HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Moraxella catarrhalis (GCA_009378645.1)

Select a Genome:
BAKTA Annotations for GCA_009378645.1
Genome Selected: Moraxella catarrhalis
ContigsBases CDSrRNA tmRNAtRNA
25 1893992 1725 3 1 45
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3564 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 3564 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 NXCO01000018.1 GCA009378645_00705 gene open 291598-292503 lpxC
1502 NXCO01000018.1 GCA009378645_00706 gene open 292780-293355 efp
1503 NXCO01000018.1 GCA009378645_00707 gene open 293485-294555 epmB
1504 NXCO01000018.1 GCA009378645_00709 gene open 294849-295238 ybjQ
1505 NXCO01000018.1 GCA009378645_00710 gene open 295291-295653 ybjQ
1506 NXCO01000018.1 GCA009378645_00711 gene open 295763-296284 yecA
1507 NXCO01000018.1 GCA009378645_00712 gene open 296387-296605
1508 NXCO01000018.1 GCA009378645_00713 gene open 296700-297956
1509 NXCO01000018.1 GCA009378645_00714 gene open 298229-299344 serB
1510 NXCO01000018.1 GCA009378645_00715 gene open 299411-299899
1511 NXCO01000018.1 GCA009378645_00716 gene open 300013-301053 bioB
1512 NXCO01000018.1 GCA009378645_00717 gene open 301162-303114 estA
1513 NXCO01000018.1 GCA009378645_00718 gene open 303264-303701 hemJ
1514 NXCO01000018.1 GCA009378645_00719 gene open 303711-304475 truC
1515 NXCO01000018.1 GCA009378645_00720 gene open 304648-305604
1516 NXCO01000018.1 GCA009378645_00721 gene open 305670-306218 purE
1517 NXCO01000018.1 GCA009378645_00722 gene open 306307-307431 purK
1518 NXCO01000018.1 GCA009378645_00723 gene open 307468-307926
1519 NXCO01000018.1 GCA009378645_00724 gene open 308096-309268 perM
1520 NXCO01000018.1 GCA009378645_00725 gene open 309268-310323 serA
1521 NXCO01000018.1 GCA009378645_00726 gene open 310371-311345 epmA
1522 NXCO01000018.1 GCA009378645_00727 gene open 311342-312154 citE
1523 NXCO01000018.1 GCA009378645_00728 gene open 312189-313394
1524 NXCO01000018.1 GCA009378645_00729 gene open 313401-313769
1525 NXCO01000018.1 GCA009378645_00730 gene open 313814-314833 pyrB
1526 NXCO01000018.1 GCA009378645_00731 gene open 315085-316083 fbp
1527 NXCO01000018.1 GCA009378645_00732 gene open 316172-316948 spoU
1528 NXCO01000018.1 GCA009378645_00733 gene open 317199-318128 fixB
1529 NXCO01000018.1 GCA009378645_00734 gene open 318167-318916 fixA
1530 NXCO01000018.1 GCA009378645_00735 gene open 319067-320080 rhaT
1531 NXCO01000018.1 GCA009378645_00736 gene open 320103-321398 hutI
1532 NXCO01000018.1 GCA009378645_00737 gene open 321490-322554 hutG
1533 NXCO01000018.1 GCA009378645_00738 gene open 322665-324218 hutH
1534 NXCO01000018.1 GCA009378645_00739 gene open 324316-326031 hutU
1535 NXCO01000018.1 GCA009378645_00740 gene open 326191-328824 acnB
1536 NXCO01000018.1 GCA009378645_00741 gene open 329214-329666 pilA
1537 NXCO01000018.1 GCA009378645_00742 gene open 329828-330199 rplS
1538 NXCO01000018.1 GCA009378645_00743 gene open 330346-331098 trmD
1539 NXCO01000018.1 GCA009378645_00744 gene open 331132-331689 rimM
1540 NXCO01000018.1 GCA009378645_00745 gene open 331836-332084 rpsP
1541 NXCO01000018.1 GCA009378645_00746 gene open 332317-333747 baeS
1542 NXCO01000018.1 GCA009378645_00747 gene open 333734-335437 baeS
1543 NXCO01000018.1 GCA009378645_00748 gene open 335518-336231 ompR
1544 NXCO01000018.1 GCA009378645_00749 gene open 336310-336729 atpC
1545 NXCO01000018.1 GCA009378645_00750 gene open 336805-338226 atpD
1546 NXCO01000018.1 GCA009378645_00751 gene open 338315-338650
1547 NXCO01000018.1 GCA009378645_00752 gene open 338673-339545 atpG
1548 NXCO01000018.1 GCA009378645_00753 gene open 339630-341174 atpA
1549 NXCO01000018.1 GCA009378645_00754 gene open 341209-341757 atpH
1550 NXCO01000018.1 GCA009378645_00755 gene open 341770-342237 atpF
1551 NXCO01000018.1 GCA009378645_00756 gene open 342325-342570 atpE
1552 NXCO01000018.1 GCA009378645_00757 gene open 342619-343488 atpB
1553 NXCO01000018.1 GCA009378645_00758 gene open 344039-344446
1554 NXCO01000018.1 GCA009378645_00759 gene open 344529-345419 znuA
1555 NXCO01000018.1 GCA009378645_00760 gene open 345741-346256 fur
1556 NXCO01000018.1 GCA009378645_00761 gene open 346234-347010 znuC
1557 NXCO01000018.1 GCA009378645_00762 gene open 347007-347810 znuB
1558 NXCO01000018.1 GCA009378645_00763 gene open 347803-348636 cpdA
1559 NXCO01000018.1 GCA009378645_00764 gene open 348756-349175 dksA
1560 NXCO01000018.1 GCA009378645_00765 gene open 349180-350097 gluQRS
1561 NXCO01000018.1 GCA009378645_00766 gene open 350200-350742
1562 NXCO01000018.1 GCA009378645_00767 gene open 351058-351735 gph
1563 NXCO01000018.1 GCA009378645_00768 gene open 351821-353671 uvrC
1564 NXCO01000018.1 GCA009378645_00769 gene open 353807-355360 gadA
1565 NXCO01000018.1 GCA009378645_00770 gene open 355449-356048
1566 NXCO01000018.1 GCA009378645_00771 gene open 355988-356647
1567 NXCO01000018.1 GCA009378645_00772 gene open 356647-359802
1568 NXCO01000018.1 GCA009378645_00773 gene open 359799-361928
1569 NXCO01000018.1 GCA009378645_00774 gene open 361985-363109
1570 NXCO01000018.1 GCA009378645_00775 gene open 363113-363568
1571 NXCO01000018.1 GCA009378645_00776 gene open 363568-364584
1572 NXCO01000018.1 GCA009378645_00777 gene open 364586-366124
1573 NXCO01000018.1 GCA009378645_00778 gene open 366299-367675 argD
1574 NXCO01000018.1 GCA009378645_00779 gene open 368162-368878 queE
1575 NXCO01000018.1 GCA009378645_00780 gene open 368988-369629 yadS
1576 NXCO01000018.1 GCA009378645_00781 gene open 369668-371437 recJ
1577 NXCO01000018.1 GCA009378645_00782 gene open 371437-372378 ispH
1578 NXCO01000018.1 GCA009378645_00783 gene open 372545-373174 gmk
1579 NXCO01000018.1 GCA009378645_00784 gene open 373262-373534 rpoZ
1580 NXCO01000018.1 GCA009378645_00785 gene open 373820-376006 spoT
1581 NXCO01000018.1 GCA009378645_00786 gene open 376102-376281
1582 NXCO01000018.1 GCA009378645_00787 gene open 376310-376690 ridA
1583 NXCO01000018.1 GCA009378645_00788 gene open 376894-377799 efeB
1584 NXCO01000018.1 GCA009378645_00789 gene open 377810-380098 priA
1585 NXCO01000018.1 GCA009378645_00790 gene open 380117-380845
1586 NXCO01000018.1 GCA009378645_00791 gene open 380895-381833
1587 NXCO01000018.1 GCA009378645_00792 gene open 381952-382782 trmB
1588 NXCO01000018.1 GCA009378645_00793 gene open 382896-383867 ribF
1589 NXCO01000018.1 GCA009378645_00794 gene open 383882-384520 ygfB
1590 NXCO01000018.1 GCA009378645_00795 gene open 384814-385173
1591 NXCO01000018.1 GCA009378645_00796 gene open 385209-385556 zapA
1592 NXCO01000018.1 GCA009378645_00797 gene open 385618-385893 yajC
1593 NXCO01000018.1 GCA009378645_00798 gene open 386142-387833 nit1
1594 NXCO01000018.1 GCA009378645_00799 gene open 387887-388597 yggS
1595 NXCO01000018.1 GCA009378645_00800 gene open 388885-389934 pilT
1596 NXCO01000018.1 GCA009378645_00801 gene open 390113-390553 fur
1597 NXCO01000018.1 GCA009378645_00802 gene open 390787-391155 bamE
1598 NXCO01000018.1 GCA009378645_00803 gene open 391219-391857 dedA
1599 NXCO01000018.1 GCA009378645_00804 gene open 392122-393009 lysR
1600 NXCO01000018.1 GCA009378645_00805 gene open 393155-395467
1601 NXCO01000018.1 GCA009378645_00445 gene open 45-121 trnD
1602 NXCO01000018.1 GCA009378645_00457 gene open 8753-8843 trnS
1603 NXCO01000018.1 GCA009378645_00458 gene open 8867-8957 trnS
1604 NXCO01000018.1 GCA009378645_00576 gene open 148705-148780 trnN
1605 NXCO01000018.1 GCA009378645_00664 gene open 244756-244829 trnC
1606 NXCO01000018.1 GCA009378645_00665 gene open 244875-244961 trnL
1607 NXCO01000018.1 GCA009378645_00708 gene open 294586-294662 trnV
1608 NXCO01000018.1 GCA009378645_00445 tRNA open 45-121 trnD tRNA-Asp(gtc)
1609 NXCO01000018.1 GCA009378645_00457 tRNA open 8753-8843 trnS tRNA-Ser(tga)
1610 NXCO01000018.1 GCA009378645_00458 tRNA open 8867-8957 trnS tRNA-Ser(tga)
1611 NXCO01000018.1 GCA009378645_00576 tRNA open 148705-148780 trnN tRNA-Asn(gtt)
1612 NXCO01000018.1 GCA009378645_00664 tRNA open 244756-244829 trnC tRNA-Cys(gca)
1613 NXCO01000018.1 GCA009378645_00665 tRNA open 244875-244961 trnL tRNA-Leu(taa)
1614 NXCO01000018.1 GCA009378645_00708 tRNA open 294586-294662 trnV tRNA-Val(gac)
1615 NXCO01000019.1 rep_origin open 38925-39521
1616 NXCO01000019.1 GCA009378645_00808 gene open 55-168 rrf
1617 NXCO01000019.1 GCA009378645_00809 gene open 279-3436 rrl
1618 NXCO01000019.1 GCA009378645_00812 gene open 3935-5464 rrs
1619 NXCO01000019.1 GCA009378645_00808 rRNA open 55-168 rrf 5S ribosomal RNA
1620 NXCO01000019.1 GCA009378645_00809 rRNA open 279-3436 rrl 23S ribosomal RNA
1621 NXCO01000019.1 GCA009378645_00812 rRNA open 3935-5464 rrs 16S ribosomal RNA
1622 NXCO01000019.1 repeat_region open 66320-66776 CRISPR array with 8 repeats of length 28%2C consensus sequence TTTCTAAGCGACCTGTGCGGTCGTGAAG and spacer length 31
1623 NXCO01000019.1 repeat_region open 66836-68980 CRISPR array with 36 repeats of length 28%2C consensus sequence TTTCTAAGCGACCTGTGCGGTCGTGAAG and spacer length 32
1624 NXCO01000019.1 repeat_region open 69063-70122 CRISPR array with 18 repeats of length 28%2C consensus sequence TTTCTAAGCGACCTGTGCGGTCGTGAAG and spacer length 32
1625 NXCO01000019.1 GCA009378645_00813 CDS open 6073-6330 _na     85_aa hypothetical protein
1626 NXCO01000019.1 GCA009378645_00814 CDS open 6327-6482 _na     51_aa hypothetical protein
1627 NXCO01000019.1 GCA009378645_00815 CDS open 7016-7942 _na     308_aa znuA Manganese ABC transporter%2C periplasmic-binding protein SitA
1628 NXCO01000019.1 GCA009378645_00816 CDS open 7942-8847 _na     301_aa znuC Manganese ABC transporter%2C ATP-binding protein SitB
1629 NXCO01000019.1 GCA009378645_00817 CDS open 8844-9686 _na     280_aa znuB Iron ABC transporter permease
1630 NXCO01000019.1 GCA009378645_00818 CDS open 9861-10565 _na     234_aa znuB Manganese ABC transporter%2C inner membrane permease protein SitD
1631 NXCO01000019.1 GCA009378645_00819 CDS open 11071-12291 _na     406_aa tyrS tyrosine--tRNA ligase
1632 NXCO01000019.1 GCA009378645_00820 CDS open 12453-13688 _na     411_aa anmK anhydro-N-acetylmuramic acid kinase
1633 NXCO01000019.1 GCA009378645_00821 CDS open 13938-14717 _na     259_aa Protein NO VEIN C-terminal domain-containing protein
1634 NXCO01000019.1 GCA009378645_00822 CDS open 14711-14959 _na     82_aa hypothetical protein
1635 NXCO01000019.1 GCA009378645_00823 CDS open 15447-16247 _na     266_aa czcD Cadmium%2C cobalt and zinc/H(+)-K(+) antiporter
1636 NXCO01000019.1 GCA009378645_00824 CDS open 16487-17740 _na     417_aa rocD ornithine--oxo-acid transaminase
1637 NXCO01000019.1 GCA009378645_00825 CDS open 17782-18714 _na     310_aa rocF arginase
1638 NXCO01000019.1 GCA009378645_00826 CDS open 19285-19635 _na     116_aa Methylitaconate delta2-delta3-isomerase
1639 NXCO01000019.1 GCA009378645_00827 CDS open 19662-21446 _na     594_aa aF0785 DUF389 domain-containing protein
1640 NXCO01000019.1 GCA009378645_00828 CDS open 21679-22287 _na     202_aa rsmC Ribosomal RNA small subunit methyltransferase C
1641 NXCO01000019.1 GCA009378645_00829 CDS open 22380-22802 _na     140_aa Putative vgr related protein
1642 NXCO01000019.1 GCA009378645_00830 CDS open 22958-24196 _na     412_aa rarA Replication-associated recombination protein A
1643 NXCO01000019.1 GCA009378645_00831 CDS open 24311-25405 _na     364_aa ribBA bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II
1644 NXCO01000019.1 GCA009378645_00832 CDS open 25572-25832 _na     86_aa yeaQ Transglycosylase
1645 NXCO01000019.1 GCA009378645_00833 CDS open 25900-26514 _na     204_aa tsaC Threonylcarbamoyl-AMP synthase
1646 NXCO01000019.1 GCA009378645_00834 CDS open 26501-27712 _na     403_aa dprA DNA-processing protein DprA
1647 NXCO01000019.1 GCA009378645_00835 CDS open 27749-29164 _na     471_aa thrC threonine synthase
1648 NXCO01000019.1 GCA009378645_00836 CDS open 29482-30828 _na     448_aa rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
1649 NXCO01000019.1 GCA009378645_00837 CDS open 30818-31843 _na     341_aa fmt methionyl-tRNA formyltransferase
1650 NXCO01000019.1 GCA009378645_00838 CDS open 31974-32642 _na     222_aa ribC riboflavin synthase
1651 NXCO01000019.1 GCA009378645_00839 CDS open 32925-33977 _na     350_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
1652 NXCO01000019.1 GCA009378645_00840 CDS open 33974-34444 _na     156_aa nrdR transcriptional regulator NrdR
1653 NXCO01000019.1 GCA009378645_00841 CDS open 34548-35948 _na     466_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
1654 NXCO01000019.1 GCA009378645_00842 CDS open 36115-37758 _na     547_aa yidC membrane protein insertase YidC
1655 NXCO01000019.1 GCA009378645_00843 CDS open 37927-38247 _na     106_aa yidD membrane protein insertion efficiency factor YidD
1656 NXCO01000019.1 GCA009378645_00844 CDS open 38265-38678 _na     137_aa rnpA ribonuclease P protein component
1657 NXCO01000019.1 GCA009378645_00845 CDS open 38790-38924 _na     44_aa rpmH 50S ribosomal protein L34
1658 NXCO01000019.1 GCA009378645_00846 CDS open 39522-40925 _na     467_aa dnaA chromosomal replication initiator protein DnaA
1659 NXCO01000019.1 GCA009378645_00847 CDS open 40962-42119 _na     385_aa dnaN DNA polymerase III subunit beta
1660 NXCO01000019.1 GCA009378645_00848 CDS open 42123-43331 _na     402_aa recF DNA replication/repair protein RecF
1661 NXCO01000019.1 GCA009378645_00849 CDS open 43468-45927 _na     819_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
1662 NXCO01000019.1 GCA009378645_00850 CDS open 46101-47660 _na     519_aa guaA glutamine-hydrolyzing GMP synthase
1663 NXCO01000019.1 GCA009378645_00851 CDS open 47813-49030 _na     405_aa Esterase-like activity of phytase family protein
1664 NXCO01000019.1 GCA009378645_00852 CDS open 49297-49791 _na     164_aa rlpA RlpA-like protein double-psi beta-barrel domain-containing protein
1665 NXCO01000019.1 GCA009378645_00853 CDS open 49805-50164 _na     119_aa fkpA Peptidyl-prolyl cis-trans isomerase
1666 NXCO01000019.1 GCA009378645_00854 CDS open 50306-51481 _na     391_aa lysA Ornithine decarboxylase
1667 NXCO01000019.1 GCA009378645_00855 CDS open 51918-52799 _na     293_aa aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme
1668 NXCO01000019.1 GCA009378645_00856 CDS open 52837-53193 _na     118_aa ridA Aminoacrylate peracid reductase
1669 NXCO01000019.1 GCA009378645_00857 CDS open 53202-54458 _na     418_aa dadA D-amino acid dehydrogenase
1670 NXCO01000019.1 GCA009378645_00858 CDS open 54800-56671 _na     623_aa thiC phosphomethylpyrimidine synthase ThiC
1671 NXCO01000019.1 GCA009378645_00859 CDS open 56788-58629 _na     613_aa mdlB ABC transporter%2C ATP-binding protein
1672 NXCO01000019.1 GCA009378645_00860 CDS open 58811-60211 _na     466_aa argH argininosuccinate lyase
1673 NXCO01000019.1 GCA009378645_00861 CDS open 60435-61400 _na     321_aa hemC hydroxymethylbilane synthase
1674 NXCO01000019.1 GCA009378645_00862 CDS open 61400-62155 _na     251_aa hemD Uroporphyrinogen-III synthase
1675 NXCO01000019.1 GCA009378645_00863 CDS open 62227-63099 _na     290_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
1676 NXCO01000019.1 GCA009378645_00864 CDS open 63165-63422 _na     85_aa nqrM (Na+)-NQR maturation NqrM
1677 NXCO01000019.1 GCA009378645_00865 CDS open 63576-65483 _na     635_aa dnaK molecular chaperone DnaK
1678 NXCO01000019.1 GCA009378645_00866 CDS open 65685-66206 _na     173_aa grpE nucleotide exchange factor GrpE
1679 NXCO01000019.1 GCA009378645_00867 CDS open 70424-71374 _na     316_aa cas1f type I-F CRISPR-associated endonuclease Cas1f
1680 NXCO01000019.1 GCA009378645_00868 CDS open 71376-74789 _na     1137_aa cas3f type I-F CRISPR-associated helicase Cas3f
1681 NXCO01000019.1 GCA009378645_00869 CDS open 74968-76341 _na     457_aa csy1 type I-F CRISPR-associated protein Csy1
1682 NXCO01000019.1 GCA009378645_00870 CDS open 76338-77273 _na     311_aa csy2 type I-F CRISPR-associated protein Csy2
1683 NXCO01000019.1 GCA009378645_00871 CDS open 77308-78315 _na     335_aa csy3 type I-F CRISPR-associated protein Csy3
1684 NXCO01000019.1 GCA009378645_00872 CDS open 78312-78902 _na     196_aa cas6f type I-F CRISPR-associated endoribonuclease Cas6/Csy4
1685 NXCO01000019.1 GCA009378645_00873 CDS open 79080-79370 _na     96_aa yggX oxidative damage protection protein
1686 NXCO01000019.1 GCA009378645_00874 CDS open 79444-79920 _na     158_aa fadM Thioesterase-like superfamily protein
1687 NXCO01000019.1 GCA009378645_00875 CDS open 80239-81621 _na     460_aa mpl UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase
1688 NXCO01000019.1 GCA009378645_00876 CDS open 81713-82222 _na     169_aa dsbB Disulfide bond formation protein B
1689 NXCO01000019.1 GCA009378645_00877 CDS open 82328-83878 _na     516_aa gshA glutamate--cysteine ligase
1690 NXCO01000019.1 GCA009378645_00878 CDS open 84028-84360 _na     110_aa erpA iron-sulfur cluster insertion protein ErpA
1691 NXCO01000019.1 GCA009378645_00879 CDS open 84507-85367 _na     286_aa tauB Cyanate ABC transporter%2C ATP-binding protein
1692 NXCO01000019.1 GCA009378645_00880 CDS open 85357-86241 _na     294_aa ntrB nitrate ABC transporter permease
1693 NXCO01000019.1 GCA009378645_00881 CDS open 86231-87646 _na     471_aa tauA Cyanate ABC transporter%2C substrate binding protein
1694 NXCO01000019.1 GCA009378645_00882 CDS open 87729-89117 _na     462_aa norV Rubredoxin-NAD+ reductase
1695 NXCO01000019.1 GCA009378645_00883 CDS open 89114-90286 _na     390_aa caiA Butyryl-CoA dehydrogenase
1696 NXCO01000019.1 GCA009378645_00884 CDS open 90543-91088 _na     181_aa yciW Carboxymuconolactone decarboxylase-like domain-containing protein
1697 NXCO01000019.1 GCA009378645_00885 CDS open 91307-93256 _na     649_aa abc-f ribosomal protection-like ABC-F family protein
1698 NXCO01000019.1 GCA009378645_00886 CDS open 93264-94103 _na     279_aa dnaJ DnaJ-class molecular chaperone CbpA
1699 NXCO01000019.1 GCA009378645_00887 CDS open 94188-95168 _na     326_aa yheT Hydrolase%2C alpha/beta fold family functionally coupled to Phosphoribulokinase
1700 NXCO01000019.1 GCA009378645_00888 CDS open 95228-96025 _na     265_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
1701 NXCO01000019.1 GCA009378645_00889 CDS open 96070-97263 _na     397_aa metC Cystathionine beta-lyase
1702 NXCO01000019.1 GCA009378645_00890 CDS open 97281-98228 _na     315_aa yfeH Sodium-dependent transporter
1703 NXCO01000019.1 GCA009378645_00891 CDS open 98390-99541 _na     383_aa dnaJ molecular chaperone DnaJ
1704 NXCO01000019.1 GCA009378645_00892 CDS open 99785-100786 _na     333_aa dsbG Thiol:disulfide interchange protein
1705 NXCO01000019.1 GCA009378645_00893 CDS open 100800-101504 _na     234_aa rsuA Pseudouridine synthase
1706 NXCO01000019.1 GCA009378645_00894 CDS open 101673-102266 _na     197_aa yIH1 YigZ family protein
1707 NXCO01000019.1 GCA009378645_00895 CDS open 102720-103046 _na     108_aa dksA Conjugal transfer protein TraR
1708 NXCO01000019.1 GCA009378645_00896 CDS open 103046-103942 _na     298_aa rluA Pseudouridylate synthase
1709 NXCO01000019.1 GCA009378645_00897 CDS open 104280-104573 _na     97_aa SHOCT domain-containing protein
1710 NXCO01000019.1 GCA009378645_00898 CDS open 104623-105834 _na     403_aa sstT serine/threonine transporter SstT
1711 NXCO01000019.1 GCA009378645_00899 CDS open 105925-106929 _na     334_aa yejR Cobalamin biosynthesis protein P47K
1712 NXCO01000019.1 GCA009378645_00900 CDS open 106996-107730 _na     244_aa ompR two-component system response regulator OmpR
1713 NXCO01000019.1 GCA009378645_00901 CDS open 107993-110359 _na     788_aa tex Transcription accessory protein S1 RNA-binding domain
1714 NXCO01000019.1 GCA009378645_00902 CDS open 110420-111118 _na     232_aa DUF305 domain-containing protein
1715 NXCO01000019.1 GCA009378645_00903 CDS open 111326-112603 _na     425_aa gltA citrate synthase
1716 NXCO01000019.1 GCA009378645_00904 CDS open 113411-113791 _na     126_aa sdhC succinate dehydrogenase%2C cytochrome b556 subunit
1717 NXCO01000019.1 GCA009378645_00905 CDS open 113791-114144 _na     117_aa sdhD succinate dehydrogenase%2C hydrophobic membrane anchor protein
1718 NXCO01000019.1 GCA009378645_00906 CDS open 114203-116053 _na     616_aa sdhA succinate dehydrogenase flavoprotein subunit
1719 NXCO01000019.1 GCA009378645_00907 CDS open 116124-116834 _na     236_aa sdhB Fumarate reductase iron-sulfur subunit
1720 NXCO01000019.1 GCA009378645_00908 CDS open 117222-120077 _na     951_aa sucA 2-oxoglutarate dehydrogenase E1 component
1721 NXCO01000019.1 GCA009378645_00909 CDS open 120171-121409 _na     412_aa odhB 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase
1722 NXCO01000019.1 GCA009378645_00910 CDS open 121499-122947 _na     482_aa lpdA dihydrolipoyl dehydrogenase
1723 NXCO01000019.1 GCA009378645_00911 CDS open 123148-123918 _na     256_aa hypothetical protein
1724 NXCO01000019.1 GCA009378645_00912 CDS open 124509-127250 _na     913_aa cirA TonB-dependent Receptor Plug domain protein
1725 NXCO01000019.1 GCA009378645_00913 CDS open 127302-127397 _na     31_aa hypothetical protein
1726 NXCO01000019.1 GCA009378645_00914 CDS open 127666-128883 _na     405_aa Porin
1727 NXCO01000019.1 GCA009378645_00915 CDS open 128982-130214 _na     410_aa Porin
1728 NXCO01000019.1 GCA009378645_00916 CDS open 130343-133138 _na     931_aa preP prolyl oligopeptidase
1729 NXCO01000019.1 GCA009378645_00917 CDS open 133327-133560 _na     77_aa Metal-binding protein
1730 NXCO01000019.1 GCA009378645_00918 CDS open 133565-135688 _na     707_aa dcp oligopeptidase A
1731 NXCO01000019.1 GCA009378645_00919 CDS open 135905-136654 _na     249_aa elsH Endonuclease/exonuclease/phosphatase domain-containing protein
1732 NXCO01000019.1 GCA009378645_00920 CDS open 136789-137400 _na     203_aa rdgB RdgB/HAM1 family non-canonical purine NTP pyrophosphatase
1733 NXCO01000019.1 GCA009378645_00921 CDS open 137585-138919 _na     444_aa tig trigger factor
1734 NXCO01000019.1 GCA009378645_00922 CDS open 139085-139738 _na     217_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
1735 NXCO01000019.1 GCA009378645_00923 CDS open 139748-141064 _na     438_aa clpX ATP-dependent protease ATP-binding subunit ClpX
1736 NXCO01000019.1 GCA009378645_00924 CDS open 141228-142352 _na     374_aa dnaJ J domain-containing protein
1737 NXCO01000019.1 GCA009378645_00925 CDS open 142702-144855 _na     717_aa fadB fatty acid oxidation complex subunit alpha FadB
1738 NXCO01000019.1 GCA009378645_00926 CDS open 144885-146057 _na     390_aa fadA acetyl-CoA C-acyltransferase FadA
1739 NXCO01000019.1 GCA009378645_00927 CDS open 146194-147351 _na     385_aa ychK UPF0028 protein YchK
1740 NXCO01000019.1 GCA009378645_00928 CDS open 147697-148428 _na     243_aa cysH phosphoadenylyl-sulfate reductase
1741 NXCO01000019.1 GCA009378645_00929 CDS open 148512-149435 _na     307_aa cysD sulfate adenylyltransferase subunit CysD
1742 NXCO01000019.1 GCA009378645_00930 CDS open 149586-150890 _na     434_aa cysN sulfate adenylyltransferase
1743 NXCO01000019.1 GCA009378645_00931 CDS open 151001-153097 _na     698_aa recG ATP-dependent DNA helicase RecG
1744 NXCO01000019.1 GCA009378645_00932 CDS open 153084-153737 _na     217_aa crp Cyclic nucleotide-binding domain-containing protein
1745 NXCO01000019.1 GCA009378645_00933 CDS open 153910-154380 _na     156_aa hlyD HlyD secretion family protein
1746 NXCO01000019.1 GCA009378645_00934 CDS open 154485-154772 _na     95_aa hlyD HlyD family secretion protein
1747 NXCO01000019.1 GCA009378645_00935 CDS open 155040-155150 _na     36_aa hypothetical protein
1748 NXCO01000019.1 GCA009378645_00936 CDS open 155128-155478 _na     116_aa AcrB/AcrD/AcrF family
1749 NXCO01000019.1 GCA009378645_00937 CDS open 155475-155747 _na     90_aa AcrB/AcrD/AcrF family protein
1750 NXCO01000019.1 GCA009378645_00938 CDS open 155796-156410 _na     204_aa Acriflavin resistance protein
1751 NXCO01000019.1 GCA009378645_00939 CDS open 156391-157380 _na     329_aa Acriflavine resistance protein B
1752 NXCO01000019.1 GCA009378645_00940 CDS open 157468-158115 _na     215_aa RND transporter
1753 NXCO01000019.1 GCA009378645_00941 CDS open 158377-158922 _na     181_aa DUF924 domain-containing protein
1754 NXCO01000019.1 GCA009378645_00942 CDS open 158914-159549 _na     211_aa coaE dephospho-CoA kinase
1755 NXCO01000019.1 GCA009378645_00943 CDS open 159701-160477 _na     258_aa pilD Peptidase
1756 NXCO01000019.1 GCA009378645_00944 CDS open 160477-161736 _na     419_aa pilC Type II secretion system (T2SS)%2C F family protein
1757 NXCO01000019.1 GCA009378645_00945 CDS open 161775-163439 _na     554_aa pilB type IV-A pilus assembly ATPase PilB
1758 NXCO01000019.1 GCA009378645_00946 CDS open 163594-164817 _na     407_aa araJ Bcr/CflA family efflux transporter
1759 NXCO01000019.1 GCA009378645_00947 CDS open 164987-168931 _na     1314_aa purL phosphoribosylformylglycinamidine synthase
1760 NXCO01000019.1 GCA009378645_00948 CDS open 169213-170484 _na     423_aa gltS sodium/glutamate symporter
1761 NXCO01000019.1 GCA009378645_00949 CDS open 170553-171884 _na     443_aa argA amino-acid N-acetyltransferase
1762 NXCO01000019.1 GCA009378645_00950 CDS open 172194-172772 _na     192_aa DUF11 domain-containing protein
1763 NXCO01000019.1 GCA009378645_00951 CDS open 173090-173434 _na     114_aa efeO iron uptake system protein EfeO
1764 NXCO01000019.1 GCA009378645_00952 CDS open 173470-174054 _na     194_aa efeO iron uptake system protein EfeO
1765 NXCO01000019.1 GCA009378645_00953 CDS open 174158-174862 _na     234_aa efeB iron uptake transporter deferrochelatase/peroxidase subunit
1766 NXCO01000019.1 GCA009378645_00954 CDS open 174841-175449 _na     202_aa Dyp-type peroxidase family protein
1767 NXCO01000019.1 GCA009378645_00955 CDS open 175597-176568 _na     323_aa dusA tRNA-dihydrouridine(16) synthase
1768 NXCO01000019.1 GCA009378645_00956 CDS open 176573-178057 _na     494_aa uvrD Putative DNA helicase
1769 NXCO01000019.1 GCA009378645_00957 CDS open 178227-178970 _na     247_aa mngR GntR family transcriptional regulator
1770 NXCO01000019.1 GCA009378645_00958 CDS open 179475-181163 _na     562_aa gltB2 Ferredoxin-dependent glutamate synthase
1771 NXCO01000019.1 GCA009378645_00959 CDS open 181365-182108 _na     247_aa tatC Sec-independent protein translocase protein TatC
1772 NXCO01000019.1 GCA009378645_00960 CDS open 182105-182641 _na     178_aa tatA Preprotein translocase subunit TatA
1773 NXCO01000019.1 GCA009378645_00961 CDS open 182638-182871 _na     77_aa tatA Sec-independent protein translocase subunit TatA
1774 NXCO01000019.1 GCA009378645_00962 CDS open 182943-183752 _na     269_aa hisIE bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE
1775 NXCO01000019.1 GCA009378645_00963 CDS open 184013-184204 _na     63_aa rpmI 50S ribosomal protein L35
1776 NXCO01000019.1 GCA009378645_00964 CDS open 184233-184589 _na     118_aa rplT 50S ribosomal protein L20
1777 NXCO01000019.1 GCA009378645_00965 CDS open 184959-187235 _na     758_aa norB Nitric-oxide reductase%2C quinol-dependent
1778 NXCO01000019.1 GCA009378645_00966 CDS open 187411-187944 _na     177_aa iscR Nitrite-sensitive transcriptional repressor NsrR
1779 NXCO01000019.1 GCA009378645_00967 CDS open 188325-189833 _na     502_aa Copper-containing nitrite reductase
1780 NXCO01000019.1 GCA009378645_00968 CDS open 190126-190962 _na     278_aa yfmG Sulfatase-modifying factor enzyme domain-containing protein
1781 NXCO01000019.1 GCA009378645_00969 CDS open 191099-191794 _na     231_aa sco1 SCO1/SenC family protein
1782 NXCO01000019.1 GCA009378645_00970 CDS open 192087-193118 _na     343_aa pheS phenylalanine--tRNA ligase subunit alpha
1783 NXCO01000019.1 GCA009378645_00971 CDS open 193171-195567 _na     798_aa pheT phenylalanine--tRNA ligase subunit beta
1784 NXCO01000019.1 GCA009378645_00972 CDS open 195716-196012 _na     98_aa hupA integration host factor subunit alpha
1785 NXCO01000019.1 GCA009378645_00973 CDS open 196225-196485 _na     86_aa rpmE type B 50S ribosomal protein L31
1786 NXCO01000019.1 GCA009378645_00974 CDS open 196810-197778 _na     322_aa zipA Cell division protein ZipA
1787 NXCO01000019.1 GCA009378645_00975 CDS open 197825-198733 _na     302_aa mutM bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase
1788 NXCO01000019.1 GCA009378645_00976 CDS open 198763-201129 _na     788_aa spoT GTP pyrophosphokinase
1789 NXCO01000019.1 GCA009378645_00977 CDS open 201803-203548 _na     581_aa srmB ATP-dependent RNA helicase
1790 NXCO01000019.1 GCA009378645_00978 CDS open 203604-205097 _na     497_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
1791 NXCO01000019.1 GCA009378645_00979 CDS open 205198-205326 _na     42_aa hypothetical protein
1792 NXCO01000019.1 GCA009378645_00980 CDS open 205384-205608 _na     74_aa hypothetical protein
1793 NXCO01000019.1 GCA009378645_00981 CDS open 205620-206393 _na     257_aa polB Putative 3'-5' exonuclease related to the exonuclease domain of PolB family protein
1794 NXCO01000019.1 GCA009378645_00982 CDS open 206402-207310 _na     302_aa cysM cysteine synthase CysM
1795 NXCO01000019.1 GCA009378645_00983 CDS open 207449-210415 _na     988_aa hPtr histidine kinase
1796 NXCO01000019.1 GCA009378645_00984 CDS open 210600-210692 _na     30_aa Inner membrane protein YgaP-like transmembrane domain-containing protein
1797 NXCO01000019.1 GCA009378645_00985 CDS open 211010-211843 _na     277_aa asd archaetidylserine decarboxylase
1798 NXCO01000019.1 GCA009378645_00986 CDS open 212083-212523 _na     146_aa ybaN Inner membrane protein
1799 NXCO01000019.1 GCA009378645_00987 CDS open 212695-214017 _na     440_aa bioA adenosylmethionine--8-amino-7-oxononanoate transaminase
1800 NXCO01000019.1 GCA009378645_00988 CDS open 214017-215216 _na     399_aa bioF Aminotransferase class I and II family protein
1801 NXCO01000019.1 GCA009378645_00989 CDS open 215213-216070 _na     285_aa tam Malonyl-[acyl-carrier protein] O-methyltransferase
1802 NXCO01000019.1 GCA009378645_00990 CDS open 216067-216771 _na     234_aa bioD dethiobiotin synthase
1803 NXCO01000019.1 GCA009378645_00991 CDS open 216784-217236 _na     150_aa dtd D-aminoacyl-tRNA deacylase
1804 NXCO01000019.1 GCA009378645_00992 CDS open 217286-217861 _na     191_aa yjhB MutT/nudix family protein
1805 NXCO01000019.1 GCA009378645_00993 CDS open 218005-218787 _na     260_aa mutT Coenzyme A pyrophosphatase
1806 NXCO01000019.1 GCA009378645_00994 CDS open 218820-219185 _na     121_aa rsfS ribosome silencing factor
1807 NXCO01000019.1 GCA009378645_00995 CDS open 219218-219982 _na     254_aa nadD nicotinate (nicotinamide) nucleotide adenylyltransferase
1808 NXCO01000019.1 GCA009378645_00996 CDS open 220055-222928 _na     957_aa uvrA excinuclease ABC subunit UvrA
1809 NXCO01000019.1 GCA009378645_00997 CDS open 223090-223812 _na     240_aa ssb Single-stranded DNA-binding protein
1810 NXCO01000019.1 GCA009378645_00998 CDS open 223903-225054 _na     383_aa gsp Glutathionylspermidine synthase preATP-grasp family protein
1811 NXCO01000019.1 GCA009378645_00999 CDS open 225051-225596 _na     181_aa Glycine zipper domain-containing protein
1812 NXCO01000019.1 GCA009378645_01000 CDS open 225794-226603 _na     269_aa ccmC Heme exporter protein C
1813 NXCO01000019.1 GCA009378645_01001 CDS open 226603-226803 _na     66_aa ccmD heme exporter protein CcmD
1814 NXCO01000019.1 GCA009378645_01002 CDS open 226873-227394 _na     173_aa ccmE cytochrome c maturation protein CcmE
1815 NXCO01000019.1 GCA009378645_01003 CDS open 227464-228294 _na     276_aa nlpA Lipoprotein
1816 NXCO01000019.1 GCA009378645_01004 CDS open 228486-229175 _na     229_aa metP Methionine ABC transporter permease protein
1817 NXCO01000019.1 GCA009378645_01005 CDS open 229165-230235 _na     356_aa metN methionine ABC transporter ATP-binding protein MetN
1818 NXCO01000019.1 GCA009378645_01006 CDS open 230359-231924 _na     521_aa baeS histidine kinase
1819 NXCO01000019.1 GCA009378645_01007 CDS open 232060-232782 _na     240_aa ompR Transcriptional regulatory protein YycF
1820 NXCO01000019.1 GCA009378645_01008 CDS open 232977-233981 _na     334_aa accB HlyD family secretion protein
1821 NXCO01000019.1 GCA009378645_01009 CDS open 234195-234710 _na     171_aa cybB Prokaryotic cytochrome b561 family protein
1822 NXCO01000019.1 GCA009378645_01010 CDS open 234757-235710 _na     317_aa prsA Ribose-phosphate pyrophosphokinase
1823 NXCO01000019.1 GCA009378645_01013 CDS open 236280-237152 _na     290_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
1824 NXCO01000019.1 GCA009378645_01014 CDS open 237157-237729 _na     190_aa lolB Outer-membrane lipoprotein LolB
1825 NXCO01000019.1 GCA009378645_01015 CDS open 237758-239773 _na     671_aa hemYx Tetratricopeptide repeat protein
1826 NXCO01000019.1 GCA009378645_01016 CDS open 240108-241451 _na     447_aa hemA glutamyl-tRNA reductase
1827 NXCO01000019.1 GCA009378645_01017 CDS open 241555-243216 _na     553_aa fixX Electron transfer flavoprotein-ubiquinone oxidoreductase
1828 NXCO01000019.1 GCA009378645_01018 CDS open 243584-244210 _na     208_aa Proteophosphoglycan
1829 NXCO01000019.1 GCA009378645_01019 CDS open 244276-245133 _na     285_aa murI glutamate racemase
1830 NXCO01000019.1 GCA009378645_01020 CDS open 245295-245480 _na     61_aa H-NS histone family
1831 NXCO01000019.1 GCA009378645_01021 CDS open 245577-246998 _na     473_aa pGRP Membrane-bound lytic murein transglycosylase B
1832 NXCO01000019.1 GCA009378645_01022 CDS open 247100-247633 _na     177_aa msrA Peptide methionine sulfoxide reductase MsrA
1833 NXCO01000019.1 GCA009378645_01023 CDS open 247688-248458 _na     256_aa cmoA carboxy-S-adenosyl-L-methionine synthase CmoA
1834 NXCO01000019.1 GCA009378645_01024 CDS open 248511-249569 _na     352_aa cmoB tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB
1835 NXCO01000019.1 GCA009378645_01025 CDS open 249653-250570 _na     305_aa mutK ABC transporter
1836 NXCO01000019.1 GCA009378645_01026 CDS open 250683-251351 _na     222_aa ftsN SPOR domain-containing protein
1837 NXCO01000019.1 GCA009378645_01027 CDS open 251549-251785 _na     78_aa DUF2788 domain-containing protein
1838 NXCO01000019.1 GCA009378645_01028 CDS open 251858-252034 _na     58_aa hypothetical protein
1839 NXCO01000019.1 GCA009378645_01029 CDS open 252031-252144 _na     37_aa hypothetical protein
1840 NXCO01000019.1 GCA009378645_01030 CDS open 252388-253515 _na     375_aa pucG Class V aminotransferase
1841 NXCO01000019.1 GCA009378645_01031 CDS open 253634-255145 _na     503_aa pepD2 Xaa-His dipeptidase%2C Metallo peptidase%2C MEROPS family M20C
1842 NXCO01000019.1 GCA009378645_01032 CDS open 255230-255967 _na     245_aa dLH Dienelactone hydrolase
1843 NXCO01000019.1 GCA009378645_01033 CDS open 256154-256618 _na     154_aa ycgN YcgN family cysteine cluster protein
1844 NXCO01000019.1 GCA009378645_01034 CDS open 256779-257651 _na     290_aa corC Magnesium/cobalt efflux protein
1845 NXCO01000019.1 GCA009378645_01035 CDS open 257723-258424 _na     233_aa ygfZ Aminomethyltransferase folate-binding domain protein
1846 NXCO01000019.1 GCA009378645_01036 CDS open 258609-258947 _na     112_aa phnA Alkylphosphonate utilization protein
1847 NXCO01000019.1 GCA009378645_01037 CDS open 258987-260291 _na     434_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
1848 NXCO01000019.1 GCA009378645_01038 CDS open 260594-263392 _na     932_aa secA preprotein translocase subunit SecA
1849 NXCO01000019.1 GCA009378645_01039 CDS open 263562-263855 _na     97_aa Lipoprotein
1850 NXCO01000019.1 GCA009378645_01040 CDS open 263994-265580 _na     528_aa lnt apolipoprotein N-acyltransferase
1851 NXCO01000019.1 GCA009378645_01041 CDS open 266005-268635 _na     876_aa Lactoferrin binding protein B
1852 NXCO01000019.1 GCA009378645_01042 CDS open 268817-271819 _na     1000_aa cirA Lactoferrin binding protein A
1853 NXCO01000019.1 GCA009378645_01043 CDS open 271821-273446 _na     541_aa Surface lipoprotein assembly modifier C-terminal beta-barrel domain-containing protein
1854 NXCO01000019.1 GCA009378645_01044 CDS open 273673-273855 _na     60_aa hypothetical protein
1855 NXCO01000019.1 GCA009378645_01045 CDS open 274029-275825 _na     598_aa pepP Xaa-Pro aminopeptidase
1856 NXCO01000019.1 GCA009378645_01046 CDS open 275841-277220 _na     459_aa trpE Para-aminobenzoate synthase%2C aminase component
1857 NXCO01000019.1 GCA009378645_01047 CDS open 277398-278630 _na     410_aa fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1
1858 NXCO01000019.1 GCA009378645_01048 CDS open 278989-281133 _na     714_aa ecsC EcsC family protein
1859 NXCO01000019.1 GCA009378645_01049 CDS open 281350-281724 _na     124_aa rpsL 30S ribosomal protein S12
1860 NXCO01000019.1 GCA009378645_01050 CDS open 281845-282318 _na     157_aa rpsG 30S ribosomal protein S7
1861 NXCO01000019.1 GCA009378645_01051 CDS open 282478-284604 _na     708_aa fusA elongation factor G
1862 NXCO01000019.1 GCA009378645_01052 CDS open 284725-285915 _na     396_aa tuf elongation factor Tu
1863 NXCO01000019.1 GCA009378645_01053 CDS open 286053-287003 _na     316_aa trxB thioredoxin-disulfide reductase
1864 NXCO01000019.1 GCA009378645_01054 CDS open 287140-288960 _na     606_aa caiA Acyl-CoA dehydrogenase
1865 NXCO01000019.1 GCA009378645_01055 CDS open 289192-289335 _na     47_aa FxLD family lantipeptide
1866 NXCO01000019.1 GCA009378645_01056 CDS open 289374-290165 _na     263_aa aroE shikimate dehydrogenase
1867 NXCO01000019.1 GCA009378645_01057 CDS open 290288-290890 _na     200_aa hypothetical protein
1868 NXCO01000019.1 GCA009378645_01058 CDS open 290898-291722 _na     274_aa ilvE Aminodeoxychorismate lyase
1869 NXCO01000019.1 GCA009378645_01059 CDS open 291828-292955 _na     375_aa mltG Endolytic murein transglycosylase
1870 NXCO01000019.1 GCA009378645_01060 CDS open 292968-293588 _na     206_aa tmk dTMP kinase
1871 NXCO01000019.1 GCA009378645_01061 CDS open 293769-294674 _na     301_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
1872 NXCO01000019.1 GCA009378645_01062 CDS open 294747-295019 _na     90_aa Lipoprotein
1873 NXCO01000019.1 GCA009378645_01063 CDS open 295073-295783 _na     236_aa purC phosphoribosylaminoimidazolesuccinocarboxamide synthase
1874 NXCO01000019.1 GCA009378645_01064 CDS open 295823-296143 _na     106_aa yqfO NIF3 1
1875 NXCO01000019.1 GCA009378645_01065 CDS open 296497-298008 _na     503_aa Anthranilate synthase component 1
1876 NXCO01000019.1 GCA009378645_01066 CDS open 298061-298540 _na     159_aa hypothetical protein
1877 NXCO01000019.1 GCA009378645_01067 CDS open 298540-298947 _na     135_aa hypothetical protein
1878 NXCO01000019.1 GCA009378645_01068 CDS open 298949-299308 _na     119_aa hypothetical protein
1879 NXCO01000019.1 GCA009378645_01069 CDS open 299305-300237 _na     310_aa rPT1 AAA+ ATPase domain-containing protein
1880 NXCO01000019.1 GCA009378645_01070 CDS open 300240-301130 _na     296_aa yobV HTH deoR-type domain-containing protein
1881 NXCO01000019.1 GCA009378645_01071 CDS open 301231-301488 _na     85_aa Transcriptional regulator
1882 NXCO01000019.1 GCA009378645_01076 CDS open 302394-303584 _na     396_aa tuf elongation factor Tu
1883 NXCO01000019.1 GCA009378645_01078 CDS open 303867-304340 _na     157_aa secE preprotein translocase subunit SecE
1884 NXCO01000019.1 GCA009378645_01079 CDS open 304362-304892 _na     176_aa nusG transcription termination/antitermination protein NusG
1885 NXCO01000019.1 GCA009378645_01080 CDS open 304993-305424 _na     143_aa rplK 50S ribosomal protein L11
1886 NXCO01000019.1 GCA009378645_01081 CDS open 305424-306125 _na     233_aa rplA 50S ribosomal protein L1
1887 NXCO01000019.1 GCA009378645_01082 CDS open 306437-306940 _na     167_aa rplJ 50S ribosomal protein L10
1888 NXCO01000019.1 GCA009378645_01083 CDS open 306998-307372 _na     124_aa rplL 50S ribosomal protein L7/L12
1889 NXCO01000019.1 GCA009378645_01084 CDS open 307792-311883 _na     1363_aa rpoB DNA-directed RNA polymerase subunit beta
1890 NXCO01000019.1 GCA009378645_01085 CDS open 311963-316201 _na     1412_aa rpoC DNA-directed RNA polymerase subunit beta'
1891 NXCO01000019.1 GCA009378645_01086 CDS open 316415-317641 _na     408_aa serA phosphoglycerate dehydrogenase
1892 NXCO01000019.1 GCA009378645_01087 CDS open 317805-319175 _na     456_aa gorA glutathione-disulfide reductase
1893 NXCO01000019.1 GCA009378645_01088 CDS open 319417-320490 _na     357_aa nagZ beta-N-acetylhexosaminidase
1894 NXCO01000019.1 GCA009378645_01089 CDS open 320726-322900 _na     724_aa ctpA C-terminal processing peptidase family protein
1895 NXCO01000019.1 GCA009378645_01090 CDS open 323027-323185 _na     52_aa UPF0391 membrane protein AO382_0985
1896 NXCO01000019.1 GCA009378645_01092 CDS open 323648-324445 _na     265_aa tauE putative membrane transporter protein
1897 NXCO01000019.1 GCA009378645_01093 CDS open 324523-325416 _na     297_aa birA2 Ligase
1898 NXCO01000019.1 GCA009378645_01094 CDS open 325471-326178 _na     235_aa coaX pantothenate kinase
1899 NXCO01000019.1 GCA009378645_01095 CDS open 326196-326618 _na     140_aa MAPEG family protein
1900 NXCO01000019.1 GCA009378645_01096 CDS open 326615-327028 _na     137_aa yhfA OsmC family protein
1901 NXCO01000019.1 GCA009378645_01097 CDS open 327560-328057 _na     165_aa mutT RNA pyrophosphohydrolase
1902 NXCO01000019.1 GCA009378645_01098 CDS open 328193-331819 _na     1208_aa smc chromosome segregation protein SMC
1903 NXCO01000019.1 GCA009378645_01099 CDS open 332053-332868 _na     271_aa rpsB 30S ribosomal protein S2
1904 NXCO01000019.1 GCA009378645_01100 CDS open 332946-333824 _na     292_aa tsf translation elongation factor Ts
1905 NXCO01000019.1 GCA009378645_01101 CDS open 333968-334615 _na     215_aa pyrE Orotate phosphoribosyltransferase
1906 NXCO01000019.1 GCA009378645_01102 CDS open 334710-335681 _na     323_aa gshB glutathione synthase
1907 NXCO01000019.1 GCA009378645_01103 CDS open 335787-336890 _na     367_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
1908 NXCO01000019.1 GCA009378645_01104 CDS open 337191-337715 _na     174_aa rimL Acetyltransferase domain protein
1909 NXCO01000019.1 GCA009378645_01105 CDS open 337880-339340 _na     486_aa murC UDP-N-acetylmuramate--L-alanine ligase
1910 NXCO01000019.1 GCA009378645_01106 CDS open 339379-340302 _na     307_aa ddlA D-alanine--D-alanine ligase
1911 NXCO01000019.1 GCA009378645_01107 CDS open 340265-340978 _na     237_aa ygjP YgjP-like metallopeptidase domain-containing protein
1912 NXCO01000019.1 GCA009378645_01108 CDS open 340992-341894 _na     300_aa lysR Hydrogen peroxide-inducible activator
1913 NXCO01000019.1 GCA009378645_01109 CDS open 342115-342681 _na     188_aa ahpC alkyl hydroperoxide reductase subunit C
1914 NXCO01000019.1 GCA009378645_01110 CDS open 342883-343116 _na     77_aa ydcH DUF465 domain-containing protein
1915 NXCO01000019.1 GCA009378645_01111 CDS open 343456-345012 _na     518_aa ahpF alkyl hydroperoxide reductase subunit F
1916 NXCO01000019.1 GCA009378645_01112 CDS open 345399-345596 _na     65_aa iscX Fe-S cluster assembly protein IscX
1917 NXCO01000019.1 GCA009378645_01113 CDS open 345655-346674 _na     339_aa potA Fe3+/spermidine/putrescine ABC transporter ATP-binding protein
1918 NXCO01000019.1 GCA009378645_01114 CDS open 346706-348307 _na     533_aa fbpB ABC transporter permease
1919 NXCO01000019.1 GCA009378645_01115 CDS open 348550-349545 _na     331_aa afuA Fe(3+) ABC transporter substrate-binding protein
1920 NXCO01000019.1 GCA009378645_01116 CDS open 349640-350824 _na     394_aa dapE succinyl-diaminopimelate desuccinylase
1921 NXCO01000019.1 GCA009378645_01117 CDS open 351142-351522 _na     126_aa Putative 30S ribosomal protein S15
1922 NXCO01000019.1 GCA009378645_01118 CDS open 351491-351745 _na     84_aa Putative 30S ribosomal protein S15
1923 NXCO01000019.1 GCA009378645_01119 CDS open 351800-352420 _na     206_aa eGL9 2OG-Fe(II) oxygenase
1924 NXCO01000019.1 GCA009378645_01120 CDS open 352560-353447 _na     295_aa rlmJ Ribosomal RNA large subunit methyltransferase J
1925 NXCO01000019.1 GCA009378645_01121 CDS open 353507-354316 _na     269_aa pssA CDP-diacylglycerol--serine O-phosphatidyltransferase
1926 NXCO01000019.1 GCA009378645_00813 gene open 6073-6330
1927 NXCO01000019.1 GCA009378645_00814 gene open 6327-6482
1928 NXCO01000019.1 GCA009378645_00815 gene open 7016-7942 znuA
1929 NXCO01000019.1 GCA009378645_00816 gene open 7942-8847 znuC
1930 NXCO01000019.1 GCA009378645_00817 gene open 8844-9686 znuB
1931 NXCO01000019.1 GCA009378645_00818 gene open 9861-10565 znuB
1932 NXCO01000019.1 GCA009378645_00819 gene open 11071-12291 tyrS
1933 NXCO01000019.1 GCA009378645_00820 gene open 12453-13688 anmK
1934 NXCO01000019.1 GCA009378645_00821 gene open 13938-14717
1935 NXCO01000019.1 GCA009378645_00822 gene open 14711-14959
1936 NXCO01000019.1 GCA009378645_00823 gene open 15447-16247 czcD
1937 NXCO01000019.1 GCA009378645_00824 gene open 16487-17740 rocD
1938 NXCO01000019.1 GCA009378645_00825 gene open 17782-18714 rocF
1939 NXCO01000019.1 GCA009378645_00826 gene open 19285-19635
1940 NXCO01000019.1 GCA009378645_00827 gene open 19662-21446 aF0785
1941 NXCO01000019.1 GCA009378645_00828 gene open 21679-22287 rsmC
1942 NXCO01000019.1 GCA009378645_00829 gene open 22380-22802
1943 NXCO01000019.1 GCA009378645_00830 gene open 22958-24196 rarA
1944 NXCO01000019.1 GCA009378645_00831 gene open 24311-25405 ribBA
1945 NXCO01000019.1 GCA009378645_00832 gene open 25572-25832 yeaQ
1946 NXCO01000019.1 GCA009378645_00833 gene open 25900-26514 tsaC
1947 NXCO01000019.1 GCA009378645_00834 gene open 26501-27712 dprA
1948 NXCO01000019.1 GCA009378645_00835 gene open 27749-29164 thrC
1949 NXCO01000019.1 GCA009378645_00836 gene open 29482-30828 rsmB
1950 NXCO01000019.1 GCA009378645_00837 gene open 30818-31843 fmt
1951 NXCO01000019.1 GCA009378645_00838 gene open 31974-32642 ribC
1952 NXCO01000019.1 GCA009378645_00839 gene open 32925-33977 ribD
1953 NXCO01000019.1 GCA009378645_00840 gene open 33974-34444 nrdR
1954 NXCO01000019.1 GCA009378645_00841 gene open 34548-35948 mnmE
1955 NXCO01000019.1 GCA009378645_00842 gene open 36115-37758 yidC
1956 NXCO01000019.1 GCA009378645_00843 gene open 37927-38247 yidD
1957 NXCO01000019.1 GCA009378645_00844 gene open 38265-38678 rnpA
1958 NXCO01000019.1 GCA009378645_00845 gene open 38790-38924 rpmH
1959 NXCO01000019.1 GCA009378645_00846 gene open 39522-40925 dnaA
1960 NXCO01000019.1 GCA009378645_00847 gene open 40962-42119 dnaN
1961 NXCO01000019.1 GCA009378645_00848 gene open 42123-43331 recF
1962 NXCO01000019.1 GCA009378645_00849 gene open 43468-45927 gyrB
1963 NXCO01000019.1 GCA009378645_00850 gene open 46101-47660 guaA
1964 NXCO01000019.1 GCA009378645_00851 gene open 47813-49030
1965 NXCO01000019.1 GCA009378645_00852 gene open 49297-49791 rlpA
1966 NXCO01000019.1 GCA009378645_00853 gene open 49805-50164 fkpA
1967 NXCO01000019.1 GCA009378645_00854 gene open 50306-51481 lysA
1968 NXCO01000019.1 GCA009378645_00855 gene open 51918-52799
1969 NXCO01000019.1 GCA009378645_00856 gene open 52837-53193 ridA
1970 NXCO01000019.1 GCA009378645_00857 gene open 53202-54458 dadA
1971 NXCO01000019.1 GCA009378645_00858 gene open 54800-56671 thiC
1972 NXCO01000019.1 GCA009378645_00859 gene open 56788-58629 mdlB
1973 NXCO01000019.1 GCA009378645_00860 gene open 58811-60211 argH
1974 NXCO01000019.1 GCA009378645_00861 gene open 60435-61400 hemC
1975 NXCO01000019.1 GCA009378645_00862 gene open 61400-62155 hemD
1976 NXCO01000019.1 GCA009378645_00863 gene open 62227-63099 rlmB
1977 NXCO01000019.1 GCA009378645_00864 gene open 63165-63422 nqrM
1978 NXCO01000019.1 GCA009378645_00865 gene open 63576-65483 dnaK
1979 NXCO01000019.1 GCA009378645_00866 gene open 65685-66206 grpE
1980 NXCO01000019.1 GCA009378645_00867 gene open 70424-71374 cas1f
1981 NXCO01000019.1 GCA009378645_00868 gene open 71376-74789 cas3f
1982 NXCO01000019.1 GCA009378645_00869 gene open 74968-76341 csy1
1983 NXCO01000019.1 GCA009378645_00870 gene open 76338-77273 csy2
1984 NXCO01000019.1 GCA009378645_00871 gene open 77308-78315 csy3
1985 NXCO01000019.1 GCA009378645_00872 gene open 78312-78902 cas6f
1986 NXCO01000019.1 GCA009378645_00873 gene open 79080-79370 yggX
1987 NXCO01000019.1 GCA009378645_00874 gene open 79444-79920 fadM
1988 NXCO01000019.1 GCA009378645_00875 gene open 80239-81621 mpl
1989 NXCO01000019.1 GCA009378645_00876 gene open 81713-82222 dsbB
1990 NXCO01000019.1 GCA009378645_00877 gene open 82328-83878 gshA
1991 NXCO01000019.1 GCA009378645_00878 gene open 84028-84360 erpA
1992 NXCO01000019.1 GCA009378645_00879 gene open 84507-85367 tauB
1993 NXCO01000019.1 GCA009378645_00880 gene open 85357-86241 ntrB
1994 NXCO01000019.1 GCA009378645_00881 gene open 86231-87646 tauA
1995 NXCO01000019.1 GCA009378645_00882 gene open 87729-89117 norV
1996 NXCO01000019.1 GCA009378645_00883 gene open 89114-90286 caiA
1997 NXCO01000019.1 GCA009378645_00884 gene open 90543-91088 yciW
1998 NXCO01000019.1 GCA009378645_00885 gene open 91307-93256 abc-f
1999 NXCO01000019.1 GCA009378645_00886 gene open 93264-94103 dnaJ
2000 NXCO01000019.1 GCA009378645_00887 gene open 94188-95168 yheT