138296 | _na 390_aa | fadA | acetyl-CoA C-acyltransferase FadA |
| 121 | QZHM01000001.1 | GCA003626375_00255 | CDS | open | 138432-138827 | _na 131_aa | patatin-like phospholipase family protein | |
| 122 | QZHM01000001.1 | GCA003626375_00256 | CDS | open | 139015-139344 | _na 109_aa | Patatin | |
| 123 | QZHM01000001.1 | GCA003626375_00257 | CDS | open | 139319-139585 | _na 88_aa | Patatin | |
| 124 | QZHM01000001.1 | GCA003626375_00258 | CDS | open | 139931-140662 | _na 243_aa | cysH | phosphoadenylyl-sulfate reductase |
| 125 | QZHM01000001.1 | GCA003626375_00259 | CDS | open | 140746-141669 | _na 307_aa | cysD | sulfate adenylyltransferase subunit CysD |
| 126 | QZHM01000001.1 | GCA003626375_00260 | CDS | open | 141820-143124 | _na 434_aa | cysN | sulfate adenylyltransferase |
| 127 | QZHM01000001.1 | GCA003626375_00261 | CDS | open | 143235-145331 | _na 698_aa | recG | ATP-dependent DNA helicase RecG |
| 128 | QZHM01000001.1 | GCA003626375_00262 | CDS | open | 145318-145971 | _na 217_aa | crp | Cyclic nucleotide-binding domain-containing protein |
| 129 | QZHM01000001.1 | GCA003626375_00263 | CDS | open | 146144-146614 | _na 156_aa | hlyD | HlyD secretion family protein |
| 130 | QZHM01000001.1 | GCA003626375_00264 | CDS | open | 146720-147007 | _na 95_aa | hlyD | HlyD family secretion protein |
| 131 | QZHM01000001.1 | GCA003626375_00265 | CDS | open | 147275-147385 | _na 36_aa | hypothetical protein | |
| 132 | QZHM01000001.1 | GCA003626375_00266 | CDS | open | 147363-147713 | _na 116_aa | AcrB/AcrD/AcrF family | |
| 133 | QZHM01000001.1 | GCA003626375_00267 | CDS | open | 147710-147982 | _na 90_aa | AcrB/AcrD/AcrF family protein | |
| 134 | QZHM01000001.1 | GCA003626375_00268 | CDS | open | 148031-148414 | _na 127_aa | AcrB/AcrD/AcrF family protein | |
| 135 | QZHM01000001.1 | GCA003626375_00269 | CDS | open | 148390-150348 | _na 652_aa | efflux RND transporter permease subunit | |
| 136 | QZHM01000001.1 | GCA003626375_00270 | CDS | open | 150610-151155 | _na 181_aa | DUF924 domain-containing protein | |
| 137 | QZHM01000001.1 | GCA003626375_00271 | CDS | open | 151147-151782 | _na 211_aa | coaE | dephospho-CoA kinase |
| 138 | QZHM01000001.1 | GCA003626375_00272 | CDS | open | 151934-152710 | _na 258_aa | pilD | Peptidase |
| 139 | QZHM01000001.1 | GCA003626375_00273 | CDS | open | 152710-153969 | _na 419_aa | pilC | Type II secretion system (T2SS)%2C F family protein |
| 140 | QZHM01000001.1 | GCA003626375_00274 | CDS | open | 154008-155672 | _na 554_aa | pilB | type IV-A pilus assembly ATPase PilB |
| 141 | QZHM01000001.1 | GCA003626375_00275 | CDS | open | 155827-157050 | _na 407_aa | araJ | Bcr/CflA family efflux transporter |
| 142 | QZHM01000001.1 | GCA003626375_00276 | CDS | open | 157220-161164 | _na 1314_aa | purL | phosphoribosylformylglycinamidine synthase |
| 143 | QZHM01000001.1 | GCA003626375_00277 | CDS | open | 161446-162717 | _na 423_aa | gltS | sodium/glutamate symporter |
| 144 | QZHM01000001.1 | GCA003626375_00278 | CDS | open | 162786-164117 | _na 443_aa | argA | amino-acid N-acetyltransferase |
| 145 | QZHM01000001.1 | GCA003626375_00279 | CDS | open | 164427-165005 | _na 192_aa | DUF11 domain-containing protein | |
| 146 | QZHM01000001.1 | GCA003626375_00280 | CDS | open | 165323-165784 | _na 153_aa | imelysin family protein | |
| 147 | QZHM01000001.1 | GCA003626375_00281 | CDS | open | 165955-166287 | _na 110_aa | Lipoprotein | |
| 148 | QZHM01000001.1 | GCA003626375_00282 | CDS | open | 166357-167211 | _na 284_aa | Dyp-type peroxidase domain-containing protein | |
| 149 | QZHM01000001.1 | GCA003626375_00283 | CDS | open | 167247-167678 | _na 143_aa | Dyp-type peroxidase | |
| 150 | QZHM01000001.1 | GCA003626375_00284 | CDS | open | 167834-168805 | _na 323_aa | dusA | tRNA-dihydrouridine(16) synthase |
| 151 | QZHM01000001.1 | GCA003626375_00285 | CDS | open | 168810-170294 | _na 494_aa | uvrD | Putative DNA helicase |
| 152 | QZHM01000001.1 | GCA003626375_00286 | CDS | open | 170464-171207 | _na 247_aa | mngR | GntR family transcriptional regulator |
| 153 | QZHM01000001.1 | GCA003626375_00287 | CDS | open | 171712-173400 | _na 562_aa | gltB2 | Ferredoxin-dependent glutamate synthase |
| 154 | QZHM01000001.1 | GCA003626375_00288 | CDS | open | 173602-174345 | _na 247_aa | tatC | Sec-independent protein translocase protein TatC |
| 155 | QZHM01000001.1 | GCA003626375_00289 | CDS | open | 174342-174878 | _na 178_aa | tatA | Preprotein translocase subunit TatA |
| 156 | QZHM01000001.1 | GCA003626375_00290 | CDS | open | 174875-175108 | _na 77_aa | tatA | Sec-independent protein translocase subunit TatA |
| 157 | QZHM01000001.1 | GCA003626375_00291 | CDS | open | 175171-175980 | _na 269_aa | hisIE | bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE |
| 158 | QZHM01000001.1 | GCA003626375_00292 | CDS | open | 176232-176423 | _na 63_aa | rpmI | 50S ribosomal protein L35 |
| 159 | QZHM01000001.1 | GCA003626375_00293 | CDS | open | 176452-176808 | _na 118_aa | rplT | 50S ribosomal protein L20 |
| 160 | QZHM01000001.1 | GCA003626375_00294 | CDS | open | 177178-179454 | _na 758_aa | norB | Nitric-oxide reductase%2C quinol-dependent |
| 161 | QZHM01000001.1 | GCA003626375_00295 | CDS | open | 179632-180165 | _na 177_aa | iscR | Nitrite-sensitive transcriptional repressor NsrR |
| 162 | QZHM01000001.1 | GCA003626375_00296 | CDS | open | 180546-182054 | _na 502_aa | Copper-containing nitrite reductase | |
| 163 | QZHM01000001.1 | GCA003626375_00297 | CDS | open | 182347-183183 | _na 278_aa | yfmG | Sulfatase-modifying factor enzyme domain-containing protein |
| 164 | QZHM01000001.1 | GCA003626375_00298 | CDS | open | 183320-184015 | _na 231_aa | sco1 | SCO1/SenC family protein |
| 165 | QZHM01000001.1 | GCA003626375_00299 | CDS | open | 184310-185341 | _na 343_aa | pheS | phenylalanine--tRNA ligase subunit alpha |
| 166 | QZHM01000001.1 | GCA003626375_00300 | CDS | open | 185394-187790 | _na 798_aa | pheT | phenylalanine--tRNA ligase subunit beta |
| 167 | QZHM01000001.1 | GCA003626375_00301 | CDS | open | 187939-188235 | _na 98_aa | hupA | integration host factor subunit alpha |
| 168 | QZHM01000001.1 | GCA003626375_00302 | CDS | open | 188448-188708 | _na 86_aa | rpmE | type B 50S ribosomal protein L31 |
| 169 | QZHM01000001.1 | GCA003626375_00303 | CDS | open | 189033-190001 | _na 322_aa | zipA | Cell division protein ZipA |
| 170 | QZHM01000001.1 | GCA003626375_00304 | CDS | open | 190049-190957 | _na 302_aa | mutM | bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase |
| 171 | QZHM01000001.1 | GCA003626375_00305 | CDS | open | 190987-193353 | _na 788_aa | spoT | GTP pyrophosphokinase |
| 172 | QZHM01000001.1 | GCA003626375_00306 | CDS | open | 194028-195773 | _na 581_aa | srmB | ATP-dependent RNA helicase |
| 173 | QZHM01000001.1 | GCA003626375_00307 | CDS | open | 195829-197322 | _na 497_aa | rlmD | 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD |
| 174 | QZHM01000001.1 | GCA003626375_00308 | CDS | open | 197423-197551 | _na 42_aa | hypothetical protein | |
| 175 | QZHM01000001.1 | GCA003626375_00309 | CDS | open | 197610-197834 | _na 74_aa | hypothetical protein | |
| 176 | QZHM01000001.1 | GCA003626375_00310 | CDS | open | 197846-198619 | _na 257_aa | polB | Putative 3'-5' exonuclease related to the exonuclease domain of PolB family protein |
| 177 | QZHM01000001.1 | GCA003626375_00311 | CDS | open | 198628-199536 | _na 302_aa | cysM | cysteine synthase CysM |
| 178 | QZHM01000001.1 | GCA003626375_00312 | CDS | open | 199675-202641 | _na 988_aa | hPtr | histidine kinase |
| 179 | QZHM01000001.1 | GCA003626375_00313 | CDS | open | 202826-202918 | _na 30_aa | Inner membrane protein YgaP-like transmembrane domain-containing protein | |
| 180 | QZHM01000001.1 | GCA003626375_00314 | CDS | open | 203236-204069 | _na 277_aa | asd | archaetidylserine decarboxylase |
| 181 | QZHM01000001.1 | GCA003626375_00315 | CDS | open | 204309-204749 | _na 146_aa | ybaN | Inner membrane protein |
| 182 | QZHM01000001.1 | GCA003626375_00316 | CDS | open | 204921-206243 | _na 440_aa | bioA | adenosylmethionine--8-amino-7-oxononanoate transaminase |
| 183 | QZHM01000001.1 | GCA003626375_00317 | CDS | open | 206243-207442 | _na 399_aa | bioF | Aminotransferase class I and II family protein |
| 184 | QZHM01000001.1 | GCA003626375_00318 | CDS | open | 207439-208296 | _na 285_aa | tam | Malonyl-[acyl-carrier protein] O-methyltransferase |
| 185 | QZHM01000001.1 | GCA003626375_00319 | CDS | open | 208293-208997 | _na 234_aa | bioD | dethiobiotin synthase |
| 186 | QZHM01000001.1 | GCA003626375_00320 | CDS | open | 209010-209462 | _na 150_aa | dtd | D-aminoacyl-tRNA deacylase |
| 187 | QZHM01000001.1 | GCA003626375_00321 | CDS | open | 209528-210103 | _na 191_aa | yjhB | MutT/nudix family protein |
| 188 | QZHM01000001.1 | GCA003626375_00322 | CDS | open | 210238-211020 | _na 260_aa | mutT | Coenzyme A pyrophosphatase |
| 189 | QZHM01000001.1 | GCA003626375_00323 | CDS | open | 211035-211400 | _na 121_aa | rsfS | ribosome silencing factor |
| 190 | QZHM01000001.1 | GCA003626375_00324 | CDS | open | 211433-212092 | _na 219_aa | nadD | nicotinate (nicotinamide) nucleotide adenylyltransferase |
| 191 | QZHM01000001.1 | GCA003626375_00325 | CDS | open | 212288-215161 | _na 957_aa | uvrA | excinuclease ABC subunit UvrA |
| 192 | QZHM01000001.1 | GCA003626375_00326 | CDS | open | 215323-216045 | _na 240_aa | ssb | Single-stranded DNA-binding protein |
| 193 | QZHM01000001.1 | GCA003626375_00327 | CDS | open | 216136-217287 | _na 383_aa | gsp | Glutathionylspermidine synthase preATP-grasp family protein |
| 194 | QZHM01000001.1 | GCA003626375_00328 | CDS | open | 217284-217829 | _na 181_aa | Glycine zipper domain-containing protein | |
| 195 | QZHM01000001.1 | GCA003626375_00329 | CDS | open | 218027-218836 | _na 269_aa | ccmC | Heme exporter protein C |
| 196 | QZHM01000001.1 | GCA003626375_00330 | CDS | open | 218836-219036 | _na 66_aa | ccmD | heme exporter protein CcmD |
| 197 | QZHM01000001.1 | GCA003626375_00331 | CDS | open | 219106-219627 | _na 173_aa | ccmE | cytochrome c maturation protein CcmE |
| 198 | QZHM01000001.1 | GCA003626375_00332 | CDS | open | 219697-220527 | _na 276_aa | nlpA | Lipoprotein |
| 199 | QZHM01000001.1 | GCA003626375_00333 | CDS | open | 220719-221408 | _na 229_aa | metP | Methionine ABC transporter permease protein |
| 200 | QZHM01000001.1 | GCA003626375_00334 | CDS | open | 221398-222468 | _na 356_aa | metN | methionine ABC transporter ATP-binding protein MetN |
| 201 | QZHM01000001.1 | GCA003626375_00335 | CDS | open | 222592-224157 | _na 521_aa | baeS | histidine kinase |
| 202 | QZHM01000001.1 | GCA003626375_00336 | CDS | open | 224293-225015 | _na 240_aa | ompR | Transcriptional regulatory protein YycF |
| 203 | QZHM01000001.1 | GCA003626375_00337 | CDS | open | 225210-226214 | _na 334_aa | accB | HlyD family secretion protein |
| 204 | QZHM01000001.1 | GCA003626375_00338 | CDS | open | 226428-226943 | _na 171_aa | cybB | Prokaryotic cytochrome b561 family protein |
| 205 | QZHM01000001.1 | GCA003626375_00339 | CDS | open | 226990-227943 | _na 317_aa | prsA | Ribose-phosphate pyrophosphokinase |
| 206 | QZHM01000001.1 | GCA003626375_00342 | CDS | open | 228512-229384 | _na 290_aa | ispE | 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase |
| 207 | QZHM01000001.1 | GCA003626375_00343 | CDS | open | 229389-229961 | _na 190_aa | lolB | Outer-membrane lipoprotein LolB |
| 208 | QZHM01000001.1 | GCA003626375_00344 | CDS | open | 229990-231861 | _na 623_aa | hemYx | Tetratricopeptide repeat protein |
| 209 | QZHM01000001.1 | GCA003626375_00345 | CDS | open | 232340-233683 | _na 447_aa | hemA | glutamyl-tRNA reductase |
| 210 | QZHM01000001.1 | GCA003626375_00346 | CDS | open | 233787-235448 | _na 553_aa | fixX | Electron transfer flavoprotein-ubiquinone oxidoreductase |
| 211 | QZHM01000001.1 | GCA003626375_00347 | CDS | open | 235816-236442 | _na 208_aa | Proteophosphoglycan | |
| 212 | QZHM01000001.1 | GCA003626375_00348 | CDS | open | 236508-237365 | _na 285_aa | murI | glutamate racemase |
| 213 | QZHM01000001.1 | GCA003626375_00349 | CDS | open | 237527-237712 | _na 61_aa | H-NS histone family | |
| 214 | QZHM01000001.1 | GCA003626375_00350 | CDS | open | 237809-239230 | _na 473_aa | pGRP | Membrane-bound lytic murein transglycosylase B |
| 215 | QZHM01000001.1 | GCA003626375_00351 | CDS | open | 239332-239865 | _na 177_aa | msrA | Peptide methionine sulfoxide reductase MsrA |
| 216 | QZHM01000001.1 | GCA003626375_00352 | CDS | open | 239920-240690 | _na 256_aa | cmoA | carboxy-S-adenosyl-L-methionine synthase CmoA |
| 217 | QZHM01000001.1 | GCA003626375_00353 | CDS | open | 240743-241801 | _na 352_aa | cmoB | tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB |
| 218 | QZHM01000001.1 | GCA003626375_00354 | CDS | open | 241885-242802 | _na 305_aa | mutK | ABC transporter |
| 219 | QZHM01000001.1 | GCA003626375_00355 | CDS | open | 242915-243583 | _na 222_aa | ftsN | SPOR domain-containing protein |
| 220 | QZHM01000001.1 | GCA003626375_00356 | CDS | open | 243781-244017 | _na 78_aa | DUF2788 domain-containing protein | |
| 221 | QZHM01000001.1 | GCA003626375_00357 | CDS | open | 244090-244377 | _na 95_aa | Lipoprotein | |
| 222 | QZHM01000001.1 | GCA003626375_00358 | CDS | open | 244621-245748 | _na 375_aa | pucG | Class V aminotransferase |
| 223 | QZHM01000001.1 | GCA003626375_00359 | CDS | open | 245867-247378 | _na 503_aa | pepD2 | Xaa-His dipeptidase%2C Metallo peptidase%2C MEROPS family M20C |
| 224 | QZHM01000001.1 | GCA003626375_00360 | CDS | open | 247463-248200 | _na 245_aa | dLH | Dienelactone hydrolase |
| 225 | QZHM01000001.1 | GCA003626375_00361 | CDS | open | 248387-248851 | _na 154_aa | ycgN | YcgN family cysteine cluster protein |
| 226 | QZHM01000001.1 | GCA003626375_00362 | CDS | open | 249024-249896 | _na 290_aa | corC | Magnesium/cobalt efflux protein |
| 227 | QZHM01000001.1 | GCA003626375_00363 | CDS | open | 249969-250670 | _na 233_aa | ygfZ | Aminomethyltransferase folate-binding domain protein |
| 228 | QZHM01000001.1 | GCA003626375_00364 | CDS | open | 250855-251193 | _na 112_aa | phnA | Alkylphosphonate utilization protein |
| 229 | QZHM01000001.1 | GCA003626375_00365 | CDS | open | 251233-252537 | _na 434_aa | hemL | glutamate-1-semialdehyde 2%2C1-aminomutase |
| 230 | QZHM01000001.1 | GCA003626375_00366 | CDS | open | 252840-255638 | _na 932_aa | secA | preprotein translocase subunit SecA |
| 231 | QZHM01000001.1 | GCA003626375_00367 | CDS | open | 255808-256104 | _na 98_aa | Lipoprotein | |
| 232 | QZHM01000001.1 | GCA003626375_00368 | CDS | open | 256240-257826 | _na 528_aa | lnt | apolipoprotein N-acyltransferase |
| 233 | QZHM01000001.1 | GCA003626375_00369 | CDS | open | 258240-260846 | _na 868_aa | transferrin-binding protein-like solute binding protein | |
| 234 | QZHM01000001.1 | GCA003626375_00370 | CDS | open | 261031-264033 | _na 1000_aa | cirA | Lactoferrin binding protein A |
| 235 | QZHM01000001.1 | GCA003626375_00371 | CDS | open | 264035-265660 | _na 541_aa | Surface lipoprotein assembly modifier C-terminal beta-barrel domain-containing protein | |
| 236 | QZHM01000001.1 | GCA003626375_00372 | CDS | open | 265887-266069 | _na 60_aa | hypothetical protein | |
| 237 | QZHM01000001.1 | GCA003626375_00373 | CDS | open | 266243-268039 | _na 598_aa | pepP | Xaa-Pro aminopeptidase |
| 238 | QZHM01000001.1 | GCA003626375_00374 | CDS | open | 268055-269434 | _na 459_aa | trpE | Para-aminobenzoate synthase%2C aminase component |
| 239 | QZHM01000001.1 | GCA003626375_00375 | CDS | open | 269612-270844 | _na 410_aa | fabB | 3-oxoacyl-[acyl-carrier-protein] synthase 1 |
| 240 | QZHM01000001.1 | GCA003626375_00376 | CDS | open | 271203-273359 | _na 718_aa | ecsC | EcsC family protein |
| 241 | QZHM01000001.1 | GCA003626375_00377 | CDS | open | 273576-273950 | _na 124_aa | rpsL | 30S ribosomal protein S12 |
| 242 | QZHM01000001.1 | GCA003626375_00378 | CDS | open | 274071-274544 | _na 157_aa | rpsG | 30S ribosomal protein S7 |
| 243 | QZHM01000001.1 | GCA003626375_00379 | CDS | open | 274704-276830 | _na 708_aa | fusA | elongation factor G |
| 244 | QZHM01000001.1 | GCA003626375_00380 | CDS | open | 276951-277514 | _na 187_aa | GTP-binding protein | |
| 245 | QZHM01000001.1 | GCA003626375_00381 | CDS | open | 277593-278141 | _na 182_aa | EF-Tu/IF-2/RF-3 family GTPase | |
| 246 | QZHM01000001.1 | GCA003626375_00382 | CDS | open | 278279-279229 | _na 316_aa | trxB | thioredoxin-disulfide reductase |
| 247 | QZHM01000001.1 | GCA003626375_00383 | CDS | open | 279366-281186 | _na 606_aa | caiA | Acyl-CoA dehydrogenase |
| 248 | QZHM01000001.1 | GCA003626375_00384 | CDS | open | 281418-281561 | _na 47_aa | FxLD family lantipeptide | |
| 249 | QZHM01000001.1 | GCA003626375_00385 | CDS | open | 281600-282391 | _na 263_aa | aroE | shikimate dehydrogenase |
| 250 | QZHM01000001.1 | GCA003626375_00386 | CDS | open | 282513-283115 | _na 200_aa | hypothetical protein | |
| 251 | QZHM01000001.1 | GCA003626375_00387 | CDS | open | 283122-283946 | _na 274_aa | ilvE | Aminodeoxychorismate lyase |
| 252 | QZHM01000001.1 | GCA003626375_00388 | CDS | open | 284052-285179 | _na 375_aa | mltG | Endolytic murein transglycosylase |
| 253 | QZHM01000001.1 | GCA003626375_00389 | CDS | open | 285192-285812 | _na 206_aa | tmk | dTMP kinase |
| 254 | QZHM01000001.1 | GCA003626375_00390 | CDS | open | 285993-286898 | _na 301_aa | dapA | 4-hydroxy-tetrahydrodipicolinate synthase |
| 255 | QZHM01000001.1 | GCA003626375_00391 | CDS | open | 286971-287243 | _na 90_aa | Lipoprotein | |
| 256 | QZHM01000001.1 | GCA003626375_00392 | CDS | open | 287297-288007 | _na 236_aa | purC | phosphoribosylaminoimidazolesuccinocarboxamide synthase |
| 257 | QZHM01000001.1 | GCA003626375_00393 | CDS | open | 288047-288367 | _na 106_aa | yqfO | NIF3 1 |
| 258 | QZHM01000001.1 | GCA003626375_00394 | CDS | open | 288721-290232 | _na 503_aa | Anthranilate synthase component 1 | |
| 259 | QZHM01000001.1 | GCA003626375_00395 | CDS | open | 290285-290764 | _na 159_aa | hypothetical protein | |
| 260 | QZHM01000001.1 | GCA003626375_00396 | CDS | open | 290764-291171 | _na 135_aa | hypothetical protein | |
| 261 | QZHM01000001.1 | GCA003626375_00397 | CDS | open | 291173-291532 | _na 119_aa | hypothetical protein | |
| 262 | QZHM01000001.1 | GCA003626375_00398 | CDS | open | 291529-292461 | _na 310_aa | rPT1 | AAA+ ATPase domain-containing protein |
| 263 | QZHM01000001.1 | GCA003626375_00399 | CDS | open | 292464-293354 | _na 296_aa | yobV | HTH deoR-type domain-containing protein |
| 264 | QZHM01000001.1 | GCA003626375_00400 | CDS | open | 293455-293712 | _na 85_aa | Transcriptional regulator | |
| 265 | QZHM01000001.1 | GCA003626375_00405 | CDS | open | 294618-295808 | _na 396_aa | tuf | elongation factor Tu |
| 266 | QZHM01000001.1 | GCA003626375_00407 | CDS | open | 296091-296564 | _na 157_aa | secE | preprotein translocase subunit SecE |
| 267 | QZHM01000001.1 | GCA003626375_00408 | CDS | open | 296586-297116 | _na 176_aa | nusG | transcription termination/antitermination protein NusG |
| 268 | QZHM01000001.1 | GCA003626375_00409 | CDS | open | 297217-297648 | _na 143_aa | rplK | 50S ribosomal protein L11 |
| 269 | QZHM01000001.1 | GCA003626375_00410 | CDS | open | 297648-298349 | _na 233_aa | rplA | 50S ribosomal protein L1 |
| 270 | QZHM01000001.1 | GCA003626375_00411 | CDS | open | 298661-299164 | _na 167_aa | rplJ | 50S ribosomal protein L10 |
| 271 | QZHM01000001.1 | GCA003626375_00412 | CDS | open | 299222-299596 | _na 124_aa | rplL | 50S ribosomal protein L7/L12 |
| 272 | QZHM01000001.1 | GCA003626375_00413 | CDS | open | 300016-304107 | _na 1363_aa | rpoB | DNA-directed RNA polymerase subunit beta |
| 273 | QZHM01000001.1 | GCA003626375_00414 | CDS | open | 304187-308425 | _na 1412_aa | rpoC | DNA-directed RNA polymerase subunit beta' |
| 274 | QZHM01000001.1 | GCA003626375_00415 | CDS | open | 308639-309865 | _na 408_aa | serA | phosphoglycerate dehydrogenase |
| 275 | QZHM01000001.1 | GCA003626375_00416 | CDS | open | 310061-311431 | _na 456_aa | gorA | glutathione-disulfide reductase |
| 276 | QZHM01000001.1 | GCA003626375_00417 | CDS | open | 311673-312746 | _na 357_aa | nagZ | beta-N-acetylhexosaminidase |
| 277 | QZHM01000001.1 | GCA003626375_00418 | CDS | open | 312982-315156 | _na 724_aa | ctpA | C-terminal processing peptidase family protein |
| 278 | QZHM01000001.1 | GCA003626375_00419 | CDS | open | 315283-315441 | _na 52_aa | UPF0391 membrane protein AO382_0985 | |
| 279 | QZHM01000001.1 | GCA003626375_00421 | CDS | open | 315905-316702 | _na 265_aa | tauE | putative membrane transporter protein |
| 280 | QZHM01000001.1 | GCA003626375_00422 | CDS | open | 316780-317673 | _na 297_aa | birA2 | Ligase |
| 281 | QZHM01000001.1 | GCA003626375_00423 | CDS | open | 317728-318435 | _na 235_aa | coaX | pantothenate kinase |
| 282 | QZHM01000001.1 | GCA003626375_00424 | CDS | open | 318453-318875 | _na 140_aa | MAPEG family protein | |
| 283 | QZHM01000001.1 | GCA003626375_00425 | CDS | open | 318872-319285 | _na 137_aa | yhfA | OsmC family protein |
| 284 | QZHM01000001.1 | GCA003626375_00426 | CDS | open | 319817-320314 | _na 165_aa | mutT | RNA pyrophosphohydrolase |
| 285 | QZHM01000001.1 | GCA003626375_00427 | CDS | open | 320450-324058 | _na 1202_aa | smc | chromosome segregation protein SMC |
| 286 | QZHM01000001.1 | GCA003626375_00428 | CDS | open | 324292-325107 | _na 271_aa | rpsB | 30S ribosomal protein S2 |
| 287 | QZHM01000001.1 | GCA003626375_00429 | CDS | open | 325185-326063 | _na 292_aa | tsf | translation elongation factor Ts |
| 288 | QZHM01000001.1 | GCA003626375_00430 | CDS | open | 326207-326854 | _na 215_aa | pyrE | Orotate phosphoribosyltransferase |
| 289 | QZHM01000001.1 | GCA003626375_00431 | CDS | open | 326949-327920 | _na 323_aa | gshB | glutathione synthase |
| 290 | QZHM01000001.1 | GCA003626375_00432 | CDS | open | 328026-329129 | _na 367_aa | murG | undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase |
| 291 | QZHM01000001.1 | GCA003626375_00433 | CDS | open | 329430-329954 | _na 174_aa | rimL | Acetyltransferase domain protein |
| 292 | QZHM01000001.1 | GCA003626375_00434 | CDS | open | 330119-331579 | _na 486_aa | murC | UDP-N-acetylmuramate--L-alanine ligase |
| 293 | QZHM01000001.1 | GCA003626375_00435 | CDS | open | 331618-332541 | _na 307_aa | ddlA | D-alanine--D-alanine ligase |
| 294 | QZHM01000001.1 | GCA003626375_00436 | CDS | open | 332504-333217 | _na 237_aa | ygjP | YgjP-like metallopeptidase domain-containing protein |
| 295 | QZHM01000001.1 | GCA003626375_00437 | CDS | open | 333231-334133 | _na 300_aa | lysR | Hydrogen peroxide-inducible activator |
| 296 | QZHM01000001.1 | GCA003626375_00438 | CDS | open | 334354-334920 | _na 188_aa | ahpC | alkyl hydroperoxide reductase subunit C |
| 297 | QZHM01000001.1 | GCA003626375_00439 | CDS | open | 335121-335354 | _na 77_aa | ydcH | DUF465 domain-containing protein |
| 298 | QZHM01000001.1 | GCA003626375_00440 | CDS | open | 335694-337250 | _na 518_aa | ahpF | alkyl hydroperoxide reductase subunit F |
| 299 | QZHM01000001.1 | GCA003626375_00441 | CDS | open | 337637-337834 | _na 65_aa | iscX | Fe-S cluster assembly protein IscX |
| 300 | QZHM01000001.1 | GCA003626375_00442 | CDS | open | 337893-338912 | _na 339_aa | potA | Fe3+/spermidine/putrescine ABC transporter ATP-binding protein |
| 301 | QZHM01000001.1 | GCA003626375_00443 | CDS | open | 338944-340545 | _na 533_aa | fbpB | ABC transporter permease |
| 302 | QZHM01000001.1 | GCA003626375_00444 | CDS | open | 340788-341783 | _na 331_aa | afuA | Fe(3+) ABC transporter substrate-binding protein |
| 303 | QZHM01000001.1 | GCA003626375_00445 | CDS | open | 341878-343062 | _na 394_aa | dapE | succinyl-diaminopimelate desuccinylase |
| 304 | QZHM01000001.1 | GCA003626375_00446 | CDS | open | 343380-343982 | _na 200_aa | 30S ribosomal protein S15 | |
| 305 | QZHM01000001.1 | GCA003626375_00447 | CDS | open | 344037-344657 | _na 206_aa | eGL9 | 2OG-Fe(II) oxygenase |
| 306 | QZHM01000001.1 | GCA003626375_00448 | CDS | open | 344797-345684 | _na 295_aa | rlmJ | Ribosomal RNA large subunit methyltransferase J |
| 307 | QZHM01000001.1 | GCA003626375_00449 | CDS | open | 345744-346553 | _na 269_aa | pssA | CDP-diacylglycerol--serine O-phosphatidyltransferase |
| 308 | QZHM01000001.1 | GCA003626375_00138 | gene | open | 466-723 | |||
| 309 | QZHM01000001.1 | GCA003626375_00139 | gene | open | 720-875 | |||
| 310 | QZHM01000001.1 | GCA003626375_00140 | gene | open | 1396-2322 | znuA | ||
| 311 | QZHM01000001.1 | GCA003626375_00141 | gene | open | 2322-3227 | znuC | ||
| 312 | QZHM01000001.1 | GCA003626375_00142 | gene | open | 3224-4066 | znuB | ||
| 313 | QZHM01000001.1 | GCA003626375_00143 | gene | open | 4241-4945 | znuB | ||
| 314 | QZHM01000001.1 | GCA003626375_00144 | gene | open | 5451-6671 | tyrS | ||
| 315 | QZHM01000001.1 | GCA003626375_00145 | gene | open | 6833-8068 | anmK | ||
| 316 | QZHM01000001.1 | GCA003626375_00146 | gene | open | 8318-9097 | |||
| 317 | QZHM01000001.1 | GCA003626375_00147 | gene | open | 9091-9339 | |||
| 318 | QZHM01000001.1 | GCA003626375_00148 | gene | open | 9460-9657 | |||
| 319 | QZHM01000001.1 | GCA003626375_00149 | gene | open | 9828-10628 | czcD | ||
| 320 | QZHM01000001.1 | GCA003626375_00150 | gene | open | 10899-11375 | |||
| 321 | QZHM01000001.1 | GCA003626375_00151 | gene | open | 11545-12798 | rocD | ||
| 322 | QZHM01000001.1 | GCA003626375_00152 | gene | open | 12839-13771 | rocF | ||
| 323 | QZHM01000001.1 | GCA003626375_00153 | gene | open | 14344-14511 | |||
| 324 | QZHM01000001.1 | GCA003626375_00154 | gene | open | 14714-16495 | aF0785 | ||
| 325 | QZHM01000001.1 | GCA003626375_00155 | gene | open | 16728-17336 | rsmC | ||
| 326 | QZHM01000001.1 | GCA003626375_00156 | gene | open | 17429-17851 | |||
| 327 | QZHM01000001.1 | GCA003626375_00157 | gene | open | 18007-19245 | rarA | ||
| 328 | QZHM01000001.1 | GCA003626375_00158 | gene | open | 19360-20454 | ribBA | ||
| 329 | QZHM01000001.1 | GCA003626375_00160 | gene | open | 20621-20881 | yeaQ | ||
| 330 | QZHM01000001.1 | GCA003626375_00161 | gene | open | 20949-21563 | tsaC | ||
| 331 | QZHM01000001.1 | GCA003626375_00162 | gene | open | 21550-22761 | dprA | ||
| 332 | QZHM01000001.1 | GCA003626375_00163 | gene | open | 22798-24213 | thrC | ||
| 333 | QZHM01000001.1 | GCA003626375_00164 | gene | open | 24531-25877 | rsmB | ||
| 334 | QZHM01000001.1 | GCA003626375_00165 | gene | open | 25867-26892 | fmt | ||
| 335 | QZHM01000001.1 | GCA003626375_00166 | gene | open | 27023-27691 | ribC | ||
| 336 | QZHM01000001.1 | GCA003626375_00167 | gene | open | 27974-29026 | ribD | ||
| 337 | QZHM01000001.1 | GCA003626375_00168 | gene | open | 29023-29493 | nrdR | ||
| 338 | QZHM01000001.1 | GCA003626375_00169 | gene | open | 29597-30997 | mnmE | ||
| 339 | QZHM01000001.1 | GCA003626375_00170 | gene | open | 31164-32837 | yidC | ||
| 340 | QZHM01000001.1 | GCA003626375_00171 | gene | open | 32976-33296 | yidD | ||
| 341 | QZHM01000001.1 | GCA003626375_00172 | gene | open | 33314-33727 | rnpA | ||
| 342 | QZHM01000001.1 | GCA003626375_00173 | gene | open | 33839-33973 | rpmH | ||
| 343 | QZHM01000001.1 | GCA003626375_00174 | gene | open | 34571-35974 | dnaA | ||
| 344 | QZHM01000001.1 | GCA003626375_00175 | gene | open | 36011-37168 | dnaN | ||
| 345 | QZHM01000001.1 | GCA003626375_00176 | gene | open | 37172-38380 | recF | ||
| 346 | QZHM01000001.1 | GCA003626375_00177 | gene | open | 38517-40976 | gyrB | ||
| 347 | QZHM01000001.1 | GCA003626375_00178 | gene | open | 41150-42709 | guaA | ||
| 348 | QZHM01000001.1 | GCA003626375_00179 | gene | open | 42862-44079 | |||
| 349 | QZHM01000001.1 | GCA003626375_00180 | gene | open | 44346-44840 | rlpA | ||
| 350 | QZHM01000001.1 | GCA003626375_00181 | gene | open | 44854-45213 | fkpA | ||
| 351 | QZHM01000001.1 | GCA003626375_00182 | gene | open | 45355-46530 | lysA | ||
| 352 | QZHM01000001.1 | GCA003626375_00183 | gene | open | 46967-47848 | |||
| 353 | QZHM01000001.1 | GCA003626375_00184 | gene | open | 47886-48242 | ridA | ||
| 354 | QZHM01000001.1 | GCA003626375_00185 | gene | open | 48251-49507 | dadA | ||
| 355 | QZHM01000001.1 | GCA003626375_00186 | gene | open | 49849-51720 | thiC | ||
| 356 | QZHM01000001.1 | GCA003626375_00187 | gene | open | 51837-53678 | mdlB | ||
| 357 | QZHM01000001.1 | GCA003626375_00188 | gene | open | 53860-55260 | argH | ||
| 358 | QZHM01000001.1 | GCA003626375_00189 | gene | open | 55484-56449 | hemC | ||
| 359 | QZHM01000001.1 | GCA003626375_00190 | gene | open | 56449-57204 | hemD | ||
| 360 | QZHM01000001.1 | GCA003626375_00191 | gene | open | 57276-58148 | rlmB | ||
| 361 | QZHM01000001.1 | GCA003626375_00192 | gene | open | 58214-58471 | nqrM | ||
| 362 | QZHM01000001.1 | GCA003626375_00193 | gene | open | 58625-60532 | dnaK | ||
| 363 | QZHM01000001.1 | GCA003626375_00194 | gene | open | 60734-61255 | grpE | ||
| 364 | QZHM01000001.1 | GCA003626375_00195 | gene | open | 62667-63617 | cas1f | ||
| 365 | QZHM01000001.1 | GCA003626375_00196 | gene | open | 63619-67032 | cas3f | ||
| 366 | QZHM01000001.1 | GCA003626375_00197 | gene | open | 67211-68584 | csy1 | ||
| 367 | QZHM01000001.1 | GCA003626375_00198 | gene | open | 68581-69516 | csy2 | ||
| 368 | QZHM01000001.1 | GCA003626375_00199 | gene | open | 69551-70558 | csy3 | ||
| 369 | QZHM01000001.1 | GCA003626375_00200 | gene | open | 70555-71145 | cas6f | ||
| 370 | QZHM01000001.1 | GCA003626375_00201 | gene | open | 71323-71613 | yggX | ||
| 371 | QZHM01000001.1 | GCA003626375_00202 | gene | open | 71687-72163 | fadM | ||
| 372 | QZHM01000001.1 | GCA003626375_00203 | gene | open | 72482-73864 | mpl | ||
| 373 | QZHM01000001.1 | GCA003626375_00204 | gene | open | 73956-74465 | dsbB | ||
| 374 | QZHM01000001.1 | GCA003626375_00205 | gene | open | 74571-76121 | gshA | ||
| 375 | QZHM01000001.1 | GCA003626375_00206 | gene | open | 76271-76603 | erpA | ||
| 376 | QZHM01000001.1 | GCA003626375_00207 | gene | open | 76750-77610 | tauB | ||
| 377 | QZHM01000001.1 | GCA003626375_00208 | gene | open | 77600-78484 | ntrB | ||
| 378 | QZHM01000001.1 | GCA003626375_00209 | gene | open | 78474-79889 | tauA | ||
| 379 | QZHM01000001.1 | GCA003626375_00210 | gene | open | 79972-81360 | norV | ||
| 380 | QZHM01000001.1 | GCA003626375_00211 | gene | open | 81357-82529 | caiA | ||
| 381 | QZHM01000001.1 | GCA003626375_00212 | gene | open | 82787-83332 | yciW | ||
| 382 | QZHM01000001.1 | GCA003626375_00213 | gene | open | 83551-85500 | abc-f | ||
| 383 | QZHM01000001.1 | GCA003626375_00214 | gene | open | 85508-86347 | dnaJ | ||
| 384 | QZHM01000001.1 | GCA003626375_00215 | gene | open | 86432-87412 | yheT | ||
| 385 | QZHM01000001.1 | GCA003626375_00216 | gene | open | 87472-88269 | dapB | ||
| 386 | QZHM01000001.1 | GCA003626375_00217 | gene | open | 88314-89507 | metC | ||
| 387 | QZHM01000001.1 | GCA003626375_00218 | gene | open | 89525-90472 | yfeH | ||
| 388 | QZHM01000001.1 | GCA003626375_00219 | gene | open | 90634-91785 | dnaJ | ||
| 389 | QZHM01000001.1 | GCA003626375_00220 | gene | open | 92029-93030 | dsbG | ||
| 390 | QZHM01000001.1 | GCA003626375_00221 | gene | open | 93044-93748 | rsuA | ||
| 391 | QZHM01000001.1 | GCA003626375_00222 | gene | open | 93917-94510 | yIH1 | ||
| 392 | QZHM01000001.1 | GCA003626375_00223 | gene | open | 94965-95291 | dksA | ||
| 393 | QZHM01000001.1 | GCA003626375_00224 | gene | open | 95291-96187 | rluA | ||
| 394 | QZHM01000001.1 | GCA003626375_00225 | gene | open | 96525-96818 | |||
| 395 | QZHM01000001.1 | GCA003626375_00226 | gene | open | 96868-98079 | sstT | ||
| 396 | QZHM01000001.1 | GCA003626375_00227 | gene | open | 98184-99173 | yejR | ||
| 397 | QZHM01000001.1 | GCA003626375_00228 | gene | open | 99240-99974 | ompR | ||
| 398 | QZHM01000001.1 | GCA003626375_00229 | gene | open | 100237-102603 | tex | ||
| 399 | QZHM01000001.1 | GCA003626375_00230 | gene | open | 102664-103362 | |||
| 400 | QZHM01000001.1 | GCA003626375_00231 | gene | open | 103570-104847 | gltA | ||
| 401 | QZHM01000001.1 | GCA003626375_00232 | gene | open | 105654-106034 | sdhC | ||
| 402 | QZHM01000001.1 | GCA003626375_00233 | gene | open | 106034-106387 | sdhD | ||
| 403 | QZHM01000001.1 | GCA003626375_00234 | gene | open | 106446-108296 | sdhA | ||
| 404 | QZHM01000001.1 | GCA003626375_00235 | gene | open | 108367-109077 | sdhB | ||
| 405 | QZHM01000001.1 | GCA003626375_00236 | gene | open | 109465-112320 | sucA | ||
| 406 | QZHM01000001.1 | GCA003626375_00237 | gene | open | 112414-113652 | odhB | ||
| 407 | QZHM01000001.1 | GCA003626375_00238 | gene | open | 113742-115190 | lpdA | ||
| 408 | QZHM01000001.1 | GCA003626375_00239 | gene | open | 115391-116161 | |||
| 409 | QZHM01000001.1 | GCA003626375_00240 | gene | open | 116752-119493 | cirA | ||
| 410 | QZHM01000001.1 | GCA003626375_00241 | gene | open | 119545-119640 | |||
| 411 | QZHM01000001.1 | GCA003626375_00242 | gene | open | 119909-121126 | |||
| 412 | QZHM01000001.1 | GCA003626375_00243 | gene | open | 121225-122457 | |||
| 413 | QZHM01000001.1 | GCA003626375_00244 | gene | open | 122693-125380 | preP | ||
| 414 | QZHM01000001.1 | GCA003626375_00245 | gene | open | 125569-125802 | |||
| 415 | QZHM01000001.1 | GCA003626375_00246 | gene | open | 125807-127930 | dcp | ||
| 416 | QZHM01000001.1 | GCA003626375_00247 | gene | open | 128147-128896 | elsH | ||
| 417 | QZHM01000001.1 | GCA003626375_00248 | gene | open | 129030-129641 | rdgB | ||
| 418 | QZHM01000001.1 | GCA003626375_00249 | gene | open | 129826-131160 | tig | ||
| 419 | QZHM01000001.1 | GCA003626375_00250 | gene | open | 131325-131978 | clpP | ||
| 420 | QZHM01000001.1 | GCA003626375_00251 | gene | open | 131988-133304 | clpX | ||
| 421 | QZHM01000001.1 | GCA003626375_00252 | gene | open | 133467-134591 | dnaJ | ||
| 422 | QZHM01000001.1 | GCA003626375_00253 | gene | open | 134941-137094 | fadB | ||
| 423 | QZHM01000001.1 | GCA003626375_00254 | gene | open | 137124-138296 | fadA | ||
| 424 | QZHM01000001.1 | GCA003626375_00255 | gene | open | 138432-138827 | |||
| 425 | QZHM01000001.1 | GCA003626375_00256 | gene | open | 139015-139344 | |||
| 426 | QZHM01000001.1 | GCA003626375_00257 | gene | open | 139319-139585 | |||
| 427 | QZHM01000001.1 | GCA003626375_00258 | gene | open | 139931-140662 | cysH | ||
| 428 | QZHM01000001.1 | GCA003626375_00259 | gene | open | 140746-141669 | cysD | ||
| 429 | QZHM01000001.1 | GCA003626375_00260 | gene | open | 141820-143124 | cysN | ||
| 430 | QZHM01000001.1 | GCA003626375_00261 | gene | open | 143235-145331 | recG | ||
| 431 | QZHM01000001.1 | GCA003626375_00262 | gene | open | 145318-145971 | crp | ||
| 432 | QZHM01000001.1 | GCA003626375_00263 | gene | open | 146144-146614 | hlyD | ||
| 433 | QZHM01000001.1 | GCA003626375_00264 | gene | open | 146720-147007 | hlyD | ||
| 434 | QZHM01000001.1 | GCA003626375_00265 | gene | open | 147275-147385 | |||
| 435 | QZHM01000001.1 | GCA003626375_00266 | gene | open | 147363-147713 | |||
| 436 | QZHM01000001.1 | GCA003626375_00267 | gene | open | 147710-147982 | |||
| 437 | QZHM01000001.1 | GCA003626375_00268 | gene | open | 148031-148414 | |||
| 438 | QZHM01000001.1 | GCA003626375_00269 | gene | open | 148390-150348 | |||
| 439 | QZHM01000001.1 | GCA003626375_00270 | gene | open | 150610-151155 | |||
| 440 | QZHM01000001.1 | GCA003626375_00271 | gene | open | 151147-151782 | coaE | ||
| 441 | QZHM01000001.1 | GCA003626375_00272 | gene | open | 151934-152710 | pilD | ||
| 442 | QZHM01000001.1 | GCA003626375_00273 | gene | open | 152710-153969 | pilC | ||
| 443 | QZHM01000001.1 | GCA003626375_00274 | gene | open | 154008-155672 | pilB | ||
| 444 | QZHM01000001.1 | GCA003626375_00275 | gene | open | 155827-157050 | araJ | ||
| 445 | QZHM01000001.1 | GCA003626375_00276 | gene | open | 157220-161164 | purL | ||
| 446 | QZHM01000001.1 | GCA003626375_00277 | gene | open | 161446-162717 | gltS | ||
| 447 | QZHM01000001.1 | GCA003626375_00278 | gene | open | 162786-164117 | argA | ||
| 448 | QZHM01000001.1 | GCA003626375_00279 | gene | open | 164427-165005 | |||
| 449 | QZHM01000001.1 | GCA003626375_00280 | gene | open | 165323-165784 | |||
| 450 | QZHM01000001.1 | GCA003626375_00281 | gene | open | 165955-166287 | |||
| 451 | QZHM01000001.1 | GCA003626375_00282 | gene | open | 166357-167211 | |||
| 452 | QZHM01000001.1 | GCA003626375_00283 | gene | open | 167247-167678 | |||
| 453 | QZHM01000001.1 | GCA003626375_00284 | gene | open | 167834-168805 | dusA | ||
| 454 | QZHM01000001.1 | GCA003626375_00285 | gene | open | 168810-170294 | uvrD | ||
| 455 | QZHM01000001.1 | GCA003626375_00286 | gene | open | 170464-171207 | mngR | ||
| 456 | QZHM01000001.1 | GCA003626375_00287 | gene | open | 171712-173400 | gltB2 | ||
| 457 | QZHM01000001.1 | GCA003626375_00288 | gene | open | 173602-174345 | tatC | ||
| 458 | QZHM01000001.1 | GCA003626375_00289 | gene | open | 174342-174878 | tatA | ||
| 459 | QZHM01000001.1 | GCA003626375_00290 | gene | open | 174875-175108 | tatA | ||
| 460 | QZHM01000001.1 | GCA003626375_00291 | gene | open | 175171-175980 | hisIE | ||
| 461 | QZHM01000001.1 | GCA003626375_00292 | gene | open | 176232-176423 | rpmI | ||
| 462 | QZHM01000001.1 | GCA003626375_00293 | gene | open | 176452-176808 | rplT | ||
| 463 | QZHM01000001.1 | GCA003626375_00294 | gene | open | 177178-179454 | norB | ||
| 464 | QZHM01000001.1 | GCA003626375_00295 | gene | open | 179632-180165 | iscR | ||
| 465 | QZHM01000001.1 | GCA003626375_00296 | gene | open | 180546-182054 | |||
| 466 | QZHM01000001.1 | GCA003626375_00297 | gene | open | 182347-183183 | yfmG | ||
| 467 | QZHM01000001.1 | GCA003626375_00298 | gene | open | 183320-184015 | sco1 | ||
| 468 | QZHM01000001.1 | GCA003626375_00299 | gene | open | 184310-185341 | pheS | ||
| 469 | QZHM01000001.1 | GCA003626375_00300 | gene | open | 185394-187790 | pheT | ||
| 470 | QZHM01000001.1 | GCA003626375_00301 | gene | open | 187939-188235 | hupA | ||
| 471 | QZHM01000001.1 | GCA003626375_00302 | gene | open | 188448-188708 | rpmE | ||
| 472 | QZHM01000001.1 | GCA003626375_00303 | gene | open | 189033-190001 | zipA | ||
| 473 | QZHM01000001.1 | GCA003626375_00304 | gene | open | 190049-190957 | mutM | ||
| 474 | QZHM01000001.1 | GCA003626375_00305 | gene | open | 190987-193353 | spoT | ||
| 475 | QZHM01000001.1 | GCA003626375_00306 | gene | open | 194028-195773 | srmB | ||
| 476 | QZHM01000001.1 | GCA003626375_00307 | gene | open | 195829-197322 | rlmD | ||
| 477 | QZHM01000001.1 | GCA003626375_00308 | gene | open | 197423-197551 | |||
| 478 | QZHM01000001.1 | GCA003626375_00309 | gene | open | 197610-197834 | |||
| 479 | QZHM01000001.1 | GCA003626375_00310 | gene | open | 197846-198619 | polB | ||
| 480 | QZHM01000001.1 | GCA003626375_00311 | gene | open | 198628-199536 | cysM | ||
| 481 | QZHM01000001.1 | GCA003626375_00312 | gene | open | 199675-202641 | hPtr | ||
| 482 | QZHM01000001.1 | GCA003626375_00313 | gene | open | 202826-202918 | |||
| 483 | QZHM01000001.1 | GCA003626375_00314 | gene | open | 203236-204069 | asd | ||
| 484 | QZHM01000001.1 | GCA003626375_00315 | gene | open | 204309-204749 | ybaN | ||
| 485 | QZHM01000001.1 | GCA003626375_00316 | gene | open | 204921-206243 | bioA | ||
| 486 | QZHM01000001.1 | GCA003626375_00317 | gene | open | 206243-207442 | bioF | ||
| 487 | QZHM01000001.1 | GCA003626375_00318 | gene | open | 207439-208296 | tam | ||
| 488 | QZHM01000001.1 | GCA003626375_00319 | gene | open | 208293-208997 | bioD | ||
| 489 | QZHM01000001.1 | GCA003626375_00320 | gene | open | 209010-209462 | dtd | ||
| 490 | QZHM01000001.1 | GCA003626375_00321 | gene | open | 209528-210103 | yjhB | ||
| 491 | QZHM01000001.1 | GCA003626375_00322 | gene | open | 210238-211020 | mutT | ||
| 492 | QZHM01000001.1 | GCA003626375_00323 | gene | open | 211035-211400 | rsfS | ||
| 493 | QZHM01000001.1 | GCA003626375_00324 | gene | open | 211433-212092 | nadD | ||
| 494 | QZHM01000001.1 | GCA003626375_00325 | gene | open | 212288-215161 | uvrA | ||
| 495 | QZHM01000001.1 | GCA003626375_00326 | gene | open | 215323-216045 | ssb | ||
| 496 | QZHM01000001.1 | GCA003626375_00327 | gene | open | 216136-217287 | gsp | ||
| 497 | QZHM01000001.1 | GCA003626375_00328 | gene | open | 217284-217829 | |||
| 498 | QZHM01000001.1 | GCA003626375_00329 | gene | open | 218027-218836 | ccmC | ||
| 499 | QZHM01000001.1 | GCA003626375_00330 | gene | open | 218836-219036 | ccmD | ||
| 500 | QZHM01000001.1 | GCA003626375_00331 | gene | open | 219106-219627 | ccmE |

