BAKTAGenome Explorer: Pseudomonas otitidis (GCA_006715895.1)
Select a Genome:
|
BAKTA Annotations for GCA_006715895.1
|
Search & Sort all 11721 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | VFOB01000001.1 | GCA006715895_04805 | gene | open | 5193843-5194194 | ssrA | ||
| 2 | VFOB01000001.1 | GCA006715895_04805 | tmRNA | open | 5193843-5194194 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | VFOB01000001.1 | rep_origin | open | 4401392-4401908 | ||||
| 4 | VFOB01000001.1 | GCA006715895_00414 | gene | open | 430186-430272 | C4 | ||
| 5 | VFOB01000001.1 | GCA006715895_00415 | gene | open | 430362-430414 | c4-a1b1 | ||
| 6 | VFOB01000001.1 | GCA006715895_00501 | gene | open | 532649-532733 | C4 | ||
| 7 | VFOB01000001.1 | GCA006715895_00502 | gene | open | 532824-532876 | c4-a1b1 | ||
| 8 | VFOB01000001.1 | GCA006715895_00790 | gene | open | 871392-871478 | C4 | ||
| 9 | VFOB01000001.1 | GCA006715895_01031 | gene | open | 1140267-1140319 | c4-a1b1 | ||
| 10 | VFOB01000001.1 | GCA006715895_01194 | gene | open | 1290392-1290464 | Hammerhead_II | ||
| 11 | VFOB01000001.1 | GCA006715895_01228 | gene | open | 1327004-1327056 | c4-a1b1 | ||
| 12 | VFOB01000001.1 | GCA006715895_01237 | gene | open | 1336894-1337028 | P11 | ||
| 13 | VFOB01000001.1 | GCA006715895_01609 | gene | open | 1758597-1758683 | C4 | ||
| 14 | VFOB01000001.1 | GCA006715895_01628 | gene | open | 1773589-1773676 | C4 | ||
| 15 | VFOB01000001.1 | GCA006715895_01699 | gene | open | 1833164-1833393 | srbA | ||
| 16 | VFOB01000001.1 | GCA006715895_01827 | gene | open | 1987558-1987643 | C4 | ||
| 17 | VFOB01000001.1 | GCA006715895_01828 | gene | open | 1987662-1987740 | isrK | ||
| 18 | VFOB01000001.1 | GCA006715895_01997 | gene | open | 2172782-2172878 | Bacteria_small_SRP | ||
| 19 | VFOB01000001.1 | GCA006715895_02052 | gene | open | 2232584-2232699 | rrf | ||
| 20 | VFOB01000001.1 | GCA006715895_02053 | gene | open | 2232822-2235713 | rrl | ||
| 21 | VFOB01000001.1 | GCA006715895_02056 | gene | open | 2236210-2237745 | rrs | ||
| 22 | VFOB01000001.1 | GCA006715895_02177 | gene | open | 2382725-2382871 | P14 | ||
| 23 | VFOB01000001.1 | GCA006715895_02226 | gene | open | 2435376-2435459 | C4 | ||
| 24 | VFOB01000001.1 | GCA006715895_02227 | gene | open | 2435491-2435575 | C4 | ||
| 25 | VFOB01000001.1 | GCA006715895_02228 | gene | open | 2435640-2435692 | c4-a1b1 | ||
| 26 | VFOB01000001.1 | GCA006715895_02229 | gene | open | 2435784-2435867 | C4 | ||
| 27 | VFOB01000001.1 | GCA006715895_02452 | gene | open | 2679178-2679260 | sRNA-Xcc1 | ||
| 28 | VFOB01000001.1 | GCA006715895_02545 | gene | open | 2766416-2766550 | P18 | ||
| 29 | VFOB01000001.1 | GCA006715895_02547 | gene | open | 2768796-2769013 | phrS | ||
| 30 | VFOB01000001.1 | GCA006715895_02695 | gene | open | 2924498-2924550 | c4-a1b1 | ||
| 31 | VFOB01000001.1 | GCA006715895_02696 | gene | open | 2924639-2924723 | C4 | ||
| 32 | VFOB01000001.1 | GCA006715895_02738 | gene | open | 2969696-2969748 | c4-a1b1 | ||
| 33 | VFOB01000001.1 | GCA006715895_02739 | gene | open | 2969836-2969920 | C4 | ||
| 34 | VFOB01000001.1 | GCA006715895_02860 | gene | open | 3102958-3103315 | RNaseP_bact_a | ||
| 35 | VFOB01000001.1 | GCA006715895_03043 | gene | open | 3296842-3296949 | yrlA | ||
| 36 | VFOB01000001.1 | GCA006715895_03045 | gene | open | 3296980-3297101 | yrlA | ||
| 37 | VFOB01000001.1 | GCA006715895_03101 | gene | open | 3364013-3364086 | P9 | ||
| 38 | VFOB01000001.1 | GCA006715895_03136 | gene | open | 3398195-3398451 | P24 | ||
| 39 | VFOB01000001.1 | GCA006715895_03292 | gene | open | 3563600-3563719 | P15 | ||
| 40 | VFOB01000001.1 | GCA006715895_03374 | gene | open | 3655508-3655791 | 5_ureB_sRNA | ||
| 41 | VFOB01000001.1 | GCA006715895_03424 | gene | open | 3707841-3707906 | P26 | ||
| 42 | VFOB01000001.1 | GCA006715895_03427 | gene | open | 3708862-3709065 | P27 | ||
| 43 | VFOB01000001.1 | GCA006715895_03440 | gene | open | 3715665-3715780 | rrf | ||
| 44 | VFOB01000001.1 | GCA006715895_03441 | gene | open | 3715903-3718794 | rrl | ||
| 45 | VFOB01000001.1 | GCA006715895_03444 | gene | open | 3719291-3720826 | rrs | ||
| 46 | VFOB01000001.1 | GCA006715895_03506 | gene | open | 3785619-3785704 | C4 | ||
| 47 | VFOB01000001.1 | GCA006715895_03533 | gene | open | 3812932-3813052 | rsmY | ||
| 48 | VFOB01000001.1 | GCA006715895_03639 | gene | open | 3938149-3938297 | proV | ||
| 49 | VFOB01000001.1 | GCA006715895_03807 | gene | open | 4118879-4119058 | P1 | ||
| 50 | VFOB01000001.1 | GCA006715895_03834 | gene | open | 4146274-4146452 | 6S | ||
| 51 | VFOB01000001.1 | GCA006715895_03988 | gene | open | 4301328-4301445 | Pseudomon-1 | ||
| 52 | VFOB01000001.1 | GCA006715895_04219 | gene | open | 4549631-4551166 | rrs | ||
| 53 | VFOB01000001.1 | GCA006715895_04222 | gene | open | 4551663-4554554 | rrl | ||
| 54 | VFOB01000001.1 | GCA006715895_04223 | gene | open | 4554677-4554792 | rrf | ||
| 55 | VFOB01000001.1 | GCA006715895_04404 | gene | open | 4742206-4742463 | nrsZ | ||
| 56 | VFOB01000001.1 | GCA006715895_04471 | gene | open | 4819383-4819676 | asponA | ||
| 57 | VFOB01000001.1 | GCA006715895_04509 | gene | open | 4858605-4858688 | sRNA-Xcc1 | ||
| 58 | VFOB01000001.1 | GCA006715895_04653 | gene | open | 5047621-5047705 | C4 | ||
| 59 | VFOB01000001.1 | GCA006715895_04822 | gene | open | 5214133-5214209 | P31 | ||
| 60 | VFOB01000001.1 | GCA006715895_04861 | gene | open | 5256231-5256632 | crcZ | ||
| 61 | VFOB01000001.1 | GCA006715895_04862 | gene | open | 5256728-5256788 | P36 | ||
| 62 | VFOB01000001.1 | GCA006715895_04878 | gene | open | 5271824-5271973 | prrF | ||
| 63 | VFOB01000001.1 | GCA006715895_04894 | gene | open | 5287237-5288772 | rrs | ||
| 64 | VFOB01000001.1 | GCA006715895_04897 | gene | open | 5289269-5292160 | rrl | ||
| 65 | VFOB01000001.1 | GCA006715895_04898 | gene | open | 5292283-5292398 | rrf | ||
| 66 | VFOB01000001.1 | GCA006715895_05057 | gene | open | 5452612-5452695 | C4 | ||
| 67 | VFOB01000001.1 | GCA006715895_05058 | gene | open | 5452773-5452825 | c4-a1b1 | ||
| 68 | VFOB01000001.1 | GCA006715895_05326 | gene | open | 5750079-5750165 | t44 | ||
| 69 | VFOB01000001.1 | GCA006715895_05361 | gene | open | 5786341-5786471 | PrrB_RsmZ | ||
| 70 | VFOB01000001.1 | GCA006715895_05625 | gene | open | 6061008-6061203 | rgsA | ||
| 71 | VFOB01000001.1 | GCA006715895_00414 | ncRNA | open | 430186-430272 | C4 antisense RNA | ||
| 72 | VFOB01000001.1 | GCA006715895_00415 | ncRNA | open | 430362-430414 | a1%2C b1 targets of C4 antisense RNA | ||
| 73 | VFOB01000001.1 | GCA006715895_00501 | ncRNA | open | 532649-532733 | C4 antisense RNA | ||
| 74 | VFOB01000001.1 | GCA006715895_00502 | ncRNA | open | 532824-532876 | a1%2C b1 targets of C4 antisense RNA | ||
| 75 | VFOB01000001.1 | GCA006715895_00790 | ncRNA | open | 871392-871478 | C4 antisense RNA | ||
| 76 | VFOB01000001.1 | GCA006715895_01031 | ncRNA | open | 1140267-1140319 | a1%2C b1 targets of C4 antisense RNA | ||
| 77 | VFOB01000001.1 | GCA006715895_01194 | ncRNA | open | 1290392-1290464 | Hammerhead ribozyme (type II) | ||
| 78 | VFOB01000001.1 | GCA006715895_01228 | ncRNA | open | 1327004-1327056 | a1%2C b1 targets of C4 antisense RNA | ||
| 79 | VFOB01000001.1 | GCA006715895_01237 | ncRNA | open | 1336894-1337028 | Pseudomonas sRNA P11 | ||
| 80 | VFOB01000001.1 | GCA006715895_01609 | ncRNA | open | 1758597-1758683 | C4 antisense RNA | ||
| 81 | VFOB01000001.1 | GCA006715895_01628 | ncRNA | open | 1773589-1773676 | C4 antisense RNA | ||
| 82 | VFOB01000001.1 | GCA006715895_01699 | ncRNA | open | 1833164-1833393 | srbA | sRNA regulator of biofilms A | |
| 83 | VFOB01000001.1 | GCA006715895_01827 | ncRNA | open | 1987558-1987643 | C4 antisense RNA | ||
| 84 | VFOB01000001.1 | GCA006715895_01828 | ncRNA | open | 1987662-1987740 | isrK | isrK Hfq binding RNA | |
| 85 | VFOB01000001.1 | GCA006715895_01997 | ncRNA | open | 2172782-2172878 | Bacterial small signal recognition particle RNA | ||
| 86 | VFOB01000001.1 | GCA006715895_02177 | ncRNA | open | 2382725-2382871 | Pseudomonas sRNA P14 | ||
| 87 | VFOB01000001.1 | GCA006715895_02226 | ncRNA | open | 2435376-2435459 | C4 antisense RNA | ||
| 88 | VFOB01000001.1 | GCA006715895_02227 | ncRNA | open | 2435491-2435575 | C4 antisense RNA | ||
| 89 | VFOB01000001.1 | GCA006715895_02228 | ncRNA | open | 2435640-2435692 | a1%2C b1 targets of C4 antisense RNA | ||
| 90 | VFOB01000001.1 | GCA006715895_02229 | ncRNA | open | 2435784-2435867 | C4 antisense RNA | ||
| 91 | VFOB01000001.1 | GCA006715895_02452 | ncRNA | open | 2679178-2679260 | sRNA-Xcc1 | ||
| 92 | VFOB01000001.1 | GCA006715895_02545 | ncRNA | open | 2766416-2766550 | Pseudomonas sRNA P18 | ||
| 93 | VFOB01000001.1 | GCA006715895_02547 | ncRNA | open | 2768796-2769013 | phrS | PhrS | |
| 94 | VFOB01000001.1 | GCA006715895_02695 | ncRNA | open | 2924498-2924550 | a1%2C b1 targets of C4 antisense RNA | ||
| 95 | VFOB01000001.1 | GCA006715895_02696 | ncRNA | open | 2924639-2924723 | C4 antisense RNA | ||
| 96 | VFOB01000001.1 | GCA006715895_02738 | ncRNA | open | 2969696-2969748 | a1%2C b1 targets of C4 antisense RNA | ||
| 97 | VFOB01000001.1 | GCA006715895_02739 | ncRNA | open | 2969836-2969920 | C4 antisense RNA | ||
| 98 | VFOB01000001.1 | GCA006715895_02860 | ncRNA | open | 3102958-3103315 | Bacterial RNase P class A | ||
| 99 | VFOB01000001.1 | GCA006715895_03043 | ncRNA | open | 3296842-3296949 | yrlA | Y RNA-like | |
| 100 | VFOB01000001.1 | GCA006715895_03045 | ncRNA | open | 3296980-3297101 | yrlA | Y RNA-like | |
| 101 | VFOB01000001.1 | GCA006715895_03101 | ncRNA | open | 3364013-3364086 | Pseudomonas sRNA P9 | ||
| 102 | VFOB01000001.1 | GCA006715895_03136 | ncRNA | open | 3398195-3398451 | Pseudomonas sRNA P24 | ||
| 103 | VFOB01000001.1 | GCA006715895_03292 | ncRNA | open | 3563600-3563719 | Pseudomonas sRNA P15 | ||
| 104 | VFOB01000001.1 | GCA006715895_03374 | ncRNA | open | 3655508-3655791 | 5' ureB small RNA | ||
| 105 | VFOB01000001.1 | GCA006715895_03424 | ncRNA | open | 3707841-3707906 | Pseudomonas sRNA P26 | ||
| 106 | VFOB01000001.1 | GCA006715895_03427 | ncRNA | open | 3708862-3709065 | Pseudomonas sRNA P27 | ||
| 107 | VFOB01000001.1 | GCA006715895_03506 | ncRNA | open | 3785619-3785704 | C4 antisense RNA | ||
| 108 | VFOB01000001.1 | GCA006715895_03533 | ncRNA | open | 3812932-3813052 | rsmY | RsmY RNA family | |
| 109 | VFOB01000001.1 | GCA006715895_03639 | ncRNA | open | 3938149-3938297 | proV | proV RNA | |
| 110 | VFOB01000001.1 | GCA006715895_03807 | ncRNA | open | 4118879-4119058 | Pseudomonas sRNA P1 | ||
| 111 | VFOB01000001.1 | GCA006715895_03834 | ncRNA | open | 4146274-4146452 | 6S / SsrS RNA | ||
| 112 | VFOB01000001.1 | GCA006715895_03988 | ncRNA | open | 4301328-4301445 | Pseudomon-1/ErsA RNA | ||
| 113 | VFOB01000001.1 | GCA006715895_04404 | ncRNA | open | 4742206-4742463 | nrsZ | Nitrogen regulated small RNA | |
| 114 | VFOB01000001.1 | GCA006715895_04471 | ncRNA | open | 4819383-4819676 | anti ponA RNA | ||
| 115 | VFOB01000001.1 | GCA006715895_04509 | ncRNA | open | 4858605-4858688 | sRNA-Xcc1 | ||
| 116 | VFOB01000001.1 | GCA006715895_04653 | ncRNA | open | 5047621-5047705 | C4 antisense RNA | ||
| 117 | VFOB01000001.1 | GCA006715895_04822 | ncRNA | open | 5214133-5214209 | Pseudomonas sRNA P31 | ||
| 118 | VFOB01000001.1 | GCA006715895_04861 | ncRNA | open | 5256231-5256632 | crcZ | Pseudomonas sRNA CrcZ | |
| 119 | VFOB01000001.1 | GCA006715895_04862 | ncRNA | open | 5256728-5256788 | Pseudomonas sRNA P36 | ||
| 120 | VFOB01000001.1 | GCA006715895_04878 | ncRNA | open | 5271824-5271973 | prrF | PrrF RNA | |
| 121 | VFOB01000001.1 | GCA006715895_05057 | ncRNA | open | 5452612-5452695 | C4 antisense RNA | ||
| 122 | VFOB01000001.1 | GCA006715895_05058 | ncRNA | open | 5452773-5452825 | a1%2C b1 targets of C4 antisense RNA | ||
| 123 | VFOB01000001.1 | GCA006715895_05326 | ncRNA | open | 5750079-5750165 | t44 RNA | ||
| 124 | VFOB01000001.1 | GCA006715895_05361 | ncRNA | open | 5786341-5786471 | PrrB/RsmZ RNA family | ||
| 125 | VFOB01000001.1 | GCA006715895_05625 | ncRNA | open | 6061008-6061203 | rgsA | RgsA sRNA | |
| 126 | VFOB01000001.1 | regulatory_region | open | 284154-284370 | sucA-II RNA | |||
| 127 | VFOB01000001.1 | regulatory_region | open | 290093-290161 | sucC RNA | |||
| 128 | VFOB01000001.1 | regulatory_region | open | 342304-342507 | Cobalamin riboswitch aptamer | |||
| 129 | VFOB01000001.1 | regulatory_region | open | 512428-512479 | terC RNA | |||
| 130 | VFOB01000001.1 | regulatory_region | open | 1039921-1040116 | Cobalamin riboswitch aptamer | |||
| 131 | VFOB01000001.1 | regulatory_region | open | 1333636-1333704 | narK RNA | |||
| 132 | VFOB01000001.1 | regulatory_region | open | 1624530-1624634 | TwoAYGGAY RNA | |||
| 133 | VFOB01000001.1 | regulatory_region | open | 1908155-1908254 | Guanidine-I riboswitch aptamer | |||
| 134 | VFOB01000001.1 | regulatory_region | open | 1912602-1912646 | Guanidine-II riboswitch aptamer (mini-ykkC) | |||
| 135 | VFOB01000001.1 | regulatory_region | open | 2594100-2594231 | rmf RNA | |||
| 136 | VFOB01000001.1 | regulatory_region | open | 3065205-3065320 | Pseudomon-groES RNA | |||
| 137 | VFOB01000001.1 | regulatory_region | open | 3541304-3541460 | FMN riboswitch aptamer (RFN element) | |||
| 138 | VFOB01000001.1 | regulatory_region | open | 3553380-3553573 | Cobalamin riboswitch aptamer | |||
| 139 | VFOB01000001.1 | regulatory_region | open | 3570433-3570637 | Cobalamin riboswitch aptamer | |||
| 140 | VFOB01000001.1 | regulatory_region | open | 3599689-3599747 | Selenocysteine insertion sequence 3 | |||
| 141 | VFOB01000001.1 | regulatory_region | open | 3624847-3624951 | TwoAYGGAY RNA | |||
| 142 | VFOB01000001.1 | regulatory_region | open | 3683838-3683936 | Alpha operon ribosome binding site | |||
| 143 | VFOB01000001.1 | regulatory_region | open | 3699185-3699315 | Pseudomonas rpsL leader | |||
| 144 | VFOB01000001.1 | regulatory_region | open | 3979729-3979822 | SAH (S-adenosyl-L-homocysteine) riboswitch aptamer | |||
| 145 | VFOB01000001.1 | regulatory_region | open | 4160073-4160171 | Pseudomon-Rho RNA | |||
| 146 | VFOB01000001.1 | regulatory_region | open | 4286938-4287032 | ivy-DE RNA | |||
| 147 | VFOB01000001.1 | regulatory_region | open | 4678844-4678899 | COG3860 RNA | |||
| 148 | VFOB01000001.1 | regulatory_region | open | 4753044-4753143 | Glycine riboswitch aptamer | |||
| 149 | VFOB01000001.1 | regulatory_region | open | 4753144-4753234 | Glycine riboswitch aptamer | |||
| 150 | VFOB01000001.1 | regulatory_region | open | 4962055-4962161 | TPP riboswitch aptamer (THI element) | |||
| 151 | VFOB01000001.1 | regulatory_region | open | 5232454-5232574 | Ribosomal S15 leader | |||
| 152 | VFOB01000001.1 | regulatory_region | open | 5374315-5374414 | Manganese Mn2+ riboswitch aptamer (yybP-ykoY) | |||
| 153 | VFOB01000001.1 | regulatory_region | open | 6021531-6021744 | Cobalamin riboswitch aptamer | |||
| 154 | VFOB01000001.1 | regulatory_region | open | 6047062-6047332 | rne-II RNA | |||
| 155 | VFOB01000001.1 | regulatory_region | open | 6238803-6238883 | gyrA RNA | |||
| 156 | VFOB01000001.1 | regulatory_region | open | 6284943-6285012 | Repression of heat shock gene expression (ROSE) element | |||
| 157 | VFOB01000001.1 | GCA006715895_02052 | rRNA | open | 2232584-2232699 | rrf | 5S ribosomal RNA | |
| 158 | VFOB01000001.1 | GCA006715895_02053 | rRNA | open | 2232822-2235713 | rrl | 23S ribosomal RNA | |
| 159 | VFOB01000001.1 | GCA006715895_02056 | rRNA | open | 2236210-2237745 | rrs | 16S ribosomal RNA | |
| 160 | VFOB01000001.1 | GCA006715895_03440 | rRNA | open | 3715665-3715780 | rrf | 5S ribosomal RNA | |
| 161 | VFOB01000001.1 | GCA006715895_03441 | rRNA | open | 3715903-3718794 | rrl | 23S ribosomal RNA | |
| 162 | VFOB01000001.1 | GCA006715895_03444 | rRNA | open | 3719291-3720826 | rrs | 16S ribosomal RNA | |
| 163 | VFOB01000001.1 | GCA006715895_04219 | rRNA | open | 4549631-4551166 | rrs | 16S ribosomal RNA | |
| 164 | VFOB01000001.1 | GCA006715895_04222 | rRNA | open | 4551663-4554554 | rrl | 23S ribosomal RNA | |
| 165 | VFOB01000001.1 | GCA006715895_04223 | rRNA | open | 4554677-4554792 | rrf | 5S ribosomal RNA | |
| 166 | VFOB01000001.1 | GCA006715895_04894 | rRNA | open | 5287237-5288772 | rrs | 16S ribosomal RNA | |
| 167 | VFOB01000001.1 | GCA006715895_04897 | rRNA | open | 5289269-5292160 | rrl | 23S ribosomal RNA | |
| 168 | VFOB01000001.1 | GCA006715895_04898 | rRNA | open | 5292283-5292398 | rrf | 5S ribosomal RNA | |
| 169 | VFOB01000001.1 | repeat_region | open | 1985774-1986361 | CRISPR array with 10 repeats of length 29%2C consensus sequence CGGTTCATCCCCACACCCGTGGGGAACAC and spacer length 32 | |||
| 170 | VFOB01000001.1 | GCA006715895_00001 | CDS | open | 196-1176 | _na 326_aa | hypothetical protein | |
| 171 | VFOB01000001.1 | GCA006715895_00002 | CDS | open | 1180-2040 | _na 286_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 172 | VFOB01000001.1 | GCA006715895_00003 | CDS | open | 2099-2722 | _na 207_aa | phosphoribosylanthranilate isomerase | |
| 173 | VFOB01000001.1 | GCA006715895_00004 | CDS | open | 2995-3885 | _na 296_aa | accD | acetyl-CoA carboxylase%2C carboxyltransferase subunit beta |
| 174 | VFOB01000001.1 | GCA006715895_00005 | CDS | open | 3882-5159 | _na 425_aa | folC | bifunctional tetrahydrofolate synthase/dihydrofolate synthase |
| 175 | VFOB01000001.1 | GCA006715895_00006 | CDS | open | 5162-5830 | _na 222_aa | dedD | DedD protein |
| 176 | VFOB01000001.1 | GCA006715895_00007 | CDS | open | 5925-6437 | _na 170_aa | cvpA | Colicin V production CvpA |
| 177 | VFOB01000001.1 | GCA006715895_00008 | CDS | open | 6522-8027 | _na 501_aa | purF | amidophosphoribosyltransferase |
| 178 | VFOB01000001.1 | GCA006715895_00009 | CDS | open | 8111-9322 | _na 403_aa | O-succinylhomoserine sulfhydrylase | |
| 179 | VFOB01000001.1 | GCA006715895_00010 | CDS | open | 9322-10098 | _na 258_aa | SDR family oxidoreductase | |
| 180 | VFOB01000001.1 | GCA006715895_00011 | CDS | open | 10315-12249 | _na 644_aa | gspD | type II secretion system secretin GspD |
| 181 | VFOB01000001.1 | GCA006715895_00012 | CDS | open | 12254-12895 | _na 213_aa | gspC | Type II secretion system protein GspC N-terminal domain-containing protein |
| 182 | VFOB01000001.1 | GCA006715895_00013 | CDS | open | 13161-14648 | _na 495_aa | gspE | type II secretion system ATPase GspE |
| 183 | VFOB01000001.1 | GCA006715895_00014 | CDS | open | 14649-15866 | _na 405_aa | gspF | GspF family T2SS innner membrane protein variant XcpS |
| 184 | VFOB01000001.1 | GCA006715895_00015 | CDS | open | 15916-16302 | _na 128_aa | gspG | type II secretion system major pseudopilin GspG |
| 185 | VFOB01000001.1 | GCA006715895_00016 | CDS | open | 16302-16847 | _na 181_aa | gspH | type II secretion system minor pseudopilin GspH |
| 186 | VFOB01000001.1 | GCA006715895_00017 | CDS | open | 16844-17233 | _na 129_aa | gspI | type II secretion system minor pseudopilin GspI |
| 187 | VFOB01000001.1 | GCA006715895_00018 | CDS | open | 17230-17913 | _na 227_aa | gspJ | type II secretion system minor pseudopilin GspJ |
| 188 | VFOB01000001.1 | GCA006715895_00019 | CDS | open | 17910-18884 | _na 324_aa | gspK | type II secretion system minor pseudopilin GspK |
| 189 | VFOB01000001.1 | GCA006715895_00020 | CDS | open | 18881-20023 | _na 380_aa | gspL | type II secretion system protein GspL |
| 190 | VFOB01000001.1 | GCA006715895_00021 | CDS | open | 20026-20541 | _na 171_aa | Type II secretion system protein M | |
| 191 | VFOB01000001.1 | GCA006715895_00025 | CDS | open | 21365-22402 | _na 345_aa | araC | Transcriptional regulator%2C AraC family |
| 192 | VFOB01000001.1 | GCA006715895_00026 | CDS | open | 22399-23469 | _na 356_aa | Hydrolase%2C carbon-nitrogen family | |
| 193 | VFOB01000001.1 | GCA006715895_00027 | CDS | open | 23675-25705 | _na 676_aa | 2%2C4-dienoyl-CoA reductase | |
| 194 | VFOB01000001.1 | GCA006715895_00028 | CDS | open | 25771-26202 | _na 143_aa | SnoaL-like domain-containing protein | |
| 195 | VFOB01000001.1 | GCA006715895_00029 | CDS | open | 26413-27783 | _na 456_aa | parA | Chromosome partitioning protein ParA |
| 196 | VFOB01000001.1 | GCA006715895_00030 | CDS | open | 27930-28820 | _na 296_aa | 1-aminocyclopropane-1-carboxylate deaminase | |
| 197 | VFOB01000001.1 | GCA006715895_00031 | CDS | open | 28817-29920 | _na 367_aa | cAMP-binding protein | |
| 198 | VFOB01000001.1 | GCA006715895_00032 | CDS | open | 29939-30877 | _na 312_aa | Cobalt chelatase | |
| 199 | VFOB01000001.1 | GCA006715895_00033 | CDS | open | 30974-31864 | _na 296_aa | NAD(+) kinase | |
| 200 | VFOB01000001.1 | GCA006715895_00034 | CDS | open | 31864-32838 | _na 324_aa | Calcineurin-like phosphoesterase domain-containing protein | |
| 201 | VFOB01000001.1 | GCA006715895_00035 | CDS | open | 32835-33698 | _na 287_aa | glpG | GlpG protein (Membrane protein of glp regulon) |
| 202 | VFOB01000001.1 | GCA006715895_00036 | CDS | open | 33789-34049 | _na 86_aa | DUF1315 domain-containing protein | |
| 203 | VFOB01000001.1 | GCA006715895_00037 | CDS | open | 34049-34900 | _na 283_aa | DUF2797 domain-containing protein | |
| 204 | VFOB01000001.1 | GCA006715895_00038 | CDS | open | 34971-37631 | _na 886_aa | pepN | aminopeptidase N |
| 205 | VFOB01000001.1 | GCA006715895_00039 | CDS | open | 38145-40112 | _na 655_aa | Glycine/betaine transmethylase | |
| 206 | VFOB01000001.1 | GCA006715895_00040 | CDS | open | 40174-41541 | _na 455_aa | Outer membrane lipoprotein-sorting protein | |
| 207 | VFOB01000001.1 | GCA006715895_00041 | CDS | open | 41743-42828 | _na 361_aa | Photosynthesis system II assembly factor Ycf48/Hcf136-like domain-containing protein | |
| 208 | VFOB01000001.1 | GCA006715895_00042 | CDS | open | 42847-45222 | _na 791_aa | SSD domain-containing protein | |
| 209 | VFOB01000001.1 | GCA006715895_00043 | CDS | open | 45427-45960 | _na 177_aa | DNA-directed RNA polymerase sigma-70 factor | |
| 210 | VFOB01000001.1 | GCA006715895_00044 | CDS | open | 45957-46916 | _na 319_aa | Putative transmembrane sensor | |
| 211 | VFOB01000001.1 | GCA006715895_00045 | CDS | open | 47041-49575 | _na 844_aa | Heme utilization protein | |
| 212 | VFOB01000001.1 | GCA006715895_00046 | CDS | open | 49975-50655 | _na 226_aa | Type 1 glutamine amidotransferase domain-containing protein | |
| 213 | VFOB01000001.1 | GCA006715895_00047 | CDS | open | 50753-51223 | _na 156_aa | Glutamate synthase (NADPH) | |
| 214 | VFOB01000001.1 | GCA006715895_00048 | CDS | open | 51306-51623 | _na 105_aa | Lipoprotein | |
| 215 | VFOB01000001.1 | GCA006715895_00049 | CDS | open | 51620-51949 | _na 109_aa | Phosphotyrosine protein phosphatase I domain-containing protein | |
| 216 | VFOB01000001.1 | GCA006715895_00050 | CDS | open | 51946-53982 | _na 678_aa | Protease II | |
| 217 | VFOB01000001.1 | GCA006715895_00051 | CDS | open | 54082-54573 | _na 163_aa | Permeases of the major facilitator superfamily | |
| 218 | VFOB01000001.1 | GCA006715895_00052 | CDS | open | 54613-55059 | _na 148_aa | Bis(5'-nucleosyl)-tetraphosphatase (Asymmetrical) | |
| 219 | VFOB01000001.1 | GCA006715895_00053 | CDS | open | 55063-55836 | _na 257_aa | Class II glutamine amidotransferase | |
| 220 | VFOB01000001.1 | GCA006715895_00054 | CDS | open | 55850-56374 | _na 174_aa | DUF2937 domain-containing protein | |
| 221 | VFOB01000001.1 | GCA006715895_00055 | CDS | open | 56375-57799 | _na 474_aa | gntR | Transcriptional regulator%2C GntR family domain |
| 222 | VFOB01000001.1 | GCA006715895_00056 | CDS | open | 57892-58836 | _na 314_aa | eamA | EamA domain-containing protein |
| 223 | VFOB01000001.1 | GCA006715895_00057 | CDS | open | 58840-59292 | _na 150_aa | MPN domain-containing protein | |
| 224 | VFOB01000001.1 | GCA006715895_00058 | CDS | open | 59319-60734 | _na 471_aa | thiF | Sulfur carrier protein adenylyltransferase ThiF |
| 225 | VFOB01000001.1 | GCA006715895_00059 | CDS | open | 60744-61658 | _na 304_aa | cysteine synthase | |
| 226 | VFOB01000001.1 | GCA006715895_00060 | CDS | open | 61682-62668 | _na 328_aa | serine O-acetyltransferase | |
| 227 | VFOB01000001.1 | GCA006715895_00061 | CDS | open | 62673-63401 | _na 242_aa | Ala-tRNA(Pro) hydrolase | |
| 228 | VFOB01000001.1 | GCA006715895_00062 | CDS | open | 63441-64112 | _na 223_aa | TIGR04211 family SH3 domain-containing protein | |
| 229 | VFOB01000001.1 | GCA006715895_00063 | CDS | open | 64323-64844 | _na 173_aa | N-acetyltransferase domain-containing protein | |
| 230 | VFOB01000001.1 | GCA006715895_00064 | CDS | open | 65153-66238 | _na 361_aa | Putrescine ABC transporter%2C periplasmic putrescine-binding protein | |
| 231 | VFOB01000001.1 | GCA006715895_00065 | CDS | open | 66305-68047 | _na 580_aa | Amidohydrolase 3 domain-containing protein | |
| 232 | VFOB01000001.1 | GCA006715895_00066 | CDS | open | 68155-69069 | _na 304_aa | Transcriptional regulator | |
| 233 | VFOB01000001.1 | GCA006715895_00067 | CDS | open | 69371-70114 | _na 247_aa | DUF481 domain-containing protein | |
| 234 | VFOB01000001.1 | GCA006715895_00068 | CDS | open | 70216-71898 | _na 560_aa | aepA | Exoenzymes regulatory protein AepA in lipid-linked oligosaccharide synthesis cluster |
| 235 | VFOB01000001.1 | GCA006715895_00069 | CDS | open | 72065-72979 | _na 304_aa | lysR | Transcriptional regulator%2C LysR family |
| 236 | VFOB01000001.1 | GCA006715895_00070 | CDS | open | 73093-74823 | _na 576_aa | aceK | bifunctional isocitrate dehydrogenase kinase/phosphatase |
| 237 | VFOB01000001.1 | GCA006715895_00071 | CDS | open | 75251-76276 | _na 341_aa | sohB | protease SohB |
| 238 | VFOB01000001.1 | GCA006715895_00072 | CDS | open | 76487-77197 | _na 236_aa | Phosphoglycerate mutase family protein | |
| 239 | VFOB01000001.1 | GCA006715895_00073 | CDS | open | 77254-77568 | _na 104_aa | SCP2 domain-containing protein | |
| 240 | VFOB01000001.1 | GCA006715895_00074 | CDS | open | 77778-78848 | _na 356_aa | Aminoglycoside phosphotransferase domain-containing protein | |
| 241 | VFOB01000001.1 | GCA006715895_00075 | CDS | open | 78873-79640 | _na 255_aa | SDR family oxidoreductase | |
| 242 | VFOB01000001.1 | GCA006715895_00076 | CDS | open | 79794-80813 | _na 339_aa | araC | Transcriptional regulator%2C AraC family |
| 243 | VFOB01000001.1 | GCA006715895_00077 | CDS | open | 81417-82457 | _na 346_aa | Acetylpolyamine amidohydrolase | |
| 244 | VFOB01000001.1 | GCA006715895_00078 | CDS | open | 82454-83542 | _na 362_aa | Spermidine/putrescine ABC transporter substrate-binding protein | |
| 245 | VFOB01000001.1 | GCA006715895_00079 | CDS | open | 83765-83983 | _na 72_aa | Methionine aminopeptidase | |
| 246 | VFOB01000001.1 | GCA006715895_00080 | CDS | open | 83980-84783 | _na 267_aa | map | type I methionyl aminopeptidase |
| 247 | VFOB01000001.1 | GCA006715895_00081 | CDS | open | 84831-86000 | _na 389_aa | Putative MFS Superfamily transporter | |
| 248 | VFOB01000001.1 | GCA006715895_00082 | CDS | open | 86106-86978 | _na 290_aa | ptrR | putrescine utilization regulator PtrR |
| 249 | VFOB01000001.1 | GCA006715895_00083 | CDS | open | 87018-87974 | _na 318_aa | Transcriptional regulator containing an amidase domain and an AraC-type DNA-binding HTH domain | |
| 250 | VFOB01000001.1 | GCA006715895_00084 | CDS | open | 88099-88728 | _na 209_aa | Amidases related to nicotinamidase | |
| 251 | VFOB01000001.1 | GCA006715895_00085 | CDS | open | 89294-89434 | _na 46_aa | PA1414 family protein | |
| 252 | VFOB01000001.1 | GCA006715895_00086 | CDS | open | 89717-90820 | _na 367_aa | sfnG | dimethylsulfone monooxygenase SfnG |
| 253 | VFOB01000001.1 | GCA006715895_00087 | CDS | open | 90924-91454 | _na 176_aa | Chalcone isomerase domain-containing protein | |
| 254 | VFOB01000001.1 | GCA006715895_00088 | CDS | open | 91485-92330 | _na 281_aa | Amidohydrolase 2 | |
| 255 | VFOB01000001.1 | GCA006715895_00089 | CDS | open | 92327-93457 | _na 376_aa | ssuD | FMNH2-dependent alkanesulfonate monooxygenase |
| 256 | VFOB01000001.1 | GCA006715895_00090 | CDS | open | 93532-94632 | _na 366_aa | Transcriptional regulator | |
| 257 | VFOB01000001.1 | GCA006715895_00091 | CDS | open | 94642-95829 | _na 395_aa | FMNH2-dependent monooxygenase | |
| 258 | VFOB01000001.1 | GCA006715895_00092 | CDS | open | 95847-96419 | _na 190_aa | msuE | FMN reductase |
| 259 | VFOB01000001.1 | GCA006715895_00093 | CDS | open | 96747-97472 | _na 241_aa | MBL fold metallo-hydrolase | |
| 260 | VFOB01000001.1 | GCA006715895_00094 | CDS | open | 97652-99253 | _na 533_aa | 5-guanidino-2-oxopentanoate decarboxylase | |
| 261 | VFOB01000001.1 | GCA006715895_00095 | CDS | open | 99352-100740 | _na 462_aa | Sodium:solute symport protein | |
| 262 | VFOB01000001.1 | GCA006715895_00096 | CDS | open | 100875-102386 | _na 503_aa | Cytosine/purine/uracil/thiamine/allantoin permease family protein | |
| 263 | VFOB01000001.1 | GCA006715895_00097 | CDS | open | 102408-102815 | _na 135_aa | Undecaprenyl pyrophosphate synthase | |
| 264 | VFOB01000001.1 | GCA006715895_00098 | CDS | open | 102817-103776 | _na 319_aa | speB | agmatinase |
| 265 | VFOB01000001.1 | GCA006715895_00099 | CDS | open | 104065-104958 | _na 297_aa | gbuR | LysR family transcriptional regulator GbuR |
| 266 | VFOB01000001.1 | GCA006715895_00100 | CDS | open | 105107-106672 | _na 521_aa | Aerotaxis receptor | |
| 267 | VFOB01000001.1 | GCA006715895_00101 | CDS | open | 106749-107369 | _na 206_aa | tRNA-uridine aminocarboxypropyltransferase | |
| 268 | VFOB01000001.1 | GCA006715895_00102 | CDS | open | 107333-107689 | _na 118_aa | Polysaccharide biosynthesis protein | |
| 269 | VFOB01000001.1 | GCA006715895_00103 | CDS | open | 107686-108384 | _na 232_aa | CTP synthase (glutamine hydrolyzing) | |
| 270 | VFOB01000001.1 | GCA006715895_00104 | CDS | open | 108469-109371 | _na 300_aa | lysR | Transcriptional regulator%2C LysR family |
| 271 | VFOB01000001.1 | GCA006715895_00105 | CDS | open | 109594-110514 | _na 306_aa | Transcriptional regulator | |
| 272 | VFOB01000001.1 | GCA006715895_00106 | CDS | open | 110627-111385 | _na 252_aa | Reductase | |
| 273 | VFOB01000001.1 | GCA006715895_00107 | CDS | open | 111441-112256 | _na 271_aa | DUF4344 domain-containing protein | |
| 274 | VFOB01000001.1 | GCA006715895_00108 | CDS | open | 112509-112853 | _na 114_aa | (S)-ureidoglycine aminohydrolase cupin domain-containing protein | |
| 275 | VFOB01000001.1 | GCA006715895_00109 | CDS | open | 112984-114510 | _na 508_aa | bchE | magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase |
| 276 | VFOB01000001.1 | GCA006715895_00110 | CDS | open | 114746-115288 | _na 180_aa | Oxidoreductase molybdopterin-binding domain-containing protein | |
| 277 | VFOB01000001.1 | GCA006715895_00111 | CDS | open | 115291-117267 | _na 658_aa | TonB-dependent receptor | |
| 278 | VFOB01000001.1 | GCA006715895_00112 | CDS | open | 117420-118076 | _na 218_aa | glutathione-specific gamma-glutamylcyclotransferase | |
| 279 | VFOB01000001.1 | GCA006715895_00113 | CDS | open | 118226-119080 | _na 284_aa | folD | bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD |
| 280 | VFOB01000001.1 | GCA006715895_00117 | CDS | open | 120050-121360 | _na 436_aa | tig | trigger factor |
| 281 | VFOB01000001.1 | GCA006715895_00118 | CDS | open | 121455-122099 | _na 214_aa | clpP | ATP-dependent Clp endopeptidase proteolytic subunit ClpP |
| 282 | VFOB01000001.1 | GCA006715895_00119 | CDS | open | 122209-123489 | _na 426_aa | clpX | ATP-dependent Clp protease ATP-binding subunit ClpX |
| 283 | VFOB01000001.1 | GCA006715895_00120 | CDS | open | 123622-126018 | _na 798_aa | lon | endopeptidase La |
| 284 | VFOB01000001.1 | GCA006715895_00121 | CDS | open | 126155-126427 | _na 90_aa | hupB | nucleoid-associated protein HU-beta |
| 285 | VFOB01000001.1 | GCA006715895_00122 | CDS | open | 126638-128512 | _na 624_aa | ppiD | Periplasmic chaperone PpiD |
| 286 | VFOB01000001.1 | GCA006715895_00123 | CDS | open | 128612-129406 | _na 264_aa | Enoyl-[acyl-carrier-protein] reductase [NADH] | |
| 287 | VFOB01000001.1 | GCA006715895_00124 | CDS | open | 129419-131026 | _na 535_aa | cntF | staphylopine uptake ABC transporter ATP-binding protein CntF |
| 288 | VFOB01000001.1 | GCA006715895_00125 | CDS | open | 131028-132047 | _na 339_aa | yejE | Inner membrane ABC transporter permease protein YejE |
| 289 | VFOB01000001.1 | GCA006715895_00126 | CDS | open | 132049-133134 | _na 361_aa | yejB | Microcin C ABC transporter permease YejB |
| 290 | VFOB01000001.1 | GCA006715895_00127 | CDS | open | 133134-135002 | _na 622_aa | ABC transporter%2C periplasmic substrate-binding protein | |
| 291 | VFOB01000001.1 | GCA006715895_00128 | CDS | open | 134999-136828 | _na 609_aa | oppA | Oligopeptide ABC transporter%2C periplasmic oligopeptide-binding protein OppA |
| 292 | VFOB01000001.1 | GCA006715895_00129 | CDS | open | 137000-138508 | _na 502_aa | HDOD domain-containing protein | |
| 293 | VFOB01000001.1 | GCA006715895_00130 | CDS | open | 138496-140016 | _na 506_aa | Membrane-bound lytic murein transglycosylase D | |
| 294 | VFOB01000001.1 | GCA006715895_00131 | CDS | open | 140180-140959 | _na 259_aa | gloB | hydroxyacylglutathione hydrolase |
| 295 | VFOB01000001.1 | GCA006715895_00132 | CDS | open | 141088-141852 | _na 254_aa | SAM-dependent methyltransferase | |
| 296 | VFOB01000001.1 | GCA006715895_00133 | CDS | open | 141853-142296 | _na 147_aa | rnhA | ribonuclease HI |
| 297 | VFOB01000001.1 | GCA006715895_00134 | CDS | open | 142355-143092 | _na 245_aa | dnaQ | DNA polymerase III subunit epsilon |
| 298 | VFOB01000001.1 | GCA006715895_00135 | CDS | open | 143190-145472 | _na 760_aa | Lysine decarboxylase%2C inducible | |
| 299 | VFOB01000001.1 | GCA006715895_00136 | CDS | open | 145490-146848 | _na 452_aa | Arginine/agmatine antiporter | |
| 300 | VFOB01000001.1 | GCA006715895_00137 | CDS | open | 146975-147787 | _na 270_aa | crotonase/enoyl-CoA hydratase family protein | |
| 301 | VFOB01000001.1 | GCA006715895_00138 | CDS | open | 147827-149506 | _na 559_aa | Ferrous iron transporter B | |
| 302 | VFOB01000001.1 | GCA006715895_00139 | CDS | open | 149508-150341 | _na 277_aa | nudC | NAD(+) diphosphatase |
| 303 | VFOB01000001.1 | GCA006715895_00140 | CDS | open | 150318-151094 | _na 258_aa | putative membrane transporter protein | |
| 304 | VFOB01000001.1 | GCA006715895_00141 | CDS | open | 151194-151844 | _na 216_aa | Cation/multidrug efflux pump | |
| 305 | VFOB01000001.1 | GCA006715895_00142 | CDS | open | 151981-153324 | _na 447_aa | Glutamine synthetase family protein | |
| 306 | VFOB01000001.1 | GCA006715895_00143 | CDS | open | 153441-154751 | _na 436_aa | Transporter%2C MFS superfamily | |
| 307 | VFOB01000001.1 | GCA006715895_00144 | CDS | open | 154771-155460 | _na 229_aa | ycgR | Flagellar brake protein YcgR |
| 308 | VFOB01000001.1 | GCA006715895_00145 | CDS | open | 155603-156070 | _na 155_aa | flgN | Flagella synthesis protein FlgN |
| 309 | VFOB01000001.1 | GCA006715895_00146 | CDS | open | 156120-156455 | _na 111_aa | flgM | flagellar biosynthesis anti-sigma factor FlgM |
| 310 | VFOB01000001.1 | GCA006715895_00147 | CDS | open | 156612-157373 | _na 253_aa | flgA | Flagella basal body P-ring formation protein FlgA |
| 311 | VFOB01000001.1 | GCA006715895_00148 | CDS | open | 157454-158386 | _na 310_aa | cheV | Chemotaxis protein CheV |
| 312 | VFOB01000001.1 | GCA006715895_00149 | CDS | open | 158413-159258 | _na 281_aa | cheR | protein-glutamate O-methyltransferase CheR |
| 313 | VFOB01000001.1 | GCA006715895_00150 | CDS | open | 159525-159932 | _na 135_aa | flgB | flagellar basal body rod protein FlgB |
| 314 | VFOB01000001.1 | GCA006715895_00151 | CDS | open | 159944-160396 | _na 150_aa | flgC | flagellar basal body rod protein FlgC |
| 315 | VFOB01000001.1 | GCA006715895_00152 | CDS | open | 160417-161094 | _na 225_aa | flgD | flagellar hook assembly protein FlgD |
| 316 | VFOB01000001.1 | GCA006715895_00153 | CDS | open | 161128-162441 | _na 437_aa | flgE | flagellar hook protein FlgE |
| 317 | VFOB01000001.1 | GCA006715895_00154 | CDS | open | 162659-163399 | _na 246_aa | flgF | Flagellar basal-body rod protein FlgF |
| 318 | VFOB01000001.1 | GCA006715895_00155 | CDS | open | 163446-164231 | _na 261_aa | flgG | flagellar basal-body rod protein FlgG |
| 319 | VFOB01000001.1 | GCA006715895_00156 | CDS | open | 164251-164964 | _na 237_aa | flgH | flagellar basal body L-ring protein FlgH |
| 320 | VFOB01000001.1 | GCA006715895_00157 | CDS | open | 164979-166079 | _na 366_aa | Flagellar P-ring protein | |
| 321 | VFOB01000001.1 | GCA006715895_00158 | CDS | open | 166090-167268 | _na 392_aa | flgJ | flagellar assembly peptidoglycan hydrolase FlgJ |
| 322 | VFOB01000001.1 | GCA006715895_00159 | CDS | open | 167278-169302 | _na 674_aa | flgK | flagellar hook-associated protein FlgK |
| 323 | VFOB01000001.1 | GCA006715895_00160 | CDS | open | 169315-170619 | _na 434_aa | flgL | flagellar hook-associated protein FlgL |
| 324 | VFOB01000001.1 | GCA006715895_00161 | CDS | open | 170804-171799 | _na 331_aa | pseB | UDP-N-acetylglucosamine 4%2C6-dehydratase (inverting) |
| 325 | VFOB01000001.1 | GCA006715895_00162 | CDS | open | 171802-172959 | _na 385_aa | pseC | UDP-4-amino-4%2C6-dideoxy-N-acetyl-beta-L-altrosamine transaminase |
| 326 | VFOB01000001.1 | GCA006715895_00163 | CDS | open | 172972-173592 | _na 206_aa | Pseudaminic acid biosynthesis-associated methylase | |
| 327 | VFOB01000001.1 | GCA006715895_00164 | CDS | open | 173589-174293 | _na 234_aa | pseF | pseudaminic acid cytidylyltransferase |
| 328 | VFOB01000001.1 | GCA006715895_00165 | CDS | open | 174294-175793 | _na 499_aa | pseG | UDP-2%2C4-diacetamido-2%2C4%2C6-trideoxy-beta-L-altropyranose hydrolase |
| 329 | VFOB01000001.1 | GCA006715895_00166 | CDS | open | 175790-176854 | _na 354_aa | pseI | pseudaminic acid synthase |
| 330 | VFOB01000001.1 | GCA006715895_00167 | CDS | open | 176851-177462 | _na 203_aa | hisH | imidazole glycerol phosphate synthase subunit HisH |
| 331 | VFOB01000001.1 | GCA006715895_00168 | CDS | open | 177459-178265 | _na 268_aa | imidazole glycerol-phosphate synthase | |
| 332 | VFOB01000001.1 | GCA006715895_00169 | CDS | open | 178276-179469 | _na 397_aa | pseA | Flagellin modification protein%2C PseA |
| 333 | VFOB01000001.1 | GCA006715895_00170 | CDS | open | 179481-180494 | _na 337_aa | SAM-dependent methyltransferase | |
| 334 | VFOB01000001.1 | GCA006715895_00171 | CDS | open | 180487-181257 | _na 256_aa | Phytanoyl-CoA dioxygenase | |
| 335 | VFOB01000001.1 | GCA006715895_00172 | CDS | open | 181367-181894 | _na 175_aa | hypothetical protein | |
| 336 | VFOB01000001.1 | GCA006715895_00173 | CDS | open | 181900-185829 | _na 1309_aa | Glycosyltransferase%2C GT2 family | |
| 337 | VFOB01000001.1 | GCA006715895_00174 | CDS | open | 186076-187539 | _na 487_aa | Flagellin | |
| 338 | VFOB01000001.1 | GCA006715895_00175 | CDS | open | 187620-188006 | _na 128_aa | flaG | Flagellar protein FlaG |
| 339 | VFOB01000001.1 | GCA006715895_00176 | CDS | open | 188086-189537 | _na 483_aa | Flagellar hook-associated protein 2 | |
| 340 | VFOB01000001.1 | GCA006715895_00177 | CDS | open | 189659-190042 | _na 127_aa | fliS | flagellar export chaperone FliS |
| 341 | VFOB01000001.1 | GCA006715895_00178 | CDS | open | 190053-190352 | _na 99_aa | fliT | Flagellar protein FliT |
| 342 | VFOB01000001.1 | GCA006715895_00179 | CDS | open | 190562-192034 | _na 490_aa | fleQ | Transcriptional regulator FleQ |
| 343 | VFOB01000001.1 | GCA006715895_00180 | CDS | open | 192145-193356 | _na 403_aa | histidine kinase | |
| 344 | VFOB01000001.1 | GCA006715895_00181 | CDS | open | 193361-194779 | _na 472_aa | Sigma-54-dependent Fis family transcriptional regulator | |
| 345 | VFOB01000001.1 | GCA006715895_00182 | CDS | open | 194967-195302 | _na 111_aa | fliE | flagellar hook-basal body complex protein FliE |
| 346 | VFOB01000001.1 | GCA006715895_00183 | CDS | open | 195319-197106 | _na 595_aa | fliF | flagellar basal-body MS-ring/collar protein FliF |
| 347 | VFOB01000001.1 | GCA006715895_00184 | CDS | open | 197099-198115 | _na 338_aa | fliG | flagellar motor switch protein FliG |
| 348 | VFOB01000001.1 | GCA006715895_00185 | CDS | open | 198126-198935 | _na 269_aa | fliH | flagellar assembly protein FliH |
| 349 | VFOB01000001.1 | GCA006715895_00186 | CDS | open | 198925-200283 | _na 452_aa | fliI | flagellar protein export ATPase FliI |
| 350 | VFOB01000001.1 | GCA006715895_00187 | CDS | open | 200290-200739 | _na 149_aa | fliJ | flagellar export protein FliJ |
| 351 | VFOB01000001.1 | GCA006715895_00188 | CDS | open | 200817-201122 | _na 101_aa | STAS domain-containing protein | |
| 352 | VFOB01000001.1 | GCA006715895_00189 | CDS | open | 201130-202824 | _na 564_aa | Serine phosphatase RsbU%2C regulator of sigma subunit | |
| 353 | VFOB01000001.1 | GCA006715895_00190 | CDS | open | 202907-203209 | _na 100_aa | HPt domain-containing protein | |
| 354 | VFOB01000001.1 | GCA006715895_00191 | CDS | open | 203275-204612 | _na 445_aa | fliK | Flagellar hook-length control protein FliK |
| 355 | VFOB01000001.1 | GCA006715895_00192 | CDS | open | 204802-205329 | _na 175_aa | fliL | flagellar basal body-associated protein FliL |
| 356 | VFOB01000001.1 | GCA006715895_00193 | CDS | open | 205342-206313 | _na 323_aa | fliM | flagellar motor switch protein FliM |
| 357 | VFOB01000001.1 | GCA006715895_00194 | CDS | open | 206349-206822 | _na 157_aa | fliN | Flagellar motor switch protein FliN |
| 358 | VFOB01000001.1 | GCA006715895_00195 | CDS | open | 206825-207295 | _na 156_aa | fliO | flagellar biosynthetic protein FliO |
| 359 | VFOB01000001.1 | GCA006715895_00196 | CDS | open | 207295-208050 | _na 251_aa | fliP | flagellar type III secretion system pore protein FliP |
| 360 | VFOB01000001.1 | GCA006715895_00197 | CDS | open | 208053-208322 | _na 89_aa | fliQ | flagellar biosynthesis protein FliQ |
| 361 | VFOB01000001.1 | GCA006715895_00198 | CDS | open | 208324-209100 | _na 258_aa | fliR | flagellar biosynthetic protein FliR |
| 362 | VFOB01000001.1 | GCA006715895_00199 | CDS | open | 209161-210297 | _na 378_aa | flhB | flagellar biosynthesis protein FlhB |
| 363 | VFOB01000001.1 | GCA006715895_00200 | CDS | open | 210450-212573 | _na 707_aa | flhA | flagellar biosynthesis protein FlhA |
| 364 | VFOB01000001.1 | GCA006715895_00201 | CDS | open | 212589-213935 | _na 448_aa | flhF | flagellar biosynthesis protein FlhF |
| 365 | VFOB01000001.1 | GCA006715895_00202 | CDS | open | 214011-214844 | _na 277_aa | fleN | flagellar synthesis regulator FleN |
| 366 | VFOB01000001.1 | GCA006715895_00203 | CDS | open | 214868-215587 | _na 239_aa | fliA | RNA polymerase sigma factor FliA |
| 367 | VFOB01000001.1 | GCA006715895_00204 | CDS | open | 215670-216044 | _na 124_aa | cheY | chemotaxis protein CheY |
| 368 | VFOB01000001.1 | GCA006715895_00205 | CDS | open | 216064-216849 | _na 261_aa | cheZ | Protein phosphatase CheZ |
| 369 | VFOB01000001.1 | GCA006715895_00206 | CDS | open | 216862-219180 | _na 772_aa | histidine kinase | |
| 370 | VFOB01000001.1 | GCA006715895_00207 | CDS | open | 219223-220335 | _na 370_aa | Protein-glutamate methylesterase/protein-glutamine glutaminase | |
| 371 | VFOB01000001.1 | GCA006715895_00208 | CDS | open | 220353-221093 | _na 246_aa | flagellar motor protein | |
| 372 | VFOB01000001.1 | GCA006715895_00209 | CDS | open | 221106-221990 | _na 294_aa | motD | flagellar motor protein MotD |
| 373 | VFOB01000001.1 | GCA006715895_00210 | CDS | open | 222031-222819 | _na 262_aa | Cobyrinic acid a%2Cc-diamide synthase | |
| 374 | VFOB01000001.1 | GCA006715895_00211 | CDS | open | 222910-223779 | _na 289_aa | cheW | CheW domain protein |
| 375 | VFOB01000001.1 | GCA006715895_00212 | CDS | open | 223881-224360 | _na 159_aa | cheW | purine-binding chemotaxis protein |
| 376 | VFOB01000001.1 | GCA006715895_00213 | CDS | open | 224362-224772 | _na 136_aa | Methyl-accepting chemotaxis protein | |
| 377 | VFOB01000001.1 | GCA006715895_00214 | CDS | open | 224876-225304 | _na 142_aa | Rhodanese domain-containing protein | |
| 378 | VFOB01000001.1 | GCA006715895_00215 | CDS | open | 225294-225626 | _na 110_aa | flhB | Flagellar biosynthetic protein FlhB |
| 379 | VFOB01000001.1 | GCA006715895_00216 | CDS | open | 225623-227170 | _na 515_aa | Flagellar hook-length control protein-like C-terminal domain-containing protein | |
| 380 | VFOB01000001.1 | GCA006715895_00217 | CDS | open | 227319-227954 | _na 211_aa | ccmA | cytochrome c biogenesis heme-transporting ATPase CcmA |
| 381 | VFOB01000001.1 | GCA006715895_00218 | CDS | open | 227951-228622 | _na 223_aa | ccmB | heme exporter protein CcmB |
| 382 | VFOB01000001.1 | GCA006715895_00219 | CDS | open | 228694-229449 | _na 251_aa | Heme exporter protein C | |
| 383 | VFOB01000001.1 | GCA006715895_00220 | CDS | open | 229479-229622 | _na 47_aa | ccmD | heme exporter protein CcmD |
| 384 | VFOB01000001.1 | GCA006715895_00221 | CDS | open | 229619-230068 | _na 149_aa | ccmE | cytochrome c maturation protein CcmE |
| 385 | VFOB01000001.1 | GCA006715895_00222 | CDS | open | 230072-232045 | _na 657_aa | ccmF | Cytochrome c-type biogenesis protein CcmF |
| 386 | VFOB01000001.1 | GCA006715895_00223 | CDS | open | 232042-232578 | _na 178_aa | dsbE | Thiol--disulfide interchange protein DsbE |
| 387 | VFOB01000001.1 | GCA006715895_00224 | CDS | open | 232575-233060 | _na 161_aa | Cytochrome c-type biogenesis protein | |
| 388 | VFOB01000001.1 | GCA006715895_00225 | CDS | open | 233060-234268 | _na 402_aa | ccmH | Cytochrome c heme lyase subunit CcmH |
| 389 | VFOB01000001.1 | GCA006715895_00226 | CDS | open | 234292-234675 | _na 127_aa | ccmH | Cytochrome c heme lyase subunit CcmH |
| 390 | VFOB01000001.1 | GCA006715895_00227 | CDS | open | 234767-235330 | _na 187_aa | DUF4124 domain-containing protein | |
| 391 | VFOB01000001.1 | GCA006715895_00228 | CDS | open | 235353-236156 | _na 267_aa | luxR | Transcriptional regulator%2C LuxR family |
| 392 | VFOB01000001.1 | GCA006715895_00229 | CDS | open | 236355-237719 | _na 454_aa | Amino acid permease | |
| 393 | VFOB01000001.1 | GCA006715895_00230 | CDS | open | 237736-238830 | _na 364_aa | D-aminopeptidase | |
| 394 | VFOB01000001.1 | GCA006715895_00231 | CDS | open | 238868-239866 | _na 332_aa | Sulfate ABC transporter substrate-binding protein | |
| 395 | VFOB01000001.1 | GCA006715895_00232 | CDS | open | 239949-240632 | _na 227_aa | N-methyl-D-aspartate receptor NMDAR2C subunit | |
| 396 | VFOB01000001.1 | GCA006715895_00233 | CDS | open | 240661-241587 | _na 308_aa | Eukaryotic-type low-affinity urea transporter | |
| 397 | VFOB01000001.1 | GCA006715895_00234 | CDS | open | 241707-243122 | _na 471_aa | pyk | pyruvate kinase |
| 398 | VFOB01000001.1 | GCA006715895_00235 | CDS | open | 243112-244392 | _na 426_aa | D-glycerate 2-kinase | |
| 399 | VFOB01000001.1 | GCA006715895_00236 | CDS | open | 244615-245505 | _na 296_aa | 2-hydroxy-3-oxopropionate reductase | |
| 400 | VFOB01000001.1 | GCA006715895_00237 | CDS | open | 245522-246304 | _na 260_aa | hyi | hydroxypyruvate isomerase |
| 401 | VFOB01000001.1 | GCA006715895_00238 | CDS | open | 246365-248140 | _na 591_aa | gcl | glyoxylate carboligase |
| 402 | VFOB01000001.1 | GCA006715895_00239 | CDS | open | 248478-248918 | _na 146_aa | glcG | GlcG protein |
| 403 | VFOB01000001.1 | GCA006715895_00240 | CDS | open | 249052-250488 | _na 478_aa | rtcB | tRNA-splicing ligase RtcB |
| 404 | VFOB01000001.1 | GCA006715895_00241 | CDS | open | 250496-251125 | _na 209_aa | rutR | Transcriptional regulator RutR of pyrimidine catabolism (TetR family) |
| 405 | VFOB01000001.1 | GCA006715895_00242 | CDS | open | 251347-252342 | _na 331_aa | moaA | GTP 3'%2C8-cyclase MoaA |
| 406 | VFOB01000001.1 | GCA006715895_00243 | CDS | open | 252489-253847 | _na 452_aa | ssnA | 8-oxoguanine deaminase |
| 407 | VFOB01000001.1 | GCA006715895_00244 | CDS | open | 253844-254686 | _na 280_aa | Solute-binding protein family 3/N-terminal domain-containing protein | |
| 408 | VFOB01000001.1 | GCA006715895_00245 | CDS | open | 254791-255240 | _na 149_aa | DUF2383 domain-containing protein | |
| 409 | VFOB01000001.1 | GCA006715895_00246 | CDS | open | 255301-256122 | _na 273_aa | Nucleoside-specific outer membrane channel protein Tsx | |
| 410 | VFOB01000001.1 | GCA006715895_00247 | CDS | open | 256627-257970 | _na 447_aa | Xanthine permease | |
| 411 | VFOB01000001.1 | GCA006715895_00248 | CDS | open | 258194-259465 | _na 423_aa | Cytochrome c domain-containing protein | |
| 412 | VFOB01000001.1 | GCA006715895_00249 | CDS | open | 259517-260020 | _na 167_aa | allA | ureidoglycolate lyase |
| 413 | VFOB01000001.1 | GCA006715895_00250 | CDS | open | 260396-260911 | _na 171_aa | 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase | |
| 414 | VFOB01000001.1 | GCA006715895_00251 | CDS | open | 260911-261837 | _na 308_aa | Uricase (Urate oxidase) | |
| 415 | VFOB01000001.1 | GCA006715895_00252 | CDS | open | 262236-262589 | _na 117_aa | uraH | hydroxyisourate hydrolase |
| 416 | VFOB01000001.1 | GCA006715895_00253 | CDS | open | 262730-263467 | _na 245_aa | prtR | HTH-type transcriptional regulator PrtR |
| 417 | VFOB01000001.1 | GCA006715895_00254 | CDS | open | 263823-264095 | _na 90_aa | Secreted protein | |
| 418 | VFOB01000001.1 | GCA006715895_00255 | CDS | open | 264142-265491 | _na 449_aa | Putative NCS2 family transporter | |
| 419 | VFOB01000001.1 | GCA006715895_00256 | CDS | open | 265805-267097 | _na 430_aa | C4-dicarboxylate transport protein 1 | |
| 420 | VFOB01000001.1 | GCA006715895_00257 | CDS | open | 267169-267873 | _na 234_aa | gntR | Transcriptional regulator%2C GntR family |
| 421 | VFOB01000001.1 | GCA006715895_00258 | CDS | open | 268011-268778 | _na 255_aa | gntR | Transcriptional regulator%2C GntR family |
| 422 | VFOB01000001.1 | GCA006715895_00259 | CDS | open | 268833-269012 | _na 59_aa | PA1571 family protein | |
| 423 | VFOB01000001.1 | GCA006715895_00260 | CDS | open | 269193-270323 | _na 376_aa | ATP-NAD kinase | |
| 424 | VFOB01000001.1 | GCA006715895_00261 | CDS | open | 270652-271242 | _na 196_aa | DUF1287 domain-containing protein | |
| 425 | VFOB01000001.1 | GCA006715895_00262 | CDS | open | 271285-271725 | _na 146_aa | DUF393 domain-containing protein | |
| 426 | VFOB01000001.1 | GCA006715895_00263 | CDS | open | 271712-272119 | _na 135_aa | doxX | DoxX family protein |
| 427 | VFOB01000001.1 | GCA006715895_00264 | CDS | open | 272132-273919 | _na 595_aa | ABC transporter ATP-binding protein/permease | |
| 428 | VFOB01000001.1 | GCA006715895_00265 | CDS | open | 273930-275036 | _na 368_aa | Saccharopine dehydrogenase | |
| 429 | VFOB01000001.1 | GCA006715895_00266 | CDS | open | 275092-275373 | _na 93_aa | Pyrimidine/purine nucleoside phosphorylase | |
| 430 | VFOB01000001.1 | GCA006715895_00267 | CDS | open | 275441-276001 | _na 186_aa | kinA | Inhibitor of the KinA pathway to sporulation%2C putative exonuclease |
| 431 | VFOB01000001.1 | GCA006715895_00268 | CDS | open | 276123-276989 | _na 288_aa | 2-hydroxy-3-oxopropionate reductase | |
| 432 | VFOB01000001.1 | GCA006715895_00269 | CDS | open | 276994-277335 | _na 113_aa | Transmembrane signal peptide protein | |
| 433 | VFOB01000001.1 | GCA006715895_00270 | CDS | open | 277405-278139 | _na 244_aa | hypothetical protein | |
| 434 | VFOB01000001.1 | GCA006715895_00271 | CDS | open | 278572-279180 | _na 202_aa | START domain-containing protein | |
| 435 | VFOB01000001.1 | GCA006715895_00272 | CDS | open | 279239-280525 | _na 428_aa | gltA | citrate synthase |
| 436 | VFOB01000001.1 | GCA006715895_00273 | CDS | open | 280887-281261 | _na 124_aa | sdhC | succinate dehydrogenase%2C cytochrome b556 subunit |
| 437 | VFOB01000001.1 | GCA006715895_00274 | CDS | open | 281255-281623 | _na 122_aa | sdhD | succinate dehydrogenase%2C hydrophobic membrane anchor protein |
| 438 | VFOB01000001.1 | GCA006715895_00275 | CDS | open | 281687-283399 | _na 570_aa | sdhA | succinate dehydrogenase flavoprotein subunit |
| 439 | VFOB01000001.1 | GCA006715895_00276 | CDS | open | 283411-284127 | _na 238_aa | sdhB | Fumarate reductase iron-sulfur subunit |
| 440 | VFOB01000001.1 | GCA006715895_00277 | CDS | open | 284374-287205 | _na 943_aa | 2-oxoglutarate dehydrogenase E1 component | |
| 441 | VFOB01000001.1 | GCA006715895_00278 | CDS | open | 287248-288471 | _na 407_aa | odhB | 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase |
| 442 | VFOB01000001.1 | GCA006715895_00279 | CDS | open | 288538-289974 | _na 478_aa | lpdA | dihydrolipoyl dehydrogenase |
| 443 | VFOB01000001.1 | GCA006715895_00280 | CDS | open | 290163-291329 | _na 388_aa | sucC | ADP-forming succinate--CoA ligase subunit beta |
| 444 | VFOB01000001.1 | GCA006715895_00281 | CDS | open | 291329-292216 | _na 295_aa | sucD | succinate--CoA ligase subunit alpha |
| 445 | VFOB01000001.1 | GCA006715895_00282 | CDS | open | 292499-293812 | _na 437_aa | brnQ | branched-chain amino acid transport system II carrier protein |
| 446 | VFOB01000001.1 | GCA006715895_00283 | CDS | open | 293867-294130 | _na 87_aa | hypothetical protein | |
| 447 | VFOB01000001.1 | GCA006715895_00284 | CDS | open | 294138-294356 | _na 72_aa | hypothetical protein | |
| 448 | VFOB01000001.1 | GCA006715895_00285 | CDS | open | 294661-295383 | _na 240_aa | amidotransferase | |
| 449 | VFOB01000001.1 | GCA006715895_00286 | CDS | open | 295457-296428 | _na 323_aa | corA | Magnesium and cobalt transport protein CorA |
| 450 | VFOB01000001.1 | GCA006715895_00287 | CDS | open | 296523-297242 | _na 239_aa | 1-acyl-sn-glycerol-3-phosphate acyltransferase | |
| 451 | VFOB01000001.1 | GCA006715895_00288 | CDS | open | 297318-298151 | _na 277_aa | Solute-binding protein family 3/N-terminal domain-containing protein | |
| 452 | VFOB01000001.1 | GCA006715895_00289 | CDS | open | 298191-300074 | _na 627_aa | Methyl-accepting chemotaxis protein | |
| 453 | VFOB01000001.1 | GCA006715895_00290 | CDS | open | 300289-300978 | _na 229_aa | crotonase/enoyl-CoA hydratase family protein | |
| 454 | VFOB01000001.1 | GCA006715895_00291 | CDS | open | 301181-301399 | _na 72_aa | hypothetical protein | |
| 455 | VFOB01000001.1 | GCA006715895_00293 | CDS | open | 301775-302434 | _na 219_aa | PIN-like domain-containing protein | |
| 456 | VFOB01000001.1 | GCA006715895_00294 | CDS | open | 302573-303157 | _na 194_aa | Ribosomal-protein-alanine N-acetyltransferase | |
| 457 | VFOB01000001.1 | GCA006715895_00295 | CDS | open | 303161-304006 | _na 281_aa | Alpha/beta hydrolase | |
| 458 | VFOB01000001.1 | GCA006715895_00296 | CDS | open | 304020-306818 | _na 932_aa | Autotransporter domain-containing protein | |
| 459 | VFOB01000001.1 | GCA006715895_00297 | CDS | open | 307081-307371 | _na 96_aa | hypothetical protein | |
| 460 | VFOB01000001.1 | GCA006715895_00298 | CDS | open | 307384-307800 | _na 138_aa | Lipoprotein | |
| 461 | VFOB01000001.1 | GCA006715895_00299 | CDS | open | 307814-308413 | _na 199_aa | DUF4136 domain-containing protein | |
| 462 | VFOB01000001.1 | GCA006715895_00300 | CDS | open | 308617-309702 | _na 361_aa | Lipoprotein | |
| 463 | VFOB01000001.1 | GCA006715895_00301 | CDS | open | 309929-310927 | _na 332_aa | Calcium-binding protein | |
| 464 | VFOB01000001.1 | GCA006715895_00302 | CDS | open | 311105-311692 | _na 195_aa | Signal peptide protein | |
| 465 | VFOB01000001.1 | GCA006715895_00303 | CDS | open | 311967-312308 | _na 113_aa | Regulator of ribonuclease activity B domain-containing protein | |
| 466 | VFOB01000001.1 | GCA006715895_00304 | CDS | open | 312375-313397 | _na 340_aa | araC | Transcriptional regulator%2C AraC family |
| 467 | VFOB01000001.1 | GCA006715895_00305 | CDS | open | 313535-315004 | _na 489_aa | Cyclohexanone monooxygenase | |
| 468 | VFOB01000001.1 | GCA006715895_00306 | CDS | open | 314988-315932 | _na 314_aa | Putative esterase | |
| 469 | VFOB01000001.1 | GCA006715895_00307 | CDS | open | 315934-316695 | _na 253_aa | SDR family oxidoreductase | |
| 470 | VFOB01000001.1 | GCA006715895_00308 | CDS | open | 316767-317642 | _na 291_aa | Permease of the drug/metabolite transporter (DMT) superfamily | |
| 471 | VFOB01000001.1 | GCA006715895_00309 | CDS | open | 317701-318417 | _na 238_aa | Glutamine amidotransferase class-I | |
| 472 | VFOB01000001.1 | GCA006715895_00310 | CDS | open | 318736-320145 | _na 469_aa | Circularly permuted ATP-grasp type 2 domain-containing protein | |
| 473 | VFOB01000001.1 | GCA006715895_00311 | CDS | open | 320148-321098 | _na 316_aa | DUF403 domain-containing protein | |
| 474 | VFOB01000001.1 | GCA006715895_00312 | CDS | open | 321095-321898 | _na 267_aa | Transglutaminase | |
| 475 | VFOB01000001.1 | GCA006715895_00313 | CDS | open | 322025-322756 | _na 243_aa | Proteasome-type protease | |
| 476 | VFOB01000001.1 | GCA006715895_00314 | CDS | open | 322867-323637 | _na 256_aa | Membrane-anchored protein | |
| 477 | VFOB01000001.1 | GCA006715895_00315 | CDS | open | 323867-325522 | _na 551_aa | Putative membrane protein | |
| 478 | VFOB01000001.1 | GCA006715895_00316 | CDS | open | 325555-326829 | _na 424_aa | histidine kinase | |
| 479 | VFOB01000001.1 | GCA006715895_00317 | CDS | open | 326860-327735 | _na 291_aa | Strictosidine synthase conserved region domain-containing protein | |
| 480 | VFOB01000001.1 | GCA006715895_00318 | CDS | open | 327997-328428 | _na 143_aa | Thiol-disulfide oxidoreductase | |
| 481 | VFOB01000001.1 | GCA006715895_00319 | CDS | open | 328503-329807 | _na 434_aa | methyl-accepting chemotaxis protein | |
| 482 | VFOB01000001.1 | GCA006715895_00320 | CDS | open | 330121-331743 | _na 540_aa | Methyl-accepting chemotaxis protein I (Serine chemoreceptor protein) | |
| 483 | VFOB01000001.1 | GCA006715895_00321 | CDS | open | 332198-332836 | _na 212_aa | tetR | TetR family transcriptional regulator |
| 484 | VFOB01000001.1 | GCA006715895_00322 | CDS | open | 332895-333443 | _na 182_aa | Mesenchymal stem cell protein DSCD75 | |
| 485 | VFOB01000001.1 | GCA006715895_00323 | CDS | open | 333551-334519 | _na 322_aa | araC | Transcriptional regulator%2C AraC family |
| 486 | VFOB01000001.1 | GCA006715895_00324 | CDS | open | 334525-334773 | _na 82_aa | Lipoprotein | |
| 487 | VFOB01000001.1 | GCA006715895_00325 | CDS | open | 334956-335606 | _na 216_aa | bioR | Putative biotin regulatory protein BioR (GntR family) |
| 488 | VFOB01000001.1 | GCA006715895_00326 | CDS | open | 335636-336910 | _na 424_aa | cynX | Cyanate transport protein CynX |
| 489 | VFOB01000001.1 | GCA006715895_00327 | CDS | open | 337286-338308 | _na 340_aa | ABC transporter (Iron-B12siderophore-hemin)%2C permease component | |
| 490 | VFOB01000001.1 | GCA006715895_00328 | CDS | open | 338305-339270 | _na 321_aa | Fe/B12 periplasmic-binding domain-containing protein | |
| 491 | VFOB01000001.1 | GCA006715895_00329 | CDS | open | 339267-340046 | _na 259_aa | ABC transporter (Iron-B12siderophore-hemin)%2C ATP-binding component | |
| 492 | VFOB01000001.1 | GCA006715895_00330 | CDS | open | 340057-342195 | _na 712_aa | TonB-dependent receptor | |
| 493 | VFOB01000001.1 | GCA006715895_00331 | CDS | open | 342626-343255 | _na 209_aa | SAM-dependent methyltransferase | |
| 494 | VFOB01000001.1 | GCA006715895_00332 | CDS | open | 343739-344224 | _na 161_aa | Nitrilotriacetate monooxygenase component B | |
| 495 | VFOB01000001.1 | GCA006715895_00333 | CDS | open | 344545-345951 | _na 468_aa | Cytosine/purine/uracil/thiamine/allantoin permease family protein | |
| 496 | VFOB01000001.1 | GCA006715895_00334 | CDS | open | 346092-346718 | _na 208_aa | LysE-family efflux protein | |
| 497 | VFOB01000001.1 | GCA006715895_00335 | CDS | open | 346776-347582 | _na 268_aa | araC | Transcriptional regulator%2C AraC family |
| 498 | VFOB01000001.1 | GCA006715895_00336 | CDS | open | 347691-348500 | _na 269_aa | AB hydrolase-1 domain-containing protein | |
| 499 | VFOB01000001.1 | GCA006715895_00337 | CDS | open | 348497-349360 | _na 287_aa | Hydrolase%2C alpha/beta fold family | |
| 500 | VFOB01000001.1 | GCA006715895_00338 | CDS | open | 349412-350074 | _na 220_aa | Glutathione S-transferase |

