BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_003862255.1)
Select a Genome:
|
BAKTA Annotations for GCA_003862255.1
|
Search & Sort all 4086 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 501 | QPGS01000002.1 | GCA003862255_00223 | gene | open | 55785-57080 | purD | ||
| 502 | QPGS01000002.1 | GCA003862255_00224 | gene | open | 57077-59275 | ptpA | ||
| 503 | QPGS01000002.1 | GCA003862255_00225 | gene | open | 59307-60761 | rlmL | ||
| 504 | QPGS01000002.1 | GCA003862255_00226 | gene | open | 60899-61300 | traJ | ||
| 505 | QPGS01000002.1 | GCA003862255_00227 | gene | open | 61448-61591 | |||
| 506 | QPGS01000002.1 | GCA003862255_00228 | gene | open | 61604-62761 | dxr | ||
| 507 | QPGS01000002.1 | GCA003862255_00229 | gene | open | 62758-63279 | rimM | ||
| 508 | QPGS01000002.1 | GCA003862255_00230 | gene | open | 63286-64590 | murA | ||
| 509 | QPGS01000002.1 | GCA003862255_00231 | gene | open | 64621-65223 | |||
| 510 | QPGS01000002.1 | GCA003862255_00232 | gene | open | 65243-66580 | pgi | ||
| 511 | QPGS01000002.1 | GCA003862255_00233 | gene | open | 66613-67617 | gpsA | ||
| 512 | QPGS01000002.1 | GCA003862255_00234 | gene | open | 67703-69439 | lysS | ||
| 513 | QPGS01000002.1 | GCA003862255_00235 | gene | open | 69562-70440 | udp | ||
| 514 | QPGS01000002.1 | GCA003862255_00236 | gene | open | 70511-71932 | |||
| 515 | QPGS01000002.1 | GCA003862255_00237 | gene | open | 72011-72286 | |||
| 516 | QPGS01000002.1 | GCA003862255_00238 | gene | open | 72462-73748 | cTD-A | ||
| 517 | QPGS01000002.1 | GCA003862255_00239 | gene | open | 75086-75265 | |||
| 518 | QPGS01000002.1 | GCA003862255_00240 | gene | open | 75277-76278 | |||
| 519 | QPGS01000002.1 | GCA003862255_00241 | gene | open | 76291-78117 | |||
| 520 | QPGS01000002.1 | GCA003862255_00242 | gene | open | 78114-78842 | |||
| 521 | QPGS01000002.1 | GCA003862255_00243 | gene | open | 78815-79591 | |||
| 522 | QPGS01000002.1 | GCA003862255_00244 | gene | open | 79599-80474 | |||
| 523 | QPGS01000002.1 | GCA003862255_00245 | gene | open | 80586-81728 | mutY | ||
| 524 | QPGS01000002.1 | GCA003862255_00246 | gene | open | 81774-82793 | tauA | ||
| 525 | QPGS01000002.1 | GCA003862255_00247 | gene | open | 82845-83543 | tauB | ||
| 526 | QPGS01000002.1 | GCA003862255_00248 | gene | open | 83540-84289 | tauC | ||
| 527 | QPGS01000002.1 | GCA003862255_00249 | gene | open | 84339-85388 | |||
| 528 | QPGS01000002.1 | GCA003862255_00250 | gene | open | 85587-86225 | rhtB | ||
| 529 | QPGS01000002.1 | GCA003862255_00251 | gene | open | 86663-87865 | bepA | ||
| 530 | QPGS01000002.1 | GCA003862255_00252 | gene | open | 87899-90478 | gyrA | ||
| 531 | QPGS01000002.1 | GCA003862255_00253 | gene | open | 90663-91589 | |||
| 532 | QPGS01000002.1 | GCA003862255_00254 | gene | open | 91626-92336 | |||
| 533 | QPGS01000002.1 | GCA003862255_00255 | gene | open | 92401-92859 | hupA | ||
| 534 | QPGS01000002.1 | GCA003862255_00256 | gene | open | 93136-94347 | |||
| 535 | QPGS01000002.1 | GCA003862255_00257 | gene | open | 94375-95832 | ftsW | ||
| 536 | QPGS01000002.1 | GCA003862255_00258 | gene | open | 95822-97687 | mrdA | ||
| 537 | QPGS01000002.1 | GCA003862255_00259 | gene | open | 97680-98198 | mreD | ||
| 538 | QPGS01000002.1 | GCA003862255_00260 | gene | open | 98198-99085 | mreC | ||
| 539 | QPGS01000002.1 | GCA003862255_00261 | gene | open | 99123-100142 | mreB | ||
| 540 | QPGS01000002.1 | GCA003862255_00262 | gene | open | 100245-101762 | purH | ||
| 541 | QPGS01000002.1 | GCA003862255_00263 | gene | open | 102295-102450 | |||
| 542 | QPGS01000002.1 | GCA003862255_00264 | gene | open | 102731-104110 | tnaA | ||
| 543 | QPGS01000002.1 | GCA003862255_00265 | gene | open | 104362-105507 | elsH | ||
| 544 | QPGS01000002.1 | GCA003862255_00266 | gene | open | 105504-106418 | glpG | ||
| 545 | QPGS01000002.1 | GCA003862255_00267 | gene | open | 106402-107118 | glpG | ||
| 546 | QPGS01000002.1 | GCA003862255_00268 | gene | open | 107145-110000 | lptD | ||
| 547 | QPGS01000002.1 | GCA003862255_00269 | gene | open | 110017-110154 | |||
| 548 | QPGS01000002.1 | GCA003862255_00270 | gene | open | 110495-111238 | |||
| 549 | QPGS01000002.1 | GCA003862255_00271 | gene | open | 111294-112259 | czcD | ||
| 550 | QPGS01000002.1 | GCA003862255_00272 | gene | open | 112256-112771 | |||
| 551 | QPGS01000002.1 | GCA003862255_00273 | gene | open | 112864-114543 | ybjL | ||
| 552 | QPGS01000002.1 | GCA003862255_00274 | gene | open | 116290-118893 | btuB | ||
| 553 | QPGS01000002.1 | GCA003862255_00275 | gene | open | 119329-120270 | yrpB | ||
| 554 | QPGS01000002.1 | GCA003862255_00276 | gene | open | 120566-122212 | ttdA | ||
| 555 | QPGS01000002.1 | GCA003862255_00277 | gene | open | 122252-124144 | dnaX | ||
| 556 | QPGS01000003.1 | GCA003862255_00771 | gene | open | 113407-113445 | abiF | ||
| 557 | QPGS01000003.1 | GCA003862255_00771 | ncRNA | open | 113407-113445 | abiF | abiF RNA | |
| 558 | QPGS01000003.1 | repeat_region | open | 21047-22180 | CRISPR array with 15 repeats of length 47%2C consensus sequence GCTGTGCGTTGCCAACAAAAATACTAAATCTGAAAGCTATTCCCAGT and spacer length 29 | |||
| 559 | QPGS01000003.1 | repeat_region | open | 22277-22948 | CRISPR array with 9 repeats of length 48%2C consensus sequence GCTGTGCGTTGCCAACAAAAATACTAAATCTGAAAGCTATTCCCAGT and spacer length 29 | |||
| 560 | QPGS01000003.1 | GCA003862255_00671 | CDS | open | 349-1194 | _na 281_aa | folP | dihydropteroate synthase |
| 561 | QPGS01000003.1 | GCA003862255_00672 | CDS | open | 1255-2022 | _na 255_aa | cdaA | diadenylate cyclase CdaA |
| 562 | QPGS01000003.1 | GCA003862255_00673 | CDS | open | 2038-2754 | _na 238_aa | lpxF | Lipid A 4'-phosphatase |
| 563 | QPGS01000003.1 | GCA003862255_00674 | CDS | open | 2775-3683 | _na 302_aa | batE | BatE protein |
| 564 | QPGS01000003.1 | GCA003862255_00675 | CDS | open | 3680-5482 | _na 600_aa | batD | Aerotolerance regulator BatD |
| 565 | QPGS01000003.1 | GCA003862255_00676 | CDS | open | 5663-6406 | _na 247_aa | batC | putative aerotolerance-related exported protein BatC |
| 566 | QPGS01000003.1 | GCA003862255_00677 | CDS | open | 6403-7422 | _na 339_aa | batB | Putative aerotolerance-related exported protein BatB |
| 567 | QPGS01000003.1 | GCA003862255_00678 | CDS | open | 7433-8416 | _na 327_aa | batA | BatA protein |
| 568 | QPGS01000003.1 | GCA003862255_00679 | CDS | open | 8413-9369 | _na 318_aa | batD | Protein BatD |
| 569 | QPGS01000003.1 | GCA003862255_00680 | CDS | open | 9366-10127 | _na 253_aa | mMP0362 | DUF58 domain-containing protein |
| 570 | QPGS01000003.1 | GCA003862255_00681 | CDS | open | 10249-11244 | _na 331_aa | mMP0363 | ATPase%2C MoxR family |
| 571 | QPGS01000003.1 | GCA003862255_00682 | CDS | open | 11344-12270 | _na 308_aa | nadA | quinolinate synthase NadA |
| 572 | QPGS01000003.1 | GCA003862255_00683 | CDS | open | 12290-13132 | _na 280_aa | nadC | carboxylating nicotinate-nucleotide diphosphorylase |
| 573 | QPGS01000003.1 | GCA003862255_00684 | CDS | open | 13164-14720 | _na 518_aa | nadB | L-aspartate oxidase |
| 574 | QPGS01000003.1 | GCA003862255_00685 | CDS | open | 15082-19368 | _na 1428_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 575 | QPGS01000003.1 | GCA003862255_00686 | CDS | open | 19381-20319 | _na 312_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 576 | QPGS01000003.1 | GCA003862255_00687 | CDS | open | 20367-20660 | _na 97_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 577 | QPGS01000003.1 | GCA003862255_00688 | CDS | open | 24225-24848 | _na 207_aa | crp | Transcriptional regulator%2C Crp family |
| 578 | QPGS01000003.1 | GCA003862255_00689 | CDS | open | 24913-25719 | _na 268_aa | tauE | putative membrane transporter protein |
| 579 | QPGS01000003.1 | GCA003862255_00690 | CDS | open | 25812-27227 | _na 471_aa | pspE | Metallo-beta-lactamase superfamily protein |
| 580 | QPGS01000003.1 | GCA003862255_00691 | CDS | open | 27200-27583 | _na 127_aa | pspE | Rhodanese domain-containing protein |
| 581 | QPGS01000003.1 | GCA003862255_00692 | CDS | open | 28152-28400 | _na 82_aa | transposase family protein | |
| 582 | QPGS01000003.1 | GCA003862255_00693 | CDS | open | 28542-30257 | _na 571_aa | gltX | glutamate--tRNA ligase |
| 583 | QPGS01000003.1 | GCA003862255_00694 | CDS | open | 30282-31520 | _na 412_aa | kdtA | 3-deoxy-D-manno-octulosonic acid transferase |
| 584 | QPGS01000003.1 | GCA003862255_00695 | CDS | open | 31605-33560 | _na 651_aa | mdoB | Sulfatase-like hydrolase/transferase |
| 585 | QPGS01000003.1 | GCA003862255_00696 | CDS | open | 33675-34544 | _na 289_aa | rfbA | glucose-1-phosphate thymidylyltransferase RfbA |
| 586 | QPGS01000003.1 | GCA003862255_00697 | CDS | open | 34559-35149 | _na 196_aa | rfbC | dTDP-4-dehydrorhamnose 3%2C5-epimerase |
| 587 | QPGS01000003.1 | GCA003862255_00698 | CDS | open | 35146-36003 | _na 285_aa | rfbD | dTDP-4-dehydrorhamnose reductase |
| 588 | QPGS01000003.1 | GCA003862255_00699 | CDS | open | 36010-37074 | _na 354_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 589 | QPGS01000003.1 | GCA003862255_00700 | CDS | open | 37149-38237 | _na 362_aa | gcvT | glycine cleavage system aminomethyltransferase GcvT |
| 590 | QPGS01000003.1 | GCA003862255_00701 | CDS | open | 39240-39566 | _na 108_aa | DUF2149 domain-containing protein | |
| 591 | QPGS01000003.1 | GCA003862255_00702 | CDS | open | 39572-40150 | _na 192_aa | tolQ | MotA/TolQ/ExbB proton channel domain-containing protein |
| 592 | QPGS01000003.1 | GCA003862255_00703 | CDS | open | 40220-40897 | _na 225_aa | hypothetical protein | |
| 593 | QPGS01000003.1 | GCA003862255_00704 | CDS | open | 40894-45303 | _na 1469_aa | cobN | Putative cobalamin biosynthesis-related protein |
| 594 | QPGS01000003.1 | GCA003862255_00705 | CDS | open | 45340-47280 | _na 646_aa | hmuR | TonB-dependent receptor HmuR |
| 595 | QPGS01000003.1 | GCA003862255_00706 | CDS | open | 47295-47945 | _na 216_aa | hmuY | HmuY protein |
| 596 | QPGS01000003.1 | GCA003862255_00707 | CDS | open | 47975-48106 | _na 43_aa | hypothetical protein | |
| 597 | QPGS01000003.1 | GCA003862255_00708 | CDS | open | 48265-48405 | _na 46_aa | hypothetical protein | |
| 598 | QPGS01000003.1 | GCA003862255_00709 | CDS | open | 48799-51321 | _na 840_aa | prtT | Thiol protease/hemagglutinin PrtT |
| 599 | QPGS01000003.1 | GCA003862255_00711 | CDS | open | 51548-51901 | _na 117_aa | hypothetical protein | |
| 600 | QPGS01000003.1 | GCA003862255_00712 | CDS | open | 52091-52666 | _na 191_aa | sodB | Superoxide dismutase [Mn/Fe] |
| 601 | QPGS01000003.1 | GCA003862255_00713 | CDS | open | 52804-53574 | _na 256_aa | yaaA | peroxide stress protein YaaA |
| 602 | QPGS01000003.1 | GCA003862255_00714 | CDS | open | 53659-54078 | _na 139_aa | fadM | Thioesterase family protein |
| 603 | QPGS01000003.1 | GCA003862255_00715 | CDS | open | 54134-55378 | _na 414_aa | prtC | Collagenase |
| 604 | QPGS01000003.1 | GCA003862255_00716 | CDS | open | 55391-55834 | _na 147_aa | folK | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase |
| 605 | QPGS01000003.1 | GCA003862255_00717 | CDS | open | 55837-56889 | _na 350_aa | queA | tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA |
| 606 | QPGS01000003.1 | GCA003862255_00718 | CDS | open | 56907-57683 | _na 258_aa | truB | tRNA pseudouridine(55) synthase TruB |
| 607 | QPGS01000003.1 | GCA003862255_00719 | CDS | open | 57693-58535 | _na 280_aa | uppP | undecaprenyl-diphosphate phosphatase |
| 608 | QPGS01000003.1 | GCA003862255_00720 | CDS | open | 58643-58870 | _na 75_aa | DUF3098 domain-containing protein | |
| 609 | QPGS01000003.1 | GCA003862255_00721 | CDS | open | 58917-59744 | _na 275_aa | ftsX | Cell division protein FtsX |
| 610 | QPGS01000003.1 | GCA003862255_00722 | CDS | open | 61725-62066 | _na 113_aa | rodZ | HTH cro/C1-type domain-containing protein |
| 611 | QPGS01000003.1 | GCA003862255_00723 | CDS | open | 62069-62458 | _na 129_aa | Conserved domain protein | |
| 612 | QPGS01000003.1 | GCA003862255_00724 | CDS | open | 62455-64503 | _na 682_aa | Topoisomerase | |
| 613 | QPGS01000003.1 | GCA003862255_00725 | CDS | open | 64500-64694 | _na 64_aa | Helix-turn-helix domain-containing protein | |
| 614 | QPGS01000003.1 | GCA003862255_00726 | CDS | open | 64751-66076 | _na 441_aa | ATPase | |
| 615 | QPGS01000003.1 | GCA003862255_00727 | CDS | open | 66529-67956 | _na 475_aa | AAA family ATPase | |
| 616 | QPGS01000003.1 | GCA003862255_00728 | CDS | open | 68023-69141 | _na 372_aa | menF | isochorismate synthase |
| 617 | QPGS01000003.1 | GCA003862255_00729 | CDS | open | 69138-70874 | _na 578_aa | menD | 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase |
| 618 | QPGS01000003.1 | GCA003862255_00730 | CDS | open | 70893-71717 | _na 274_aa | menB | 1%2C4-dihydroxy-2-naphthoyl-CoA synthase |
| 619 | QPGS01000003.1 | GCA003862255_00731 | CDS | open | 71717-72784 | _na 355_aa | rspA | L-Ala-D/L-Glu epimerase |
| 620 | QPGS01000003.1 | GCA003862255_00732 | CDS | open | 72784-73866 | _na 360_aa | menE | O-succinylbenzoic acid--CoA ligase |
| 621 | QPGS01000003.1 | GCA003862255_00733 | CDS | open | 74073-74345 | _na 90_aa | hypothetical protein | |
| 622 | QPGS01000003.1 | GCA003862255_00734 | CDS | open | 74365-75033 | _na 222_aa | yigB | HAD-superfamily hydrolase%2C subfamily IA%2C variant 1 family protein |
| 623 | QPGS01000003.1 | GCA003862255_00735 | CDS | open | 75158-75361 | _na 67_aa | hypothetical protein | |
| 624 | QPGS01000003.1 | GCA003862255_00736 | CDS | open | 75342-75596 | _na 84_aa | hypothetical protein | |
| 625 | QPGS01000003.1 | GCA003862255_00737 | CDS | open | 75593-75994 | _na 133_aa | hypothetical protein | |
| 626 | QPGS01000003.1 | GCA003862255_00738 | CDS | open | 76099-76992 | _na 297_aa | ygiQ | Radical SAM domain protein |
| 627 | QPGS01000003.1 | GCA003862255_00739 | CDS | open | 77037-78023 | _na 328_aa | wcaG | NAD dependent protein |
| 628 | QPGS01000003.1 | GCA003862255_00740 | CDS | open | 78040-78990 | _na 316_aa | ispH | LytB-related protein |
| 629 | QPGS01000003.1 | GCA003862255_00741 | CDS | open | 79006-79656 | _na 216_aa | AfsA-related hotdog domain-containing protein | |
| 630 | QPGS01000003.1 | GCA003862255_00742 | CDS | open | 79788-79922 | _na 44_aa | hypothetical protein | |
| 631 | QPGS01000003.1 | GCA003862255_00743 | CDS | open | 80164-80763 | _na 199_aa | acrR | Transcriptional regulator%2C tetR family |
| 632 | QPGS01000003.1 | GCA003862255_00744 | CDS | open | 80826-88013 | _na 2395_aa | DUF2958 domain-containing protein | |
| 633 | QPGS01000003.1 | GCA003862255_00745 | CDS | open | 88019-90112 | _na 697_aa | topA | DNA topoisomerase |
| 634 | QPGS01000003.1 | GCA003862255_00746 | CDS | open | 90201-91610 | _na 469_aa | DUF3945 domain-containing protein | |
| 635 | QPGS01000003.1 | GCA003862255_00747 | CDS | open | 91822-94323 | _na 833_aa | TonB-dependent receptor | |
| 636 | QPGS01000003.1 | GCA003862255_00748 | CDS | open | 94444-95322 | _na 292_aa | GLPGLI family protein | |
| 637 | QPGS01000003.1 | GCA003862255_00749 | CDS | open | 95434-95616 | _na 60_aa | hypothetical protein | |
| 638 | QPGS01000003.1 | GCA003862255_00750 | CDS | open | 96441-96743 | _na 100_aa | ISPg1 transposase | |
| 639 | QPGS01000003.1 | GCA003862255_00751 | CDS | open | 97033-99039 | _na 668_aa | mobC | Conjugal transfer protein MobC |
| 640 | QPGS01000003.1 | GCA003862255_00752 | CDS | open | 99041-100321 | _na 426_aa | MobA/VirD2-like nuclease domain-containing protein | |
| 641 | QPGS01000003.1 | GCA003862255_00753 | CDS | open | 100306-100707 | _na 133_aa | mobA | MobA protein |
| 642 | QPGS01000003.1 | GCA003862255_00754 | CDS | open | 101334-102143 | _na 269_aa | traA | Conjugative transposon protein TraA |
| 643 | QPGS01000003.1 | GCA003862255_00755 | CDS | open | 102130-102516 | _na 128_aa | traC | Conjugative transposon protein TraC |
| 644 | QPGS01000003.1 | GCA003862255_00756 | CDS | open | 102521-103225 | _na 234_aa | Conjugal transfer protein | |
| 645 | QPGS01000003.1 | GCA003862255_00757 | CDS | open | 103432-103716 | _na 94_aa | traE | Conjugative transposon protein TraE |
| 646 | QPGS01000003.1 | GCA003862255_00758 | CDS | open | 103720-104055 | _na 111_aa | traF | Conjugative transposon protein TraF |
| 647 | QPGS01000003.1 | GCA003862255_00759 | CDS | open | 104052-106577 | _na 841_aa | traG | TraG family conjugative transposon ATPase |
| 648 | QPGS01000003.1 | GCA003862255_00760 | CDS | open | 106605-107234 | _na 209_aa | Conjugal transfer protein | |
| 649 | QPGS01000003.1 | GCA003862255_00761 | CDS | open | 107266-108393 | _na 375_aa | traJ | conjugative transposon protein TraJ |
| 650 | QPGS01000003.1 | GCA003862255_00762 | CDS | open | 108405-109028 | _na 207_aa | traK | conjugative transposon protein TraK |
| 651 | QPGS01000003.1 | GCA003862255_00763 | CDS | open | 109025-109312 | _na 95_aa | traL | Conjugative transposon protein TraL |
| 652 | QPGS01000003.1 | GCA003862255_00764 | CDS | open | 109302-109850 | _na 182_aa | hypothetical protein | |
| 653 | QPGS01000003.1 | GCA003862255_00765 | CDS | open | 109928-110146 | _na 72_aa | Phage protein | |
| 654 | QPGS01000003.1 | GCA003862255_00766 | CDS | open | 110385-111038 | _na 217_aa | DUF998 domain-containing protein | |
| 655 | QPGS01000003.1 | GCA003862255_00767 | CDS | open | 111025-111597 | _na 190_aa | sTE14 | Isoprenylcysteine carboxylmethyltransferase family protein |
| 656 | QPGS01000003.1 | GCA003862255_00768 | CDS | open | 111679-112227 | _na 182_aa | ubiE | Methyltransferase domain protein |
| 657 | QPGS01000003.1 | GCA003862255_00769 | CDS | open | 112268-112783 | _na 171_aa | DUF1579 domain-containing protein | |
| 658 | QPGS01000003.1 | GCA003862255_00770 | CDS | open | 112898-113344 | _na 148_aa | YdbS-like PH domain-containing protein | |
| 659 | QPGS01000003.1 | GCA003862255_00772 | CDS | open | 113544-114008 | _na 154_aa | traQ | Conjugative transposon protein TraQ |
| 660 | QPGS01000003.1 | GCA003862255_00773 | CDS | open | 114021-114593 | _na 190_aa | traO | Conjugative transposon protein TraO |
| 661 | QPGS01000003.1 | GCA003862255_00774 | CDS | open | 114593-115618 | _na 341_aa | traN | conjugative transposon protein TraN |
| 662 | QPGS01000003.1 | GCA003862255_00775 | CDS | open | 115641-116468 | _na 275_aa | traM | conjugative transposon protein TraM |
| 663 | QPGS01000003.1 | GCA003862255_00671 | gene | open | 349-1194 | folP | ||
| 664 | QPGS01000003.1 | GCA003862255_00672 | gene | open | 1255-2022 | cdaA | ||
| 665 | QPGS01000003.1 | GCA003862255_00673 | gene | open | 2038-2754 | lpxF | ||
| 666 | QPGS01000003.1 | GCA003862255_00674 | gene | open | 2775-3683 | batE | ||
| 667 | QPGS01000003.1 | GCA003862255_00675 | gene | open | 3680-5482 | batD | ||
| 668 | QPGS01000003.1 | GCA003862255_00676 | gene | open | 5663-6406 | batC | ||
| 669 | QPGS01000003.1 | GCA003862255_00677 | gene | open | 6403-7422 | batB | ||
| 670 | QPGS01000003.1 | GCA003862255_00678 | gene | open | 7433-8416 | batA | ||
| 671 | QPGS01000003.1 | GCA003862255_00679 | gene | open | 8413-9369 | batD | ||
| 672 | QPGS01000003.1 | GCA003862255_00680 | gene | open | 9366-10127 | mMP0362 | ||
| 673 | QPGS01000003.1 | GCA003862255_00681 | gene | open | 10249-11244 | mMP0363 | ||
| 674 | QPGS01000003.1 | GCA003862255_00682 | gene | open | 11344-12270 | nadA | ||
| 675 | QPGS01000003.1 | GCA003862255_00683 | gene | open | 12290-13132 | nadC | ||
| 676 | QPGS01000003.1 | GCA003862255_00684 | gene | open | 13164-14720 | nadB | ||
| 677 | QPGS01000003.1 | GCA003862255_00685 | gene | open | 15082-19368 | cas9 | ||
| 678 | QPGS01000003.1 | GCA003862255_00686 | gene | open | 19381-20319 | cas1 | ||
| 679 | QPGS01000003.1 | GCA003862255_00687 | gene | open | 20367-20660 | cas2 | ||
| 680 | QPGS01000003.1 | GCA003862255_00688 | gene | open | 24225-24848 | crp | ||
| 681 | QPGS01000003.1 | GCA003862255_00689 | gene | open | 24913-25719 | tauE | ||
| 682 | QPGS01000003.1 | GCA003862255_00690 | gene | open | 25812-27227 | pspE | ||
| 683 | QPGS01000003.1 | GCA003862255_00691 | gene | open | 27200-27583 | pspE | ||
| 684 | QPGS01000003.1 | GCA003862255_00692 | gene | open | 28152-28400 | |||
| 685 | QPGS01000003.1 | GCA003862255_00693 | gene | open | 28542-30257 | gltX | ||
| 686 | QPGS01000003.1 | GCA003862255_00694 | gene | open | 30282-31520 | kdtA | ||
| 687 | QPGS01000003.1 | GCA003862255_00695 | gene | open | 31605-33560 | mdoB | ||
| 688 | QPGS01000003.1 | GCA003862255_00696 | gene | open | 33675-34544 | rfbA | ||
| 689 | QPGS01000003.1 | GCA003862255_00697 | gene | open | 34559-35149 | rfbC | ||
| 690 | QPGS01000003.1 | GCA003862255_00698 | gene | open | 35146-36003 | rfbD | ||
| 691 | QPGS01000003.1 | GCA003862255_00699 | gene | open | 36010-37074 | rfbB | ||
| 692 | QPGS01000003.1 | GCA003862255_00700 | gene | open | 37149-38237 | gcvT | ||
| 693 | QPGS01000003.1 | GCA003862255_00701 | gene | open | 39240-39566 | |||
| 694 | QPGS01000003.1 | GCA003862255_00702 | gene | open | 39572-40150 | tolQ | ||
| 695 | QPGS01000003.1 | GCA003862255_00703 | gene | open | 40220-40897 | |||
| 696 | QPGS01000003.1 | GCA003862255_00704 | gene | open | 40894-45303 | cobN | ||
| 697 | QPGS01000003.1 | GCA003862255_00705 | gene | open | 45340-47280 | hmuR | ||
| 698 | QPGS01000003.1 | GCA003862255_00706 | gene | open | 47295-47945 | hmuY | ||
| 699 | QPGS01000003.1 | GCA003862255_00707 | gene | open | 47975-48106 | |||
| 700 | QPGS01000003.1 | GCA003862255_00708 | gene | open | 48265-48405 | |||
| 701 | QPGS01000003.1 | GCA003862255_00709 | gene | open | 48799-51321 | prtT | ||
| 702 | QPGS01000003.1 | GCA003862255_00711 | gene | open | 51548-51901 | |||
| 703 | QPGS01000003.1 | GCA003862255_00712 | gene | open | 52091-52666 | sodB | ||
| 704 | QPGS01000003.1 | GCA003862255_00713 | gene | open | 52804-53574 | yaaA | ||
| 705 | QPGS01000003.1 | GCA003862255_00714 | gene | open | 53659-54078 | fadM | ||
| 706 | QPGS01000003.1 | GCA003862255_00715 | gene | open | 54134-55378 | prtC | ||
| 707 | QPGS01000003.1 | GCA003862255_00716 | gene | open | 55391-55834 | folK | ||
| 708 | QPGS01000003.1 | GCA003862255_00717 | gene | open | 55837-56889 | queA | ||
| 709 | QPGS01000003.1 | GCA003862255_00718 | gene | open | 56907-57683 | truB | ||
| 710 | QPGS01000003.1 | GCA003862255_00719 | gene | open | 57693-58535 | uppP | ||
| 711 | QPGS01000003.1 | GCA003862255_00720 | gene | open | 58643-58870 | |||
| 712 | QPGS01000003.1 | GCA003862255_00721 | gene | open | 58917-59744 | ftsX | ||
| 713 | QPGS01000003.1 | GCA003862255_00722 | gene | open | 61725-62066 | rodZ | ||
| 714 | QPGS01000003.1 | GCA003862255_00723 | gene | open | 62069-62458 | |||
| 715 | QPGS01000003.1 | GCA003862255_00724 | gene | open | 62455-64503 | |||
| 716 | QPGS01000003.1 | GCA003862255_00725 | gene | open | 64500-64694 | |||
| 717 | QPGS01000003.1 | GCA003862255_00726 | gene | open | 64751-66076 | |||
| 718 | QPGS01000003.1 | GCA003862255_00727 | gene | open | 66529-67956 | |||
| 719 | QPGS01000003.1 | GCA003862255_00728 | gene | open | 68023-69141 | menF | ||
| 720 | QPGS01000003.1 | GCA003862255_00729 | gene | open | 69138-70874 | menD | ||
| 721 | QPGS01000003.1 | GCA003862255_00730 | gene | open | 70893-71717 | menB | ||
| 722 | QPGS01000003.1 | GCA003862255_00731 | gene | open | 71717-72784 | rspA | ||
| 723 | QPGS01000003.1 | GCA003862255_00732 | gene | open | 72784-73866 | menE | ||
| 724 | QPGS01000003.1 | GCA003862255_00733 | gene | open | 74073-74345 | |||
| 725 | QPGS01000003.1 | GCA003862255_00734 | gene | open | 74365-75033 | yigB | ||
| 726 | QPGS01000003.1 | GCA003862255_00735 | gene | open | 75158-75361 | |||
| 727 | QPGS01000003.1 | GCA003862255_00736 | gene | open | 75342-75596 | |||
| 728 | QPGS01000003.1 | GCA003862255_00737 | gene | open | 75593-75994 | |||
| 729 | QPGS01000003.1 | GCA003862255_00738 | gene | open | 76099-76992 | ygiQ | ||
| 730 | QPGS01000003.1 | GCA003862255_00739 | gene | open | 77037-78023 | wcaG | ||
| 731 | QPGS01000003.1 | GCA003862255_00740 | gene | open | 78040-78990 | ispH | ||
| 732 | QPGS01000003.1 | GCA003862255_00741 | gene | open | 79006-79656 | |||
| 733 | QPGS01000003.1 | GCA003862255_00742 | gene | open | 79788-79922 | |||
| 734 | QPGS01000003.1 | GCA003862255_00743 | gene | open | 80164-80763 | acrR | ||
| 735 | QPGS01000003.1 | GCA003862255_00744 | gene | open | 80826-88013 | |||
| 736 | QPGS01000003.1 | GCA003862255_00745 | gene | open | 88019-90112 | topA | ||
| 737 | QPGS01000003.1 | GCA003862255_00746 | gene | open | 90201-91610 | |||
| 738 | QPGS01000003.1 | GCA003862255_00747 | gene | open | 91822-94323 | |||
| 739 | QPGS01000003.1 | GCA003862255_00748 | gene | open | 94444-95322 | |||
| 740 | QPGS01000003.1 | GCA003862255_00749 | gene | open | 95434-95616 | |||
| 741 | QPGS01000003.1 | GCA003862255_00750 | gene | open | 96441-96743 | |||
| 742 | QPGS01000003.1 | GCA003862255_00751 | gene | open | 97033-99039 | mobC | ||
| 743 | QPGS01000003.1 | GCA003862255_00752 | gene | open | 99041-100321 | |||
| 744 | QPGS01000003.1 | GCA003862255_00753 | gene | open | 100306-100707 | mobA | ||
| 745 | QPGS01000003.1 | GCA003862255_00754 | gene | open | 101334-102143 | traA | ||
| 746 | QPGS01000003.1 | GCA003862255_00755 | gene | open | 102130-102516 | traC | ||
| 747 | QPGS01000003.1 | GCA003862255_00756 | gene | open | 102521-103225 | |||
| 748 | QPGS01000003.1 | GCA003862255_00757 | gene | open | 103432-103716 | traE | ||
| 749 | QPGS01000003.1 | GCA003862255_00758 | gene | open | 103720-104055 | traF | ||
| 750 | QPGS01000003.1 | GCA003862255_00759 | gene | open | 104052-106577 | traG | ||
| 751 | QPGS01000003.1 | GCA003862255_00760 | gene | open | 106605-107234 | |||
| 752 | QPGS01000003.1 | GCA003862255_00761 | gene | open | 107266-108393 | traJ | ||
| 753 | QPGS01000003.1 | GCA003862255_00762 | gene | open | 108405-109028 | traK | ||
| 754 | QPGS01000003.1 | GCA003862255_00763 | gene | open | 109025-109312 | traL | ||
| 755 | QPGS01000003.1 | GCA003862255_00764 | gene | open | 109302-109850 | |||
| 756 | QPGS01000003.1 | GCA003862255_00765 | gene | open | 109928-110146 | |||
| 757 | QPGS01000003.1 | GCA003862255_00766 | gene | open | 110385-111038 | |||
| 758 | QPGS01000003.1 | GCA003862255_00767 | gene | open | 111025-111597 | sTE14 | ||
| 759 | QPGS01000003.1 | GCA003862255_00768 | gene | open | 111679-112227 | ubiE | ||
| 760 | QPGS01000003.1 | GCA003862255_00769 | gene | open | 112268-112783 | |||
| 761 | QPGS01000003.1 | GCA003862255_00770 | gene | open | 112898-113344 | |||
| 762 | QPGS01000003.1 | GCA003862255_00772 | gene | open | 113544-114008 | traQ | ||
| 763 | QPGS01000003.1 | GCA003862255_00773 | gene | open | 114021-114593 | traO | ||
| 764 | QPGS01000003.1 | GCA003862255_00774 | gene | open | 114593-115618 | traN | ||
| 765 | QPGS01000003.1 | GCA003862255_00775 | gene | open | 115641-116468 | traM | ||
| 766 | QPGS01000003.1 | GCA003862255_00710 | gene | open | 51470-51543 | trnR | ||
| 767 | QPGS01000003.1 | GCA003862255_00710 | tRNA | open | 51470-51543 | trnR | tRNA-Arg(tct) | |
| 768 | QPGS01000004.1 | repeat_region | open | 49537-50506 | CRISPR array with 15 repeats of length 36%2C consensus sequence GTTGGATCTACCCTCTATTCGAAGGGTACACACAAC and spacer length 29 | |||
| 769 | QPGS01000004.1 | GCA003862255_01083 | CDS | open | 506-1396 | _na 296_aa | wcaE | Glycosyltransferase 2-like domain-containing protein |
| 770 | QPGS01000004.1 | GCA003862255_01084 | CDS | open | 1411-2535 | _na 374_aa | dprA | DNA-processing protein DprA |
| 771 | QPGS01000004.1 | GCA003862255_01085 | CDS | open | 2528-6232 | _na 1234_aa | purL | phosphoribosylformylglycinamidine synthase |
| 772 | QPGS01000004.1 | GCA003862255_01086 | CDS | open | 6569-7006 | _na 145_aa | hypothetical protein | |
| 773 | QPGS01000004.1 | GCA003862255_01087 | CDS | open | 7137-7424 | _na 95_aa | Partial transposase in ISPg3 | |
| 774 | QPGS01000004.1 | GCA003862255_01088 | CDS | open | 7640-8932 | _na 430_aa | cpoB | TPR domain protein |
| 775 | QPGS01000004.1 | GCA003862255_01089 | CDS | open | 9297-9719 | _na 140_aa | rseC | Positive regulator of sigma(E)%2C RseC/MucC |
| 776 | QPGS01000004.1 | GCA003862255_01090 | CDS | open | 9729-10601 | _na 290_aa | rnfB | Fe-S cluster domain-containing protein |
| 777 | QPGS01000004.1 | GCA003862255_01091 | CDS | open | 10637-11968 | _na 443_aa | rsxC | electron transport complex subunit RsxC |
| 778 | QPGS01000004.1 | GCA003862255_01092 | CDS | open | 11984-12967 | _na 327_aa | rnfD | Ion-translocating oxidoreductase complex subunit D |
| 779 | QPGS01000004.1 | GCA003862255_01093 | CDS | open | 12964-13641 | _na 225_aa | rnfG | Ion-translocating oxidoreductase complex subunit G |
| 780 | QPGS01000004.1 | GCA003862255_01094 | CDS | open | 13638-14228 | _na 196_aa | rnfE | Ion-translocating oxidoreductase complex subunit E |
| 781 | QPGS01000004.1 | GCA003862255_01095 | CDS | open | 14253-14825 | _na 190_aa | rnfA | Ion-translocating oxidoreductase complex subunit A |
| 782 | QPGS01000004.1 | GCA003862255_01096 | CDS | open | 15038-16051 | _na 337_aa | apbE | FAD:protein FMN transferase |
| 783 | QPGS01000004.1 | GCA003862255_01097 | CDS | open | 16048-16587 | _na 179_aa | nfnB | Nitroreductase family protein |
| 784 | QPGS01000004.1 | GCA003862255_01098 | CDS | open | 16587-17540 | _na 317_aa | wcaA | Glycosyl transferase%2C group 2 family protein |
| 785 | QPGS01000004.1 | GCA003862255_01099 | CDS | open | 17537-18076 | _na 179_aa | DUF4199 domain-containing protein | |
| 786 | QPGS01000004.1 | GCA003862255_01100 | CDS | open | 18339-18554 | _na 71_aa | 50S ribosomal protein L28 domain protein | |
| 787 | QPGS01000004.1 | GCA003862255_01101 | CDS | open | 18805-19122 | _na 105_aa | rplU | 50S ribosomal protein L21 |
| 788 | QPGS01000004.1 | GCA003862255_01102 | CDS | open | 19150-19407 | _na 85_aa | rpmA | 50S ribosomal protein L27 |
| 789 | QPGS01000004.1 | GCA003862255_01103 | CDS | open | 19507-20778 | _na 423_aa | serS | serine--tRNA ligase |
| 790 | QPGS01000004.1 | GCA003862255_01104 | CDS | open | 20791-23451 | _na 886_aa | Peptidase family M49 | |
| 791 | QPGS01000004.1 | GCA003862255_01105 | CDS | open | 23609-23857 | _na 82_aa | hypothetical protein | |
| 792 | QPGS01000004.1 | GCA003862255_01106 | CDS | open | 24063-24446 | _na 127_aa | DUF1573 domain-containing protein | |
| 793 | QPGS01000004.1 | GCA003862255_01107 | CDS | open | 24478-25566 | _na 362_aa | DUF1573 domain-containing protein | |
| 794 | QPGS01000004.1 | GCA003862255_01108 | CDS | open | 25642-26748 | _na 368_aa | meaB | methylmalonyl Co-A mutase-associated GTPase MeaB |
| 795 | QPGS01000004.1 | GCA003862255_01109 | CDS | open | 26777-27955 | _na 392_aa | gltP | Serine/threonine transporter |
| 796 | QPGS01000004.1 | GCA003862255_01110 | CDS | open | 28078-28407 | _na 109_aa | qdoI | Cupin type-2 domain-containing protein |
| 797 | QPGS01000004.1 | GCA003862255_01111 | CDS | open | 28609-30114 | _na 501_aa | hutH | histidine ammonia-lyase |
| 798 | QPGS01000004.1 | GCA003862255_01112 | CDS | open | 30105-30734 | _na 209_aa | ftcD | Cyclodeaminase/cyclohydrolase domain-containing protein |
| 799 | QPGS01000004.1 | GCA003862255_01113 | CDS | open | 30759-31886 | _na 375_aa | lomR | Porin |
| 800 | QPGS01000004.1 | GCA003862255_01114 | CDS | open | 31927-33081 | _na 384_aa | Nucleoside transporter/FeoB GTPase Gate domain-containing protein | |
| 801 | QPGS01000004.1 | GCA003862255_01115 | CDS | open | 33175-34425 | _na 416_aa | hutI | imidazolonepropionase |
| 802 | QPGS01000004.1 | GCA003862255_01116 | CDS | open | 34547-35449 | _na 300_aa | ftcD | glutamate formimidoyltransferase |
| 803 | QPGS01000004.1 | GCA003862255_01117 | CDS | open | 35490-36485 | _na 331_aa | Lipoprotein | |
| 804 | QPGS01000004.1 | GCA003862255_01118 | CDS | open | 36518-37036 | _na 172_aa | hupA | DNA-binding protein%2C histone-like family |
| 805 | QPGS01000004.1 | GCA003862255_01119 | CDS | open | 37711-39687 | _na 658_aa | rho | transcription termination factor Rho |
| 806 | QPGS01000004.1 | GCA003862255_01120 | CDS | open | 39915-40823 | _na 302_aa | rhaT | EamA domain-containing protein |
| 807 | QPGS01000004.1 | GCA003862255_01121 | CDS | open | 40834-41793 | _na 319_aa | wcaA | Glycosyl transferase%2C group 2 family protein |
| 808 | QPGS01000004.1 | GCA003862255_01122 | CDS | open | 41821-43335 | _na 504_aa | Glycosyltransferase family 39 protein | |
| 809 | QPGS01000004.1 | GCA003862255_01123 | CDS | open | 43475-44377 | _na 300_aa | miaA | tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA |
| 810 | QPGS01000004.1 | GCA003862255_01124 | CDS | open | 44394-44963 | _na 189_aa | Plasmid pRiA4b Orf3-like domain-containing protein | |
| 811 | QPGS01000004.1 | GCA003862255_01125 | CDS | open | 45251-48778 | _na 1175_aa | cas13b | type VI-B CRISPR-associated RNA-guided ribonuclease Cas13b |
| 812 | QPGS01000004.1 | GCA003862255_01126 | CDS | open | 48786-49328 | _na 180_aa | csx28 | CRISPR-associated protein Csx28 |
| 813 | QPGS01000004.1 | GCA003862255_01127 | CDS | open | 50994-51239 | _na 81_aa | hypothetical protein | |
| 814 | QPGS01000004.1 | GCA003862255_01128 | CDS | open | 51321-52502 | _na 393_aa | megL | methionine gamma-lyase |
| 815 | QPGS01000004.1 | GCA003862255_01129 | CDS | open | 52683-54152 | _na 489_aa | cpdA | Metallophosphoesterase family protein |
| 816 | QPGS01000004.1 | GCA003862255_01130 | CDS | open | 54155-54748 | _na 197_aa | Histidine kinase | |
| 817 | QPGS01000004.1 | GCA003862255_01131 | CDS | open | 54849-55454 | _na 201_aa | yihA | ribosome biogenesis GTP-binding protein YihA/YsxC |
| 818 | QPGS01000004.1 | GCA003862255_01132 | CDS | open | 55464-56492 | _na 342_aa | galE | UDP-glucose 4-epimerase GalE |
| 819 | QPGS01000004.1 | GCA003862255_01133 | CDS | open | 56535-58631 | _na 698_aa | recG | ATP-dependent DNA helicase RecG |
| 820 | QPGS01000004.1 | GCA003862255_01134 | CDS | open | 58649-59401 | _na 250_aa | ycjU | Hydrolase%2C haloacid dehalogenase-like family |
| 821 | QPGS01000004.1 | GCA003862255_01135 | CDS | open | 59496-60950 | _na 484_aa | yopM | Internalin |
| 822 | QPGS01000004.1 | GCA003862255_01136 | CDS | open | 61376-62956 | _na 526_aa | nanH | exo-alpha-sialidase |
| 823 | QPGS01000004.1 | GCA003862255_01137 | CDS | open | 63889-64815 | _na 308_aa | hypothetical protein | |
| 824 | QPGS01000004.1 | GCA003862255_01138 | CDS | open | 64844-65581 | _na 245_aa | sIMPL | SIMPL domain-containing protein |
| 825 | QPGS01000004.1 | GCA003862255_01139 | CDS | open | 65628-66542 | _na 304_aa | pyrB | aspartate carbamoyltransferase |
| 826 | QPGS01000004.1 | GCA003862255_01140 | CDS | open | 66570-67010 | _na 146_aa | pyrI | aspartate carbamoyltransferase regulatory subunit |
| 827 | QPGS01000004.1 | GCA003862255_01141 | CDS | open | 67039-67626 | _na 195_aa | rutF | Putative flavoredoxin |
| 828 | QPGS01000004.1 | GCA003862255_01142 | CDS | open | 67670-68260 | _na 196_aa | lemA | LemA protein |
| 829 | QPGS01000004.1 | GCA003862255_01143 | CDS | open | 68282-69589 | _na 435_aa | rPS27A | TPM domain-containing protein |
| 830 | QPGS01000004.1 | GCA003862255_01144 | CDS | open | 69597-71657 | _na 686_aa | TonB-dependent receptor | |
| 831 | QPGS01000004.1 | GCA003862255_01145 | CDS | open | 71664-72485 | _na 273_aa | mltF | Solute-binding protein family 3/N-terminal domain-containing protein |
| 832 | QPGS01000004.1 | GCA003862255_01146 | CDS | open | 72548-73753 | _na 401_aa | rlmK | PUA domain-containing protein |
| 833 | QPGS01000004.1 | GCA003862255_01147 | CDS | open | 73750-74352 | _na 200_aa | rnd | 3'-5' exonuclease domain protein |
| 834 | QPGS01000004.1 | GCA003862255_01148 | CDS | open | 74393-74953 | _na 186_aa | DUF5063 domain-containing protein | |
| 835 | QPGS01000004.1 | GCA003862255_01149 | CDS | open | 75432-77366 | _na 644_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) |
| 836 | QPGS01000004.1 | GCA003862255_01150 | CDS | open | 77397-77858 | _na 153_aa | coaD | pantetheine-phosphate adenylyltransferase |
| 837 | QPGS01000004.1 | GCA003862255_01151 | CDS | open | 78893-79561 | _na 222_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 838 | QPGS01000004.1 | GCA003862255_01152 | CDS | open | 80122-80577 | _na 151_aa | rplM | 50S ribosomal protein L13 |
| 839 | QPGS01000004.1 | GCA003862255_01153 | CDS | open | 80587-80973 | _na 128_aa | rpsI | 30S ribosomal protein S9 |
| 840 | QPGS01000004.1 | GCA003862255_01154 | CDS | open | 81108-81953 | _na 281_aa | rpsB | 30S ribosomal protein S2 |
| 841 | QPGS01000004.1 | GCA003862255_01155 | CDS | open | 82092-82916 | _na 274_aa | tsf | translation elongation factor Ts |
| 842 | QPGS01000004.1 | GCA003862255_01156 | CDS | open | 83290-85326 | _na 678_aa | uvrB | excinuclease ABC subunit UvrB |
| 843 | QPGS01000004.1 | GCA003862255_01157 | CDS | open | 85323-86843 | _na 506_aa | nhaP2 | potassium/proton antiporter |
| 844 | QPGS01000004.1 | GCA003862255_01158 | CDS | open | 87320-88639 | _na 439_aa | rseP | RIP metalloprotease RseP |
| 845 | QPGS01000004.1 | GCA003862255_01159 | CDS | open | 88649-91171 | _na 840_aa | rqcU | endonuclease MutS2 |
| 846 | QPGS01000004.1 | GCA003862255_01160 | CDS | open | 91326-91517 | _na 63_aa | rpsU | 30S ribosomal protein S21 |
| 847 | QPGS01000004.1 | GCA003862255_01161 | CDS | open | 91594-92796 | _na 400_aa | hpf | ribosome hibernation-promoting factor%2C HPF/YfiA family |
| 848 | QPGS01000004.1 | GCA003862255_01164 | CDS | open | 93190-94377 | _na 395_aa | tuf | elongation factor Tu |
| 849 | QPGS01000004.1 | GCA003862255_01166 | CDS | open | 94536-94739 | _na 67_aa | secE | preprotein translocase subunit SecE |
| 850 | QPGS01000004.1 | GCA003862255_01167 | CDS | open | 94761-95300 | _na 179_aa | nusG | transcription termination/antitermination protein NusG |
| 851 | QPGS01000004.1 | GCA003862255_01168 | CDS | open | 95369-95806 | _na 145_aa | rplK | 50S ribosomal protein L11 |
| 852 | QPGS01000004.1 | GCA003862255_01169 | CDS | open | 95827-96525 | _na 232_aa | rplA | 50S ribosomal protein L1 |
| 853 | QPGS01000004.1 | GCA003862255_01170 | CDS | open | 96541-97065 | _na 174_aa | rplJ | 50S ribosomal protein L10 |
| 854 | QPGS01000004.1 | GCA003862255_01171 | CDS | open | 97107-97484 | _na 125_aa | rplL | 50S ribosomal protein L7/L12 |
| 855 | QPGS01000004.1 | GCA003862255_01172 | CDS | open | 97596-101405 | _na 1269_aa | rpoB | DNA-directed RNA polymerase subunit beta |
| 856 | QPGS01000004.1 | GCA003862255_01173 | CDS | open | 101471-105772 | _na 1433_aa | rpoC | DNA-directed RNA polymerase subunit beta' |
| 857 | QPGS01000004.1 | GCA003862255_01174 | CDS | open | 106060-106758 | _na 232_aa | crp | Transcriptional regulator%2C Crp/Fnr family |
| 858 | QPGS01000004.1 | GCA003862255_01083 | gene | open | 506-1396 | wcaE | ||
| 859 | QPGS01000004.1 | GCA003862255_01084 | gene | open | 1411-2535 | dprA | ||
| 860 | QPGS01000004.1 | GCA003862255_01085 | gene | open | 2528-6232 | purL | ||
| 861 | QPGS01000004.1 | GCA003862255_01086 | gene | open | 6569-7006 | |||
| 862 | QPGS01000004.1 | GCA003862255_01087 | gene | open | 7137-7424 | |||
| 863 | QPGS01000004.1 | GCA003862255_01088 | gene | open | 7640-8932 | cpoB | ||
| 864 | QPGS01000004.1 | GCA003862255_01089 | gene | open | 9297-9719 | rseC | ||
| 865 | QPGS01000004.1 | GCA003862255_01090 | gene | open | 9729-10601 | rnfB | ||
| 866 | QPGS01000004.1 | GCA003862255_01091 | gene | open | 10637-11968 | rsxC | ||
| 867 | QPGS01000004.1 | GCA003862255_01092 | gene | open | 11984-12967 | rnfD | ||
| 868 | QPGS01000004.1 | GCA003862255_01093 | gene | open | 12964-13641 | rnfG | ||
| 869 | QPGS01000004.1 | GCA003862255_01094 | gene | open | 13638-14228 | rnfE | ||
| 870 | QPGS01000004.1 | GCA003862255_01095 | gene | open | 14253-14825 | rnfA | ||
| 871 | QPGS01000004.1 | GCA003862255_01096 | gene | open | 15038-16051 | apbE | ||
| 872 | QPGS01000004.1 | GCA003862255_01097 | gene | open | 16048-16587 | nfnB | ||
| 873 | QPGS01000004.1 | GCA003862255_01098 | gene | open | 16587-17540 | wcaA | ||
| 874 | QPGS01000004.1 | GCA003862255_01099 | gene | open | 17537-18076 | |||
| 875 | QPGS01000004.1 | GCA003862255_01100 | gene | open | 18339-18554 | |||
| 876 | QPGS01000004.1 | GCA003862255_01101 | gene | open | 18805-19122 | rplU | ||
| 877 | QPGS01000004.1 | GCA003862255_01102 | gene | open | 19150-19407 | rpmA | ||
| 878 | QPGS01000004.1 | GCA003862255_01103 | gene | open | 19507-20778 | serS | ||
| 879 | QPGS01000004.1 | GCA003862255_01104 | gene | open | 20791-23451 | |||
| 880 | QPGS01000004.1 | GCA003862255_01105 | gene | open | 23609-23857 | |||
| 881 | QPGS01000004.1 | GCA003862255_01106 | gene | open | 24063-24446 | |||
| 882 | QPGS01000004.1 | GCA003862255_01107 | gene | open | 24478-25566 | |||
| 883 | QPGS01000004.1 | GCA003862255_01108 | gene | open | 25642-26748 | meaB | ||
| 884 | QPGS01000004.1 | GCA003862255_01109 | gene | open | 26777-27955 | gltP | ||
| 885 | QPGS01000004.1 | GCA003862255_01110 | gene | open | 28078-28407 | qdoI | ||
| 886 | QPGS01000004.1 | GCA003862255_01111 | gene | open | 28609-30114 | hutH | ||
| 887 | QPGS01000004.1 | GCA003862255_01112 | gene | open | 30105-30734 | ftcD | ||
| 888 | QPGS01000004.1 | GCA003862255_01113 | gene | open | 30759-31886 | lomR | ||
| 889 | QPGS01000004.1 | GCA003862255_01114 | gene | open | 31927-33081 | |||
| 890 | QPGS01000004.1 | GCA003862255_01115 | gene | open | 33175-34425 | hutI | ||
| 891 | QPGS01000004.1 | GCA003862255_01116 | gene | open | 34547-35449 | ftcD | ||
| 892 | QPGS01000004.1 | GCA003862255_01117 | gene | open | 35490-36485 | |||
| 893 | QPGS01000004.1 | GCA003862255_01118 | gene | open | 36518-37036 | hupA | ||
| 894 | QPGS01000004.1 | GCA003862255_01119 | gene | open | 37711-39687 | rho | ||
| 895 | QPGS01000004.1 | GCA003862255_01120 | gene | open | 39915-40823 | rhaT | ||
| 896 | QPGS01000004.1 | GCA003862255_01121 | gene | open | 40834-41793 | wcaA | ||
| 897 | QPGS01000004.1 | GCA003862255_01122 | gene | open | 41821-43335 | |||
| 898 | QPGS01000004.1 | GCA003862255_01123 | gene | open | 43475-44377 | miaA | ||
| 899 | QPGS01000004.1 | GCA003862255_01124 | gene | open | 44394-44963 | |||
| 900 | QPGS01000004.1 | GCA003862255_01125 | gene | open | 45251-48778 | cas13b | ||
| 901 | QPGS01000004.1 | GCA003862255_01126 | gene | open | 48786-49328 | csx28 | ||
| 902 | QPGS01000004.1 | GCA003862255_01127 | gene | open | 50994-51239 | |||
| 903 | QPGS01000004.1 | GCA003862255_01128 | gene | open | 51321-52502 | megL | ||
| 904 | QPGS01000004.1 | GCA003862255_01129 | gene | open | 52683-54152 | cpdA | ||
| 905 | QPGS01000004.1 | GCA003862255_01130 | gene | open | 54155-54748 | |||
| 906 | QPGS01000004.1 | GCA003862255_01131 | gene | open | 54849-55454 | yihA | ||
| 907 | QPGS01000004.1 | GCA003862255_01132 | gene | open | 55464-56492 | galE | ||
| 908 | QPGS01000004.1 | GCA003862255_01133 | gene | open | 56535-58631 | recG | ||
| 909 | QPGS01000004.1 | GCA003862255_01134 | gene | open | 58649-59401 | ycjU | ||
| 910 | QPGS01000004.1 | GCA003862255_01135 | gene | open | 59496-60950 | yopM | ||
| 911 | QPGS01000004.1 | GCA003862255_01136 | gene | open | 61376-62956 | nanH | ||
| 912 | QPGS01000004.1 | GCA003862255_01137 | gene | open | 63889-64815 | |||
| 913 | QPGS01000004.1 | GCA003862255_01138 | gene | open | 64844-65581 | sIMPL | ||
| 914 | QPGS01000004.1 | GCA003862255_01139 | gene | open | 65628-66542 | pyrB | ||
| 915 | QPGS01000004.1 | GCA003862255_01140 | gene | open | 66570-67010 | pyrI | ||
| 916 | QPGS01000004.1 | GCA003862255_01141 | gene | open | 67039-67626 | rutF | ||
| 917 | QPGS01000004.1 | GCA003862255_01142 | gene | open | 67670-68260 | lemA | ||
| 918 | QPGS01000004.1 | GCA003862255_01143 | gene | open | 68282-69589 | rPS27A | ||
| 919 | QPGS01000004.1 | GCA003862255_01144 | gene | open | 69597-71657 | |||
| 920 | QPGS01000004.1 | GCA003862255_01145 | gene | open | 71664-72485 | mltF | ||
| 921 | QPGS01000004.1 | GCA003862255_01146 | gene | open | 72548-73753 | rlmK | ||
| 922 | QPGS01000004.1 | GCA003862255_01147 | gene | open | 73750-74352 | rnd | ||
| 923 | QPGS01000004.1 | GCA003862255_01148 | gene | open | 74393-74953 | |||
| 924 | QPGS01000004.1 | GCA003862255_01149 | gene | open | 75432-77366 | gyrB | ||
| 925 | QPGS01000004.1 | GCA003862255_01150 | gene | open | 77397-77858 | coaD | ||
| 926 | QPGS01000004.1 | GCA003862255_01151 | gene | open | 78893-79561 | |||
| 927 | QPGS01000004.1 | GCA003862255_01152 | gene | open | 80122-80577 | rplM | ||
| 928 | QPGS01000004.1 | GCA003862255_01153 | gene | open | 80587-80973 | rpsI | ||
| 929 | QPGS01000004.1 | GCA003862255_01154 | gene | open | 81108-81953 | rpsB | ||
| 930 | QPGS01000004.1 | GCA003862255_01155 | gene | open | 82092-82916 | tsf | ||
| 931 | QPGS01000004.1 | GCA003862255_01156 | gene | open | 83290-85326 | uvrB | ||
| 932 | QPGS01000004.1 | GCA003862255_01157 | gene | open | 85323-86843 | nhaP2 | ||
| 933 | QPGS01000004.1 | GCA003862255_01158 | gene | open | 87320-88639 | rseP | ||
| 934 | QPGS01000004.1 | GCA003862255_01159 | gene | open | 88649-91171 | rqcU | ||
| 935 | QPGS01000004.1 | GCA003862255_01160 | gene | open | 91326-91517 | rpsU | ||
| 936 | QPGS01000004.1 | GCA003862255_01161 | gene | open | 91594-92796 | hpf | ||
| 937 | QPGS01000004.1 | GCA003862255_01164 | gene | open | 93190-94377 | tuf | ||
| 938 | QPGS01000004.1 | GCA003862255_01166 | gene | open | 94536-94739 | secE | ||
| 939 | QPGS01000004.1 | GCA003862255_01167 | gene | open | 94761-95300 | nusG | ||
| 940 | QPGS01000004.1 | GCA003862255_01168 | gene | open | 95369-95806 | rplK | ||
| 941 | QPGS01000004.1 | GCA003862255_01169 | gene | open | 95827-96525 | rplA | ||
| 942 | QPGS01000004.1 | GCA003862255_01170 | gene | open | 96541-97065 | rplJ | ||
| 943 | QPGS01000004.1 | GCA003862255_01171 | gene | open | 97107-97484 | rplL | ||
| 944 | QPGS01000004.1 | GCA003862255_01172 | gene | open | 97596-101405 | rpoB | ||
| 945 | QPGS01000004.1 | GCA003862255_01173 | gene | open | 101471-105772 | rpoC | ||
| 946 | QPGS01000004.1 | GCA003862255_01174 | gene | open | 106060-106758 | crp | ||
| 947 | QPGS01000004.1 | GCA003862255_01162 | gene | open | 92936-93018 | trnY | ||
| 948 | QPGS01000004.1 | GCA003862255_01163 | gene | open | 93051-93122 | trnT | ||
| 949 | QPGS01000004.1 | GCA003862255_01165 | gene | open | 94448-94520 | trnW | ||
| 950 | QPGS01000004.1 | GCA003862255_01162 | tRNA | open | 92936-93018 | trnY | tRNA-Tyr(gta) | |
| 951 | QPGS01000004.1 | GCA003862255_01163 | tRNA | open | 93051-93122 | trnT | tRNA-Thr(ggt) | |
| 952 | QPGS01000004.1 | GCA003862255_01165 | tRNA | open | 94448-94520 | trnW | tRNA-Trp(cca) | |
| 953 | QPGS01000005.1 | regulatory_region | open | 74133-74391 | Cobalamin riboswitch aptamer | |||
| 954 | QPGS01000005.1 | GCA003862255_01387 | CDS | open | 261-1796 | _na 511_aa | dltB | Alginate O-acetyltransferase%2C putative |
| 955 | QPGS01000005.1 | GCA003862255_01388 | CDS | open | 1817-2644 | _na 275_aa | tesA | SGNH hydrolase-type esterase domain-containing protein |
| 956 | QPGS01000005.1 | GCA003862255_01389 | CDS | open | 2628-4019 | _na 463_aa | Lipase | |
| 957 | QPGS01000005.1 | GCA003862255_01390 | CDS | open | 4941-6821 | _na 626_aa | DUF349 domain-containing protein | |
| 958 | QPGS01000005.1 | GCA003862255_01391 | CDS | open | 7061-8014 | _na 317_aa | ldhA | Glycerate dehydrogenase |
| 959 | QPGS01000005.1 | GCA003862255_01392 | CDS | open | 8259-8432 | _na 57_aa | hypothetical protein | |
| 960 | QPGS01000005.1 | GCA003862255_01393 | CDS | open | 8928-10076 | _na 382_aa | bioF | 8-amino-7-oxononanoate synthase |
| 961 | QPGS01000005.1 | GCA003862255_01394 | CDS | open | 10076-10495 | _na 139_aa | Lipoprotein | |
| 962 | QPGS01000005.1 | GCA003862255_01395 | CDS | open | 10499-10924 | _na 141_aa | DUF304 domain-containing protein | |
| 963 | QPGS01000005.1 | GCA003862255_01396 | CDS | open | 11059-11580 | _na 173_aa | toxin-antitoxin system protein | |
| 964 | QPGS01000005.1 | GCA003862255_01397 | CDS | open | 11589-14795 | _na 1068_aa | KAP NTPase domain-containing protein | |
| 965 | QPGS01000005.1 | GCA003862255_01398 | CDS | open | 14854-15732 | _na 292_aa | fic | protein adenylyltransferase Fic |
| 966 | QPGS01000005.1 | GCA003862255_01399 | CDS | open | 15740-15946 | _na 68_aa | hipB | HTH cro/C1-type domain-containing protein |
| 967 | QPGS01000005.1 | GCA003862255_01400 | CDS | open | 16048-16332 | _na 94_aa | Transmembrane protein | |
| 968 | QPGS01000005.1 | GCA003862255_01401 | CDS | open | 16326-16709 | _na 127_aa | Transmembrane protein | |
| 969 | QPGS01000005.1 | GCA003862255_01402 | CDS | open | 16712-17632 | _na 306_aa | MobA/VirD2-like nuclease domain-containing protein | |
| 970 | QPGS01000005.1 | GCA003862255_01403 | CDS | open | 17629-18129 | _na 166_aa | nikA | Mobilization protein NikA |
| 971 | QPGS01000005.1 | GCA003862255_01404 | CDS | open | 18126-18965 | _na 279_aa | Zinc finger CHC2-type domain-containing protein | |
| 972 | QPGS01000005.1 | GCA003862255_01405 | CDS | open | 19234-20448 | _na 404_aa | Virulence-associated protein E-like domain-containing protein | |
| 973 | QPGS01000005.1 | GCA003862255_01406 | CDS | open | 20460-20816 | _na 118_aa | Helix-turn-helix domain-containing protein | |
| 974 | QPGS01000005.1 | GCA003862255_01407 | CDS | open | 20916-21662 | _na 248_aa | Mobilization protein | |
| 975 | QPGS01000005.1 | GCA003862255_01408 | CDS | open | 21677-22933 | _na 418_aa | fimB | Tyr recombinase domain-containing protein |
| 976 | QPGS01000005.1 | GCA003862255_01409 | CDS | open | 22947-23504 | _na 185_aa | Helix-turn-helix domain-containing protein | |
| 977 | QPGS01000005.1 | GCA003862255_01410 | CDS | open | 23712-25634 | _na 640_aa | dnaK | molecular chaperone DnaK |
| 978 | QPGS01000005.1 | GCA003862255_01411 | CDS | open | 26223-27770 | _na 515_aa | DUF4301 domain-containing protein | |
| 979 | QPGS01000005.1 | GCA003862255_01412 | CDS | open | 27819-29606 | _na 595_aa | pepP | Peptidase%2C M24 family |
| 980 | QPGS01000005.1 | GCA003862255_01413 | CDS | open | 29615-30154 | _na 179_aa | paaY | Putative acetyltransferase |
| 981 | QPGS01000005.1 | GCA003862255_01414 | CDS | open | 30167-31180 | _na 337_aa | tPR | TPR domain protein |
| 982 | QPGS01000005.1 | GCA003862255_01415 | CDS | open | 31208-31858 | _na 216_aa | rnh1 | Ribonuclease H |
| 983 | QPGS01000005.1 | GCA003862255_01416 | CDS | open | 31873-33045 | _na 390_aa | ATP-grasp domain-containing protein | |
| 984 | QPGS01000005.1 | GCA003862255_01417 | CDS | open | 33405-34217 | _na 270_aa | bamD | Outer membrane lipoprotein BamD-like domain-containing protein |
| 985 | QPGS01000005.1 | GCA003862255_01418 | CDS | open | 34359-34691 | _na 110_aa | RNA polymerase Rpb6 | |
| 986 | QPGS01000005.1 | GCA003862255_01419 | CDS | open | 34721-35179 | _na 152_aa | DUF4293 domain-containing protein | |
| 987 | QPGS01000005.1 | GCA003862255_01420 | CDS | open | 35213-35398 | _na 61_aa | hypothetical protein | |
| 988 | QPGS01000005.1 | GCA003862255_01421 | CDS | open | 35455-35766 | _na 103_aa | DUF3467 domain-containing protein | |
| 989 | QPGS01000005.1 | GCA003862255_01422 | CDS | open | 35770-36903 | _na 377_aa | pdxB | 4-phosphoerythronate dehydrogenase PdxB |
| 990 | QPGS01000005.1 | GCA003862255_01423 | CDS | open | 36913-37638 | _na 241_aa | yqjQ | Oxidoreductase%2C short chain dehydrogenase/reductase family |
| 991 | QPGS01000005.1 | GCA003862255_01424 | CDS | open | 38581-40146 | _na 521_aa | mltF | putative exported transglycosylase protein |
| 992 | QPGS01000005.1 | GCA003862255_01425 | CDS | open | 40172-42043 | _na 623_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 993 | QPGS01000005.1 | GCA003862255_01426 | CDS | open | 42090-42755 | _na 221_aa | ppiB | peptidylprolyl isomerase |
| 994 | QPGS01000005.1 | GCA003862255_01427 | CDS | open | 42861-43199 | _na 112_aa | hypothetical protein | |
| 995 | QPGS01000005.1 | GCA003862255_01428 | CDS | open | 43359-45467 | _na 702_aa | Peptidase M3A/M3B catalytic domain-containing protein | |
| 996 | QPGS01000005.1 | GCA003862255_01429 | CDS | open | 45672-46991 | _na 439_aa | gdhA | NADP-specific glutamate dehydrogenase |
| 997 | QPGS01000005.1 | GCA003862255_01430 | CDS | open | 47342-47443 | _na 33_aa | hypothetical protein | |
| 998 | QPGS01000005.1 | GCA003862255_01431 | CDS | open | 47698-48693 | _na 331_aa | wcaG | Epimerase/reductase%2C putative |
| 999 | QPGS01000005.1 | GCA003862255_01432 | CDS | open | 48713-48802 | _na 29_aa | hypothetical protein | |
| 1000 | QPGS01000005.1 | GCA003862255_01433 | CDS | open | 48971-49681 | _na 236_aa | rIC | Hemerythrin-like domain-containing protein |

