HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Aggregatibacter actinomycetemcomitans (GCA_008084195.1)

Select a Genome:
BAKTA Annotations for GCA_008084195.1
Genome Selected: Aggregatibacter actinomycetemcomitans
ContigsBases CDSrRNA tmRNAtRNA
27 2134503 2058 4 1 49
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4330 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 4330 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 VSES01000003.1 GCA008084195_01300 gene open 50689-52959 nrdA
1502 VSES01000003.1 GCA008084195_01301 gene open 53262-54734
1503 VSES01000003.1 GCA008084195_01302 gene open 55005-56033 afuA
1504 VSES01000003.1 GCA008084195_01303 gene open 56085-58118 fbpB
1505 VSES01000003.1 GCA008084195_01304 gene open 58102-59142 potA
1506 VSES01000003.1 GCA008084195_01305 gene open 59202-61253 amyA
1507 VSES01000003.1 GCA008084195_01306 gene open 61348-62238 malG
1508 VSES01000003.1 GCA008084195_01307 gene open 62260-63804 malF
1509 VSES01000003.1 GCA008084195_01308 gene open 63928-65118 malE
1510 VSES01000003.1 GCA008084195_01309 gene open 65575-66693 malK
1511 VSES01000003.1 GCA008084195_01310 gene open 66770-68053 lamB
1512 VSES01000003.1 GCA008084195_01311 gene open 68139-69038 malM
1513 VSES01000003.1 GCA008084195_01312 gene open 69416-70147 moeB
1514 VSES01000003.1 GCA008084195_01313 gene open 70163-71377 moeA
1515 VSES01000003.1 GCA008084195_01314 gene open 71506-72162 folE
1516 VSES01000003.1 GCA008084195_01315 gene open 72263-73705 dacB
1517 VSES01000003.1 GCA008084195_01317 gene open 73865-74341 greA
1518 VSES01000003.1 GCA008084195_01318 gene open 74414-74716 yhbY
1519 VSES01000003.1 GCA008084195_01319 gene open 74884-75183
1520 VSES01000003.1 GCA008084195_01320 gene open 75180-75476 pA5055
1521 VSES01000003.1 GCA008084195_01321 gene open 75509-76123 ribC
1522 VSES01000003.1 GCA008084195_01322 gene open 76150-77547 norM
1523 VSES01000003.1 GCA008084195_01324 gene open 77851-78330 ybaK
1524 VSES01000003.1 GCA008084195_01325 gene open 78391-79194
1525 VSES01000003.1 GCA008084195_01326 gene open 79143-79628
1526 VSES01000003.1 GCA008084195_01327 gene open 79603-80400 cysU
1527 VSES01000003.1 GCA008084195_01328 gene open 80400-81017 tauB
1528 VSES01000003.1 GCA008084195_01329 gene open 81014-81874 nadC
1529 VSES01000003.1 GCA008084195_01330 gene open 82170-83618 tldD
1530 VSES01000003.1 GCA008084195_01331 gene open 83669-89440 yfaS
1531 VSES01000003.1 GCA008084195_01332 gene open 89573-90622 yeiH
1532 VSES01000003.1 GCA008084195_01333 gene open 90742-93099 pbpC
1533 VSES01000003.1 GCA008084195_01334 gene open 93209-93883 ulaD
1534 VSES01000003.1 GCA008084195_01335 gene open 93960-94421 ptsN
1535 VSES01000003.1 GCA008084195_01336 gene open 94476-96248 sgaB
1536 VSES01000003.1 GCA008084195_01337 gene open 96596-97687 ulaG
1537 VSES01000003.1 GCA008084195_01338 gene open 97779-98528 ulaR
1538 VSES01000003.1 GCA008084195_01339 gene open 98569-99429 sgaU
1539 VSES01000003.1 GCA008084195_01340 gene open 99423-100118 araD
1540 VSES01000003.1 GCA008084195_01341 gene open 100201-101415 sdaC
1541 VSES01000003.1 GCA008084195_01342 gene open 101710-101904 lacZ
1542 VSES01000003.1 GCA008084195_01343 gene open 102168-102431 grxC
1543 VSES01000003.1 GCA008084195_01344 gene open 102558-103292 nfsA
1544 VSES01000003.1 GCA008084195_01345 gene open 103311-104216 lysX
1545 VSES01000003.1 GCA008084195_01346 gene open 104512-105117
1546 VSES01000003.1 GCA008084195_01347 gene open 105221-106615 fumC
1547 VSES01000003.1 GCA008084195_01348 gene open 106825-107274 holC
1548 VSES01000003.1 GCA008084195_01349 gene open 107804-108232
1549 VSES01000003.1 GCA008084195_01350 gene open 108316-111180 valS
1550 VSES01000003.1 GCA008084195_01351 gene open 111247-112140
1551 VSES01000003.1 GCA008084195_01352 gene open 112757-113038
1552 VSES01000003.1 GCA008084195_01353 gene open 113182-114699 araJ
1553 VSES01000003.1 GCA008084195_01354 gene open 114709-115869 emrA
1554 VSES01000003.1 GCA008084195_01355 gene open 116078-116560 dps
1555 VSES01000003.1 GCA008084195_01356 gene open 116679-118658 rnb
1556 VSES01000003.1 GCA008084195_01357 gene open 118731-119519 fabI
1557 VSES01000003.1 GCA008084195_01358 gene open 119610-120365 nIF3
1558 VSES01000003.1 GCA008084195_01359 gene open 120590-121219 queE
1559 VSES01000003.1 GCA008084195_01360 gene open 121225-121650 queD
1560 VSES01000003.1 GCA008084195_01361 gene open 121840-123348 lysS
1561 VSES01000003.1 GCA008084195_01362 gene open 123405-124307 prfB
1562 VSES01000003.1 GCA008084195_01363 gene open 124671-125354 dsbC
1563 VSES01000003.1 GCA008084195_01364 gene open 125367-127088 recJ
1564 VSES01000003.1 GCA008084195_01365 gene open 127097-127768 dsbA
1565 VSES01000003.1 GCA008084195_01366 gene open 127785-128477 mtnN
1566 VSES01000003.1 GCA008084195_01367 gene open 128656-129351
1567 VSES01000003.1 GCA008084195_01368 gene open 129358-129861
1568 VSES01000003.1 GCA008084195_01369 gene open 129861-130514 cbiM
1569 VSES01000003.1 GCA008084195_01370 gene open 130511-131206 ecfT
1570 VSES01000003.1 GCA008084195_01371 gene open 131172-131795
1571 VSES01000003.1 GCA008084195_01372 gene open 131874-132683 hypB
1572 VSES01000003.1 GCA008084195_01373 gene open 132710-133822 hypD
1573 VSES01000003.1 GCA008084195_01374 gene open 133822-134835 hypE
1574 VSES01000003.1 GCA008084195_01375 gene open 135243-135638
1575 VSES01000003.1 GCA008084195_01376 gene open 136065-136652
1576 VSES01000003.1 GCA008084195_01377 gene open 136801-137616 aroE
1577 VSES01000003.1 GCA008084195_01378 gene open 137766-138650 metF
1578 VSES01000003.1 GCA008084195_01379 gene open 138825-139892 lptG
1579 VSES01000003.1 GCA008084195_01380 gene open 139897-141015 lptF
1580 VSES01000003.1 GCA008084195_01381 gene open 141152-142642 pepB
1581 VSES01000003.1 GCA008084195_01382 gene open 142787-143848 modC
1582 VSES01000003.1 GCA008084195_01383 gene open 143835-144563 modB
1583 VSES01000003.1 GCA008084195_01384 gene open 144642-145406 modA
1584 VSES01000003.1 GCA008084195_01385 gene open 145633-146412 mopI
1585 VSES01000003.1 GCA008084195_01386 gene open 146579-147976 citT
1586 VSES01000003.1 GCA008084195_01387 gene open 148043-148639 yfbR
1587 VSES01000003.1 GCA008084195_01388 gene open 148648-149676 degS
1588 VSES01000003.1 GCA008084195_01389 gene open 149685-150809 ribD
1589 VSES01000003.1 GCA008084195_01390 gene open 150809-151261 nrdR
1590 VSES01000003.1 GCA008084195_01391 gene open 151378-152466 rlmM
1591 VSES01000003.1 GCA008084195_01392 gene open 152459-153364 lysR
1592 VSES01000003.1 GCA008084195_01394 gene open 153826-154845 ilvE
1593 VSES01000003.1 GCA008084195_01395 gene open 155213-155953
1594 VSES01000003.1 GCA008084195_01396 gene open 156109-157044 mdh
1595 VSES01000003.1 GCA008084195_01397 gene open 157300-157767 argR
1596 VSES01000003.1 GCA008084195_01398 gene open 157791-158678 yfcH
1597 VSES01000003.1 GCA008084195_01399 gene open 158869-159450 rsxA
1598 VSES01000003.1 GCA008084195_01400 gene open 159450-160040 rsxB
1599 VSES01000003.1 GCA008084195_01401 gene open 160041-161993 rsxC
1600 VSES01000003.1 GCA008084195_01402 gene open 162004-163083 rsxD
1601 VSES01000003.1 GCA008084195_01403 gene open 163090-163710 rsxG
1602 VSES01000003.1 GCA008084195_01404 gene open 163703-164488 rnfE
1603 VSES01000003.1 GCA008084195_01406 gene open 164635-165270 nth
1604 VSES01000003.1 GCA008084195_01407 gene open 165295-166662 yocR
1605 VSES01000003.1 GCA008084195_01408 gene open 167057-167842 znuB
1606 VSES01000003.1 GCA008084195_01409 gene open 167854-168627 znuC
1607 VSES01000003.1 GCA008084195_01410 gene open 168816-170348 mepM
1608 VSES01000003.1 GCA008084195_01411 gene open 170456-171214 ceuD
1609 VSES01000003.1 GCA008084195_01412 gene open 171226-172167 ceuC
1610 VSES01000003.1 GCA008084195_01413 gene open 172157-173122 ceuB
1611 VSES01000003.1 GCA008084195_01414 gene open 173182-174081 ceuA
1612 VSES01000003.1 GCA008084195_01415 gene open 174310-176286 cpdB
1613 VSES01000003.1 GCA008084195_01416 gene open 176360-177277 fdhE
1614 VSES01000003.1 GCA008084195_01417 gene open 177391-177525
1615 VSES01000003.1 GCA008084195_01418 gene open 177650-177883 ydeI
1616 VSES01000003.1 GCA008084195_01419 gene open 177884-178066 ydeI
1617 VSES01000003.1 GCA008084195_01420 gene open 178200-178532
1618 VSES01000003.1 GCA008084195_01421 gene open 178545-178790
1619 VSES01000003.1 GCA008084195_01422 gene open 178794-179000
1620 VSES01000003.1 GCA008084195_01423 gene open 179000-181780
1621 VSES01000003.1 GCA008084195_01267 gene open 22092-22167 trnG
1622 VSES01000003.1 GCA008084195_01267 tRNA open 22092-22167 trnG tRNA-Gly(gcc)
1623 VSES01000004.1 GCA008084195_01464 gene open 34672-34773 AaHKsRNA22
1624 VSES01000004.1 GCA008084195_01572 gene open 119458-119534 AaHKsRNA20
1625 VSES01000004.1 GCA008084195_01464 ncRNA open 34672-34773 Aggregatibacter sRNA 22
1626 VSES01000004.1 GCA008084195_01572 ncRNA open 119458-119534 Aggregatibacter sRNA 20
1627 VSES01000004.1 GCA008084195_01424 CDS open 14-634 _na     206_aa type IV secretory system conjugative DNA transfer family protein
1628 VSES01000004.1 GCA008084195_01425 CDS open 668-1105 _na     145_aa Cag pathogenicity island Cag12 family protein
1629 VSES01000004.1 GCA008084195_01426 CDS open 1089-1421 _na     110_aa TrbM-like protein
1630 VSES01000004.1 GCA008084195_01427 CDS open 1501-1785 _na     94_aa Type II toxin-antitoxin system RelE/ParE family toxin
1631 VSES01000004.1 GCA008084195_01428 CDS open 1782-1949 _na     55_aa hypothetical protein
1632 VSES01000004.1 GCA008084195_01429 CDS open 2210-2344 _na     44_aa hypothetical protein
1633 VSES01000004.1 GCA008084195_01430 CDS open 2369-3010 _na     213_aa parA ParA family partition ATPase
1634 VSES01000004.1 GCA008084195_01431 CDS open 3003-3242 _na     79_aa parB Chromosome partitioning protein ParB
1635 VSES01000004.1 GCA008084195_01432 CDS open 3295-3558 _na     87_aa hypothetical protein
1636 VSES01000004.1 GCA008084195_01433 CDS open 3678-3881 _na     67_aa Type II toxin-antitoxin system RelB/DinJ family antitoxin
1637 VSES01000004.1 GCA008084195_01434 CDS open 4263-5117 _na     284_aa Replication protein
1638 VSES01000004.1 GCA008084195_01435 CDS open 5146-6099 _na     317_aa galM galactose-1-epimerase
1639 VSES01000004.1 GCA008084195_01437 CDS open 6364-7863 _na     499_aa dsbB Disulfide bond formation protein B
1640 VSES01000004.1 GCA008084195_01438 CDS open 7882-8049 _na     55_aa hypothetical protein
1641 VSES01000004.1 GCA008084195_01439 CDS open 8142-9575 _na     477_aa citT Anion permease
1642 VSES01000004.1 GCA008084195_01440 CDS open 9562-10974 _na     470_aa citX putative 2-(5''-triphosphoribosyl)-3'-dephosphocoenzyme-A synthase
1643 VSES01000004.1 GCA008084195_01441 CDS open 11168-12670 _na     500_aa citF citrate lyase subunit alpha
1644 VSES01000004.1 GCA008084195_01442 CDS open 12685-13560 _na     291_aa citE citrate (pro-3S)-lyase subunit beta
1645 VSES01000004.1 GCA008084195_01443 CDS open 13557-13844 _na     95_aa citD citrate lyase acyl carrier protein
1646 VSES01000004.1 GCA008084195_01444 CDS open 13884-14891 _na     335_aa citC [citrate (pro-3S)-lyase] ligase
1647 VSES01000004.1 GCA008084195_01445 CDS open 15137-16033 _na     298_aa corC CNNM family magnesium/cobalt transport protein CorC
1648 VSES01000004.1 GCA008084195_01446 CDS open 16424-17968 _na     514_aa lnt apolipoprotein N-acyltransferase
1649 VSES01000004.1 GCA008084195_01447 CDS open 18031-18249 _na     72_aa infA translation initiation factor IF-1
1650 VSES01000004.1 GCA008084195_01448 CDS open 18469-19776 _na     435_aa pepB aminopeptidase PepB
1651 VSES01000004.1 GCA008084195_01449 CDS open 19788-20213 _na     141_aa ndk nucleoside-diphosphate kinase
1652 VSES01000004.1 GCA008084195_01450 CDS open 20349-21494 _na     381_aa dspB glycoside hydrolase dispersin B
1653 VSES01000004.1 GCA008084195_01451 CDS open 21584-22696 _na     370_aa apbC iron-sulfur cluster carrier protein ApbC
1654 VSES01000004.1 GCA008084195_01452 CDS open 22869-24929 _na     686_aa metG methionine--tRNA ligase
1655 VSES01000004.1 GCA008084195_01453 CDS open 25063-25257 _na     64_aa iscX Fe-S cluster assembly protein IscX
1656 VSES01000004.1 GCA008084195_01454 CDS open 25257-25598 _na     113_aa fdx ISC system 2Fe-2S type ferredoxin
1657 VSES01000004.1 GCA008084195_01455 CDS open 25610-27469 _na     619_aa hscA Fe-S protein assembly chaperone HscA
1658 VSES01000004.1 GCA008084195_01456 CDS open 27490-28011 _na     173_aa hscB Fe-S protein assembly co-chaperone HscB
1659 VSES01000004.1 GCA008084195_01457 CDS open 28023-28346 _na     107_aa iscA iron-sulfur cluster assembly protein IscA
1660 VSES01000004.1 GCA008084195_01458 CDS open 28478-28861 _na     127_aa iscU Iron-sulfur cluster assembly scaffold protein IscU
1661 VSES01000004.1 GCA008084195_01459 CDS open 28921-30135 _na     404_aa iscS IscS subfamily cysteine desulfurase
1662 VSES01000004.1 GCA008084195_01460 CDS open 30189-30662 _na     157_aa iscR Fe-S cluster assembly transcriptional regulator IscR
1663 VSES01000004.1 GCA008084195_01461 CDS open 30724-31464 _na     246_aa trmJ tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ
1664 VSES01000004.1 GCA008084195_01462 CDS open 31615-32415 _na     266_aa suhB inositol-1-monophosphatase
1665 VSES01000004.1 GCA008084195_01463 CDS open 32468-34579 _na     703_aa DUF945 domain-containing protein
1666 VSES01000004.1 GCA008084195_01465 CDS open 34858-35904 _na     348_aa fbpC ferric ABC transporter ATP-binding protein
1667 VSES01000004.1 GCA008084195_01466 CDS open 35920-37977 _na     685_aa fbpB Fe3+ ABC transporter permease
1668 VSES01000004.1 GCA008084195_01467 CDS open 38005-39048 _na     347_aa afuA ABC transporter substrate-binding protein
1669 VSES01000004.1 GCA008084195_01468 CDS open 39210-40250 _na     346_aa afuA putative protein HI_0131
1670 VSES01000004.1 GCA008084195_01469 CDS open 40559-41209 _na     216_aa udk uridine kinase
1671 VSES01000004.1 GCA008084195_01470 CDS open 41219-41803 _na     194_aa dcd dCTP deaminase
1672 VSES01000004.1 GCA008084195_01471 CDS open 41804-43006 _na     400_aa AsmA-like C-terminal domain-containing protein
1673 VSES01000004.1 GCA008084195_01472 CDS open 43008-44204 _na     398_aa araJ sugar transporter
1674 VSES01000004.1 GCA008084195_01473 CDS open 44274-45806 _na     510_aa der ribosome biogenesis GTPase Der
1675 VSES01000004.1 GCA008084195_01474 CDS open 46094-47077 _na     327_aa dnaJ Curved DNA-binding protein
1676 VSES01000004.1 GCA008084195_01475 CDS open 47100-47390 _na     96_aa merR MerR family transcriptional regulator
1677 VSES01000004.1 GCA008084195_01476 CDS open 47455-48753 _na     432_aa purA adenylosuccinate synthase
1678 VSES01000004.1 GCA008084195_01477 CDS open 48841-49806 _na     321_aa cmoB tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB
1679 VSES01000004.1 GCA008084195_01478 CDS open 49820-51340 _na     506_aa putP sodium/proline symporter PutP
1680 VSES01000004.1 GCA008084195_01479 CDS open 51479-52954 _na     491_aa rng ribonuclease G
1681 VSES01000004.1 GCA008084195_01480 CDS open 53071-53718 _na     215_aa grxB glutaredoxin 2
1682 VSES01000004.1 GCA008084195_01481 CDS open 53734-54432 _na     232_aa cobB NAD-dependent protein deacylase
1683 VSES01000004.1 GCA008084195_01482 CDS open 54505-54879 _na     124_aa helix-turn-helix domain-containing protein
1684 VSES01000004.1 GCA008084195_01483 CDS open 54805-55131 _na     108_aa hypothetical protein
1685 VSES01000004.1 GCA008084195_01484 CDS open 55358-55492 _na     44_aa hypothetical protein
1686 VSES01000004.1 GCA008084195_01485 CDS open 55494-56177 _na     227_aa virB8 Bacterial virulence protein VirB8 domain-containing protein
1687 VSES01000004.1 GCA008084195_01486 CDS open 56135-56395 _na     86_aa TrbC/VirB2 family protein
1688 VSES01000004.1 GCA008084195_01487 CDS open 57008-57187 _na     59_aa Antitoxin
1689 VSES01000004.1 GCA008084195_01488 CDS open 57184-57462 _na     92_aa Type II toxin-antitoxin system RelE/ParE family toxin
1690 VSES01000004.1 GCA008084195_01489 CDS open 57501-57680 _na     59_aa hypothetical protein
1691 VSES01000004.1 GCA008084195_01490 CDS open 58251-58505 _na     84_aa Transcriptional regulator
1692 VSES01000004.1 GCA008084195_01491 CDS open 58508-58852 _na     114_aa mazF type II toxin-antitoxin system PemK/MazF family toxin
1693 VSES01000004.1 GCA008084195_01492 CDS open 58936-59202 _na     88_aa vagC AbrB/MazE/SpoVT family DNA-binding domain-containing protein
1694 VSES01000004.1 GCA008084195_01493 CDS open 59421-60089 _na     222_aa cdtA cytolethal distending toxin subunit Aa-CdtA
1695 VSES01000004.1 GCA008084195_01494 CDS open 60104-60955 _na     283_aa cdtB cytolethal distending toxin nuclease subunit Aa-CdtB
1696 VSES01000004.1 GCA008084195_01495 CDS open 60966-61526 _na     186_aa cdtC cytolethal distending toxin subunit Aa-CdtC
1697 VSES01000004.1 GCA008084195_01496 CDS open 61909-62019 _na     36_aa hypothetical protein
1698 VSES01000004.1 GCA008084195_01497 CDS open 62602-63183 _na     193_aa DNA cytosine methyltransferase
1699 VSES01000004.1 GCA008084195_01500 CDS open 63642-64463 _na     273_aa xerD XerD
1700 VSES01000004.1 GCA008084195_01501 CDS open 64432-64554 _na     40_aa hypothetical protein
1701 VSES01000004.1 GCA008084195_01502 CDS open 64547-66433 _na     628_aa mobH MobH family relaxase
1702 VSES01000004.1 GCA008084195_01503 CDS open 66712-66891 _na     59_aa Antitoxin
1703 VSES01000004.1 GCA008084195_01504 CDS open 66888-67166 _na     92_aa Type II toxin-antitoxin system RelE/ParE family toxin
1704 VSES01000004.1 GCA008084195_01505 CDS open 67177-67341 _na     54_aa hypothetical protein
1705 VSES01000004.1 GCA008084195_01506 CDS open 67982-68458 _na     158_aa hypothetical protein
1706 VSES01000004.1 GCA008084195_01507 CDS open 68483-68713 _na     76_aa hypothetical protein
1707 VSES01000004.1 GCA008084195_01508 CDS open 68742-68858 _na     38_aa hypothetical protein
1708 VSES01000004.1 GCA008084195_01509 CDS open 68880-68972 _na     30_aa hypothetical protein
1709 VSES01000004.1 GCA008084195_01510 CDS open 69077-69412 _na     111_aa hypothetical protein
1710 VSES01000004.1 GCA008084195_01511 CDS open 69814-70773 _na     319_aa DNA primase
1711 VSES01000004.1 GCA008084195_01512 CDS open 70908-71153 _na     81_aa hypothetical protein
1712 VSES01000004.1 GCA008084195_01513 CDS open 71248-71583 _na     111_aa hypothetical protein
1713 VSES01000004.1 GCA008084195_01514 CDS open 71964-72404 _na     146_aa TIGR03757 family integrating conjugative element protein
1714 VSES01000004.1 GCA008084195_01515 CDS open 72412-73326 _na     304_aa TIGR03756 family integrating conjugative element protein
1715 VSES01000004.1 GCA008084195_01516 CDS open 73348-75342 _na     664_aa integrating conjugative element protein
1716 VSES01000004.1 GCA008084195_01517 CDS open 75365-75706 _na     113_aa hypothetical protein
1717 VSES01000004.1 GCA008084195_01518 CDS open 75817-76152 _na     111_aa hypothetical protein
1718 VSES01000004.1 GCA008084195_01519 CDS open 76199-77713 _na     504_aa traG conjugal transfer protein TraG N-terminal domain-containing protein
1719 VSES01000004.1 GCA008084195_01520 CDS open 77726-78055 _na     109_aa hypothetical protein
1720 VSES01000004.1 GCA008084195_01521 CDS open 78036-78494 _na     152_aa DUF5655 domain-containing protein
1721 VSES01000004.1 GCA008084195_01522 CDS open 78466-81336 _na     956_aa conjugative transfer ATPase
1722 VSES01000004.1 GCA008084195_01523 CDS open 81336-81644 _na     102_aa Conjugal transfer protein
1723 VSES01000004.1 GCA008084195_01524 CDS open 81760-83178 _na     472_aa TIGR03752 family integrating conjugative element protein
1724 VSES01000004.1 GCA008084195_01525 CDS open 83189-84049 _na     286_aa Conjugal transfer protein
1725 VSES01000004.1 GCA008084195_01526 CDS open 84049-84687 _na     212_aa PFL_4703 family integrating conjugative element protein
1726 VSES01000004.1 GCA008084195_01527 CDS open 84696-85070 _na     124_aa TIGR03750 family conjugal transfer protein
1727 VSES01000004.1 GCA008084195_01528 CDS open 85089-85478 _na     129_aa DUF2976 domain-containing protein
1728 VSES01000004.1 GCA008084195_01529 CDS open 85495-85734 _na     79_aa DUF3262 domain-containing protein
1729 VSES01000004.1 GCA008084195_01530 CDS open 85734-86000 _na     88_aa RAQPRD family integrative conjugative element protein
1730 VSES01000004.1 GCA008084195_01531 CDS open 86224-86910 _na     228_aa TIGR03747 family integrating conjugative element membrane protein
1731 VSES01000004.1 GCA008084195_01532 CDS open 86910-87233 _na     107_aa Hemophilus-specific protein
1732 VSES01000004.1 GCA008084195_01533 CDS open 87234-89471 _na     745_aa traD type IV conjugative transfer system coupling protein TraD
1733 VSES01000004.1 GCA008084195_01534 CDS open 89468-89971 _na     167_aa integrating conjugative element protein
1734 VSES01000004.1 GCA008084195_01535 CDS open 90013-90723 _na     236_aa transglycosylase SLT domain-containing protein
1735 VSES01000004.1 GCA008084195_01536 CDS open 90702-91457 _na     251_aa TIGR03759 family integrating conjugative element protein
1736 VSES01000004.1 GCA008084195_01537 CDS open 91460-92062 _na     200_aa pilL PilL N-terminal domain-containing protein
1737 VSES01000004.1 GCA008084195_01538 CDS open 92166-92879 _na     237_aa traX TraX family protein
1738 VSES01000004.1 GCA008084195_01539 CDS open 93035-93619 _na     194_aa hypothetical protein
1739 VSES01000004.1 GCA008084195_01540 CDS open 93720-94190 _na     156_aa radC RadC family protein
1740 VSES01000004.1 GCA008084195_01541 CDS open 94306-94953 _na     215_aa DUF3560 domain-containing protein
1741 VSES01000004.1 GCA008084195_01542 CDS open 95056-95454 _na     132_aa hypothetical protein
1742 VSES01000004.1 GCA008084195_01543 CDS open 95552-96001 _na     149_aa STY4534 family ICE replication protein
1743 VSES01000004.1 GCA008084195_01544 CDS open 96087-96245 _na     52_aa hypothetical protein
1744 VSES01000004.1 GCA008084195_01545 CDS open 96315-96527 _na     70_aa hypothetical protein
1745 VSES01000004.1 GCA008084195_01546 CDS open 97320-99353 _na     677_aa DNA topoisomerase III
1746 VSES01000004.1 GCA008084195_01547 CDS open 99366-99614 _na     82_aa hypothetical protein
1747 VSES01000004.1 GCA008084195_01548 CDS open 99601-99804 _na     67_aa Filamentous phage CTX RstR-like repressor
1748 VSES01000004.1 GCA008084195_01549 CDS open 99907-100095 _na     62_aa hypothetical protein
1749 VSES01000004.1 GCA008084195_01550 CDS open 100116-100313 _na     65_aa hypothetical protein
1750 VSES01000004.1 GCA008084195_01551 CDS open 100471-100974 _na     167_aa membrane lipoprotein lipid attachment site-containing protein
1751 VSES01000004.1 GCA008084195_01552 CDS open 101047-101538 _na     163_aa single-stranded DNA-binding protein
1752 VSES01000004.1 GCA008084195_01553 CDS open 101717-101986 _na     89_aa hypothetical protein
1753 VSES01000004.1 GCA008084195_01554 CDS open 102121-102606 _na     161_aa DUF3158 domain-containing protein
1754 VSES01000004.1 GCA008084195_01555 CDS open 102627-103397 _na     256_aa PFL_4669 family integrating conjugative element protein
1755 VSES01000004.1 GCA008084195_01556 CDS open 103582-104799 _na     405_aa STY4528 family pathogenicity island replication protein
1756 VSES01000004.1 GCA008084195_01557 CDS open 104957-105514 _na     185_aa DUF2857 domain-containing protein
1757 VSES01000004.1 GCA008084195_01558 CDS open 105501-107243 _na     580_aa parB ParB
1758 VSES01000004.1 GCA008084195_01559 CDS open 107236-108612 _na     458_aa dnaB replicative DNA helicase
1759 VSES01000004.1 GCA008084195_01560 CDS open 108618-109451 _na     277_aa dnaB replicative DNA helicase
1760 VSES01000004.1 GCA008084195_01564 CDS open 109979-110536 _na     185_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
1761 VSES01000004.1 GCA008084195_01565 CDS open 110791-111981 _na     396_aa metC cystathionine beta-lyase
1762 VSES01000004.1 GCA008084195_01566 CDS open 112195-113247 _na     350_aa ompC Porin
1763 VSES01000004.1 GCA008084195_01567 CDS open 113391-113648 _na     85_aa mazE SpoVT-AbrB domain-containing protein
1764 VSES01000004.1 GCA008084195_01568 CDS open 113648-113995 _na     115_aa mazF Growth inhibitor PemK
1765 VSES01000004.1 GCA008084195_01569 CDS open 114073-115200 _na     375_aa dnaJ molecular chaperone DnaJ
1766 VSES01000004.1 GCA008084195_01570 CDS open 115635-117536 _na     633_aa dnaK molecular chaperone DnaK
1767 VSES01000004.1 GCA008084195_01571 CDS open 117822-119255 _na     477_aa ydgA GTP-binding protein
1768 VSES01000004.1 GCA008084195_01573 CDS open 119615-121348 _na     577_aa argS arginine--tRNA ligase
1769 VSES01000004.1 GCA008084195_01574 CDS open 121445-122032 _na     195_aa yecM VOC family protein
1770 VSES01000004.1 GCA008084195_01575 CDS open 122074-122529 _na     151_aa slyB Glycine zipper 2TM domain-containing protein
1771 VSES01000004.1 GCA008084195_01576 CDS open 122669-123751 _na     360_aa prfA peptide chain release factor 1
1772 VSES01000004.1 GCA008084195_01577 CDS open 123791-124690 _na     299_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
1773 VSES01000004.1 GCA008084195_01578 CDS open 124700-125554 _na     284_aa kdsA 3-deoxy-8-phosphooctulonate synthase
1774 VSES01000004.1 GCA008084195_01579 CDS open 125734-126243 _na     169_aa nlpC NlpC/P60 domain-containing protein
1775 VSES01000004.1 GCA008084195_01580 CDS open 126640-126891 _na     83_aa ycgL YcgL domain-containing protein ACT75-10365
1776 VSES01000004.1 GCA008084195_01581 CDS open 126975-127637 _na     220_aa minC septum site-determining protein MinC
1777 VSES01000004.1 GCA008084195_01582 CDS open 127659-128204 _na     181_aa Histone
1778 VSES01000004.1 GCA008084195_01583 CDS open 128428-128895 _na     155_aa sixA phosphohistidine phosphatase SixA
1779 VSES01000004.1 GCA008084195_01584 CDS open 128908-130245 _na     445_aa glmM phosphoglucosamine mutase
1780 VSES01000004.1 GCA008084195_01585 CDS open 130274-131101 _na     275_aa folP dihydropteroate synthase
1781 VSES01000004.1 GCA008084195_01586 CDS open 131271-132305 _na     344_aa dinB DNA polymerase IV
1782 VSES01000004.1 GCA008084195_01587 CDS open 133089-133382 _na     97_aa hypothetical protein
1783 VSES01000004.1 GCA008084195_01588 CDS open 133384-134121 _na     245_aa zeta toxin family protein
1784 VSES01000004.1 GCA008084195_01589 CDS open 134904-135158 _na     84_aa Insertion element IS150 protein InsJ-like helix-turn-helix domain-containing protein
1785 VSES01000004.1 GCA008084195_01590 CDS open 135364-136830 _na     488_aa guaB IMP dehydrogenase
1786 VSES01000004.1 GCA008084195_01591 CDS open 136972-137904 _na     310_aa birA bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA
1787 VSES01000004.1 GCA008084195_01592 CDS open 137991-138194 _na     67_aa Glycine zipper 2TM domain-containing protein
1788 VSES01000004.1 GCA008084195_01424 gene open 14-634
1789 VSES01000004.1 GCA008084195_01425 gene open 668-1105
1790 VSES01000004.1 GCA008084195_01426 gene open 1089-1421
1791 VSES01000004.1 GCA008084195_01427 gene open 1501-1785
1792 VSES01000004.1 GCA008084195_01428 gene open 1782-1949
1793 VSES01000004.1 GCA008084195_01429 gene open 2210-2344
1794 VSES01000004.1 GCA008084195_01430 gene open 2369-3010 parA
1795 VSES01000004.1 GCA008084195_01431 gene open 3003-3242 parB
1796 VSES01000004.1 GCA008084195_01432 gene open 3295-3558
1797 VSES01000004.1 GCA008084195_01433 gene open 3678-3881
1798 VSES01000004.1 GCA008084195_01434 gene open 4263-5117
1799 VSES01000004.1 GCA008084195_01435 gene open 5146-6099 galM
1800 VSES01000004.1 GCA008084195_01437 gene open 6364-7863 dsbB
1801 VSES01000004.1 GCA008084195_01438 gene open 7882-8049
1802 VSES01000004.1 GCA008084195_01439 gene open 8142-9575 citT
1803 VSES01000004.1 GCA008084195_01440 gene open 9562-10974 citX
1804 VSES01000004.1 GCA008084195_01441 gene open 11168-12670 citF
1805 VSES01000004.1 GCA008084195_01442 gene open 12685-13560 citE
1806 VSES01000004.1 GCA008084195_01443 gene open 13557-13844 citD
1807 VSES01000004.1 GCA008084195_01444 gene open 13884-14891 citC
1808 VSES01000004.1 GCA008084195_01445 gene open 15137-16033 corC
1809 VSES01000004.1 GCA008084195_01446 gene open 16424-17968 lnt
1810 VSES01000004.1 GCA008084195_01447 gene open 18031-18249 infA
1811 VSES01000004.1 GCA008084195_01448 gene open 18469-19776 pepB
1812 VSES01000004.1 GCA008084195_01449 gene open 19788-20213 ndk
1813 VSES01000004.1 GCA008084195_01450 gene open 20349-21494 dspB
1814 VSES01000004.1 GCA008084195_01451 gene open 21584-22696 apbC
1815 VSES01000004.1 GCA008084195_01452 gene open 22869-24929 metG
1816 VSES01000004.1 GCA008084195_01453 gene open 25063-25257 iscX
1817 VSES01000004.1 GCA008084195_01454 gene open 25257-25598 fdx
1818 VSES01000004.1 GCA008084195_01455 gene open 25610-27469 hscA
1819 VSES01000004.1 GCA008084195_01456 gene open 27490-28011 hscB
1820 VSES01000004.1 GCA008084195_01457 gene open 28023-28346 iscA
1821 VSES01000004.1 GCA008084195_01458 gene open 28478-28861 iscU
1822 VSES01000004.1 GCA008084195_01459 gene open 28921-30135 iscS
1823 VSES01000004.1 GCA008084195_01460 gene open 30189-30662 iscR
1824 VSES01000004.1 GCA008084195_01461 gene open 30724-31464 trmJ
1825 VSES01000004.1 GCA008084195_01462 gene open 31615-32415 suhB
1826 VSES01000004.1 GCA008084195_01463 gene open 32468-34579
1827 VSES01000004.1 GCA008084195_01465 gene open 34858-35904 fbpC
1828 VSES01000004.1 GCA008084195_01466 gene open 35920-37977 fbpB
1829 VSES01000004.1 GCA008084195_01467 gene open 38005-39048 afuA
1830 VSES01000004.1 GCA008084195_01468 gene open 39210-40250 afuA
1831 VSES01000004.1 GCA008084195_01469 gene open 40559-41209 udk
1832 VSES01000004.1 GCA008084195_01470 gene open 41219-41803 dcd
1833 VSES01000004.1 GCA008084195_01471 gene open 41804-43006
1834 VSES01000004.1 GCA008084195_01472 gene open 43008-44204 araJ
1835 VSES01000004.1 GCA008084195_01473 gene open 44274-45806 der
1836 VSES01000004.1 GCA008084195_01474 gene open 46094-47077 dnaJ
1837 VSES01000004.1 GCA008084195_01475 gene open 47100-47390 merR
1838 VSES01000004.1 GCA008084195_01476 gene open 47455-48753 purA
1839 VSES01000004.1 GCA008084195_01477 gene open 48841-49806 cmoB
1840 VSES01000004.1 GCA008084195_01478 gene open 49820-51340 putP
1841 VSES01000004.1 GCA008084195_01479 gene open 51479-52954 rng
1842 VSES01000004.1 GCA008084195_01480 gene open 53071-53718 grxB
1843 VSES01000004.1 GCA008084195_01481 gene open 53734-54432 cobB
1844 VSES01000004.1 GCA008084195_01482 gene open 54505-54879
1845 VSES01000004.1 GCA008084195_01483 gene open 54805-55131
1846 VSES01000004.1 GCA008084195_01484 gene open 55358-55492
1847 VSES01000004.1 GCA008084195_01485 gene open 55494-56177 virB8
1848 VSES01000004.1 GCA008084195_01486 gene open 56135-56395
1849 VSES01000004.1 GCA008084195_01487 gene open 57008-57187
1850 VSES01000004.1 GCA008084195_01488 gene open 57184-57462
1851 VSES01000004.1 GCA008084195_01489 gene open 57501-57680
1852 VSES01000004.1 GCA008084195_01490 gene open 58251-58505
1853 VSES01000004.1 GCA008084195_01491 gene open 58508-58852 mazF
1854 VSES01000004.1 GCA008084195_01492 gene open 58936-59202 vagC
1855 VSES01000004.1 GCA008084195_01493 gene open 59421-60089 cdtA
1856 VSES01000004.1 GCA008084195_01494 gene open 60104-60955 cdtB
1857 VSES01000004.1 GCA008084195_01495 gene open 60966-61526 cdtC
1858 VSES01000004.1 GCA008084195_01496 gene open 61909-62019
1859 VSES01000004.1 GCA008084195_01497 gene open 62602-63183
1860 VSES01000004.1 GCA008084195_01500 gene open 63642-64463 xerD
1861 VSES01000004.1 GCA008084195_01501 gene open 64432-64554
1862 VSES01000004.1 GCA008084195_01502 gene open 64547-66433 mobH
1863 VSES01000004.1 GCA008084195_01503 gene open 66712-66891
1864 VSES01000004.1 GCA008084195_01504 gene open 66888-67166
1865 VSES01000004.1 GCA008084195_01505 gene open 67177-67341
1866 VSES01000004.1 GCA008084195_01506 gene open 67982-68458
1867 VSES01000004.1 GCA008084195_01507 gene open 68483-68713
1868 VSES01000004.1 GCA008084195_01508 gene open 68742-68858
1869 VSES01000004.1 GCA008084195_01509 gene open 68880-68972
1870 VSES01000004.1 GCA008084195_01510 gene open 69077-69412
1871 VSES01000004.1 GCA008084195_01511 gene open 69814-70773
1872 VSES01000004.1 GCA008084195_01512 gene open 70908-71153
1873 VSES01000004.1 GCA008084195_01513 gene open 71248-71583
1874 VSES01000004.1 GCA008084195_01514 gene open 71964-72404
1875 VSES01000004.1 GCA008084195_01515 gene open 72412-73326
1876 VSES01000004.1 GCA008084195_01516 gene open 73348-75342
1877 VSES01000004.1 GCA008084195_01517 gene open 75365-75706
1878 VSES01000004.1 GCA008084195_01518 gene open 75817-76152
1879 VSES01000004.1 GCA008084195_01519 gene open 76199-77713 traG
1880 VSES01000004.1 GCA008084195_01520 gene open 77726-78055
1881 VSES01000004.1 GCA008084195_01521 gene open 78036-78494
1882 VSES01000004.1 GCA008084195_01522 gene open 78466-81336
1883 VSES01000004.1 GCA008084195_01523 gene open 81336-81644
1884 VSES01000004.1 GCA008084195_01524 gene open 81760-83178
1885 VSES01000004.1 GCA008084195_01525 gene open 83189-84049
1886 VSES01000004.1 GCA008084195_01526 gene open 84049-84687
1887 VSES01000004.1 GCA008084195_01527 gene open 84696-85070
1888 VSES01000004.1 GCA008084195_01528 gene open 85089-85478
1889 VSES01000004.1 GCA008084195_01529 gene open 85495-85734
1890 VSES01000004.1 GCA008084195_01530 gene open 85734-86000
1891 VSES01000004.1 GCA008084195_01531 gene open 86224-86910
1892 VSES01000004.1 GCA008084195_01532 gene open 86910-87233
1893 VSES01000004.1 GCA008084195_01533 gene open 87234-89471 traD
1894 VSES01000004.1 GCA008084195_01534 gene open 89468-89971
1895 VSES01000004.1 GCA008084195_01535 gene open 90013-90723
1896 VSES01000004.1 GCA008084195_01536 gene open 90702-91457
1897 VSES01000004.1 GCA008084195_01537 gene open 91460-92062 pilL
1898 VSES01000004.1 GCA008084195_01538 gene open 92166-92879 traX
1899 VSES01000004.1 GCA008084195_01539 gene open 93035-93619
1900 VSES01000004.1 GCA008084195_01540 gene open 93720-94190 radC
1901 VSES01000004.1 GCA008084195_01541 gene open 94306-94953
1902 VSES01000004.1 GCA008084195_01542 gene open 95056-95454
1903 VSES01000004.1 GCA008084195_01543 gene open 95552-96001
1904 VSES01000004.1 GCA008084195_01544 gene open 96087-96245
1905 VSES01000004.1 GCA008084195_01545 gene open 96315-96527
1906 VSES01000004.1 GCA008084195_01546 gene open 97320-99353
1907 VSES01000004.1 GCA008084195_01547 gene open 99366-99614
1908 VSES01000004.1 GCA008084195_01548 gene open 99601-99804
1909 VSES01000004.1 GCA008084195_01549 gene open 99907-100095
1910 VSES01000004.1 GCA008084195_01550 gene open 100116-100313
1911 VSES01000004.1 GCA008084195_01551 gene open 100471-100974
1912 VSES01000004.1 GCA008084195_01552 gene open 101047-101538
1913 VSES01000004.1 GCA008084195_01553 gene open 101717-101986
1914 VSES01000004.1 GCA008084195_01554 gene open 102121-102606
1915 VSES01000004.1 GCA008084195_01555 gene open 102627-103397
1916 VSES01000004.1 GCA008084195_01556 gene open 103582-104799
1917 VSES01000004.1 GCA008084195_01557 gene open 104957-105514
1918 VSES01000004.1 GCA008084195_01558 gene open 105501-107243 parB
1919 VSES01000004.1 GCA008084195_01559 gene open 107236-108612 dnaB
1920 VSES01000004.1 GCA008084195_01560 gene open 108618-109451 dnaB
1921 VSES01000004.1 GCA008084195_01564 gene open 109979-110536 pgsA
1922 VSES01000004.1 GCA008084195_01565 gene open 110791-111981 metC
1923 VSES01000004.1 GCA008084195_01566 gene open 112195-113247 ompC
1924 VSES01000004.1 GCA008084195_01567 gene open 113391-113648 mazE
1925 VSES01000004.1 GCA008084195_01568 gene open 113648-113995 mazF
1926 VSES01000004.1 GCA008084195_01569 gene open 114073-115200 dnaJ
1927 VSES01000004.1 GCA008084195_01570 gene open 115635-117536 dnaK
1928 VSES01000004.1 GCA008084195_01571 gene open 117822-119255 ydgA
1929 VSES01000004.1 GCA008084195_01573 gene open 119615-121348 argS
1930 VSES01000004.1 GCA008084195_01574 gene open 121445-122032 yecM
1931 VSES01000004.1 GCA008084195_01575 gene open 122074-122529 slyB
1932 VSES01000004.1 GCA008084195_01576 gene open 122669-123751 prfA
1933 VSES01000004.1 GCA008084195_01577 gene open 123791-124690 prmC
1934 VSES01000004.1 GCA008084195_01578 gene open 124700-125554 kdsA
1935 VSES01000004.1 GCA008084195_01579 gene open 125734-126243 nlpC
1936 VSES01000004.1 GCA008084195_01580 gene open 126640-126891 ycgL
1937 VSES01000004.1 GCA008084195_01581 gene open 126975-127637 minC
1938 VSES01000004.1 GCA008084195_01582 gene open 127659-128204
1939 VSES01000004.1 GCA008084195_01583 gene open 128428-128895 sixA
1940 VSES01000004.1 GCA008084195_01584 gene open 128908-130245 glmM
1941 VSES01000004.1 GCA008084195_01585 gene open 130274-131101 folP
1942 VSES01000004.1 GCA008084195_01586 gene open 131271-132305 dinB
1943 VSES01000004.1 GCA008084195_01587 gene open 133089-133382
1944 VSES01000004.1 GCA008084195_01588 gene open 133384-134121
1945 VSES01000004.1 GCA008084195_01589 gene open 134904-135158
1946 VSES01000004.1 GCA008084195_01590 gene open 135364-136830 guaB
1947 VSES01000004.1 GCA008084195_01591 gene open 136972-137904 birA
1948 VSES01000004.1 GCA008084195_01592 gene open 137991-138194
1949 VSES01000004.1 GCA008084195_01436 gene open 6199-6285 trnL
1950 VSES01000004.1 GCA008084195_01498 gene open 63287-63362 trnK
1951 VSES01000004.1 GCA008084195_01499 gene open 63415-63528
1952 VSES01000004.1 GCA008084195_01561 gene open 109529-109604 trnK
1953 VSES01000004.1 GCA008084195_01562 gene open 109655-109741 trnL
1954 VSES01000004.1 GCA008084195_01563 gene open 109743-109818 trnG
1955 VSES01000004.1 GCA008084195_01436 tRNA open 6199-6285 trnL tRNA-Leu(cag)
1956 VSES01000004.1 GCA008084195_01498 tRNA open 63287-63362 trnK tRNA-Lys(ttt)
1957 VSES01000004.1 GCA008084195_01499 tRNA open 63415-63528 tRNA-Xxx
1958 VSES01000004.1 GCA008084195_01561 tRNA open 109529-109604 trnK tRNA-Lys(ttt)
1959 VSES01000004.1 GCA008084195_01562 tRNA open 109655-109741 trnL tRNA-Leu(taa)
1960 VSES01000004.1 GCA008084195_01563 tRNA open 109743-109818 trnG tRNA-Gly(gcc)
1961 VSES01000005.1 GCA008084195_01605 gene open 15135-15234 AaHKsRNA22
1962 VSES01000005.1 GCA008084195_01645 gene open 50092-50176 C4
1963 VSES01000005.1 GCA008084195_01646 gene open 50197-50277 AaHKsRNA82
1964 VSES01000005.1 GCA008084195_01677 gene open 75268-75365 AaHKsRNA22
1965 VSES01000005.1 GCA008084195_01690 gene open 88500-88597 AaHKsRNA22
1966 VSES01000005.1 GCA008084195_01605 ncRNA open 15135-15234 Aggregatibacter sRNA 22
1967 VSES01000005.1 GCA008084195_01645 ncRNA open 50092-50176 C4 antisense RNA
1968 VSES01000005.1 GCA008084195_01646 ncRNA open 50197-50277 Aggregatibacter sRNA 82
1969 VSES01000005.1 GCA008084195_01677 ncRNA open 75268-75365 Aggregatibacter sRNA 22
1970 VSES01000005.1 GCA008084195_01690 ncRNA open 88500-88597 Aggregatibacter sRNA 22
1971 VSES01000005.1 regulatory_region open 19839-19926 TPP riboswitch aptamer (THI element)
1972 VSES01000005.1 repeat_region open 19202-19651 CRISPR array with 7 repeats of length 32%2C consensus sequence GCAGCCACCTTCAGGTGGCTGTGTGTTGAAAC and spacer length 36
1973 VSES01000005.1 GCA008084195_01593 CDS open 524-1918 _na     464_aa qseC quorum sensing histidine kinase QseC
1974 VSES01000005.1 GCA008084195_01594 CDS open 2003-3772 _na     589_aa ggt gamma-glutamyltransferase
1975 VSES01000005.1 GCA008084195_01595 CDS open 4005-4250 _na     81_aa L-lactate dehydrogenase
1976 VSES01000005.1 GCA008084195_01596 CDS open 4440-5777 _na     445_aa argG argininosuccinate synthase
1977 VSES01000005.1 GCA008084195_01597 CDS open 5872-6699 _na     275_aa wcaG NAD-dependent dehydratase
1978 VSES01000005.1 GCA008084195_01598 CDS open 7056-8639 _na     527_aa prfC peptide chain release factor 3
1979 VSES01000005.1 GCA008084195_01599 CDS open 8827-9177 _na     116_aa gp49 Addiction module toxin RelE
1980 VSES01000005.1 GCA008084195_01600 CDS open 9174-9473 _na     99_aa aF2118 Transcriptional regulator
1981 VSES01000005.1 GCA008084195_01601 CDS open 9509-12442 _na     977_aa glnE bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase
1982 VSES01000005.1 GCA008084195_01602 CDS open 12643-12870 _na     75_aa CRISPR-associated protein Cas3
1983 VSES01000005.1 GCA008084195_01603 CDS open 12863-14563 _na     566_aa CRISPR-associated endonuclease Cas3''
1984 VSES01000005.1 GCA008084195_01604 CDS open 14526-14981 _na     151_aa cas7 type I CRISPR-associated protein Cas7
1985 VSES01000005.1 GCA008084195_01606 CDS open 15225-15902 _na     225_aa cas4 CRISPR-associated protein Cas4
1986 VSES01000005.1 GCA008084195_01607 CDS open 15892-17646 _na     584_aa ybjD ATP-dependent endonuclease
1987 VSES01000005.1 GCA008084195_01608 CDS open 17700-18713 _na     337_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
1988 VSES01000005.1 GCA008084195_01609 CDS open 18717-19010 _na     97_aa cas2 CRISPR-associated endonuclease Cas2
1989 VSES01000005.1 GCA008084195_01610 CDS open 20050-20274 _na     74_aa bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase
1990 VSES01000005.1 GCA008084195_01611 CDS open 20472-21476 _na     334_aa thiB thiamine ABC transporter substrate binding subunit
1991 VSES01000005.1 GCA008084195_01612 CDS open 21485-23113 _na     542_aa thiP thiamine/thiamine pyrophosphate ABC transporter permease ThiP
1992 VSES01000005.1 GCA008084195_01613 CDS open 23097-23744 _na     215_aa thiQ thiamine ABC transporter ATP-binding protein
1993 VSES01000005.1 GCA008084195_01614 CDS open 23789-24793 _na     334_aa bioB biotin synthase BioB
1994 VSES01000005.1 GCA008084195_01615 CDS open 24891-26273 _na     460_aa degQ Periplasmic pH-dependent serine endoprotease DegQ
1995 VSES01000005.1 GCA008084195_01616 CDS open 26464-26874 _na     136_aa yhcB Z-ring associated protein G
1996 VSES01000005.1 GCA008084195_01617 CDS open 27045-28808 _na     587_aa ycaO 30S ribosomal protein S12 methylthiotransferase accessory factor YcaO
1997 VSES01000005.1 GCA008084195_01618 CDS open 28899-30104 _na     401_aa manA mannose-6-phosphate isomerase%2C class I
1998 VSES01000005.1 GCA008084195_01619 CDS open 30280-30618 _na     112_aa yegP DUF1508 domain-containing protein
1999 VSES01000005.1 GCA008084195_01620 CDS open 30806-32299 _na     497_aa ptsG2 PTS family glucose porter%2C IICBA component
2000 VSES01000005.1 GCA008084195_01621 CDS open 32357-33055 _na     232_aa SAM-dependent methyltransferase