BAKTAGenome Explorer: Moraxella catarrhalis (GCA_003985315.1)
Select a Genome:
|
BAKTA Annotations for GCA_003985315.1
|
Search & Sort all 3653 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | RYES01000001.1 | GCA003985315_00064 | gene | open | 68530-68888 | ssrA | ||
| 2 | RYES01000001.1 | GCA003985315_00064 | tmRNA | open | 68530-68888 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | RYES01000001.1 | rep_origin | open | 408068-408665 | ||||
| 4 | RYES01000001.1 | GCA003985315_00001 | gene | open | 1-3124 | rrl | ||
| 5 | RYES01000001.1 | GCA003985315_00004 | gene | open | 3623-5152 | rrs | ||
| 6 | RYES01000001.1 | GCA003985315_00057 | gene | open | 62321-62404 | sRNA-Xcc1 | ||
| 7 | RYES01000001.1 | GCA003985315_00219 | gene | open | 228198-228311 | rrf | ||
| 8 | RYES01000001.1 | GCA003985315_00220 | gene | open | 228422-231579 | rrl | ||
| 9 | RYES01000001.1 | GCA003985315_00223 | gene | open | 232078-233607 | rrs | ||
| 10 | RYES01000001.1 | GCA003985315_00225 | gene | open | 234270-234608 | RNaseP_bact_a | ||
| 11 | RYES01000001.1 | GCA003985315_00359 | gene | open | 368500-368613 | rrf | ||
| 12 | RYES01000001.1 | GCA003985315_00360 | gene | open | 368724-371881 | rrl | ||
| 13 | RYES01000001.1 | GCA003985315_00363 | gene | open | 372380-373909 | rrs | ||
| 14 | RYES01000001.1 | GCA003985315_00385 | gene | open | 393551-393654 | V_AS9 | ||
| 15 | RYES01000001.1 | GCA003985315_00677 | gene | open | 722112-723641 | rrs | ||
| 16 | RYES01000001.1 | GCA003985315_00680 | gene | open | 724140-727297 | rrl | ||
| 17 | RYES01000001.1 | GCA003985315_00681 | gene | open | 727408-727521 | rrf | ||
| 18 | RYES01000001.1 | GCA003985315_00941 | gene | open | 1004835-1005025 | 6S | ||
| 19 | RYES01000001.1 | GCA003985315_00057 | ncRNA | open | 62321-62404 | sRNA-Xcc1 | ||
| 20 | RYES01000001.1 | GCA003985315_00225 | ncRNA | open | 234270-234608 | Bacterial RNase P class A | ||
| 21 | RYES01000001.1 | GCA003985315_00385 | ncRNA | open | 393551-393654 | Vibrio RNA AS9 | ||
| 22 | RYES01000001.1 | GCA003985315_00941 | ncRNA | open | 1004835-1005025 | 6S / SsrS RNA | ||
| 23 | RYES01000001.1 | GCA003985315_00001 | rRNA | open | 1-3124 | rrl | 23S ribosomal RNA | |
| 24 | RYES01000001.1 | GCA003985315_00004 | rRNA | open | 3623-5152 | rrs | 16S ribosomal RNA | |
| 25 | RYES01000001.1 | GCA003985315_00219 | rRNA | open | 228198-228311 | rrf | 5S ribosomal RNA | |
| 26 | RYES01000001.1 | GCA003985315_00220 | rRNA | open | 228422-231579 | rrl | 23S ribosomal RNA | |
| 27 | RYES01000001.1 | GCA003985315_00223 | rRNA | open | 232078-233607 | rrs | 16S ribosomal RNA | |
| 28 | RYES01000001.1 | GCA003985315_00359 | rRNA | open | 368500-368613 | rrf | 5S ribosomal RNA | |
| 29 | RYES01000001.1 | GCA003985315_00360 | rRNA | open | 368724-371881 | rrl | 23S ribosomal RNA | |
| 30 | RYES01000001.1 | GCA003985315_00363 | rRNA | open | 372380-373909 | rrs | 16S ribosomal RNA | |
| 31 | RYES01000001.1 | GCA003985315_00677 | rRNA | open | 722112-723641 | rrs | 16S ribosomal RNA | |
| 32 | RYES01000001.1 | GCA003985315_00680 | rRNA | open | 724140-727297 | rrl | 23S ribosomal RNA | |
| 33 | RYES01000001.1 | GCA003985315_00681 | rRNA | open | 727408-727521 | rrf | 5S ribosomal RNA | |
| 34 | RYES01000001.1 | repeat_region | open | 435462-435680 | CRISPR array with 4 repeats of length 29%2C consensus sequence TTTTCTAAGCGACCTGTGCGGTCGTGAAG and spacer length 31 | |||
| 35 | RYES01000001.1 | repeat_region | open | 436767-437526 | CRISPR array with 13 repeats of length 28%2C consensus sequence TTTCTAAGCGACCTGTGCGGTCGTGAAG and spacer length 32 | |||
| 36 | RYES01000001.1 | GCA003985315_00005 | CDS | open | 5795-5965 | _na 56_aa | hypothetical protein | |
| 37 | RYES01000001.1 | GCA003985315_00006 | CDS | open | 6021-6410 | _na 129_aa | polymorphic toxin-type HINT domain-containing protein | |
| 38 | RYES01000001.1 | GCA003985315_00007 | CDS | open | 7311-7610 | _na 99_aa | hypothetical protein | |
| 39 | RYES01000001.1 | GCA003985315_00008 | CDS | open | 7992-9911 | _na 639_aa | thrS | threonine--tRNA ligase |
| 40 | RYES01000001.1 | GCA003985315_00009 | CDS | open | 10023-11345 | _na 440_aa | ABC transmembrane type-1 domain-containing protein | |
| 41 | RYES01000001.1 | GCA003985315_00010 | CDS | open | 11495-11935 | _na 146_aa | infC | translation initiation factor IF-3 |
| 42 | RYES01000001.1 | GCA003985315_00011 | CDS | open | 12023-12556 | _na 177_aa | rimI | ribosomal protein S18-alanine N-acetyltransferase |
| 43 | RYES01000001.1 | GCA003985315_00012 | CDS | open | 12676-14988 | _na 770_aa | rnr | ribonuclease R |
| 44 | RYES01000001.1 | GCA003985315_00013 | CDS | open | 15122-15853 | _na 243_aa | hisA | 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase |
| 45 | RYES01000001.1 | GCA003985315_00014 | CDS | open | 16376-17728 | _na 450_aa | nqrA | Na(+)-translocating NADH-quinone reductase subunit A |
| 46 | RYES01000001.1 | GCA003985315_00015 | CDS | open | 17731-18963 | _na 410_aa | NADH:ubiquinone reductase (Na(+)-transporting) subunit B | |
| 47 | RYES01000001.1 | GCA003985315_00016 | CDS | open | 18947-19756 | _na 269_aa | nqrC | Na(+)-translocating NADH-quinone reductase subunit C |
| 48 | RYES01000001.1 | GCA003985315_00017 | CDS | open | 19759-20430 | _na 223_aa | nqrD | NADH:ubiquinone reductase (Na(+)-transporting) subunit D |
| 49 | RYES01000001.1 | GCA003985315_00018 | CDS | open | 20430-21038 | _na 202_aa | nqrE | NADH:ubiquinone reductase (Na(+)-transporting) subunit E |
| 50 | RYES01000001.1 | GCA003985315_00019 | CDS | open | 21058-22293 | _na 411_aa | nqrF | NADH:ubiquinone reductase (Na(+)-transporting) subunit F |
| 51 | RYES01000001.1 | GCA003985315_00020 | CDS | open | 22417-23937 | _na 506_aa | katE | Catalase |
| 52 | RYES01000001.1 | GCA003985315_00021 | CDS | open | 24260-25858 | _na 532_aa | abgT | Aminobenzoyl-glutamate transport protein |
| 53 | RYES01000001.1 | GCA003985315_00022 | CDS | open | 26032-26565 | _na 177_aa | rutF | 4-hydroxyphenylacetate 3-monooxygenase%2C reductase component |
| 54 | RYES01000001.1 | GCA003985315_00023 | CDS | open | 26694-27728 | _na 344_aa | metE | methionine synthase |
| 55 | RYES01000001.1 | GCA003985315_00024 | CDS | open | 27821-28798 | _na 325_aa | DUF1852 domain-containing protein | |
| 56 | RYES01000001.1 | GCA003985315_00025 | CDS | open | 29054-29542 | _na 162_aa | slpA | Peptidyl-prolyl cis-trans isomerase |
| 57 | RYES01000001.1 | GCA003985315_00026 | CDS | open | 29945-31723 | _na 592_aa | M61 glycyl aminopeptidase family protein | |
| 58 | RYES01000001.1 | GCA003985315_00027 | CDS | open | 31735-32487 | _na 250_aa | rsuA | Pseudouridine synthase |
| 59 | RYES01000001.1 | GCA003985315_00028 | CDS | open | 32749-34404 | _na 551_aa | ompA | OmpA-like domain-containing protein |
| 60 | RYES01000001.1 | GCA003985315_00029 | CDS | open | 34942-35547 | _na 201_aa | glpG | Rhomboid family protein |
| 61 | RYES01000001.1 | GCA003985315_00030 | CDS | open | 35636-36355 | _na 239_aa | 3-hydroxyisobutyryl-CoA hydrolase | |
| 62 | RYES01000001.1 | GCA003985315_00031 | CDS | open | 36408-36701 | _na 97_aa | enoyl-CoA hydratase/isomerase family protein | |
| 63 | RYES01000001.1 | GCA003985315_00032 | CDS | open | 36919-37692 | _na 257_aa | yaaA | peroxide stress protein YaaA |
| 64 | RYES01000001.1 | GCA003985315_00033 | CDS | open | 37825-37965 | _na 46_aa | ykgO | type B 50S ribosomal protein L36 |
| 65 | RYES01000001.1 | GCA003985315_00034 | CDS | open | 38236-39705 | _na 489_aa | pta | phosphate acetyltransferase |
| 66 | RYES01000001.1 | GCA003985315_00035 | CDS | open | 39793-40977 | _na 394_aa | ackA | Acetate kinase |
| 67 | RYES01000001.1 | GCA003985315_00036 | CDS | open | 41335-41481 | _na 48_aa | lptM | LPS translocon maturation chaperone LptM |
| 68 | RYES01000001.1 | GCA003985315_00037 | CDS | open | 41522-42829 | _na 435_aa | lysA | diaminopimelate decarboxylase |
| 69 | RYES01000001.1 | GCA003985315_00038 | CDS | open | 43094-43993 | _na 299_aa | dapF | diaminopimelate epimerase |
| 70 | RYES01000001.1 | GCA003985315_00039 | CDS | open | 43993-44985 | _na 330_aa | xerA | site-specific tyrosine recombinase/integron integrase |
| 71 | RYES01000001.1 | GCA003985315_00040 | CDS | open | 45284-46480 | _na 398_aa | ubiM | 5-demethoxyubiquinol-8 5-hydroxylase UbiM |
| 72 | RYES01000001.1 | GCA003985315_00041 | CDS | open | 46543-46989 | _na 148_aa | hypothetical protein | |
| 73 | RYES01000001.1 | GCA003985315_00042 | CDS | open | 47128-48171 | _na 347_aa | apbE | FAD:protein FMN transferase |
| 74 | RYES01000001.1 | GCA003985315_00043 | CDS | open | 48225-48740 | _na 171_aa | folA | Dihydrofolate reductase |
| 75 | RYES01000001.1 | GCA003985315_00044 | CDS | open | 48737-49579 | _na 280_aa | thyA | thymidylate synthase |
| 76 | RYES01000001.1 | GCA003985315_00045 | CDS | open | 49576-50454 | _na 292_aa | lgt | prolipoprotein diacylglyceryl transferase |
| 77 | RYES01000001.1 | GCA003985315_00046 | CDS | open | 50656-52293 | _na 545_aa | groL | chaperonin GroEL |
| 78 | RYES01000001.1 | GCA003985315_00047 | CDS | open | 52419-52709 | _na 96_aa | groES | Co-chaperonin GroES |
| 79 | RYES01000001.1 | GCA003985315_00048 | CDS | open | 52995-53723 | _na 242_aa | DUF3108 domain-containing protein | |
| 80 | RYES01000001.1 | GCA003985315_00049 | CDS | open | 53937-54368 | _na 143_aa | DUF2069 domain-containing protein | |
| 81 | RYES01000001.1 | GCA003985315_00050 | CDS | open | 54365-54970 | _na 201_aa | wrbA | NAD(P)H:quinone oxidoreductase |
| 82 | RYES01000001.1 | GCA003985315_00051 | CDS | open | 55262-56764 | _na 500_aa | brkB | UPF0761 membrane protein AO384_1700 |
| 83 | RYES01000001.1 | GCA003985315_00052 | CDS | open | 58603-60681 | _na 692_aa | DUF3987 domain-containing protein | |
| 84 | RYES01000001.1 | GCA003985315_00053 | CDS | open | 60746-61303 | _na 185_aa | dnaG | Zinc finger CHC2-type domain-containing protein |
| 85 | RYES01000001.1 | GCA003985315_00054 | CDS | open | 61355-61708 | _na 117_aa | hypothetical protein | |
| 86 | RYES01000001.1 | GCA003985315_00055 | CDS | open | 61825-62127 | _na 100_aa | hypothetical protein | |
| 87 | RYES01000001.1 | GCA003985315_00056 | CDS | open | 62129-62683 | _na 184_aa | hypothetical protein | |
| 88 | RYES01000001.1 | GCA003985315_00058 | CDS | open | 62835-63239 | _na 134_aa | Bro-N domain-containing protein | |
| 89 | RYES01000001.1 | GCA003985315_00059 | CDS | open | 63256-63576 | _na 106_aa | Helix-turn-helix domain-containing protein | |
| 90 | RYES01000001.1 | GCA003985315_00060 | CDS | open | 63573-63773 | _na 66_aa | Transcriptional regulator | |
| 91 | RYES01000001.1 | GCA003985315_00061 | CDS | open | 63924-64994 | _na 356_aa | hypothetical protein | |
| 92 | RYES01000001.1 | GCA003985315_00062 | CDS | open | 65114-66157 | _na 347_aa | Archaeal ATPase family protein | |
| 93 | RYES01000001.1 | GCA003985315_00063 | CDS | open | 67066-68301 | _na 411_aa | fimB | Integrase |
| 94 | RYES01000001.1 | GCA003985315_00065 | CDS | open | 69681-70496 | _na 271_aa | WG repeat-containing protein | |
| 95 | RYES01000001.1 | GCA003985315_00066 | CDS | open | 70708-73458 | _na 916_aa | glnD | [protein-PII] uridylyltransferase |
| 96 | RYES01000001.1 | GCA003985315_00067 | CDS | open | 73579-74367 | _na 262_aa | map | type I methionyl aminopeptidase |
| 97 | RYES01000001.1 | GCA003985315_00068 | CDS | open | 74578-74913 | _na 111_aa | Sulfide-quinone reductase | |
| 98 | RYES01000001.1 | GCA003985315_00069 | CDS | open | 75179-77329 | _na 716_aa | fadH | 2%2C4-dienoyl-CoA reductase NADPH |
| 99 | RYES01000001.1 | GCA003985315_00070 | CDS | open | 77430-78944 | _na 504_aa | yifB | YifB family Mg chelatase-like AAA ATPase |
| 100 | RYES01000001.1 | GCA003985315_00071 | CDS | open | 79030-81894 | _na 954_aa | rapA | RNA polymerase-associated protein RapA |
| 101 | RYES01000001.1 | GCA003985315_00072 | CDS | open | 82118-83074 | _na 318_aa | ldhA | D-3-phosphoglycerate dehydrogenase |
| 102 | RYES01000001.1 | GCA003985315_00074 | CDS | open | 83335-84381 | _na 348_aa | ispA | Polyprenyl synthetase family protein |
| 103 | RYES01000001.1 | GCA003985315_00075 | CDS | open | 84413-85645 | _na 410_aa | mutY | A/G-specific adenine glycosylase |
| 104 | RYES01000001.1 | GCA003985315_00076 | CDS | open | 85793-86791 | _na 332_aa | nUC1 | Endonuclease |
| 105 | RYES01000001.1 | GCA003985315_00077 | CDS | open | 86820-87068 | _na 82_aa | hypothetical protein | |
| 106 | RYES01000001.1 | GCA003985315_00078 | CDS | open | 87284-87649 | _na 121_aa | DUF2147 domain-containing protein | |
| 107 | RYES01000001.1 | GCA003985315_00079 | CDS | open | 87763-88101 | _na 112_aa | glnK | P-II family nitrogen regulator |
| 108 | RYES01000001.1 | GCA003985315_00080 | CDS | open | 88300-89718 | _na 472_aa | murD | UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase |
| 109 | RYES01000001.1 | GCA003985315_00081 | CDS | open | 89891-91066 | _na 391_aa | ftsW | putative peptidoglycan glycosyltransferase FtsW |
| 110 | RYES01000001.1 | GCA003985315_00082 | CDS | open | 91242-92636 | _na 464_aa | norM | Multidrug-efflux transporter |
| 111 | RYES01000001.1 | GCA003985315_00083 | CDS | open | 92668-93249 | _na 193_aa | fxsA | FxsA protein |
| 112 | RYES01000001.1 | GCA003985315_00084 | CDS | open | 93405-93995 | _na 196_aa | ruvC | crossover junction endodeoxyribonuclease RuvC |
| 113 | RYES01000001.1 | GCA003985315_00085 | CDS | open | 94126-94338 | _na 70_aa | cspD | Cold shock domain protein CspD |
| 114 | RYES01000001.1 | GCA003985315_00086 | CDS | open | 94687-95097 | _na 136_aa | Integral membrane protein | |
| 115 | RYES01000001.1 | GCA003985315_00087 | CDS | open | 95206-96228 | _na 340_aa | ilvC | ketol-acid reductoisomerase |
| 116 | RYES01000001.1 | GCA003985315_00088 | CDS | open | 96392-96907 | _na 171_aa | ilvN | acetolactate synthase small subunit |
| 117 | RYES01000001.1 | GCA003985315_00089 | CDS | open | 96907-98742 | _na 611_aa | ilvB | acetolactate synthase 3 large subunit |
| 118 | RYES01000001.1 | GCA003985315_00090 | CDS | open | 99135-99617 | _na 160_aa | hypothetical protein | |
| 119 | RYES01000001.1 | GCA003985315_00091 | CDS | open | 99921-100418 | _na 165_aa | lysM | peptidoglycan-binding protein LysM |
| 120 | RYES01000001.1 | GCA003985315_00092 | CDS | open | 100633-100869 | _na 78_aa | acpP | acyl carrier protein |
| 121 | RYES01000001.1 | GCA003985315_00093 | CDS | open | 101060-101788 | _na 242_aa | fabG | 3-oxoacyl-ACP reductase FabG |
| 122 | RYES01000001.1 | GCA003985315_00094 | CDS | open | 101785-102744 | _na 319_aa | fabD | ACP S-malonyltransferase |
| 123 | RYES01000001.1 | GCA003985315_00095 | CDS | open | 103014-103196 | _na 60_aa | rpmF | 50S ribosomal protein L32 |
| 124 | RYES01000001.1 | GCA003985315_00096 | CDS | open | 103434-103976 | _na 180_aa | yceD | Large ribosomal RNA subunit accumulation protein YceD |
| 125 | RYES01000001.1 | GCA003985315_00097 | CDS | open | 104142-104900 | _na 252_aa | epmC | ATPase |
| 126 | RYES01000001.1 | GCA003985315_00098 | CDS | open | 104905-105471 | _na 188_aa | tsaC | Telomere recombination family protein |
| 127 | RYES01000001.1 | GCA003985315_00099 | CDS | open | 105558-105917 | _na 119_aa | rplQ | 50S ribosomal protein L17 |
| 128 | RYES01000001.1 | GCA003985315_00100 | CDS | open | 105936-106940 | _na 334_aa | rpoA | DNA-directed RNA polymerase subunit alpha |
| 129 | RYES01000001.1 | GCA003985315_00101 | CDS | open | 106965-107606 | _na 213_aa | rpsD | 30S ribosomal protein S4 |
| 130 | RYES01000001.1 | GCA003985315_00102 | CDS | open | 107619-108011 | _na 130_aa | rpsK | 30S ribosomal protein S11 |
| 131 | RYES01000001.1 | GCA003985315_00103 | CDS | open | 108032-108388 | _na 118_aa | rpsM | 30S ribosomal protein S13 |
| 132 | RYES01000001.1 | GCA003985315_00104 | CDS | open | 108641-109966 | _na 441_aa | secY | preprotein translocase subunit SecY |
| 133 | RYES01000001.1 | GCA003985315_00105 | CDS | open | 109970-110410 | _na 146_aa | rplO | 50S ribosomal protein L15 |
| 134 | RYES01000001.1 | GCA003985315_00106 | CDS | open | 110410-110589 | _na 59_aa | rpmD | 50S ribosomal protein L30 |
| 135 | RYES01000001.1 | GCA003985315_00107 | CDS | open | 110607-111104 | _na 165_aa | rpsE | 30S ribosomal protein S5 |
| 136 | RYES01000001.1 | GCA003985315_00108 | CDS | open | 111107-111457 | _na 116_aa | rplR | 50S ribosomal protein L18 |
| 137 | RYES01000001.1 | GCA003985315_00109 | CDS | open | 111469-112002 | _na 177_aa | rplF | 50S ribosomal protein L6 |
| 138 | RYES01000001.1 | GCA003985315_00110 | CDS | open | 112153-112551 | _na 132_aa | rpsH | 30S ribosomal protein S8 |
| 139 | RYES01000001.1 | GCA003985315_00111 | CDS | open | 112566-112871 | _na 101_aa | rpsN | 30S ribosomal protein S14 |
| 140 | RYES01000001.1 | GCA003985315_00112 | CDS | open | 112883-113419 | _na 178_aa | rplE | 50S ribosomal protein L5 |
| 141 | RYES01000001.1 | GCA003985315_00113 | CDS | open | 113440-113757 | _na 105_aa | rplX | 50S ribosomal protein L24 |
| 142 | RYES01000001.1 | GCA003985315_00114 | CDS | open | 113775-114143 | _na 122_aa | rplN | 50S ribosomal protein L14 |
| 143 | RYES01000001.1 | GCA003985315_00115 | CDS | open | 114252-114524 | _na 90_aa | rpsQ | 30S ribosomal protein S17 |
| 144 | RYES01000001.1 | GCA003985315_00116 | CDS | open | 114521-114718 | _na 65_aa | rpmC | 50S ribosomal protein L29 |
| 145 | RYES01000001.1 | GCA003985315_00117 | CDS | open | 114718-115131 | _na 137_aa | rplP | 50S ribosomal protein L16 |
| 146 | RYES01000001.1 | GCA003985315_00118 | CDS | open | 115135-115857 | _na 240_aa | rpsC | 30S ribosomal protein S3 |
| 147 | RYES01000001.1 | GCA003985315_00119 | CDS | open | 115860-116189 | _na 109_aa | rplV | 50S ribosomal protein L22 |
| 148 | RYES01000001.1 | GCA003985315_00120 | CDS | open | 116199-116474 | _na 91_aa | rpsS | 30S ribosomal protein S19 |
| 149 | RYES01000001.1 | GCA003985315_00121 | CDS | open | 116487-117314 | _na 275_aa | rplB | 50S ribosomal protein L2 |
| 150 | RYES01000001.1 | GCA003985315_00122 | CDS | open | 117325-117654 | _na 109_aa | rplW | 50S ribosomal protein L23 |
| 151 | RYES01000001.1 | GCA003985315_00123 | CDS | open | 117651-118253 | _na 200_aa | rplD | 50S ribosomal protein L4 |
| 152 | RYES01000001.1 | GCA003985315_00124 | CDS | open | 118268-118906 | _na 212_aa | rplC | 50S ribosomal protein L3 |
| 153 | RYES01000001.1 | GCA003985315_00125 | CDS | open | 118959-119270 | _na 103_aa | rpsJ | 30S ribosomal protein S10 |
| 154 | RYES01000001.1 | GCA003985315_00126 | CDS | open | 119671-121299 | _na 542_aa | rng | ribonuclease G |
| 155 | RYES01000001.1 | GCA003985315_00127 | CDS | open | 121488-122099 | _na 203_aa | maf | dTTP/UTP pyrophosphatase |
| 156 | RYES01000001.1 | GCA003985315_00128 | CDS | open | 122416-122703 | _na 95_aa | gatC | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC |
| 157 | RYES01000001.1 | GCA003985315_00129 | CDS | open | 122797-124275 | _na 492_aa | gatA | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA |
| 158 | RYES01000001.1 | GCA003985315_00130 | CDS | open | 124351-125292 | _na 313_aa | blaBRO-1 | class A beta-lactamase BRO-1 |
| 159 | RYES01000001.1 | GCA003985315_00131 | CDS | open | 125326-126798 | _na 490_aa | gatB | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB |
| 160 | RYES01000001.1 | GCA003985315_00133 | CDS | open | 127360-127884 | _na 174_aa | cytC5 | Cytochrome c5 |
| 161 | RYES01000001.1 | GCA003985315_00134 | CDS | open | 128513-129187 | _na 224_aa | ompA | OmpA-like domain-containing protein |
| 162 | RYES01000001.1 | GCA003985315_00135 | CDS | open | 129543-130499 | _na 318_aa | plsC | Acyltransferase family protein |
| 163 | RYES01000001.1 | GCA003985315_00136 | CDS | open | 130408-130641 | _na 77_aa | hypothetical protein | |
| 164 | RYES01000001.1 | GCA003985315_00137 | CDS | open | 130681-131724 | _na 347_aa | secA | Preprotein translocase subunit SecA |
| 165 | RYES01000001.1 | GCA003985315_00138 | CDS | open | 131883-132665 | _na 260_aa | minC | septum site-determining protein MinC |
| 166 | RYES01000001.1 | GCA003985315_00139 | CDS | open | 132820-133635 | _na 271_aa | minD | septum site-determining protein MinD |
| 167 | RYES01000001.1 | GCA003985315_00140 | CDS | open | 133638-133913 | _na 91_aa | minE | cell division topological specificity factor MinE |
| 168 | RYES01000001.1 | GCA003985315_00141 | CDS | open | 134076-134291 | _na 71_aa | rpsU | 30S ribosomal protein S21 |
| 169 | RYES01000001.1 | GCA003985315_00142 | CDS | open | 134690-136186 | _na 498_aa | putP | sodium/proline symporter PutP |
| 170 | RYES01000001.1 | GCA003985315_00143 | CDS | open | 136661-137332 | _na 223_aa | rplY | 50S ribosomal protein L25/general stress protein Ctc |
| 171 | RYES01000001.1 | GCA003985315_00144 | CDS | open | 137409-137981 | _na 190_aa | pth | aminoacyl-tRNA hydrolase |
| 172 | RYES01000001.1 | GCA003985315_00145 | CDS | open | 138168-139577 | _na 469_aa | hemN | oxygen-independent coproporphyrinogen III oxidase |
| 173 | RYES01000001.1 | GCA003985315_00146 | CDS | open | 139598-140275 | _na 225_aa | RDD domain-containing protein | |
| 174 | RYES01000001.1 | GCA003985315_00149 | CDS | open | 140864-141661 | _na 265_aa | thiD | hydroxymethylpyrimidine kinase |
| 175 | RYES01000001.1 | GCA003985315_00150 | CDS | open | 141723-142286 | _na 187_aa | yggT | YggT family protein |
| 176 | RYES01000001.1 | GCA003985315_00151 | CDS | open | 142322-143167 | _na 281_aa | proC | pyrroline-5-carboxylate reductase |
| 177 | RYES01000001.1 | GCA003985315_00152 | CDS | open | 143294-144649 | _na 451_aa | ttcA | tRNA(Ile)-lysidine synthase |
| 178 | RYES01000001.1 | GCA003985315_00153 | CDS | open | 144744-145541 | _na 265_aa | accA | acetyl-CoA carboxylase carboxyltransferase subunit alpha |
| 179 | RYES01000001.1 | GCA003985315_00154 | CDS | open | 145675-147225 | _na 516_aa | ppx | exopolyphosphatase |
| 180 | RYES01000001.1 | GCA003985315_00155 | CDS | open | 147334-148482 | _na 382_aa | rluA | Pseudouridine synthase |
| 181 | RYES01000001.1 | GCA003985315_00156 | CDS | open | 149251-152487 | _na 1078_aa | cafA | Ribonuclease E |
| 182 | RYES01000001.1 | GCA003985315_00157 | CDS | open | 152441-152746 | _na 101_aa | hypothetical protein | |
| 183 | RYES01000001.1 | GCA003985315_00158 | CDS | open | 153064-155226 | _na 720_aa | aceB | malate synthase G |
| 184 | RYES01000001.1 | GCA003985315_00159 | CDS | open | 155384-156982 | _na 532_aa | aceA | isocitrate lyase |
| 185 | RYES01000001.1 | GCA003985315_00160 | CDS | open | 157393-157875 | _na 160_aa | ubiC | Chorismate lyase |
| 186 | RYES01000001.1 | GCA003985315_00161 | CDS | open | 158011-159273 | _na 420_aa | glyA | Serine hydroxymethyltransferase |
| 187 | RYES01000001.1 | GCA003985315_00162 | CDS | open | 159360-160127 | _na 255_aa | aat | leucyl/phenylalanyl-tRNA--protein transferase |
| 188 | RYES01000001.1 | GCA003985315_00164 | CDS | open | 160372-162450 | _na 692_aa | glyS | Glycine--tRNA ligase beta subunit |
| 189 | RYES01000001.1 | GCA003985315_00165 | CDS | open | 162654-163610 | _na 318_aa | glyQ | glycine--tRNA ligase subunit alpha |
| 190 | RYES01000001.1 | GCA003985315_00166 | CDS | open | 163799-164044 | _na 81_aa | pspC | Stress-responsive transcriptional regulator |
| 191 | RYES01000001.1 | GCA003985315_00167 | CDS | open | 164369-165424 | _na 351_aa | nadR | multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR |
| 192 | RYES01000001.1 | GCA003985315_00168 | CDS | open | 165439-166200 | _na 253_aa | pnuC | nicotinamide riboside transporter PnuC |
| 193 | RYES01000001.1 | GCA003985315_00169 | CDS | open | 166425-167084 | _na 219_aa | pgsA | CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase |
| 194 | RYES01000001.1 | GCA003985315_00170 | CDS | open | 167242-168462 | _na 406_aa | yhiN | BaiN-like insert domain-containing protein |
| 195 | RYES01000001.1 | GCA003985315_00171 | CDS | open | 168575-171544 | _na 989_aa | cym1 | Peptidase M16 |
| 196 | RYES01000001.1 | GCA003985315_00172 | CDS | open | 171817-172266 | _na 149_aa | Universal stress protein | |
| 197 | RYES01000001.1 | GCA003985315_00173 | CDS | open | 172388-173407 | _na 339_aa | rbsK | PfkB carbohydrate kinase family protein |
| 198 | RYES01000001.1 | GCA003985315_00174 | CDS | open | 173527-174138 | _na 203_aa | nfuA | Fe-S biogenesis protein NfuA |
| 199 | RYES01000001.1 | GCA003985315_00175 | CDS | open | 174379-175407 | _na 342_aa | nadR | bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase |
| 200 | RYES01000001.1 | GCA003985315_00176 | CDS | open | 175511-176854 | _na 447_aa | lpd | Putative Dihydrolipoamide dehydrogenase |
| 201 | RYES01000001.1 | GCA003985315_00177 | CDS | open | 177354-178148 | _na 264_aa | fabG | diacetyl reductase [(S)-acetoin forming] |
| 202 | RYES01000001.1 | GCA003985315_00178 | CDS | open | 178255-178350 | _na 31_aa | hypothetical protein | |
| 203 | RYES01000001.1 | GCA003985315_00179 | CDS | open | 178319-178879 | _na 186_aa | DUF302 domain-containing protein | |
| 204 | RYES01000001.1 | GCA003985315_00180 | CDS | open | 178944-179321 | _na 125_aa | Sulfurtransferase | |
| 205 | RYES01000001.1 | GCA003985315_00181 | CDS | open | 179440-180471 | _na 343_aa | Selenocysteine synthase | |
| 206 | RYES01000001.1 | GCA003985315_00182 | CDS | open | 180508-181158 | _na 216_aa | leuE | leucine efflux protein LeuE |
| 207 | RYES01000001.1 | GCA003985315_00183 | CDS | open | 181328-182137 | _na 269_aa | fkpA | Peptidyl-prolyl cis-trans isomerase |
| 208 | RYES01000001.1 | GCA003985315_00184 | CDS | open | 182553-184214 | _na 553_aa | ettA | energy-dependent translational throttle protein EttA |
| 209 | RYES01000001.1 | GCA003985315_00185 | CDS | open | 184602-184922 | _na 106_aa | Lipoprotein | |
| 210 | RYES01000001.1 | GCA003985315_00186 | CDS | open | 184996-185256 | _na 86_aa | yidJ | N-acetyltransferase domain-containing protein |
| 211 | RYES01000001.1 | GCA003985315_00187 | CDS | open | 185585-186058 | _na 157_aa | DUF2946 domain-containing protein | |
| 212 | RYES01000001.1 | GCA003985315_00188 | CDS | open | 186164-187693 | _na 509_aa | piuB | Peptidase |
| 213 | RYES01000001.1 | GCA003985315_00189 | CDS | open | 187823-188674 | _na 283_aa | mcrA | HNH nuclease domain-containing protein |
| 214 | RYES01000001.1 | GCA003985315_00190 | CDS | open | 188661-189275 | _na 204_aa | ompA | OmpA-like domain-containing protein |
| 215 | RYES01000001.1 | GCA003985315_00191 | CDS | open | 189374-190771 | _na 465_aa | smc | Putative membrane protein |
| 216 | RYES01000001.1 | GCA003985315_00192 | CDS | open | 190814-192670 | _na 618_aa | DUF4407 domain-containing protein | |
| 217 | RYES01000001.1 | GCA003985315_00193 | CDS | open | 193266-193550 | _na 94_aa | phhB | 4a-hydroxytetrahydrobiopterin dehydratase |
| 218 | RYES01000001.1 | GCA003985315_00194 | CDS | open | 193684-195921 | _na 745_aa | parC | DNA topoisomerase IV subunit A |
| 219 | RYES01000001.1 | GCA003985315_00195 | CDS | open | 196030-196836 | _na 268_aa | ubiE | Ribosomal RNA large subunit methyltransferase A |
| 220 | RYES01000001.1 | GCA003985315_00196 | CDS | open | 196934-197818 | _na 294_aa | rhaT | EamA domain-containing protein |
| 221 | RYES01000001.1 | GCA003985315_00197 | CDS | open | 197836-199422 | _na 528_aa | prfC | peptide chain release factor 3 |
| 222 | RYES01000001.1 | GCA003985315_00198 | CDS | open | 199707-200015 | _na 102_aa | Lipoprotein | |
| 223 | RYES01000001.1 | GCA003985315_00199 | CDS | open | 200120-202999 | _na 959_aa | polA | DNA polymerase I |
| 224 | RYES01000001.1 | GCA003985315_00200 | CDS | open | 203334-205961 | _na 875_aa | topA | type I DNA topoisomerase |
| 225 | RYES01000001.1 | GCA003985315_00201 | CDS | open | 206118-206714 | _na 198_aa | DUF302 domain-containing protein | |
| 226 | RYES01000001.1 | GCA003985315_00202 | CDS | open | 206724-209324 | _na 866_aa | ftsK | DNA translocase FtsK |
| 227 | RYES01000001.1 | GCA003985315_00203 | CDS | open | 209704-210477 | _na 257_aa | hisP | Histidine transport ATP-binding protein HisP |
| 228 | RYES01000001.1 | GCA003985315_00204 | CDS | open | 210517-211305 | _na 262_aa | hisJ | Extracellular solute-binding protein family 3 |
| 229 | RYES01000001.1 | GCA003985315_00205 | CDS | open | 211383-212180 | _na 265_aa | hisJ | ABC transporter substrate-binding protein |
| 230 | RYES01000001.1 | GCA003985315_00206 | CDS | open | 212262-213059 | _na 265_aa | hisJ | ABC transporter substrate-binding protein |
| 231 | RYES01000001.1 | GCA003985315_00207 | CDS | open | 213248-213970 | _na 240_aa | artQ | Arginine ABC transporter%2C permease protein ArtQ |
| 232 | RYES01000001.1 | GCA003985315_00208 | CDS | open | 213967-214692 | _na 241_aa | artM | Arginine ABC transporter permease protein ArtM |
| 233 | RYES01000001.1 | GCA003985315_00209 | CDS | open | 214707-216068 | _na 453_aa | glmU | bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU |
| 234 | RYES01000001.1 | GCA003985315_00210 | CDS | open | 216291-218135 | _na 614_aa | typA | translational GTPase TypA |
| 235 | RYES01000001.1 | GCA003985315_00211 | CDS | open | 218391-219752 | _na 453_aa | ompA | OmpA-like domain-containing protein |
| 236 | RYES01000001.1 | GCA003985315_00212 | CDS | open | 220004-220753 | _na 249_aa | pdxJ | pyridoxine 5'-phosphate synthase |
| 237 | RYES01000001.1 | GCA003985315_00213 | CDS | open | 220779-221588 | _na 269_aa | recO | DNA recombination protein RecO |
| 238 | RYES01000001.1 | GCA003985315_00214 | CDS | open | 221612-222607 | _na 331_aa | era | GTPase Era |
| 239 | RYES01000001.1 | GCA003985315_00215 | CDS | open | 222653-223441 | _na 262_aa | rnc | ribonuclease III |
| 240 | RYES01000001.1 | GCA003985315_00216 | CDS | open | 223456-224550 | _na 364_aa | lepB | signal peptidase I |
| 241 | RYES01000001.1 | GCA003985315_00217 | CDS | open | 224608-226422 | _na 604_aa | lepA | translation elongation factor 4 |
| 242 | RYES01000001.1 | GCA003985315_00218 | CDS | open | 226887-227303 | _na 138_aa | queH | Epoxyqueuosine reductase QueH |
| 243 | RYES01000001.1 | GCA003985315_00226 | CDS | open | 234628-234879 | _na 83_aa | nuoI | YfhL family 4Fe-4S dicluster ferredoxin |
| 244 | RYES01000001.1 | GCA003985315_00227 | CDS | open | 234888-235382 | _na 164_aa | coaD | pantetheine-phosphate adenylyltransferase |
| 245 | RYES01000001.1 | GCA003985315_00228 | CDS | open | 235543-236325 | _na 260_aa | nfsA | oxygen-insensitive NADPH nitroreductase |
| 246 | RYES01000001.1 | GCA003985315_00229 | CDS | open | 236606-237070 | _na 154_aa | smpB | SsrA-binding protein SmpB |
| 247 | RYES01000001.1 | GCA003985315_00230 | CDS | open | 237138-237755 | _na 205_aa | Lipoprotein | |
| 248 | RYES01000001.1 | GCA003985315_00231 | CDS | open | 237791-238675 | _na 294_aa | rhaT | EamA domain-containing protein |
| 249 | RYES01000001.1 | GCA003985315_00232 | CDS | open | 238678-240753 | _na 691_aa | ligA | NAD-dependent DNA ligase LigA |
| 250 | RYES01000001.1 | GCA003985315_00233 | CDS | open | 241018-242040 | _na 340_aa | pfoR | Putative nicotinate-regulated transporter |
| 251 | RYES01000001.1 | GCA003985315_00234 | CDS | open | 242220-242867 | _na 215_aa | upp | uracil phosphoribosyltransferase |
| 252 | RYES01000001.1 | GCA003985315_00235 | CDS | open | 242982-243974 | _na 330_aa | ssuD | Luciferase oxidoreductase%2C group 1 family protein |
| 253 | RYES01000001.1 | GCA003985315_00236 | CDS | open | 244541-245242 | _na 233_aa | serB | Hydrolase |
| 254 | RYES01000001.1 | GCA003985315_00237 | CDS | open | 245316-246311 | _na 331_aa | potA | ABC transporter ATP-binding protein |
| 255 | RYES01000001.1 | GCA003985315_00238 | CDS | open | 246308-247153 | _na 281_aa | potC | ABC transporter permease |
| 256 | RYES01000001.1 | GCA003985315_00239 | CDS | open | 247169-248086 | _na 305_aa | Polyamine ABC transporter permease | |
| 257 | RYES01000001.1 | GCA003985315_00240 | CDS | open | 248083-248898 | _na 271_aa | ataC | Nucleotide pyrophosphatase |
| 258 | RYES01000001.1 | GCA003985315_00241 | CDS | open | 248968-250074 | _na 368_aa | afuA | ABC transporter substrate-binding protein |
| 259 | RYES01000001.1 | GCA003985315_00243 | CDS | open | 250927-252417 | _na 496_aa | gppA | Exopolyphosphatase |
| 260 | RYES01000001.1 | GCA003985315_00244 | CDS | open | 252430-253479 | _na 349_aa | phoR | phosphate regulon sensor histidine kinase PhoR |
| 261 | RYES01000001.1 | GCA003985315_00245 | CDS | open | 253476-254168 | _na 230_aa | phoB | phosphate regulon transcriptional regulator PhoB |
| 262 | RYES01000001.1 | GCA003985315_00246 | CDS | open | 254399-255238 | _na 279_aa | pstB | phosphate ABC transporter ATP-binding protein PstB |
| 263 | RYES01000001.1 | GCA003985315_00247 | CDS | open | 255307-256179 | _na 290_aa | pstA | phosphate ABC transporter permease PstA |
| 264 | RYES01000001.1 | GCA003985315_00248 | CDS | open | 256190-257152 | _na 320_aa | pstC | phosphate ABC transporter permease subunit PstC |
| 265 | RYES01000001.1 | GCA003985315_00249 | CDS | open | 257260-258399 | _na 379_aa | pstS | phosphate ABC transporter substrate-binding protein PstS |
| 266 | RYES01000001.1 | GCA003985315_00250 | CDS | open | 258748-259575 | _na 275_aa | bepA | Peptidase M48 |
| 267 | RYES01000001.1 | GCA003985315_00251 | CDS | open | 259608-259928 | _na 106_aa | bolA | BolA-like family protein |
| 268 | RYES01000001.1 | GCA003985315_00252 | CDS | open | 260092-261801 | _na 569_aa | sUL1 | Sulfate transporter family protein |
| 269 | RYES01000001.1 | GCA003985315_00253 | CDS | open | 261940-262266 | _na 108_aa | Beta-lactamase hydrolase-like protein phosphatase-like domain-containing protein | |
| 270 | RYES01000001.1 | GCA003985315_00254 | CDS | open | 262315-263043 | _na 242_aa | rluA | Dual-specificity RNA pseudouridine synthase RluA |
| 271 | RYES01000001.1 | GCA003985315_00255 | CDS | open | 263241-263561 | _na 106_aa | trxA | thioredoxin |
| 272 | RYES01000001.1 | GCA003985315_00256 | CDS | open | 263795-265063 | _na 422_aa | rho | transcription termination factor Rho |
| 273 | RYES01000001.1 | GCA003985315_00257 | CDS | open | 265430-265780 | _na 116_aa | Entericidin | |
| 274 | RYES01000001.1 | GCA003985315_00258 | CDS | open | 265950-266363 | _na 137_aa | osmC | Osmotically inducible protein OsmC |
| 275 | RYES01000001.1 | GCA003985315_00259 | CDS | open | 266540-268066 | _na 508_aa | ttdA | Fumarate hydratase class I |
| 276 | RYES01000001.1 | GCA003985315_00260 | CDS | open | 268255-269352 | _na 365_aa | hisC | histidinol-phosphate transaminase |
| 277 | RYES01000001.1 | GCA003985315_00261 | CDS | open | 269441-270748 | _na 435_aa | hisD | Histidinol dehydrogenase |
| 278 | RYES01000001.1 | GCA003985315_00262 | CDS | open | 270947-271603 | _na 218_aa | hisG | ATP phosphoribosyltransferase |
| 279 | RYES01000001.1 | GCA003985315_00263 | CDS | open | 271682-272944 | _na 420_aa | murA | UDP-N-acetylglucosamine 1-carboxyvinyltransferase |
| 280 | RYES01000001.1 | GCA003985315_00264 | CDS | open | 272960-273220 | _na 86_aa | ibaG | BolA family transcriptional regulator |
| 281 | RYES01000001.1 | GCA003985315_00265 | CDS | open | 273336-274097 | _na 253_aa | osmY | Phospholipid-binding protein |
| 282 | RYES01000001.1 | GCA003985315_00266 | CDS | open | 274182-274595 | _na 137_aa | yraN | YraN family protein |
| 283 | RYES01000001.1 | GCA003985315_00267 | CDS | open | 274595-275089 | _na 164_aa | yckC | RDD domain-containing protein |
| 284 | RYES01000001.1 | GCA003985315_00268 | CDS | open | 275264-275746 | _na 160_aa | rlmH | 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH |
| 285 | RYES01000001.1 | GCA003985315_00269 | CDS | open | 275876-277963 | _na 695_aa | pnp | polyribonucleotide nucleotidyltransferase |
| 286 | RYES01000001.1 | GCA003985315_00270 | CDS | open | 278058-278267 | _na 69_aa | hypothetical protein | |
| 287 | RYES01000001.1 | GCA003985315_00271 | CDS | open | 278176-278442 | _na 88_aa | rpsO | 30S ribosomal protein S15 |
| 288 | RYES01000001.1 | GCA003985315_00272 | CDS | open | 278655-279302 | _na 215_aa | lomR | Porin opacity type domain-containing protein |
| 289 | RYES01000001.1 | GCA003985315_00273 | CDS | open | 279436-280371 | _na 311_aa | truB | tRNA pseudouridine(55) synthase TruB |
| 290 | RYES01000001.1 | GCA003985315_00274 | CDS | open | 280368-280793 | _na 141_aa | rbfA | ribosome-binding factor A |
| 291 | RYES01000001.1 | GCA003985315_00275 | CDS | open | 281369-282217 | _na 282_aa | ysnF | DUF2382 domain-containing protein |
| 292 | RYES01000001.1 | GCA003985315_00276 | CDS | open | 282397-282903 | _na 168_aa | ysnF | DUF2382 domain-containing protein |
| 293 | RYES01000001.1 | GCA003985315_00277 | CDS | open | 283144-285882 | _na 912_aa | infB | translation initiation factor IF-2 |
| 294 | RYES01000001.1 | GCA003985315_00278 | CDS | open | 286038-287519 | _na 493_aa | nusA | Transcription termination/antitermination protein NusA |
| 295 | RYES01000001.1 | GCA003985315_00279 | CDS | open | 287619-288116 | _na 165_aa | rimP | ribosome maturation factor RimP |
| 296 | RYES01000001.1 | GCA003985315_00282 | CDS | open | 288754-289056 | _na 100_aa | secG | preprotein translocase subunit SecG |
| 297 | RYES01000001.1 | GCA003985315_00283 | CDS | open | 289095-289847 | _na 250_aa | tpiA | triose-phosphate isomerase |
| 298 | RYES01000001.1 | GCA003985315_00284 | CDS | open | 290041-291138 | _na 365_aa | mraY | phospho-N-acetylmuramoyl-pentapeptide-transferase |
| 299 | RYES01000001.1 | GCA003985315_00285 | CDS | open | 291156-292640 | _na 494_aa | murF | UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase |
| 300 | RYES01000001.1 | GCA003985315_00286 | CDS | open | 292662-294221 | _na 519_aa | murE | UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase |
| 301 | RYES01000001.1 | GCA003985315_00287 | CDS | open | 294260-296218 | _na 652_aa | ftsI | Septum formation%2C penicillin binding protein 3%2C peptidoglycan synthetase |
| 302 | RYES01000001.1 | GCA003985315_00288 | CDS | open | 296222-296572 | _na 116_aa | ftsL | Cell division protein FtsL |
| 303 | RYES01000001.1 | GCA003985315_00289 | CDS | open | 296603-297595 | _na 330_aa | rsmH | 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH |
| 304 | RYES01000001.1 | GCA003985315_00290 | CDS | open | 297883-299379 | _na 498_aa | gltX | glutamate--tRNA ligase |
| 305 | RYES01000001.1 | GCA003985315_00293 | CDS | open | 299921-300595 | _na 224_aa | Hydrolase | |
| 306 | RYES01000001.1 | GCA003985315_00294 | CDS | open | 300685-301581 | _na 298_aa | Transmembrane protein | |
| 307 | RYES01000001.1 | GCA003985315_00295 | CDS | open | 301578-302462 | _na 294_aa | yafJ | Putative glutamine amidotransferase%2C class-II protein |
| 308 | RYES01000001.1 | GCA003985315_00296 | CDS | open | 302465-303466 | _na 333_aa | srkA | homoserine kinase |
| 309 | RYES01000001.1 | GCA003985315_00297 | CDS | open | 303772-304545 | _na 257_aa | hisF | Imidazole glycerol phosphate synthase subunit HisF |
| 310 | RYES01000001.1 | GCA003985315_00298 | CDS | open | 304709-305203 | _na 164_aa | ribE | 6%2C7-dimethyl-8-ribityllumazine synthase |
| 311 | RYES01000001.1 | GCA003985315_00299 | CDS | open | 305309-305836 | _na 175_aa | nusB | transcription antitermination factor NusB |
| 312 | RYES01000001.1 | GCA003985315_00300 | CDS | open | 305893-306867 | _na 324_aa | thiL | thiamine-phosphate kinase |
| 313 | RYES01000001.1 | GCA003985315_00301 | CDS | open | 307001-307606 | _na 201_aa | pgpA | Phosphatidylglycerophosphatase A |
| 314 | RYES01000001.1 | GCA003985315_00302 | CDS | open | 308023-308592 | _na 189_aa | Type III restriction system methylase | |
| 315 | RYES01000001.1 | GCA003985315_00303 | CDS | open | 308594-308980 | _na 128_aa | Putative site-specific DNA-methyltransferase | |
| 316 | RYES01000001.1 | GCA003985315_00304 | CDS | open | 308982-310250 | _na 422_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 317 | RYES01000001.1 | GCA003985315_00305 | CDS | open | 310301-310810 | _na 169_aa | Putative type III restriction system endonuclease | |
| 318 | RYES01000001.1 | GCA003985315_00306 | CDS | open | 310807-312786 | _na 659_aa | Restriction endonuclease | |
| 319 | RYES01000001.1 | GCA003985315_00307 | CDS | open | 312940-313872 | _na 310_aa | hslO | Heat-shock protein Hsp33 |
| 320 | RYES01000001.1 | GCA003985315_00308 | CDS | open | 314063-315901 | _na 612_aa | glmS | glutamine--fructose-6-phosphate transaminase (isomerizing) |
| 321 | RYES01000001.1 | GCA003985315_00309 | CDS | open | 315982-317052 | _na 356_aa | galE | UDP-glucose 4-epimerase GalE |
| 322 | RYES01000001.1 | GCA003985315_00310 | CDS | open | 317241-317699 | _na 152_aa | Surface-adhesin protein E-like domain-containing protein | |
| 323 | RYES01000001.1 | GCA003985315_00311 | CDS | open | 317861-318220 | _na 119_aa | Lipoprotein | |
| 324 | RYES01000001.1 | GCA003985315_00312 | CDS | open | 318711-318956 | _na 81_aa | hypothetical protein | |
| 325 | RYES01000001.1 | GCA003985315_00313 | CDS | open | 319329-320597 | _na 422_aa | ugd | UDP-glucose 6-dehydrogenase |
| 326 | RYES01000001.1 | GCA003985315_00314 | CDS | open | 320590-322218 | _na 542_aa | pgi | glucose-6-phosphate isomerase |
| 327 | RYES01000001.1 | GCA003985315_00315 | CDS | open | 322251-323123 | _na 290_aa | galU | UTP--glucose-1-phosphate uridylyltransferase |
| 328 | RYES01000001.1 | GCA003985315_00316 | CDS | open | 323191-325770 | _na 859_aa | plsB | glycerol-3-phosphate 1-O-acyltransferase PlsB |
| 329 | RYES01000001.1 | GCA003985315_00317 | CDS | open | 325947-326918 | _na 323_aa | tesB | Acyl-CoA thioesterase II |
| 330 | RYES01000001.1 | GCA003985315_00318 | CDS | open | 327117-328277 | _na 386_aa | DUF1615 domain-containing protein | |
| 331 | RYES01000001.1 | GCA003985315_00319 | CDS | open | 328296-329405 | _na 369_aa | lptG | LPS export ABC transporter permease LptG |
| 332 | RYES01000001.1 | GCA003985315_00320 | CDS | open | 329402-330565 | _na 387_aa | lptF | LPS export ABC transporter permease LptF |
| 333 | RYES01000001.1 | GCA003985315_00321 | CDS | open | 330923-332434 | _na 503_aa | pepB | leucyl aminopeptidase |
| 334 | RYES01000001.1 | GCA003985315_00322 | CDS | open | 332734-333930 | _na 398_aa | tyrB | Aminotransferase |
| 335 | RYES01000001.1 | GCA003985315_00323 | CDS | open | 334051-334974 | _na 307_aa | lysR | Cyn operon transcriptional activator |
| 336 | RYES01000001.1 | GCA003985315_00324 | CDS | open | 335173-336252 | _na 359_aa | chaA | Calcium/proton antiporter |
| 337 | RYES01000001.1 | GCA003985315_00325 | CDS | open | 336355-337677 | _na 440_aa | mpfA | Polyamine export protein |
| 338 | RYES01000001.1 | GCA003985315_00326 | CDS | open | 337781-338560 | _na 259_aa | fabG | YciK family oxidoreductase |
| 339 | RYES01000001.1 | GCA003985315_00327 | CDS | open | 338695-339387 | _na 230_aa | gph | Phosphoglycolate phosphatase%2C bacterial |
| 340 | RYES01000001.1 | GCA003985315_00328 | CDS | open | 339397-340209 | _na 270_aa | ubiG | bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG |
| 341 | RYES01000001.1 | GCA003985315_00329 | CDS | open | 340556-341176 | _na 206_aa | frnE | Thiol:disulfide interchange protein |
| 342 | RYES01000001.1 | GCA003985315_00330 | CDS | open | 341305-341808 | _na 167_aa | yjgA | ribosome biogenesis factor YjgA |
| 343 | RYES01000001.1 | GCA003985315_00331 | CDS | open | 341929-342213 | _na 94_aa | hypothetical protein | |
| 344 | RYES01000001.1 | GCA003985315_00332 | CDS | open | 342316-342936 | _na 206_aa | hsdS | Type I restriction modification DNA specificity domain protein |
| 345 | RYES01000001.1 | GCA003985315_00333 | CDS | open | 342950-343837 | _na 295_aa | rapZ | RNase adapter RapZ |
| 346 | RYES01000001.1 | GCA003985315_00334 | CDS | open | 343950-344792 | _na 280_aa | panC | pantoate--beta-alanine ligase |
| 347 | RYES01000001.1 | GCA003985315_00335 | CDS | open | 344802-345644 | _na 280_aa | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase |
| 348 | RYES01000001.1 | GCA003985315_00336 | CDS | open | 345791-346279 | _na 162_aa | folK | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase |
| 349 | RYES01000001.1 | GCA003985315_00337 | CDS | open | 346276-348060 | _na 594_aa | pcnB | Poly(A) polymerase I |
| 350 | RYES01000001.1 | GCA003985315_00338 | CDS | open | 348239-348577 | _na 112_aa | comEA | DNA uptake protein |
| 351 | RYES01000001.1 | GCA003985315_00339 | CDS | open | 348567-349406 | _na 279_aa | mazG | nucleoside triphosphate pyrophosphohydrolase |
| 352 | RYES01000001.1 | GCA003985315_00340 | CDS | open | 349477-350406 | _na 309_aa | cysK | cysteine synthase A |
| 353 | RYES01000001.1 | GCA003985315_00341 | CDS | open | 350912-352336 | _na 474_aa | manB | phosphomannomutase |
| 354 | RYES01000001.1 | GCA003985315_00342 | CDS | open | 352405-353262 | _na 285_aa | hflK | FtsH protease regulator HflK |
| 355 | RYES01000001.1 | GCA003985315_00343 | CDS | open | 353318-353767 | _na 149_aa | ybbJ | NfeD-like C-terminal domain-containing protein |
| 356 | RYES01000001.1 | GCA003985315_00344 | CDS | open | 353821-355053 | _na 410_aa | cynX | Cyanate permease |
| 357 | RYES01000001.1 | GCA003985315_00345 | CDS | open | 355201-356529 | _na 442_aa | fabF | beta-ketoacyl-ACP synthase II |
| 358 | RYES01000001.1 | GCA003985315_00346 | CDS | open | 356699-357622 | _na 307_aa | xerD | site-specific tyrosine recombinase XerD |
| 359 | RYES01000001.1 | GCA003985315_00347 | CDS | open | 357642-357881 | _na 79_aa | tusA | sulfurtransferase TusA |
| 360 | RYES01000001.1 | GCA003985315_00348 | CDS | open | 357986-358453 | _na 155_aa | Putative membrane protein | |
| 361 | RYES01000001.1 | GCA003985315_00349 | CDS | open | 358471-358947 | _na 158_aa | ruvX | Holliday junction resolvase RuvX |
| 362 | RYES01000001.1 | GCA003985315_00350 | CDS | open | 358947-359504 | _na 185_aa | algH | UPF0301 protein AO384_1363 |
| 363 | RYES01000001.1 | GCA003985315_00351 | CDS | open | 359501-361207 | _na 568_aa | recN | DNA repair protein RecN |
| 364 | RYES01000001.1 | GCA003985315_00352 | CDS | open | 361292-361846 | _na 184_aa | def | peptide deformylase |
| 365 | RYES01000001.1 | GCA003985315_00353 | CDS | open | 362070-362660 | _na 196_aa | hisB | imidazoleglycerol-phosphate dehydratase HisB |
| 366 | RYES01000001.1 | GCA003985315_00354 | CDS | open | 362670-363296 | _na 208_aa | hisH | imidazole glycerol phosphate synthase subunit HisH |
| 367 | RYES01000001.1 | GCA003985315_00355 | CDS | open | 363378-365267 | _na 629_aa | parE | DNA topoisomerase IV subunit B |
| 368 | RYES01000001.1 | GCA003985315_00356 | CDS | open | 365466-366074 | _na 202_aa | ycfP | Esterase |
| 369 | RYES01000001.1 | GCA003985315_00357 | CDS | open | 366618-367004 | _na 128_aa | hypothetical protein | |
| 370 | RYES01000001.1 | GCA003985315_00358 | CDS | open | 367113-368180 | _na 355_aa | Permease of the major facilitator superfamily | |
| 371 | RYES01000001.1 | GCA003985315_00364 | CDS | open | 374517-374774 | _na 85_aa | hypothetical protein | |
| 372 | RYES01000001.1 | GCA003985315_00365 | CDS | open | 374771-374926 | _na 51_aa | hypothetical protein | |
| 373 | RYES01000001.1 | GCA003985315_00366 | CDS | open | 375062-375151 | _na 29_aa | hypothetical protein | |
| 374 | RYES01000001.1 | GCA003985315_00367 | CDS | open | 375454-376380 | _na 308_aa | znuA | Manganese ABC transporter%2C periplasmic-binding protein SitA |
| 375 | RYES01000001.1 | GCA003985315_00368 | CDS | open | 376380-377285 | _na 301_aa | znuC | Manganese ABC transporter%2C ATP-binding protein SitB |
| 376 | RYES01000001.1 | GCA003985315_00369 | CDS | open | 377282-378124 | _na 280_aa | znuB | Iron ABC transporter permease |
| 377 | RYES01000001.1 | GCA003985315_00370 | CDS | open | 378299-379003 | _na 234_aa | znuB | Manganese ABC transporter%2C inner membrane permease protein SitD |
| 378 | RYES01000001.1 | GCA003985315_00371 | CDS | open | 379509-380729 | _na 406_aa | tyrS | tyrosine--tRNA ligase |
| 379 | RYES01000001.1 | GCA003985315_00372 | CDS | open | 380891-382126 | _na 411_aa | anmK | anhydro-N-acetylmuramic acid kinase |
| 380 | RYES01000001.1 | GCA003985315_00373 | CDS | open | 382379-383173 | _na 264_aa | Protein NO VEIN C-terminal domain-containing protein | |
| 381 | RYES01000001.1 | GCA003985315_00374 | CDS | open | 383238-383411 | _na 57_aa | hypothetical protein | |
| 382 | RYES01000001.1 | GCA003985315_00375 | CDS | open | 383899-384699 | _na 266_aa | czcD | Cadmium%2C cobalt and zinc/H(+)-K(+) antiporter |
| 383 | RYES01000001.1 | GCA003985315_00376 | CDS | open | 384970-385431 | _na 153_aa | hemerythrin domain-containing protein | |
| 384 | RYES01000001.1 | GCA003985315_00377 | CDS | open | 385629-386882 | _na 417_aa | rocD | ornithine--oxo-acid transaminase |
| 385 | RYES01000001.1 | GCA003985315_00378 | CDS | open | 386923-387855 | _na 310_aa | rocF | arginase |
| 386 | RYES01000001.1 | GCA003985315_00379 | CDS | open | 388428-388778 | _na 116_aa | Methylitaconate delta2-delta3-isomerase | |
| 387 | RYES01000001.1 | GCA003985315_00380 | CDS | open | 388805-390589 | _na 594_aa | aF0785 | DUF389 domain-containing protein |
| 388 | RYES01000001.1 | GCA003985315_00381 | CDS | open | 390822-391430 | _na 202_aa | rsmC | Ribosomal RNA small subunit methyltransferase C |
| 389 | RYES01000001.1 | GCA003985315_00382 | CDS | open | 391523-391945 | _na 140_aa | Putative vgr related protein | |
| 390 | RYES01000001.1 | GCA003985315_00383 | CDS | open | 392101-393339 | _na 412_aa | rarA | Replication-associated recombination protein A |
| 391 | RYES01000001.1 | GCA003985315_00384 | CDS | open | 393454-394548 | _na 364_aa | ribBA | bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II |
| 392 | RYES01000001.1 | GCA003985315_00386 | CDS | open | 394715-394975 | _na 86_aa | yeaQ | Transglycosylase |
| 393 | RYES01000001.1 | GCA003985315_00387 | CDS | open | 395043-395657 | _na 204_aa | tsaC | Threonylcarbamoyl-AMP synthase |
| 394 | RYES01000001.1 | GCA003985315_00388 | CDS | open | 395644-396855 | _na 403_aa | dprA | DNA-processing protein DprA |
| 395 | RYES01000001.1 | GCA003985315_00389 | CDS | open | 396892-398307 | _na 471_aa | thrC | threonine synthase |
| 396 | RYES01000001.1 | GCA003985315_00390 | CDS | open | 398625-399971 | _na 448_aa | rsmB | 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB |
| 397 | RYES01000001.1 | GCA003985315_00391 | CDS | open | 399961-400986 | _na 341_aa | fmt | methionyl-tRNA formyltransferase |
| 398 | RYES01000001.1 | GCA003985315_00392 | CDS | open | 401117-401785 | _na 222_aa | ribC | riboflavin synthase |
| 399 | RYES01000001.1 | GCA003985315_00393 | CDS | open | 402068-403120 | _na 350_aa | ribD | bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD |
| 400 | RYES01000001.1 | GCA003985315_00394 | CDS | open | 403117-403587 | _na 156_aa | nrdR | transcriptional regulator NrdR |
| 401 | RYES01000001.1 | GCA003985315_00395 | CDS | open | 403691-405091 | _na 466_aa | mnmE | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE |
| 402 | RYES01000001.1 | GCA003985315_00396 | CDS | open | 405258-406901 | _na 547_aa | yidC | membrane protein insertase YidC |
| 403 | RYES01000001.1 | GCA003985315_00397 | CDS | open | 407070-407390 | _na 106_aa | yidD | membrane protein insertion efficiency factor YidD |
| 404 | RYES01000001.1 | GCA003985315_00398 | CDS | open | 407408-407821 | _na 137_aa | rnpA | ribonuclease P protein component |
| 405 | RYES01000001.1 | GCA003985315_00399 | CDS | open | 407933-408067 | _na 44_aa | rpmH | 50S ribosomal protein L34 |
| 406 | RYES01000001.1 | GCA003985315_00400 | CDS | open | 408666-410069 | _na 467_aa | dnaA | chromosomal replication initiator protein DnaA |
| 407 | RYES01000001.1 | GCA003985315_00401 | CDS | open | 410106-411263 | _na 385_aa | dnaN | DNA polymerase III subunit beta |
| 408 | RYES01000001.1 | GCA003985315_00402 | CDS | open | 411267-412475 | _na 402_aa | recF | DNA replication/repair protein RecF |
| 409 | RYES01000001.1 | GCA003985315_00403 | CDS | open | 412612-415071 | _na 819_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 410 | RYES01000001.1 | GCA003985315_00404 | CDS | open | 415245-416804 | _na 519_aa | guaA | glutamine-hydrolyzing GMP synthase |
| 411 | RYES01000001.1 | GCA003985315_00405 | CDS | open | 416957-418174 | _na 405_aa | Esterase-like activity of phytase family protein | |
| 412 | RYES01000001.1 | GCA003985315_00406 | CDS | open | 418440-418934 | _na 164_aa | rlpA | RlpA-like protein double-psi beta-barrel domain-containing protein |
| 413 | RYES01000001.1 | GCA003985315_00407 | CDS | open | 418948-419307 | _na 119_aa | fkpA | Peptidyl-prolyl cis-trans isomerase |
| 414 | RYES01000001.1 | GCA003985315_00408 | CDS | open | 419449-420624 | _na 391_aa | lysA | Ornithine decarboxylase |
| 415 | RYES01000001.1 | GCA003985315_00409 | CDS | open | 421061-421987 | _na 308_aa | aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme | |
| 416 | RYES01000001.1 | GCA003985315_00410 | CDS | open | 421982-422338 | _na 118_aa | ridA | Aminoacrylate peracid reductase |
| 417 | RYES01000001.1 | GCA003985315_00411 | CDS | open | 422347-423603 | _na 418_aa | dadA | D-amino acid dehydrogenase |
| 418 | RYES01000001.1 | GCA003985315_00412 | CDS | open | 423945-425816 | _na 623_aa | thiC | phosphomethylpyrimidine synthase ThiC |
| 419 | RYES01000001.1 | GCA003985315_00413 | CDS | open | 425930-427771 | _na 613_aa | mdlB | ABC transporter%2C ATP-binding protein |
| 420 | RYES01000001.1 | GCA003985315_00414 | CDS | open | 427953-429353 | _na 466_aa | argH | argininosuccinate lyase |
| 421 | RYES01000001.1 | GCA003985315_00415 | CDS | open | 429577-430542 | _na 321_aa | hemC | hydroxymethylbilane synthase |
| 422 | RYES01000001.1 | GCA003985315_00416 | CDS | open | 430542-431297 | _na 251_aa | hemD | Uroporphyrinogen-III synthase |
| 423 | RYES01000001.1 | GCA003985315_00417 | CDS | open | 431369-432241 | _na 290_aa | rlmB | 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB |
| 424 | RYES01000001.1 | GCA003985315_00418 | CDS | open | 432307-432564 | _na 85_aa | nqrM | (Na+)-NQR maturation NqrM |
| 425 | RYES01000001.1 | GCA003985315_00419 | CDS | open | 432718-434625 | _na 635_aa | dnaK | molecular chaperone DnaK |
| 426 | RYES01000001.1 | GCA003985315_00420 | CDS | open | 436208-436405 | _na 65_aa | hypothetical protein | |
| 427 | RYES01000001.1 | GCA003985315_00421 | CDS | open | 437827-438777 | _na 316_aa | cas1f | type I-F CRISPR-associated endonuclease Cas1f |
| 428 | RYES01000001.1 | GCA003985315_00422 | CDS | open | 438779-442192 | _na 1137_aa | cas3f | type I-F CRISPR-associated helicase Cas3f |
| 429 | RYES01000001.1 | GCA003985315_00423 | CDS | open | 442371-443744 | _na 457_aa | csy1 | type I-F CRISPR-associated protein Csy1 |
| 430 | RYES01000001.1 | GCA003985315_00424 | CDS | open | 443741-444676 | _na 311_aa | csy2 | type I-F CRISPR-associated protein Csy2 |
| 431 | RYES01000001.1 | GCA003985315_00425 | CDS | open | 444711-445718 | _na 335_aa | csy3 | type I-F CRISPR-associated protein Csy3 |
| 432 | RYES01000001.1 | GCA003985315_00426 | CDS | open | 445715-446305 | _na 196_aa | cas6f | type I-F CRISPR-associated endoribonuclease Cas6/Csy4 |
| 433 | RYES01000001.1 | GCA003985315_00427 | CDS | open | 446483-446773 | _na 96_aa | yggX | oxidative damage protection protein |
| 434 | RYES01000001.1 | GCA003985315_00428 | CDS | open | 446847-447323 | _na 158_aa | fadM | Thioesterase-like superfamily protein |
| 435 | RYES01000001.1 | GCA003985315_00429 | CDS | open | 447642-449024 | _na 460_aa | mpl | UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase |
| 436 | RYES01000001.1 | GCA003985315_00430 | CDS | open | 449116-449625 | _na 169_aa | dsbB | Disulfide bond formation protein B |
| 437 | RYES01000001.1 | GCA003985315_00431 | CDS | open | 449731-451281 | _na 516_aa | gshA | glutamate--cysteine ligase |
| 438 | RYES01000001.1 | GCA003985315_00432 | CDS | open | 451431-451763 | _na 110_aa | erpA | iron-sulfur cluster insertion protein ErpA |
| 439 | RYES01000001.1 | GCA003985315_00433 | CDS | open | 451910-452770 | _na 286_aa | tauB | Cyanate ABC transporter%2C ATP-binding protein |
| 440 | RYES01000001.1 | GCA003985315_00434 | CDS | open | 452760-453644 | _na 294_aa | ntrB | nitrate ABC transporter permease |
| 441 | RYES01000001.1 | GCA003985315_00435 | CDS | open | 453634-455049 | _na 471_aa | tauA | Cyanate ABC transporter%2C substrate binding protein |
| 442 | RYES01000001.1 | GCA003985315_00436 | CDS | open | 455132-456520 | _na 462_aa | norV | Rubredoxin-NAD+ reductase |
| 443 | RYES01000001.1 | GCA003985315_00437 | CDS | open | 456517-457689 | _na 390_aa | caiA | Butyryl-CoA dehydrogenase |
| 444 | RYES01000001.1 | GCA003985315_00438 | CDS | open | 457947-458492 | _na 181_aa | yciW | Carboxymuconolactone decarboxylase-like domain-containing protein |
| 445 | RYES01000001.1 | GCA003985315_00439 | CDS | open | 458711-460660 | _na 649_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 446 | RYES01000001.1 | GCA003985315_00440 | CDS | open | 460668-461507 | _na 279_aa | dnaJ | DnaJ-class molecular chaperone CbpA |
| 447 | RYES01000001.1 | GCA003985315_00441 | CDS | open | 461592-462572 | _na 326_aa | yheT | Hydrolase%2C alpha/beta fold family functionally coupled to Phosphoribulokinase |
| 448 | RYES01000001.1 | GCA003985315_00442 | CDS | open | 462632-463429 | _na 265_aa | dapB | 4-hydroxy-tetrahydrodipicolinate reductase |
| 449 | RYES01000001.1 | GCA003985315_00443 | CDS | open | 463474-464667 | _na 397_aa | metC | Cystathionine beta-lyase |
| 450 | RYES01000001.1 | GCA003985315_00444 | CDS | open | 464685-465632 | _na 315_aa | yfeH | Sodium-dependent transporter |
| 451 | RYES01000001.1 | GCA003985315_00445 | CDS | open | 465794-466945 | _na 383_aa | dnaJ | molecular chaperone DnaJ |
| 452 | RYES01000001.1 | GCA003985315_00446 | CDS | open | 467189-468190 | _na 333_aa | dsbG | Thiol:disulfide interchange protein |
| 453 | RYES01000001.1 | GCA003985315_00447 | CDS | open | 468204-468908 | _na 234_aa | rsuA | Pseudouridine synthase |
| 454 | RYES01000001.1 | GCA003985315_00448 | CDS | open | 469077-469670 | _na 197_aa | yIH1 | Putative translation regulator%2C IMPACT (imprinted ancient) protein family |
| 455 | RYES01000001.1 | GCA003985315_00449 | CDS | open | 470124-470450 | _na 108_aa | dksA | Conjugal transfer protein TraR |
| 456 | RYES01000001.1 | GCA003985315_00450 | CDS | open | 470450-471346 | _na 298_aa | rluA | Pseudouridylate synthase |
| 457 | RYES01000001.1 | GCA003985315_00451 | CDS | open | 471684-471977 | _na 97_aa | SHOCT domain-containing protein | |
| 458 | RYES01000001.1 | GCA003985315_00452 | CDS | open | 472027-473238 | _na 403_aa | sstT | serine/threonine transporter SstT |
| 459 | RYES01000001.1 | GCA003985315_00453 | CDS | open | 473329-474333 | _na 334_aa | yejR | Cobalamin biosynthesis protein P47K |
| 460 | RYES01000001.1 | GCA003985315_00454 | CDS | open | 474400-475134 | _na 244_aa | ompR | two-component system response regulator OmpR |
| 461 | RYES01000001.1 | GCA003985315_00455 | CDS | open | 475397-477763 | _na 788_aa | tex | Transcription accessory protein S1 RNA-binding domain |
| 462 | RYES01000001.1 | GCA003985315_00456 | CDS | open | 477824-478522 | _na 232_aa | DUF305 domain-containing protein | |
| 463 | RYES01000001.1 | GCA003985315_00457 | CDS | open | 478730-480007 | _na 425_aa | gltA | citrate synthase |
| 464 | RYES01000001.1 | GCA003985315_00458 | CDS | open | 480816-481196 | _na 126_aa | sdhC | succinate dehydrogenase%2C cytochrome b556 subunit |
| 465 | RYES01000001.1 | GCA003985315_00459 | CDS | open | 481196-481549 | _na 117_aa | sdhD | succinate dehydrogenase%2C hydrophobic membrane anchor protein |
| 466 | RYES01000001.1 | GCA003985315_00460 | CDS | open | 481608-483458 | _na 616_aa | sdhA | succinate dehydrogenase flavoprotein subunit |
| 467 | RYES01000001.1 | GCA003985315_00461 | CDS | open | 483529-484239 | _na 236_aa | sdhB | Fumarate reductase iron-sulfur subunit |
| 468 | RYES01000001.1 | GCA003985315_00462 | CDS | open | 484627-487482 | _na 951_aa | sucA | 2-oxoglutarate dehydrogenase E1 component |
| 469 | RYES01000001.1 | GCA003985315_00463 | CDS | open | 487576-488814 | _na 412_aa | odhB | 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase |
| 470 | RYES01000001.1 | GCA003985315_00464 | CDS | open | 488904-490352 | _na 482_aa | lpdA | dihydrolipoyl dehydrogenase |
| 471 | RYES01000001.1 | GCA003985315_00465 | CDS | open | 490553-490753 | _na 66_aa | hypothetical protein | |
| 472 | RYES01000001.1 | GCA003985315_00466 | CDS | open | 490747-491334 | _na 195_aa | hypothetical protein | |
| 473 | RYES01000001.1 | GCA003985315_00467 | CDS | open | 491925-494666 | _na 913_aa | cirA | TonB-dependent Receptor Plug domain protein |
| 474 | RYES01000001.1 | GCA003985315_00468 | CDS | open | 494718-494813 | _na 31_aa | hypothetical protein | |
| 475 | RYES01000001.1 | GCA003985315_00469 | CDS | open | 495082-496299 | _na 405_aa | Porin | |
| 476 | RYES01000001.1 | GCA003985315_00470 | CDS | open | 496398-497630 | _na 410_aa | Porin | |
| 477 | RYES01000001.1 | GCA003985315_00471 | CDS | open | 497867-500554 | _na 895_aa | preP | prolyl oligopeptidase |
| 478 | RYES01000001.1 | GCA003985315_00472 | CDS | open | 500744-500977 | _na 77_aa | Metal-binding protein | |
| 479 | RYES01000001.1 | GCA003985315_00473 | CDS | open | 500982-503105 | _na 707_aa | dcp | oligopeptidase A |
| 480 | RYES01000001.1 | GCA003985315_00474 | CDS | open | 503322-504071 | _na 249_aa | elsH | Endonuclease/exonuclease/phosphatase domain-containing protein |
| 481 | RYES01000001.1 | GCA003985315_00475 | CDS | open | 504205-504816 | _na 203_aa | rdgB | RdgB/HAM1 family non-canonical purine NTP pyrophosphatase |
| 482 | RYES01000001.1 | GCA003985315_00476 | CDS | open | 505001-506335 | _na 444_aa | tig | trigger factor |
| 483 | RYES01000001.1 | GCA003985315_00477 | CDS | open | 506500-507153 | _na 217_aa | clpP | ATP-dependent Clp endopeptidase proteolytic subunit ClpP |
| 484 | RYES01000001.1 | GCA003985315_00478 | CDS | open | 507163-508479 | _na 438_aa | clpX | ATP-dependent protease ATP-binding subunit ClpX |
| 485 | RYES01000001.1 | GCA003985315_00479 | CDS | open | 508642-509766 | _na 374_aa | dnaJ | J domain-containing protein |
| 486 | RYES01000001.1 | GCA003985315_00480 | CDS | open | 510116-512269 | _na 717_aa | fadB | fatty acid oxidation complex subunit alpha FadB |
| 487 | RYES01000001.1 | GCA003985315_00481 | CDS | open | 512299-513471 | _na 390_aa | fadA | acetyl-CoA C-acyltransferase FadA |
| 488 | RYES01000001.1 | GCA003985315_00482 | CDS | open | 513607-514521 | _na 304_aa | Alpha-beta hydrolase family esterase | |
| 489 | RYES01000001.1 | GCA003985315_00483 | CDS | open | 514496-514762 | _na 88_aa | Patatin | |
| 490 | RYES01000001.1 | GCA003985315_00484 | CDS | open | 515108-515839 | _na 243_aa | cysH | phosphoadenylyl-sulfate reductase |
| 491 | RYES01000001.1 | GCA003985315_00485 | CDS | open | 515923-516846 | _na 307_aa | cysD | sulfate adenylyltransferase subunit CysD |
| 492 | RYES01000001.1 | GCA003985315_00486 | CDS | open | 516997-518301 | _na 434_aa | cysN | sulfate adenylyltransferase |
| 493 | RYES01000001.1 | GCA003985315_00487 | CDS | open | 518412-520508 | _na 698_aa | recG | ATP-dependent DNA helicase RecG |
| 494 | RYES01000001.1 | GCA003985315_00488 | CDS | open | 520495-521148 | _na 217_aa | crp | Cyclic nucleotide-binding domain-containing protein |
| 495 | RYES01000001.1 | GCA003985315_00489 | CDS | open | 521215-521790 | _na 191_aa | hlyD | HlyD secretion family protein |
| 496 | RYES01000001.1 | GCA003985315_00490 | CDS | open | 521895-522182 | _na 95_aa | hlyD | HlyD family secretion protein |
| 497 | RYES01000001.1 | GCA003985315_00491 | CDS | open | 522450-522560 | _na 36_aa | hypothetical protein | |
| 498 | RYES01000001.1 | GCA003985315_00492 | CDS | open | 522538-522888 | _na 116_aa | AcrB/AcrD/AcrF family | |
| 499 | RYES01000001.1 | GCA003985315_00493 | CDS | open | 522885-523157 | _na 90_aa | AcrB/AcrD/AcrF family protein | |
| 500 | RYES01000001.1 | GCA003985315_00494 | CDS | open | 523206-523589 | _na 127_aa | AcrB/AcrD/AcrF family protein |

