BAKTAGenome Explorer: Leptotrichia shahii (GCA_008327825.1)
Select a Genome:
|
BAKTA Annotations for GCA_008327825.1
|
Search & Sort all 4081 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | AP019827.1 | GCA008327825_01940 | gene | open | 2060492-2060830 | ssrA | ||
| 2 | AP019827.1 | GCA008327825_01940 | tmRNA | open | 2060492-2060830 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | AP019827.1 | GCA008327825_00087 | gene | open | 92500-94009 | rrs | ||
| 4 | AP019827.1 | GCA008327825_00088 | gene | open | 94120-97017 | rrl | ||
| 5 | AP019827.1 | GCA008327825_00089 | gene | open | 97076-97186 | rrf | ||
| 6 | AP019827.1 | GCA008327825_00095 | gene | open | 102272-103783 | rrs | ||
| 7 | AP019827.1 | GCA008327825_00096 | gene | open | 103894-106790 | rrl | ||
| 8 | AP019827.1 | GCA008327825_00097 | gene | open | 106849-106961 | rrf | ||
| 9 | AP019827.1 | GCA008327825_00311 | gene | open | 330551-330663 | DUF3800-I | ||
| 10 | AP019827.1 | GCA008327825_00478 | gene | open | 507000-508510 | rrs | ||
| 11 | AP019827.1 | GCA008327825_00481 | gene | open | 508788-511674 | rrl | ||
| 12 | AP019827.1 | GCA008327825_00482 | gene | open | 511733-511845 | rrf | ||
| 13 | AP019827.1 | GCA008327825_00599 | gene | open | 661192-661456 | Bacteria_large_SRP | ||
| 14 | AP019827.1 | GCA008327825_00600 | gene | open | 661305-661402 | Bacteria_small_SRP | ||
| 15 | AP019827.1 | GCA008327825_01605 | gene | open | 1729294-1729654 | RNaseP_bact_a | ||
| 16 | AP019827.1 | GCA008327825_01816 | gene | open | 1939013-1939125 | rrf | ||
| 17 | AP019827.1 | GCA008327825_01817 | gene | open | 1939184-1942044 | rrl | ||
| 18 | AP019827.1 | GCA008327825_01820 | gene | open | 1942322-1943833 | rrs | ||
| 19 | AP019827.1 | GCA008327825_01985 | gene | open | 2106409-2106520 | rrf | ||
| 20 | AP019827.1 | GCA008327825_01986 | gene | open | 2106578-2109463 | rrl | ||
| 21 | AP019827.1 | GCA008327825_01987 | gene | open | 2109574-2111080 | rrs | ||
| 22 | AP019827.1 | GCA008327825_00311 | ncRNA | open | 330551-330663 | DUF3800-I RNA | ||
| 23 | AP019827.1 | GCA008327825_00599 | ncRNA | open | 661192-661456 | Bacterial large signal recognition particle RNA | ||
| 24 | AP019827.1 | GCA008327825_00600 | ncRNA | open | 661305-661402 | Bacterial small signal recognition particle RNA | ||
| 25 | AP019827.1 | GCA008327825_01605 | ncRNA | open | 1729294-1729654 | Bacterial RNase P class A | ||
| 26 | AP019827.1 | regulatory_region | open | 50874-51056 | Cobalamin riboswitch aptamer | |||
| 27 | AP019827.1 | regulatory_region | open | 181380-181552 | glmS glucosamine-6-phosphate activated ribozyme aptamer | |||
| 28 | AP019827.1 | regulatory_region | open | 295404-295569 | Ribosomal protein L10 leader | |||
| 29 | AP019827.1 | regulatory_region | open | 752291-752424 | FMN riboswitch aptamer (RFN element) | |||
| 30 | AP019827.1 | regulatory_region | open | 1147590-1147680 | Glycine riboswitch aptamer | |||
| 31 | AP019827.1 | regulatory_region | open | 1147681-1147784 | Glycine riboswitch aptamer | |||
| 32 | AP019827.1 | regulatory_region | open | 1153596-1153685 | TPP riboswitch aptamer (THI element) | |||
| 33 | AP019827.1 | regulatory_region | open | 1255994-1256169 | Lysine riboswitch aptamer | |||
| 34 | AP019827.1 | regulatory_region | open | 1455328-1455427 | SAM riboswitch aptamer (S box leader) | |||
| 35 | AP019827.1 | regulatory_region | open | 1524979-1525044 | S4-Fusobacteriales ribosomal protein leader | |||
| 36 | AP019827.1 | GCA008327825_00087 | rRNA | open | 92500-94009 | rrs | 16S ribosomal RNA | |
| 37 | AP019827.1 | GCA008327825_00088 | rRNA | open | 94120-97017 | rrl | 23S ribosomal RNA | |
| 38 | AP019827.1 | GCA008327825_00089 | rRNA | open | 97076-97186 | rrf | 5S ribosomal RNA | |
| 39 | AP019827.1 | GCA008327825_00095 | rRNA | open | 102272-103783 | rrs | 16S ribosomal RNA | |
| 40 | AP019827.1 | GCA008327825_00096 | rRNA | open | 103894-106790 | rrl | 23S ribosomal RNA | |
| 41 | AP019827.1 | GCA008327825_00097 | rRNA | open | 106849-106961 | rrf | 5S ribosomal RNA | |
| 42 | AP019827.1 | GCA008327825_00478 | rRNA | open | 507000-508510 | rrs | 16S ribosomal RNA | |
| 43 | AP019827.1 | GCA008327825_00481 | rRNA | open | 508788-511674 | rrl | 23S ribosomal RNA | |
| 44 | AP019827.1 | GCA008327825_00482 | rRNA | open | 511733-511845 | rrf | 5S ribosomal RNA | |
| 45 | AP019827.1 | GCA008327825_01816 | rRNA | open | 1939013-1939125 | rrf | 5S ribosomal RNA | |
| 46 | AP019827.1 | GCA008327825_01817 | rRNA | open | 1939184-1942044 | rrl | 23S ribosomal RNA | |
| 47 | AP019827.1 | GCA008327825_01820 | rRNA | open | 1942322-1943833 | rrs | 16S ribosomal RNA | |
| 48 | AP019827.1 | GCA008327825_01985 | rRNA | open | 2106409-2106520 | rrf | 5S ribosomal RNA | |
| 49 | AP019827.1 | GCA008327825_01986 | rRNA | open | 2106578-2109463 | rrl | 23S ribosomal RNA | |
| 50 | AP019827.1 | GCA008327825_01987 | rRNA | open | 2109574-2111080 | rrs | 16S ribosomal RNA | |
| 51 | AP019827.1 | repeat_region | open | 1199690-1200573 | CRISPR array with 14 repeats of length 29%2C consensus sequence ATTTACAATACAAAATGTTCCTATTAAAT and spacer length 36 | |||
| 52 | AP019827.1 | repeat_region | open | 1203671-1205788 | CRISPR array with 33 repeats of length 27%2C consensus sequence TTTAATAGGAACATTTTGTATTGTAAA and spacer length 38 | |||
| 53 | AP019827.1 | repeat_region | open | 1401618-1402033 | CRISPR array with 6 repeats of length 37%2C consensus sequence GTTTCAATCCTTGTTTTAATGGATACTCTACTTTAAC and spacer length 36 | |||
| 54 | AP019827.1 | GCA008327825_00001 | CDS | open | 575-1924 | _na 449_aa | dnaA | chromosomal replication initiator protein DnaA |
| 55 | AP019827.1 | GCA008327825_00002 | CDS | open | 2541-2774 | _na 77_aa | yaaA | S4 domain-containing protein YaaA |
| 56 | AP019827.1 | GCA008327825_00003 | CDS | open | 2822-3940 | _na 372_aa | recF | DNA replication/repair protein RecF |
| 57 | AP019827.1 | GCA008327825_00004 | CDS | open | 3927-4970 | _na 347_aa | DUF721 domain-containing protein | |
| 58 | AP019827.1 | GCA008327825_00005 | CDS | open | 5112-5900 | _na 262_aa | Spherulation-specific family 4 | |
| 59 | AP019827.1 | GCA008327825_00006 | CDS | open | 6022-7050 | _na 342_aa | Tetratricopeptide repeat protein | |
| 60 | AP019827.1 | GCA008327825_00007 | CDS | open | 7079-7993 | _na 304_aa | Protein kinase domain-containing protein | |
| 61 | AP019827.1 | GCA008327825_00008 | CDS | open | 8232-10124 | _na 630_aa | mnmG | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG |
| 62 | AP019827.1 | GCA008327825_00009 | CDS | open | 10353-10919 | _na 188_aa | pth | aminoacyl-tRNA hydrolase |
| 63 | AP019827.1 | GCA008327825_00010 | CDS | open | 11129-12766 | _na 545_aa | AAA-ATPase-like domain-containing protein | |
| 64 | AP019827.1 | GCA008327825_00011 | CDS | open | 12805-13368 | _na 187_aa | Tetratricopeptide repeat protein | |
| 65 | AP019827.1 | GCA008327825_00012 | CDS | open | 13628-14146 | _na 172_aa | tpx | thiol peroxidase |
| 66 | AP019827.1 | GCA008327825_00013 | CDS | open | 14258-14632 | _na 124_aa | arsR | Regulatory protein ArsR |
| 67 | AP019827.1 | GCA008327825_00014 | CDS | open | 14866-15762 | _na 298_aa | Transglycosylase SLT domain-containing protein | |
| 68 | AP019827.1 | GCA008327825_00015 | CDS | open | 15979-16959 | _na 326_aa | dppB | Alkaline phosphatase |
| 69 | AP019827.1 | GCA008327825_00016 | CDS | open | 16959-17924 | _na 321_aa | dppC | Binding-protein-dependent transport systems inner membrane component |
| 70 | AP019827.1 | GCA008327825_00017 | CDS | open | 18192-19241 | _na 349_aa | dppD | Oligopeptide transport ATP-binding protein OppD |
| 71 | AP019827.1 | GCA008327825_00018 | CDS | open | 19241-20191 | _na 316_aa | dppD | ABC transporter related |
| 72 | AP019827.1 | GCA008327825_00019 | CDS | open | 20256-21857 | _na 533_aa | Family 5 extracellular solute-binding protein | |
| 73 | AP019827.1 | GCA008327825_00020 | CDS | open | 21907-23496 | _na 529_aa | oppA | Extracellular solute-binding protein family 5 |
| 74 | AP019827.1 | GCA008327825_00021 | CDS | open | 23532-25121 | _na 529_aa | Family 5 extracellular solute-binding protein | |
| 75 | AP019827.1 | GCA008327825_00022 | CDS | open | 25302-26885 | _na 527_aa | Family 5 extracellular solute-binding protein | |
| 76 | AP019827.1 | GCA008327825_00023 | CDS | open | 27058-27624 | _na 188_aa | D%2CD-heptose 1%2C7-bisphosphate phosphatase | |
| 77 | AP019827.1 | GCA008327825_00024 | CDS | open | 27709-29199 | _na 496_aa | hemD | uroporphyrinogen-III C-methyltransferase |
| 78 | AP019827.1 | GCA008327825_00025 | CDS | open | 29186-30154 | _na 322_aa | hemC | hydroxymethylbilane synthase |
| 79 | AP019827.1 | GCA008327825_00026 | CDS | open | 30151-31191 | _na 346_aa | hemA | glutamyl-tRNA reductase |
| 80 | AP019827.1 | GCA008327825_00027 | CDS | open | 31216-31833 | _na 205_aa | TIGR02646 family protein | |
| 81 | AP019827.1 | GCA008327825_00028 | CDS | open | 31817-33079 | _na 420_aa | ATPase AAA-type core domain-containing protein | |
| 82 | AP019827.1 | GCA008327825_00029 | CDS | open | 33104-35128 | _na 674_aa | ATP-dependent DNA helicase Rep | |
| 83 | AP019827.1 | GCA008327825_00030 | CDS | open | 35109-36455 | _na 448_aa | hypothetical protein | |
| 84 | AP019827.1 | GCA008327825_00031 | CDS | open | 36551-37201 | _na 216_aa | Endonuclease GajA/Old nuclease/RecF-like AAA domain-containing protein | |
| 85 | AP019827.1 | GCA008327825_00032 | CDS | open | 37268-40489 | _na 1073_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 86 | AP019827.1 | GCA008327825_00033 | CDS | open | 40787-43858 | _na 1023_aa | Outer membrane autotransporter barrel domain-containing protein | |
| 87 | AP019827.1 | GCA008327825_00034 | CDS | open | 44064-44690 | _na 208_aa | cbiE | Precorrin-6y C5%2C15-methyltransferase (Decarboxylating) subunit CbiE |
| 88 | AP019827.1 | GCA008327825_00035 | CDS | open | 44756-45862 | _na 368_aa | cbiD | cobalt-precorrin-5B (C(1))-methyltransferase CbiD |
| 89 | AP019827.1 | GCA008327825_00036 | CDS | open | 46018-46674 | _na 218_aa | Putative precorrin-8X methylmutase | |
| 90 | AP019827.1 | GCA008327825_00037 | CDS | open | 46874-48229 | _na 451_aa | cobyrinate a%2Cc-diamide synthase | |
| 91 | AP019827.1 | GCA008327825_00038 | CDS | open | 48226-49032 | _na 268_aa | ecfA2 | ABC transporter ATP-binding protein |
| 92 | AP019827.1 | GCA008327825_00039 | CDS | open | 49034-49729 | _na 231_aa | cbiQ | Putative cobalt ABC transporter%2C permease protein CbiQ |
| 93 | AP019827.1 | GCA008327825_00040 | CDS | open | 49704-50006 | _na 100_aa | cbiN | energy-coupling factor ABC transporter substrate-binding protein |
| 94 | AP019827.1 | GCA008327825_00041 | CDS | open | 50006-50713 | _na 235_aa | energy-coupling factor ABC transporter permease | |
| 95 | AP019827.1 | GCA008327825_00042 | CDS | open | 51080-51829 | _na 249_aa | Anaerobic cobalt chelatase | |
| 96 | AP019827.1 | GCA008327825_00043 | CDS | open | 51911-53248 | _na 445_aa | ffh | signal recognition particle protein |
| 97 | AP019827.1 | GCA008327825_00044 | CDS | open | 53715-54938 | _na 407_aa | Peptidase Do | |
| 98 | AP019827.1 | GCA008327825_00045 | CDS | open | 54980-55651 | _na 223_aa | Aminoglycoside phosphotransferase domain-containing protein | |
| 99 | AP019827.1 | GCA008327825_00046 | CDS | open | 56245-56643 | _na 132_aa | tnpA | IS200/IS605 family transposase |
| 100 | AP019827.1 | GCA008327825_00047 | CDS | open | 56648-57745 | _na 365_aa | tnpB | Transposase%2C IS605 OrfB family |
| 101 | AP019827.1 | GCA008327825_00048 | CDS | open | 58026-58865 | _na 279_aa | manZ | PTS system mannose-specific EIID component |
| 102 | AP019827.1 | GCA008327825_00049 | CDS | open | 58867-59256 | _na 129_aa | Methyl-accepting chemotaxis protein | |
| 103 | AP019827.1 | GCA008327825_00050 | CDS | open | 59579-60598 | _na 339_aa | pheS | phenylalanine--tRNA ligase subunit alpha |
| 104 | AP019827.1 | GCA008327825_00051 | CDS | open | 60619-60831 | _na 70_aa | Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein | |
| 105 | AP019827.1 | GCA008327825_00052 | CDS | open | 60831-61097 | _na 88_aa | relE | mRNA interferase toxin RelE |
| 106 | AP019827.1 | GCA008327825_00053 | CDS | open | 61119-61601 | _na 160_aa | rimI | N-acetyltransferase domain-containing protein |
| 107 | AP019827.1 | GCA008327825_00054 | CDS | open | 61611-62474 | _na 287_aa | hypothetical protein | |
| 108 | AP019827.1 | GCA008327825_00055 | CDS | open | 63110-65509 | _na 799_aa | pheT | phenylalanine--tRNA ligase subunit beta |
| 109 | AP019827.1 | GCA008327825_00056 | CDS | open | 65534-66016 | _na 160_aa | HRDC domain-containing protein | |
| 110 | AP019827.1 | GCA008327825_00057 | CDS | open | 66094-66345 | _na 83_aa | hypothetical protein | |
| 111 | AP019827.1 | GCA008327825_00058 | CDS | open | 66735-67400 | _na 221_aa | thiamine diphosphokinase | |
| 112 | AP019827.1 | GCA008327825_00059 | CDS | open | 68138-69286 | _na 382_aa | rluA | Pseudouridine synthase%2C RluA family |
| 113 | AP019827.1 | GCA008327825_00060 | CDS | open | 69371-70717 | _na 448_aa | norM | MATE efflux family protein |
| 114 | AP019827.1 | GCA008327825_00061 | CDS | open | 70887-71858 | _na 323_aa | Oxidoreductase%2C 2-nitropropane dioxygenase family protein | |
| 115 | AP019827.1 | GCA008327825_00062 | CDS | open | 71995-72363 | _na 122_aa | hxlR | HTH-type transcriptional activator HxlR family protein |
| 116 | AP019827.1 | GCA008327825_00063 | CDS | open | 72381-72743 | _na 120_aa | Glutamyl-tRNA amidotransferase | |
| 117 | AP019827.1 | GCA008327825_00064 | CDS | open | 72791-73201 | _na 136_aa | Lipoprotein | |
| 118 | AP019827.1 | GCA008327825_00065 | CDS | open | 73279-74058 | _na 259_aa | yqjQ | Oxidoreductase%2C short chain dehydrogenase/reductase family protein |
| 119 | AP019827.1 | GCA008327825_00066 | CDS | open | 74145-74702 | _na 185_aa | Putative acetyltransferase | |
| 120 | AP019827.1 | GCA008327825_00067 | CDS | open | 74837-75718 | _na 293_aa | cynR | HTH-type transcriptional regulator CynR |
| 121 | AP019827.1 | GCA008327825_00068 | CDS | open | 75730-76917 | _na 395_aa | Xaa-Pro dipeptidyl-peptidase-like domain-containing protein | |
| 122 | AP019827.1 | GCA008327825_00069 | CDS | open | 77622-78212 | _na 196_aa | hypothetical protein | |
| 123 | AP019827.1 | GCA008327825_00070 | CDS | open | 78730-79248 | _na 172_aa | hypothetical protein | |
| 124 | AP019827.1 | GCA008327825_00071 | CDS | open | 79265-79759 | _na 164_aa | hypothetical protein | |
| 125 | AP019827.1 | GCA008327825_00072 | CDS | open | 79889-81394 | _na 501_aa | cobQ | cobyric acid synthase |
| 126 | AP019827.1 | GCA008327825_00073 | CDS | open | 81425-82540 | _na 371_aa | Threonine-phosphate decarboxylase | |
| 127 | AP019827.1 | GCA008327825_00074 | CDS | open | 82733-83104 | _na 123_aa | Uroporphyrin-III C-methyltransferase | |
| 128 | AP019827.1 | GCA008327825_00075 | CDS | open | 83204-83929 | _na 241_aa | cobI | precorrin-2 C(20)-methyltransferase |
| 129 | AP019827.1 | GCA008327825_00076 | CDS | open | 83902-84807 | _na 301_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 130 | AP019827.1 | GCA008327825_00077 | CDS | open | 84854-85537 | _na 227_aa | GLPGLI family protein | |
| 131 | AP019827.1 | GCA008327825_00078 | CDS | open | 85598-86149 | _na 183_aa | Putative nuclease | |
| 132 | AP019827.1 | GCA008327825_00079 | CDS | open | 86142-86471 | _na 109_aa | hxlR | HTH-type transcriptional activator HxlR |
| 133 | AP019827.1 | GCA008327825_00080 | CDS | open | 86492-86905 | _na 137_aa | Pyridoxamine 5'-phosphate oxidase N-terminal domain-containing protein | |
| 134 | AP019827.1 | GCA008327825_00081 | CDS | open | 87182-87847 | _na 221_aa | DUF2262 domain-containing protein | |
| 135 | AP019827.1 | GCA008327825_00082 | CDS | open | 87884-88645 | _na 253_aa | cobM | precorrin-4 C(11)-methyltransferase |
| 136 | AP019827.1 | GCA008327825_00083 | CDS | open | 88645-89280 | _na 211_aa | DUF5105 domain-containing protein | |
| 137 | AP019827.1 | GCA008327825_00084 | CDS | open | 89277-90344 | _na 355_aa | hypothetical protein | |
| 138 | AP019827.1 | GCA008327825_00085 | CDS | open | 90416-90874 | _na 152_aa | DUF2798 domain-containing protein | |
| 139 | AP019827.1 | GCA008327825_00086 | CDS | open | 91049-91816 | _na 255_aa | NUDIX hydrolase | |
| 140 | AP019827.1 | GCA008327825_00091 | CDS | open | 97362-98750 | _na 462_aa | Glycogen synthase | |
| 141 | AP019827.1 | GCA008327825_00092 | CDS | open | 99052-100305 | _na 417_aa | glgC | glucose-1-phosphate adenylyltransferase |
| 142 | AP019827.1 | GCA008327825_00093 | CDS | open | 100457-100834 | _na 125_aa | relE | Toxin-antitoxin system%2C toxin component%2C RelE domain protein |
| 143 | AP019827.1 | GCA008327825_00094 | CDS | open | 101636-101833 | _na 65_aa | Transposase IS30-like HTH domain-containing protein | |
| 144 | AP019827.1 | GCA008327825_00099 | CDS | open | 107134-107967 | _na 277_aa | Family 2 glycosyl transferase | |
| 145 | AP019827.1 | GCA008327825_00100 | CDS | open | 108240-109259 | _na 339_aa | Glycosyl hydrolase family 16 | |
| 146 | AP019827.1 | GCA008327825_00101 | CDS | open | 109780-110349 | _na 189_aa | rfbC | dTDP-4-dehydrorhamnose 3%2C5-epimerase |
| 147 | AP019827.1 | GCA008327825_00102 | CDS | open | 110380-111585 | _na 401_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 148 | AP019827.1 | GCA008327825_00103 | CDS | open | 111803-112075 | _na 90_aa | Glucosamine-6-phosphate deaminase | |
| 149 | AP019827.1 | GCA008327825_00104 | CDS | open | 112689-113936 | _na 415_aa | Transposase | |
| 150 | AP019827.1 | GCA008327825_00105 | CDS | open | 114329-114583 | _na 84_aa | Glucosamine-6-phosphate deaminase | |
| 151 | AP019827.1 | GCA008327825_00106 | CDS | open | 114946-116094 | _na 382_aa | nagA | N-acetylglucosamine-6-phosphate deacetylase |
| 152 | AP019827.1 | GCA008327825_00107 | CDS | open | 116621-117976 | _na 451_aa | pgi | glucose-6-phosphate isomerase |
| 153 | AP019827.1 | GCA008327825_00108 | CDS | open | 118497-119870 | _na 457_aa | lAP4 | aminopeptidase |
| 154 | AP019827.1 | GCA008327825_00109 | CDS | open | 119901-122954 | _na 1017_aa | amyA | Glycosyl hydrolase family 13 catalytic domain-containing protein |
| 155 | AP019827.1 | GCA008327825_00110 | CDS | open | 123116-127285 | _na 1389_aa | cas13a | type VI-A CRISPR-associated effector C2c2 |
| 156 | AP019827.1 | GCA008327825_00111 | CDS | open | 127315-128229 | _na 304_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 157 | AP019827.1 | GCA008327825_00112 | CDS | open | 128219-128536 | _na 105_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 158 | AP019827.1 | GCA008327825_00113 | CDS | open | 129267-131177 | _na 636_aa | thrS | threonine--tRNA ligase |
| 159 | AP019827.1 | GCA008327825_00114 | CDS | open | 131464-132231 | _na 255_aa | ybhL | Inner membrane protein YbhL |
| 160 | AP019827.1 | GCA008327825_00115 | CDS | open | 132325-132909 | _na 194_aa | hypothetical protein | |
| 161 | AP019827.1 | GCA008327825_00116 | CDS | open | 132935-133321 | _na 128_aa | Phosphoribosyl-ATP pyrophosphohydrolase | |
| 162 | AP019827.1 | GCA008327825_00117 | CDS | open | 133538-133795 | _na 85_aa | rpmB | 50S ribosomal protein L28 |
| 163 | AP019827.1 | GCA008327825_00119 | CDS | open | 134284-134871 | _na 195_aa | GCN5-related N-acetyltransferase | |
| 164 | AP019827.1 | GCA008327825_00120 | CDS | open | 135063-136265 | _na 400_aa | pgk | Phosphoglycerate kinase |
| 165 | AP019827.1 | GCA008327825_00121 | CDS | open | 136515-136781 | _na 88_aa | yajC | preprotein translocase subunit YajC |
| 166 | AP019827.1 | GCA008327825_00122 | CDS | open | 137107-138234 | _na 375_aa | N-acetylmuramoyl-L-alanineamidase | |
| 167 | AP019827.1 | GCA008327825_00123 | CDS | open | 138265-138810 | _na 181_aa | GerMN domain-containing protein | |
| 168 | AP019827.1 | GCA008327825_00124 | CDS | open | 139187-145447 | _na 2086_aa | Autotransporter domain-containing protein | |
| 169 | AP019827.1 | GCA008327825_00125 | CDS | open | 145754-147583 | _na 609_aa | peptidylprolyl isomerase | |
| 170 | AP019827.1 | GCA008327825_00126 | CDS | open | 147852-148511 | _na 219_aa | O-methyltransferase-like protein | |
| 171 | AP019827.1 | GCA008327825_00127 | CDS | open | 148650-149717 | _na 355_aa | Porin | |
| 172 | AP019827.1 | GCA008327825_00128 | CDS | open | 150046-150522 | _na 158_aa | Thioredoxin domain-containing protein | |
| 173 | AP019827.1 | GCA008327825_00129 | CDS | open | 150824-150982 | _na 52_aa | hypothetical protein | |
| 174 | AP019827.1 | GCA008327825_00130 | CDS | open | 150979-151119 | _na 46_aa | hypothetical protein | |
| 175 | AP019827.1 | GCA008327825_00131 | CDS | open | 151248-151610 | _na 120_aa | Response regulator receiver protein | |
| 176 | AP019827.1 | GCA008327825_00132 | CDS | open | 151900-152712 | _na 270_aa | Cof family hydrolase | |
| 177 | AP019827.1 | GCA008327825_00133 | CDS | open | 152857-153681 | _na 274_aa | cof | Cof-like hydrolase |
| 178 | AP019827.1 | GCA008327825_00134 | CDS | open | 153868-154617 | _na 249_aa | Type 11 methyltransferase | |
| 179 | AP019827.1 | GCA008327825_00135 | CDS | open | 154784-155803 | _na 339_aa | tsaD | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD |
| 180 | AP019827.1 | GCA008327825_00136 | CDS | open | 155986-157026 | _na 346_aa | Glycosyl transferase family protein | |
| 181 | AP019827.1 | GCA008327825_00140 | CDS | open | 157999-159510 | _na 503_aa | UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase | |
| 182 | AP019827.1 | GCA008327825_00141 | CDS | open | 159868-160236 | _na 122_aa | rpsL | 30S ribosomal protein S12 |
| 183 | AP019827.1 | GCA008327825_00142 | CDS | open | 160269-160739 | _na 156_aa | rpsG | 30S ribosomal protein S7 |
| 184 | AP019827.1 | GCA008327825_00143 | CDS | open | 160969-163053 | _na 694_aa | fusA | elongation factor G |
| 185 | AP019827.1 | GCA008327825_00144 | CDS | open | 163086-163973 | _na 295_aa | tuf | elongation factor Tu |
| 186 | AP019827.1 | GCA008327825_00145 | CDS | open | 164018-164269 | _na 83_aa | Elongation factor Tu 2 | |
| 187 | AP019827.1 | GCA008327825_00146 | CDS | open | 164454-164759 | _na 101_aa | rpsJ | 30S ribosomal protein S10 |
| 188 | AP019827.1 | GCA008327825_00147 | CDS | open | 164820-165446 | _na 208_aa | rplC | 50S ribosomal protein L3 |
| 189 | AP019827.1 | GCA008327825_00148 | CDS | open | 165468-166112 | _na 214_aa | rplD | 50S ribosomal protein L4 |
| 190 | AP019827.1 | GCA008327825_00149 | CDS | open | 166112-166396 | _na 94_aa | rplW | 50S ribosomal protein L23 |
| 191 | AP019827.1 | GCA008327825_00150 | CDS | open | 166584-167411 | _na 275_aa | rplB | 50S ribosomal protein L2 |
| 192 | AP019827.1 | GCA008327825_00151 | CDS | open | 167617-167886 | _na 89_aa | rpsS | 30S ribosomal protein S19 |
| 193 | AP019827.1 | GCA008327825_00152 | CDS | open | 167945-168283 | _na 112_aa | rplV | 50S ribosomal protein L22 |
| 194 | AP019827.1 | GCA008327825_00153 | CDS | open | 168299-168955 | _na 218_aa | rpsC | 30S ribosomal protein S3 |
| 195 | AP019827.1 | GCA008327825_00154 | CDS | open | 168957-169382 | _na 141_aa | rplP | 50S ribosomal protein L16 |
| 196 | AP019827.1 | GCA008327825_00155 | CDS | open | 169382-169573 | _na 63_aa | rpmC | 50S ribosomal protein L29 |
| 197 | AP019827.1 | GCA008327825_00156 | CDS | open | 169585-169845 | _na 86_aa | rpsQ | 30S ribosomal protein S17 |
| 198 | AP019827.1 | GCA008327825_00157 | CDS | open | 169941-170309 | _na 122_aa | rplN | 50S ribosomal protein L14 |
| 199 | AP019827.1 | GCA008327825_00158 | CDS | open | 170325-170708 | _na 127_aa | rplX | 50S ribosomal protein L24 |
| 200 | AP019827.1 | GCA008327825_00159 | CDS | open | 170734-171288 | _na 184_aa | rplE | 50S ribosomal protein L5 |
| 201 | AP019827.1 | GCA008327825_00160 | CDS | open | 171319-171606 | _na 95_aa | rpsN | 30S ribosomal protein S14 |
| 202 | AP019827.1 | GCA008327825_00161 | CDS | open | 171628-172023 | _na 131_aa | rpsH | 30S ribosomal protein S8 |
| 203 | AP019827.1 | GCA008327825_00162 | CDS | open | 172056-172589 | _na 177_aa | rplF | 50S ribosomal protein L6 |
| 204 | AP019827.1 | GCA008327825_00163 | CDS | open | 172603-172965 | _na 120_aa | rplR | 50S ribosomal protein L18 |
| 205 | AP019827.1 | GCA008327825_00164 | CDS | open | 172984-173493 | _na 169_aa | rpsE | 30S ribosomal protein S5 |
| 206 | AP019827.1 | GCA008327825_00165 | CDS | open | 173515-173694 | _na 59_aa | rpmD | 50S ribosomal protein L30 |
| 207 | AP019827.1 | GCA008327825_00166 | CDS | open | 173700-174314 | _na 204_aa | rplO | 50S ribosomal protein L15 |
| 208 | AP019827.1 | GCA008327825_00167 | CDS | open | 174361-175668 | _na 435_aa | secY | preprotein translocase subunit SecY |
| 209 | AP019827.1 | GCA008327825_00168 | CDS | open | 176204-177010 | _na 268_aa | phnE | Putative phosphonate ABC transporter%2C permease protein PhnE |
| 210 | AP019827.1 | GCA008327825_00169 | CDS | open | 177085-177879 | _na 264_aa | phnE | Putative phosphonate ABC transporter%2C permease protein PhnE |
| 211 | AP019827.1 | GCA008327825_00170 | CDS | open | 177891-178640 | _na 249_aa | phnC | phosphonate ABC transporter ATP-binding protein |
| 212 | AP019827.1 | GCA008327825_00171 | CDS | open | 178737-180281 | _na 514_aa | hypothetical protein | |
| 213 | AP019827.1 | GCA008327825_00172 | CDS | open | 180309-181193 | _na 294_aa | peptidylprolyl isomerase | |
| 214 | AP019827.1 | GCA008327825_00173 | CDS | open | 181586-183415 | _na 609_aa | glmS | glutamine--fructose-6-phosphate transaminase (isomerizing) |
| 215 | AP019827.1 | GCA008327825_00174 | CDS | open | 183465-183776 | _na 103_aa | Late embryogenesis abundant protein domain-containing protein | |
| 216 | AP019827.1 | GCA008327825_00175 | CDS | open | 184542-185306 | _na 254_aa | Peptidase%2C M50 family | |
| 217 | AP019827.1 | GCA008327825_00176 | CDS | open | 185692-186573 | _na 293_aa | Type I restriction-modificationenzyme 1%2C R subunit | |
| 218 | AP019827.1 | GCA008327825_00177 | CDS | open | 186662-187822 | _na 386_aa | TPR repeat-containing protein | |
| 219 | AP019827.1 | GCA008327825_00178 | CDS | open | 188048-188413 | _na 121_aa | Lysozyme inhibitor LprI-like N-terminal domain-containing protein | |
| 220 | AP019827.1 | GCA008327825_00179 | CDS | open | 188542-188919 | _na 125_aa | Integral membrane protein | |
| 221 | AP019827.1 | GCA008327825_00180 | CDS | open | 188968-189741 | _na 257_aa | map | type I methionyl aminopeptidase |
| 222 | AP019827.1 | GCA008327825_00181 | CDS | open | 190015-190644 | _na 209_aa | adk | adenylate kinase |
| 223 | AP019827.1 | GCA008327825_00182 | CDS | open | 190920-191180 | _na 86_aa | hypothetical protein | |
| 224 | AP019827.1 | GCA008327825_00183 | CDS | open | 191407-193197 | _na 596_aa | nadN | NAD nucleotidase |
| 225 | AP019827.1 | GCA008327825_00184 | CDS | open | 193302-193724 | _na 140_aa | mazG | MazG nucleotide pyrophosphohydrolase |
| 226 | AP019827.1 | GCA008327825_00185 | CDS | open | 193730-195388 | _na 552_aa | 5'-nucleotidase domain-containing protein | |
| 227 | AP019827.1 | GCA008327825_00186 | CDS | open | 195613-196794 | _na 393_aa | tgt | tRNA guanosine(34) transglycosylase Tgt |
| 228 | AP019827.1 | GCA008327825_00187 | CDS | open | 197297-197962 | _na 221_aa | Cyclic nucleotide-binding protein | |
| 229 | AP019827.1 | GCA008327825_00188 | CDS | open | 198161-198655 | _na 164_aa | Lipoprotein | |
| 230 | AP019827.1 | GCA008327825_00189 | CDS | open | 198826-199401 | _na 191_aa | yqeK | bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK |
| 231 | AP019827.1 | GCA008327825_00190 | CDS | open | 199424-201700 | _na 758_aa | rnr | ribonuclease R |
| 232 | AP019827.1 | GCA008327825_00191 | CDS | open | 201727-202176 | _na 149_aa | smpB | SsrA-binding protein SmpB |
| 233 | AP019827.1 | GCA008327825_00192 | CDS | open | 202313-202630 | _na 105_aa | Thioredoxin | |
| 234 | AP019827.1 | GCA008327825_00193 | CDS | open | 202892-203917 | _na 341_aa | galE | UDP-glucose 4-epimerase GalE |
| 235 | AP019827.1 | GCA008327825_00194 | CDS | open | 203962-204564 | _na 200_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 236 | AP019827.1 | GCA008327825_00195 | CDS | open | 204590-205825 | _na 411_aa | ampS | Peptidase M29 aminopeptidase II |
| 237 | AP019827.1 | GCA008327825_00196 | CDS | open | 205851-206009 | _na 52_aa | Chorismate mutase | |
| 238 | AP019827.1 | GCA008327825_00197 | CDS | open | 206558-207883 | _na 441_aa | der | ribosome biogenesis GTPase Der |
| 239 | AP019827.1 | GCA008327825_00198 | CDS | open | 207968-209188 | _na 406_aa | Pheromone autoinducer 2 transporter | |
| 240 | AP019827.1 | GCA008327825_00199 | CDS | open | 209195-209680 | _na 161_aa | marR | Transcriptional regulator%2C MarR family |
| 241 | AP019827.1 | GCA008327825_00200 | CDS | open | 209900-210667 | _na 255_aa | tpiA | triose-phosphate isomerase |
| 242 | AP019827.1 | GCA008327825_00201 | CDS | open | 210734-210940 | _na 68_aa | secG | preprotein translocase subunit SecG |
| 243 | AP019827.1 | GCA008327825_00202 | CDS | open | 211479-214352 | _na 957_aa | PD-(D/E)XK endonuclease-like domain-containing protein | |
| 244 | AP019827.1 | GCA008327825_00203 | CDS | open | 214339-217533 | _na 1064_aa | DNA 3'-5' helicase | |
| 245 | AP019827.1 | GCA008327825_00204 | CDS | open | 217795-218715 | _na 306_aa | pPX1 | manganese-dependent inorganic pyrophosphatase |
| 246 | AP019827.1 | GCA008327825_00205 | CDS | open | 218748-219101 | _na 117_aa | hypothetical protein | |
| 247 | AP019827.1 | GCA008327825_00206 | CDS | open | 219249-219890 | _na 213_aa | Peptidyl-prolyl cis-trans isomerase | |
| 248 | AP019827.1 | GCA008327825_00207 | CDS | open | 220143-221003 | _na 286_aa | Glycerophosphoryl diester phosphodiesterase membrane domain-containing protein | |
| 249 | AP019827.1 | GCA008327825_00208 | CDS | open | 221604-225287 | _na 1227_aa | OstA-like protein | |
| 250 | AP019827.1 | GCA008327825_00209 | CDS | open | 225565-226086 | _na 173_aa | OmpA/MotB domain-containing protein | |
| 251 | AP019827.1 | GCA008327825_00210 | CDS | open | 226511-227443 | _na 310_aa | hslO | Hsp33 family molecular chaperone HslO |
| 252 | AP019827.1 | GCA008327825_00211 | CDS | open | 227477-228403 | _na 308_aa | ddlA | D-alanine--D-alanine ligase |
| 253 | AP019827.1 | GCA008327825_00212 | CDS | open | 228480-228959 | _na 159_aa | S-ribosylhomocysteine lyase | |
| 254 | AP019827.1 | GCA008327825_00213 | CDS | open | 229060-229494 | _na 144_aa | Lysozyme inhibitor LprI-like N-terminal domain-containing protein | |
| 255 | AP019827.1 | GCA008327825_00214 | CDS | open | 229674-230363 | _na 229_aa | Lipoprotein | |
| 256 | AP019827.1 | GCA008327825_00215 | CDS | open | 230393-230995 | _na 200_aa | DUF4878 domain-containing protein | |
| 257 | AP019827.1 | GCA008327825_00216 | CDS | open | 231068-231832 | _na 254_aa | tatD | Hydrolase%2C TatD family |
| 258 | AP019827.1 | GCA008327825_00217 | CDS | open | 231846-233747 | _na 633_aa | Peptidase S8/S53 domain-containing protein | |
| 259 | AP019827.1 | GCA008327825_00218 | CDS | open | 234002-235312 | _na 436_aa | eno | phosphopyruvate hydratase |
| 260 | AP019827.1 | GCA008327825_00219 | CDS | open | 235524-235958 | _na 144_aa | fadA | Adhesion protein FadA |
| 261 | AP019827.1 | GCA008327825_00220 | CDS | open | 236038-236442 | _na 134_aa | fadA | Adhesion protein FadA |
| 262 | AP019827.1 | GCA008327825_00221 | CDS | open | 236531-237421 | _na 296_aa | Permiase | |
| 263 | AP019827.1 | GCA008327825_00222 | CDS | open | 237696-238772 | _na 358_aa | pepP | Peptidase M24 |
| 264 | AP019827.1 | GCA008327825_00223 | CDS | open | 239187-240479 | _na 430_aa | Aromatic hydrocarbon degradation membrane protein | |
| 265 | AP019827.1 | GCA008327825_00224 | CDS | open | 241016-245992 | _na 1658_aa | tamB | Translocation/assembly module TamB |
| 266 | AP019827.1 | GCA008327825_00225 | CDS | open | 246001-248331 | _na 776_aa | Outer membrane protein | |
| 267 | AP019827.1 | GCA008327825_00226 | CDS | open | 248485-249504 | _na 339_aa | lpxD | UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase |
| 268 | AP019827.1 | GCA008327825_00227 | CDS | open | 249614-250255 | _na 213_aa | DUF4878 domain-containing protein | |
| 269 | AP019827.1 | GCA008327825_00228 | CDS | open | 250466-251062 | _na 198_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 270 | AP019827.1 | GCA008327825_00229 | CDS | open | 251341-252453 | _na 370_aa | livK | Leucine-binding protein domain-containing protein |
| 271 | AP019827.1 | GCA008327825_00230 | CDS | open | 252535-253653 | _na 372_aa | livK | Leucine-binding protein domain-containing protein |
| 272 | AP019827.1 | GCA008327825_00231 | CDS | open | 254034-254930 | _na 298_aa | livH | Branched-chain amino acid ABC transporter%2C permease protein |
| 273 | AP019827.1 | GCA008327825_00232 | CDS | open | 254955-256067 | _na 370_aa | Inner-membrane translocator | |
| 274 | AP019827.1 | GCA008327825_00233 | CDS | open | 256114-256872 | _na 252_aa | livG | ABC transporter domain-containing protein |
| 275 | AP019827.1 | GCA008327825_00234 | CDS | open | 256917-257630 | _na 237_aa | ABC transporter domain-containing protein | |
| 276 | AP019827.1 | GCA008327825_00235 | CDS | open | 257868-259214 | _na 448_aa | Endonuclease GajA/Old nuclease/RecF-like AAA domain-containing protein | |
| 277 | AP019827.1 | GCA008327825_00236 | CDS | open | 259215-259610 | _na 131_aa | hypothetical protein | |
| 278 | AP019827.1 | GCA008327825_00237 | CDS | open | 259576-259878 | _na 100_aa | hypothetical protein | |
| 279 | AP019827.1 | GCA008327825_00238 | CDS | open | 259949-260974 | _na 341_aa | Low specificity L-threonine aldolase | |
| 280 | AP019827.1 | GCA008327825_00239 | CDS | open | 260997-261815 | _na 272_aa | cof | Cof-like hydrolase |
| 281 | AP019827.1 | GCA008327825_00240 | CDS | open | 261895-262755 | _na 286_aa | HTH araC/xylS-type domain-containing protein | |
| 282 | AP019827.1 | GCA008327825_00241 | CDS | open | 262875-263828 | _na 317_aa | dnaX | ATPase |
| 283 | AP019827.1 | GCA008327825_00242 | CDS | open | 263868-264899 | _na 343_aa | mreB | Cell shape-determining protein MreB |
| 284 | AP019827.1 | GCA008327825_00243 | CDS | open | 264995-265885 | _na 296_aa | pldB | Serine aminopeptidase S33 domain-containing protein |
| 285 | AP019827.1 | GCA008327825_00244 | CDS | open | 266407-267840 | _na 477_aa | Mga helix-turn-helix domain-containing protein | |
| 286 | AP019827.1 | GCA008327825_00245 | CDS | open | 268053-270284 | _na 743_aa | pflB | formate C-acetyltransferase |
| 287 | AP019827.1 | GCA008327825_00246 | CDS | open | 270616-271350 | _na 244_aa | pflA | pyruvate formate-lyase-activating protein |
| 288 | AP019827.1 | GCA008327825_00247 | CDS | open | 271399-272430 | _na 343_aa | Glutamine amidotransferase | |
| 289 | AP019827.1 | GCA008327825_00248 | CDS | open | 272660-274021 | _na 453_aa | tRNA(Met) cytidine acetate ligase | |
| 290 | AP019827.1 | GCA008327825_00249 | CDS | open | 274157-275116 | _na 319_aa | AB hydrolase-1 domain-containing protein | |
| 291 | AP019827.1 | GCA008327825_00250 | CDS | open | 275149-276477 | _na 442_aa | melB | Transporter%2C major facilitator family protein |
| 292 | AP019827.1 | GCA008327825_00251 | CDS | open | 276522-277340 | _na 272_aa | tktA1 | Transketolase domain-containing protein |
| 293 | AP019827.1 | GCA008327825_00252 | CDS | open | 277645-278571 | _na 308_aa | tktA2 | Transketolase C-terminal domain-containing protein |
| 294 | AP019827.1 | GCA008327825_00253 | CDS | open | 278696-279880 | _na 394_aa | tuf | elongation factor Tu |
| 295 | AP019827.1 | GCA008327825_00254 | CDS | open | 280309-281409 | _na 366_aa | Porin | |
| 296 | AP019827.1 | GCA008327825_00256 | CDS | open | 281981-283309 | _na 442_aa | miaB | tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB |
| 297 | AP019827.1 | GCA008327825_00257 | CDS | open | 283310-284734 | _na 474_aa | rho | transcription termination factor Rho |
| 298 | AP019827.1 | GCA008327825_00258 | CDS | open | 284755-285036 | _na 93_aa | Cupin domain protein | |
| 299 | AP019827.1 | GCA008327825_00259 | CDS | open | 285221-286705 | _na 494_aa | rnfD | NQR2 and RnfD family protein |
| 300 | AP019827.1 | GCA008327825_00260 | CDS | open | 286695-288080 | _na 461_aa | rsxC | electron transport complex subunit RsxC |
| 301 | AP019827.1 | GCA008327825_00261 | CDS | open | 288254-289414 | _na 386_aa | yrpB | Nitronate monooxygenase domain-containing protein |
| 302 | AP019827.1 | GCA008327825_00262 | CDS | open | 289444-289923 | _na 159_aa | hypothetical protein | |
| 303 | AP019827.1 | GCA008327825_00263 | CDS | open | 290303-292012 | _na 569_aa | DUF262 domain-containing protein | |
| 304 | AP019827.1 | GCA008327825_00264 | CDS | open | 292024-292518 | _na 164_aa | DUF441 domain-containing protein | |
| 305 | AP019827.1 | GCA008327825_00265 | CDS | open | 292576-292815 | _na 79_aa | rpmG | 50S ribosomal protein L33 |
| 306 | AP019827.1 | GCA008327825_00267 | CDS | open | 293053-293268 | _na 71_aa | secE | preprotein translocase subunit SecE |
| 307 | AP019827.1 | GCA008327825_00268 | CDS | open | 293270-293896 | _na 208_aa | nusG | transcription termination/antitermination protein NusG |
| 308 | AP019827.1 | GCA008327825_00269 | CDS | open | 294022-294447 | _na 141_aa | rplK | 50S ribosomal protein L11 |
| 309 | AP019827.1 | GCA008327825_00270 | CDS | open | 294547-295254 | _na 235_aa | rplA | 50S ribosomal protein L1 |
| 310 | AP019827.1 | GCA008327825_00271 | CDS | open | 295581-296087 | _na 168_aa | rplJ | 50S ribosomal protein L10 |
| 311 | AP019827.1 | GCA008327825_00272 | CDS | open | 296163-296531 | _na 122_aa | rplL | 50S ribosomal protein L7/L12 |
| 312 | AP019827.1 | GCA008327825_00273 | CDS | open | 296912-300358 | _na 1148_aa | rpoB | DNA-directed RNA polymerase subunit beta |
| 313 | AP019827.1 | GCA008327825_00274 | CDS | open | 300440-300955 | _na 171_aa | DUF3828 domain-containing protein | |
| 314 | AP019827.1 | GCA008327825_00275 | CDS | open | 301027-305094 | _na 1355_aa | rpoC | DNA-directed RNA polymerase subunit beta' |
| 315 | AP019827.1 | GCA008327825_00276 | CDS | open | 305352-305897 | _na 181_aa | gmk | guanylate kinase |
| 316 | AP019827.1 | GCA008327825_00277 | CDS | open | 305939-306136 | _na 65_aa | Putative DNA-directed RNA polymerase%2C omega subunit | |
| 317 | AP019827.1 | GCA008327825_00278 | CDS | open | 306234-308072 | _na 612_aa | DNA primase | |
| 318 | AP019827.1 | GCA008327825_00279 | CDS | open | 308065-309243 | _na 392_aa | rpoD | RNA polymerase sigma factor SigA |
| 319 | AP019827.1 | GCA008327825_00280 | CDS | open | 309371-310321 | _na 316_aa | RNA polymerase sigma-70 region 4 domain-containing protein | |
| 320 | AP019827.1 | GCA008327825_00281 | CDS | open | 310560-311372 | _na 270_aa | Nif3-like dinuclear metal center hexameric protein | |
| 321 | AP019827.1 | GCA008327825_00282 | CDS | open | 311687-312970 | _na 427_aa | Nramp family divalent metal transporter | |
| 322 | AP019827.1 | GCA008327825_00291 | CDS | open | 315166-315384 | _na 72_aa | feoA | FeoA domain protein |
| 323 | AP019827.1 | GCA008327825_00292 | CDS | open | 315381-317576 | _na 731_aa | feoB | ferrous iron transport protein B |
| 324 | AP019827.1 | GCA008327825_00293 | CDS | open | 317611-317787 | _na 58_aa | Virus attachment protein p12 family protein | |
| 325 | AP019827.1 | GCA008327825_00294 | CDS | open | 318228-319292 | _na 354_aa | Tyr recombinase domain-containing protein | |
| 326 | AP019827.1 | GCA008327825_00295 | CDS | open | 319368-319565 | _na 65_aa | HTH cro/C1-type domain-containing protein | |
| 327 | AP019827.1 | GCA008327825_00296 | CDS | open | 319605-320357 | _na 250_aa | Replication protein | |
| 328 | AP019827.1 | GCA008327825_00297 | CDS | open | 321111-321317 | _na 68_aa | hypothetical protein | |
| 329 | AP019827.1 | GCA008327825_00298 | CDS | open | 321357-321506 | _na 49_aa | Methyltransferase | |
| 330 | AP019827.1 | GCA008327825_00299 | CDS | open | 321585-322454 | _na 289_aa | hypothetical protein | |
| 331 | AP019827.1 | GCA008327825_00300 | CDS | open | 322435-322683 | _na 82_aa | hypothetical protein | |
| 332 | AP019827.1 | GCA008327825_00301 | CDS | open | 322698-323021 | _na 107_aa | cheR | Signal transduction histidine kinase with CheB and CheR activity |
| 333 | AP019827.1 | GCA008327825_00302 | CDS | open | 323035-323142 | _na 35_aa | hypothetical protein | |
| 334 | AP019827.1 | GCA008327825_00303 | CDS | open | 323224-323427 | _na 67_aa | Toxin-antitoxin system%2C antitoxin component%2C Xre family | |
| 335 | AP019827.1 | GCA008327825_00304 | CDS | open | 323605-324336 | _na 243_aa | HTH cro/C1-type domain-containing protein | |
| 336 | AP019827.1 | GCA008327825_00305 | CDS | open | 326082-326378 | _na 98_aa | Toxin-antitoxin system%2C toxin component%2C RelEfamily | |
| 337 | AP019827.1 | GCA008327825_00306 | CDS | open | 326368-326646 | _na 92_aa | RelB/DinJ family addiction module antitoxin | |
| 338 | AP019827.1 | GCA008327825_00307 | CDS | open | 328087-328452 | _na 121_aa | Tyr recombinase domain-containing protein | |
| 339 | AP019827.1 | GCA008327825_00308 | CDS | open | 328589-329443 | _na 284_aa | HTH cro/C1-type domain-containing protein | |
| 340 | AP019827.1 | GCA008327825_00309 | CDS | open | 329558-329893 | _na 111_aa | XRE family transcriptional regulator | |
| 341 | AP019827.1 | GCA008327825_00310 | CDS | open | 330152-330478 | _na 108_aa | RelB/DinJ family addiction module antitoxin | |
| 342 | AP019827.1 | GCA008327825_00312 | CDS | open | 331239-332024 | _na 261_aa | ABC transporter | |
| 343 | AP019827.1 | GCA008327825_00313 | CDS | open | 332117-333175 | _na 352_aa | leuB | 3-isopropylmalate dehydrogenase |
| 344 | AP019827.1 | GCA008327825_00314 | CDS | open | 333197-333724 | _na 175_aa | DUF2262 domain-containing protein | |
| 345 | AP019827.1 | GCA008327825_00315 | CDS | open | 333831-334085 | _na 84_aa | relB | Addiction module antitoxin%2C RelB/DinJ family |
| 346 | AP019827.1 | GCA008327825_00316 | CDS | open | 334191-334649 | _na 152_aa | hypothetical protein | |
| 347 | AP019827.1 | GCA008327825_00317 | CDS | open | 334684-334941 | _na 85_aa | Endonuclease | |
| 348 | AP019827.1 | GCA008327825_00318 | CDS | open | 335240-336235 | _na 331_aa | Esterase | |
| 349 | AP019827.1 | GCA008327825_00319 | CDS | open | 336375-337139 | _na 254_aa | ubiE | Methyltransferase domain protein |
| 350 | AP019827.1 | GCA008327825_00320 | CDS | open | 337259-337633 | _na 124_aa | Integral membrane protein | |
| 351 | AP019827.1 | GCA008327825_00321 | CDS | open | 337833-338639 | _na 268_aa | DUF2262 domain-containing protein | |
| 352 | AP019827.1 | GCA008327825_00322 | CDS | open | 338674-339168 | _na 164_aa | DUF2262 domain-containing protein | |
| 353 | AP019827.1 | GCA008327825_00323 | CDS | open | 339231-339806 | _na 191_aa | leuD | 3-isopropylmalate dehydratase small subunit |
| 354 | AP019827.1 | GCA008327825_00324 | CDS | open | 340012-341430 | _na 472_aa | leuC | 3-isopropylmalate dehydratase large subunit |
| 355 | AP019827.1 | GCA008327825_00325 | CDS | open | 341497-342171 | _na 224_aa | Filamentation induced by cAMP protein fic | |
| 356 | AP019827.1 | GCA008327825_00326 | CDS | open | 342199-343038 | _na 279_aa | ywqG | DUF1963 domain-containing protein |
| 357 | AP019827.1 | GCA008327825_00327 | CDS | open | 343058-343903 | _na 281_aa | yaeI | Calcineurin-like phosphoesterase domain-containing protein |
| 358 | AP019827.1 | GCA008327825_00328 | CDS | open | 343970-344350 | _na 126_aa | ridA | Endoribonuclease L-PSP |
| 359 | AP019827.1 | GCA008327825_00329 | CDS | open | 344453-345295 | _na 280_aa | Metallophosphoesterase | |
| 360 | AP019827.1 | GCA008327825_00330 | CDS | open | 345270-345725 | _na 151_aa | DUF5658 domain-containing protein | |
| 361 | AP019827.1 | GCA008327825_00331 | CDS | open | 345800-345991 | _na 63_aa | pspC | Phage shock protein PspC N-terminal domain-containing protein |
| 362 | AP019827.1 | GCA008327825_00332 | CDS | open | 346018-346380 | _na 120_aa | DUF4181 domain-containing protein | |
| 363 | AP019827.1 | GCA008327825_00333 | CDS | open | 346395-346961 | _na 188_aa | Flavodoxin-like fold domain-containing protein | |
| 364 | AP019827.1 | GCA008327825_00334 | CDS | open | 347648-348943 | _na 431_aa | Cytosine-specific methyltransferase | |
| 365 | AP019827.1 | GCA008327825_00335 | CDS | open | 348999-350126 | _na 375_aa | GmrSD restriction endonucleases N-terminal domain-containing protein | |
| 366 | AP019827.1 | GCA008327825_00336 | CDS | open | 350116-350706 | _na 196_aa | Polymerase nucleotidyl transferase domain-containing protein | |
| 367 | AP019827.1 | GCA008327825_00337 | CDS | open | 351171-351677 | _na 168_aa | asbA | Petrobactin biosynthesis protein AsbA |
| 368 | AP019827.1 | GCA008327825_00338 | CDS | open | 351704-353215 | _na 503_aa | leuA | 2-isopropylmalate synthase |
| 369 | AP019827.1 | GCA008327825_00339 | CDS | open | 353330-354079 | _na 249_aa | ubiE | Methyltransferase type 11 domain-containing protein |
| 370 | AP019827.1 | GCA008327825_00340 | CDS | open | 354202-354690 | _na 162_aa | ilvN | acetolactate synthase small subunit |
| 371 | AP019827.1 | GCA008327825_00341 | CDS | open | 354683-356404 | _na 573_aa | ilvB | biosynthetic-type acetolactate synthase large subunit |
| 372 | AP019827.1 | GCA008327825_00342 | CDS | open | 356445-357668 | _na 407_aa | ilvA | threonine ammonia-lyase |
| 373 | AP019827.1 | GCA008327825_00343 | CDS | open | 357788-358657 | _na 289_aa | BD-FAE-like domain-containing protein | |
| 374 | AP019827.1 | GCA008327825_00344 | CDS | open | 358900-360573 | _na 557_aa | ilvD | dihydroxy-acid dehydratase |
| 375 | AP019827.1 | GCA008327825_00345 | CDS | open | 360790-360951 | _na 53_aa | hypothetical protein | |
| 376 | AP019827.1 | GCA008327825_00346 | CDS | open | 361105-361845 | _na 246_aa | Tetratricopeptide repeat protein | |
| 377 | AP019827.1 | GCA008327825_00347 | CDS | open | 362015-362812 | _na 265_aa | Tetratricopeptide repeat protein | |
| 378 | AP019827.1 | GCA008327825_00348 | CDS | open | 363201-364925 | _na 574_aa | argS | arginine--tRNA ligase |
| 379 | AP019827.1 | GCA008327825_00349 | CDS | open | 365173-365460 | _na 95_aa | Serine/threonine protein phosphatase-like protein | |
| 380 | AP019827.1 | GCA008327825_00350 | CDS | open | 365481-366335 | _na 284_aa | Polysaccharide deacetylase | |
| 381 | AP019827.1 | GCA008327825_00351 | CDS | open | 366488-366982 | _na 164_aa | rlpA | putative endolytic peptidoglycan transglycosylase RlpA |
| 382 | AP019827.1 | GCA008327825_00352 | CDS | open | 367038-367748 | _na 236_aa | fabG | 3-oxoacyl-[acyl-carrier-protein] reductase |
| 383 | AP019827.1 | GCA008327825_00353 | CDS | open | 367756-368388 | _na 210_aa | Ribonuclease H | |
| 384 | AP019827.1 | GCA008327825_00354 | CDS | open | 368408-368866 | _na 152_aa | hypothetical protein | |
| 385 | AP019827.1 | GCA008327825_00355 | CDS | open | 368998-369135 | _na 45_aa | Membrane intrinsic methyl-accepting chemotaxis phosphatase | |
| 386 | AP019827.1 | GCA008327825_00356 | CDS | open | 369163-371424 | _na 753_aa | GTP diphosphokinase | |
| 387 | AP019827.1 | GCA008327825_00357 | CDS | open | 371872-372618 | _na 248_aa | sufC | Fe-S cluster assembly ATPase SufC |
| 388 | AP019827.1 | GCA008327825_00358 | CDS | open | 372633-374063 | _na 476_aa | sufB | Fe-S cluster assembly protein SufB |
| 389 | AP019827.1 | GCA008327825_00359 | CDS | open | 374202-375329 | _na 375_aa | sufD | Fe-S cluster assembly protein SufD |
| 390 | AP019827.1 | GCA008327825_00360 | CDS | open | 375522-376727 | _na 401_aa | csdA | cysteine desulfurase |
| 391 | AP019827.1 | GCA008327825_00361 | CDS | open | 376767-377216 | _na 149_aa | sufU | Fe-S cluster assembly sulfur transfer protein SufU |
| 392 | AP019827.1 | GCA008327825_00362 | CDS | open | 377469-378803 | _na 444_aa | Spherulation-specific family 4 | |
| 393 | AP019827.1 | GCA008327825_00363 | CDS | open | 379060-379638 | _na 192_aa | 5-formyltetrahydrofolate cyclo-ligase | |
| 394 | AP019827.1 | GCA008327825_00364 | CDS | open | 379753-380340 | _na 195_aa | cobU | bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase |
| 395 | AP019827.1 | GCA008327825_00365 | CDS | open | 380383-381039 | _na 218_aa | arsR | ArsR family transcriptional regulator |
| 396 | AP019827.1 | GCA008327825_00366 | CDS | open | 381514-381825 | _na 103_aa | trxA | thioredoxin |
| 397 | AP019827.1 | GCA008327825_00367 | CDS | open | 381934-382869 | _na 311_aa | trxB | thioredoxin-disulfide reductase |
| 398 | AP019827.1 | GCA008327825_00368 | CDS | open | 383190-384602 | _na 470_aa | O-antigen polysaccharide polymerase Wzy | |
| 399 | AP019827.1 | GCA008327825_00369 | CDS | open | 384625-385575 | _na 316_aa | DUF304 domain-containing protein | |
| 400 | AP019827.1 | GCA008327825_00370 | CDS | open | 385597-386070 | _na 157_aa | Acetyltransferase%2C GNAT family | |
| 401 | AP019827.1 | GCA008327825_00371 | CDS | open | 386080-386868 | _na 262_aa | Glycosyltransferase | |
| 402 | AP019827.1 | GCA008327825_00372 | CDS | open | 386970-387743 | _na 257_aa | Endonuclease/exonuclease/phosphatase | |
| 403 | AP019827.1 | GCA008327825_00373 | CDS | open | 387784-388620 | _na 278_aa | Glycosyltransferase%2C group 2 family protein | |
| 404 | AP019827.1 | GCA008327825_00374 | CDS | open | 388636-389652 | _na 338_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 405 | AP019827.1 | GCA008327825_00375 | CDS | open | 389658-390617 | _na 319_aa | Site-specific DNA-methyltransferase (adenine-specific) | |
| 406 | AP019827.1 | GCA008327825_00376 | CDS | open | 390556-392127 | _na 523_aa | alwI | AlwI restriction endonuclease |
| 407 | AP019827.1 | GCA008327825_00377 | CDS | open | 392154-393347 | _na 397_aa | CDP-glycerol:poly(Glycerophosphate) glycerophosphotransferase | |
| 408 | AP019827.1 | GCA008327825_00378 | CDS | open | 393347-393625 | _na 92_aa | hypothetical protein | |
| 409 | AP019827.1 | GCA008327825_00379 | CDS | open | 393960-395057 | _na 365_aa | tnpB | Transposase%2C IS605 OrfB family |
| 410 | AP019827.1 | GCA008327825_00380 | CDS | open | 395284-397965 | _na 893_aa | mutS | DNA mismatch repair protein MutS |
| 411 | AP019827.1 | GCA008327825_00381 | CDS | open | 397979-400297 | _na 772_aa | lptC | LPS export ABC transporter periplasmic protein LptC |
| 412 | AP019827.1 | GCA008327825_00382 | CDS | open | 400774-401454 | _na 226_aa | Hemolysin III family channel protein | |
| 413 | AP019827.1 | GCA008327825_00383 | CDS | open | 401494-402051 | _na 185_aa | Putative transposase | |
| 414 | AP019827.1 | GCA008327825_00384 | CDS | open | 402276-403172 | _na 298_aa | lgt | prolipoprotein diacylglyceryl transferase |
| 415 | AP019827.1 | GCA008327825_00385 | CDS | open | 403245-404333 | _na 362_aa | pucG | Aminotransferase class V domain-containing protein |
| 416 | AP019827.1 | GCA008327825_00386 | CDS | open | 404370-405206 | _na 278_aa | kdsA | 3-deoxy-8-phosphooctulonate synthase |
| 417 | AP019827.1 | GCA008327825_00387 | CDS | open | 405537-406664 | _na 375_aa | Putative mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase | |
| 418 | AP019827.1 | GCA008327825_00388 | CDS | open | 406716-407696 | _na 326_aa | Arabinose 5-phosphate isomerase | |
| 419 | AP019827.1 | GCA008327825_00389 | CDS | open | 407713-409173 | _na 486_aa | rfbX | Polysaccharide biosynthesis protein C-terminal domain-containing protein |
| 420 | AP019827.1 | GCA008327825_00390 | CDS | open | 409209-410081 | _na 290_aa | Family 2 glycosyl transferase | |
| 421 | AP019827.1 | GCA008327825_00391 | CDS | open | 410107-411186 | _na 359_aa | mnmA | tRNA 2-thiouridine(34) synthase MnmA |
| 422 | AP019827.1 | GCA008327825_00393 | CDS | open | 411569-413557 | _na 662_aa | fusA | Small GTP-binding protein |
| 423 | AP019827.1 | GCA008327825_00394 | CDS | open | 413740-414267 | _na 175_aa | psbP | PsbP C-terminal domain-containing protein |
| 424 | AP019827.1 | GCA008327825_00395 | CDS | open | 414552-414668 | _na 38_aa | Lipoprotein | |
| 425 | AP019827.1 | GCA008327825_00396 | CDS | open | 414701-414820 | _na 39_aa | Lipoprotein | |
| 426 | AP019827.1 | GCA008327825_00397 | CDS | open | 414987-415526 | _na 179_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 427 | AP019827.1 | GCA008327825_00398 | CDS | open | 415993-417033 | _na 346_aa | Sel1 domain-containing protein repeat-containing protein | |
| 428 | AP019827.1 | GCA008327825_00399 | CDS | open | 417476-418408 | _na 310_aa | pyrD | dihydroorotate oxidase |
| 429 | AP019827.1 | GCA008327825_00400 | CDS | open | 418441-419175 | _na 244_aa | sIR2 | NAD-dependent protein deacylase |
| 430 | AP019827.1 | GCA008327825_00401 | CDS | open | 419212-419667 | _na 151_aa | wzb | protein-tyrosine-phosphatase |
| 431 | AP019827.1 | GCA008327825_00402 | CDS | open | 419850-421031 | _na 393_aa | gltP | Sodium:dicarboxylate symporter |
| 432 | AP019827.1 | GCA008327825_00403 | CDS | open | 421457-421915 | _na 152_aa | Septicolysin | |
| 433 | AP019827.1 | GCA008327825_00404 | CDS | open | 422172-423221 | _na 349_aa | hrcA | heat-inducible transcriptional repressor HrcA |
| 434 | AP019827.1 | GCA008327825_00405 | CDS | open | 423203-423769 | _na 188_aa | grpE | nucleotide exchange factor GrpE |
| 435 | AP019827.1 | GCA008327825_00406 | CDS | open | 423889-425712 | _na 607_aa | dnaK | molecular chaperone DnaK |
| 436 | AP019827.1 | GCA008327825_00407 | CDS | open | 425849-426100 | _na 83_aa | SpoVT-AbrB domain-containing protein | |
| 437 | AP019827.1 | GCA008327825_00408 | CDS | open | 426094-426423 | _na 109_aa | mRNA interferase | |
| 438 | AP019827.1 | GCA008327825_00409 | CDS | open | 426502-427383 | _na 293_aa | galM | Aldose 1-epimerase |
| 439 | AP019827.1 | GCA008327825_00410 | CDS | open | 427569-428054 | _na 161_aa | Phosphatidate cytidylyltransferase | |
| 440 | AP019827.1 | GCA008327825_00411 | CDS | open | 428149-429330 | _na 393_aa | dnaJ | molecular chaperone DnaJ |
| 441 | AP019827.1 | GCA008327825_00412 | CDS | open | 429555-430565 | _na 336_aa | ilvC | ketol-acid reductoisomerase |
| 442 | AP019827.1 | GCA008327825_00413 | CDS | open | 430878-432626 | _na 582_aa | ErfK/YbiS/YcfS/YnhG family protein | |
| 443 | AP019827.1 | GCA008327825_00414 | CDS | open | 432663-434357 | _na 564_aa | L%2CD-TPase catalytic domain-containing protein | |
| 444 | AP019827.1 | GCA008327825_00415 | CDS | open | 434508-435728 | _na 406_aa | malY | cysteine-S-conjugate beta-lyase |
| 445 | AP019827.1 | GCA008327825_00416 | CDS | open | 435750-437321 | _na 523_aa | Sel1 repeat protein | |
| 446 | AP019827.1 | GCA008327825_00417 | CDS | open | 437369-437863 | _na 164_aa | nimA | Pyridoxamine 5'-phosphate oxidase family protein |
| 447 | AP019827.1 | GCA008327825_00418 | CDS | open | 437904-439574 | _na 556_aa | mIS1 | formate--tetrahydrofolate ligase |
| 448 | AP019827.1 | GCA008327825_00419 | CDS | open | 439782-444125 | _na 1447_aa | PolC-type DNA polymerase III | |
| 449 | AP019827.1 | GCA008327825_00420 | CDS | open | 444538-445275 | _na 245_aa | nadE | NH(3)-dependent NAD(+) synthetase |
| 450 | AP019827.1 | GCA008327825_00421 | CDS | open | 445277-446473 | _na 398_aa | pncB | nicotinate phosphoribosyltransferase |
| 451 | AP019827.1 | GCA008327825_00422 | CDS | open | 446512-447048 | _na 178_aa | Citrate lyase ligase domain protein | |
| 452 | AP019827.1 | GCA008327825_00423 | CDS | open | 447290-448174 | _na 294_aa | fba1 | fructose bisphosphate aldolase |
| 453 | AP019827.1 | GCA008327825_00424 | CDS | open | 448364-449083 | _na 239_aa | tACO1 | YebC/PmpR family DNA-binding transcriptional regulator |
| 454 | AP019827.1 | GCA008327825_00425 | CDS | open | 449371-450114 | _na 247_aa | trmN6 | Methyltransferase |
| 455 | AP019827.1 | GCA008327825_00426 | CDS | open | 450358-451107 | _na 249_aa | queuosine precursor transporter | |
| 456 | AP019827.1 | GCA008327825_00427 | CDS | open | 451107-451811 | _na 234_aa | Radical SAM protein | |
| 457 | AP019827.1 | GCA008327825_00428 | CDS | open | 452117-452491 | _na 124_aa | hypothetical protein | |
| 458 | AP019827.1 | GCA008327825_00429 | CDS | open | 452867-453601 | _na 244_aa | lptB | LPS export ABC transporter ATP-binding protein |
| 459 | AP019827.1 | GCA008327825_00430 | CDS | open | 453616-454233 | _na 205_aa | Peptidase S51 dipeptidase E | |
| 460 | AP019827.1 | GCA008327825_00431 | CDS | open | 454527-457142 | _na 871_aa | alaS | alanine--tRNA ligase |
| 461 | AP019827.1 | GCA008327825_00432 | CDS | open | 457245-457661 | _na 138_aa | ruvX | Holliday junction resolvase RuvX |
| 462 | AP019827.1 | GCA008327825_00433 | CDS | open | 457820-459037 | _na 405_aa | secD | Protein translocase subunit SecD |
| 463 | AP019827.1 | GCA008327825_00434 | CDS | open | 459027-459998 | _na 323_aa | secF | Protein-export membrane protein SecF |
| 464 | AP019827.1 | GCA008327825_00435 | CDS | open | 460056-461153 | _na 365_aa | alr | alanine racemase |
| 465 | AP019827.1 | GCA008327825_00436 | CDS | open | 461164-461745 | _na 193_aa | cvpA | CvpA family protein |
| 466 | AP019827.1 | GCA008327825_00437 | CDS | open | 461810-462907 | _na 365_aa | Permease%2C YjgP/YjgQ family | |
| 467 | AP019827.1 | GCA008327825_00438 | CDS | open | 462921-463997 | _na 358_aa | Permease%2C YjgP/YjgQ family | |
| 468 | AP019827.1 | GCA008327825_00439 | CDS | open | 464176-465408 | _na 410_aa | Peptidase M16 domain-containing protein | |
| 469 | AP019827.1 | GCA008327825_00440 | CDS | open | 465452-466558 | _na 368_aa | rodA | rod shape-determining protein RodA |
| 470 | AP019827.1 | GCA008327825_00441 | CDS | open | 466580-467551 | _na 323_aa | Pseudouridine synthase | |
| 471 | AP019827.1 | GCA008327825_00442 | CDS | open | 467820-468671 | _na 283_aa | accD | acetyl-CoA carboxylase%2C carboxyltransferase subunit beta |
| 472 | AP019827.1 | GCA008327825_00443 | CDS | open | 468705-469652 | _na 315_aa | acetyl-CoA carboxylase carboxyltransferase subunit alpha | |
| 473 | AP019827.1 | GCA008327825_00444 | CDS | open | 469728-470132 | _na 134_aa | ATP synthase I | |
| 474 | AP019827.1 | GCA008327825_00445 | CDS | open | 470175-470519 | _na 114_aa | F0F1-ATPase subunit | |
| 475 | AP019827.1 | GCA008327825_00446 | CDS | open | 470541-471314 | _na 257_aa | Type 11 methyltransferase | |
| 476 | AP019827.1 | GCA008327825_00447 | CDS | open | 471529-471963 | _na 144_aa | hypothetical protein | |
| 477 | AP019827.1 | GCA008327825_00448 | CDS | open | 472210-473922 | _na 570_aa | proS | proline--tRNA ligase |
| 478 | AP019827.1 | GCA008327825_00449 | CDS | open | 474033-474398 | _na 121_aa | ridA | Endoribonuclease L-PSP |
| 479 | AP019827.1 | GCA008327825_00450 | CDS | open | 474495-476846 | _na 783_aa | Patatin | |
| 480 | AP019827.1 | GCA008327825_00451 | CDS | open | 476886-477602 | _na 238_aa | yjjG | YjjG family noncanonical pyrimidine nucleotidase |
| 481 | AP019827.1 | GCA008327825_00452 | CDS | open | 478008-479006 | _na 332_aa | hypothetical protein | |
| 482 | AP019827.1 | GCA008327825_00453 | CDS | open | 479060-480274 | _na 404_aa | hypothetical protein | |
| 483 | AP019827.1 | GCA008327825_00454 | CDS | open | 480300-481544 | _na 414_aa | YARHG domain-containing protein | |
| 484 | AP019827.1 | GCA008327825_00455 | CDS | open | 481808-483046 | _na 412_aa | Glycosyl hydrolase-like 10 domain-containing protein | |
| 485 | AP019827.1 | GCA008327825_00456 | CDS | open | 483416-484657 | _na 413_aa | gltS | sodium/glutamate symporter |
| 486 | AP019827.1 | GCA008327825_00457 | CDS | open | 485029-485925 | _na 298_aa | atpB | F0F1 ATP synthase subunit A |
| 487 | AP019827.1 | GCA008327825_00458 | CDS | open | 486049-486291 | _na 80_aa | atpE | ATP synthase F0 subunit C |
| 488 | AP019827.1 | GCA008327825_00459 | CDS | open | 486468-486956 | _na 162_aa | atpF | F0F1 ATP synthase subunit B |
| 489 | AP019827.1 | GCA008327825_00460 | CDS | open | 486958-487485 | _na 175_aa | atpH | ATP synthase F1 subunit delta |
| 490 | AP019827.1 | GCA008327825_00461 | CDS | open | 487504-489009 | _na 501_aa | atpA | F0F1 ATP synthase subunit alpha |
| 491 | AP019827.1 | GCA008327825_00462 | CDS | open | 489025-489885 | _na 286_aa | atpG | ATP synthase F1 subunit gamma |
| 492 | AP019827.1 | GCA008327825_00463 | CDS | open | 489956-491353 | _na 465_aa | atpD | F0F1 ATP synthase subunit beta |
| 493 | AP019827.1 | GCA008327825_00464 | CDS | open | 491459-491848 | _na 129_aa | atpC | ATP synthase F1 subunit epsilon |
| 494 | AP019827.1 | GCA008327825_00465 | CDS | open | 492013-493011 | _na 332_aa | DUF4912 domain-containing protein | |
| 495 | AP019827.1 | GCA008327825_00466 | CDS | open | 493054-493437 | _na 127_aa | Aldoketomutase | |
| 496 | AP019827.1 | GCA008327825_00467 | CDS | open | 493554-494288 | _na 244_aa | dapB | 4-hydroxy-tetrahydrodipicolinate reductase |
| 497 | AP019827.1 | GCA008327825_00468 | CDS | open | 494639-495040 | _na 133_aa | Lipoprotein | |
| 498 | AP019827.1 | GCA008327825_00469 | CDS | open | 495106-495705 | _na 199_aa | Peptidyl-prolyl cis-trans isomerase | |
| 499 | AP019827.1 | GCA008327825_00470 | CDS | open | 495739-496941 | _na 400_aa | argG | argininosuccinate synthase |
| 500 | AP019827.1 | GCA008327825_00471 | CDS | open | 497366-498241 | _na 291_aa | metF | methylenetetrahydrofolate reductase [NAD(P)H] |

