BAKTAGenome Explorer: Moraxella catarrhalis (GCA_009378755.1)
Select a Genome:
|
BAKTA Annotations for GCA_009378755.1
|
Search & Sort all 3548 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1001 | RCJS01000001.1 | GCA009378755_00395 | gene | open | 387518-388282 | |||
| 1002 | RCJS01000001.1 | GCA009378755_00396 | gene | open | 388279-389883 | wcaA | ||
| 1003 | RCJS01000001.1 | GCA009378755_00397 | gene | open | 390065-390559 | |||
| 1004 | RCJS01000001.1 | GCA009378755_00398 | gene | open | 390621-390926 | |||
| 1005 | RCJS01000001.1 | GCA009378755_00399 | gene | open | 391366-392775 | glnA | ||
| 1006 | RCJS01000001.1 | GCA009378755_00400 | gene | open | 392957-394258 | ubiH | ||
| 1007 | RCJS01000001.1 | GCA009378755_00401 | gene | open | 394296-395210 | lysO | ||
| 1008 | RCJS01000001.1 | GCA009378755_00402 | gene | open | 395434-396099 | rpiA | ||
| 1009 | RCJS01000001.1 | GCA009378755_00403 | gene | open | 396183-397712 | araJ | ||
| 1010 | RCJS01000001.1 | GCA009378755_00404 | gene | open | 397723-397839 | |||
| 1011 | RCJS01000001.1 | GCA009378755_00405 | gene | open | 397944-399572 | cls | ||
| 1012 | RCJS01000001.1 | GCA009378755_00406 | gene | open | 399739-400344 | folE | ||
| 1013 | RCJS01000001.1 | GCA009378755_00407 | gene | open | 400555-401379 | fabI | ||
| 1014 | RCJS01000001.1 | GCA009378755_00408 | gene | open | 401509-402189 | rpe | ||
| 1015 | RCJS01000001.1 | GCA009378755_00409 | gene | open | 402186-402539 | |||
| 1016 | RCJS01000001.1 | GCA009378755_00410 | gene | open | 402539-402841 | |||
| 1017 | RCJS01000001.1 | GCA009378755_00411 | gene | open | 402909-403616 | |||
| 1018 | RCJS01000001.1 | GCA009378755_00412 | gene | open | 403719-404315 | fAU1 | ||
| 1019 | RCJS01000001.1 | GCA009378755_00413 | gene | open | 404489-405877 | fumC | ||
| 1020 | RCJS01000001.1 | GCA009378755_00414 | gene | open | 405985-407757 | cydD | ||
| 1021 | RCJS01000001.1 | GCA009378755_00415 | gene | open | 407732-409465 | cydC | ||
| 1022 | RCJS01000001.1 | GCA009378755_00416 | gene | open | 409470-410630 | rfaB | ||
| 1023 | RCJS01000001.1 | GCA009378755_00417 | gene | open | 410649-411149 | bcp | ||
| 1024 | RCJS01000001.1 | GCA009378755_00418 | gene | open | 411416-412729 | nCS2 | ||
| 1025 | RCJS01000001.1 | GCA009378755_00419 | gene | open | 412808-413395 | acrR | ||
| 1026 | RCJS01000001.1 | GCA009378755_00420 | gene | open | 413641-415203 | gpmI | ||
| 1027 | RCJS01000001.1 | GCA009378755_00421 | gene | open | 415228-416484 | ctpA | ||
| 1028 | RCJS01000001.1 | GCA009378755_00422 | gene | open | 416547-417188 | citB | ||
| 1029 | RCJS01000001.1 | GCA009378755_00423 | gene | open | 417373-417639 | rpsT | ||
| 1030 | RCJS01000001.1 | GCA009378755_00424 | gene | open | 417929-418627 | wcaG | ||
| 1031 | RCJS01000001.1 | GCA009378755_00425 | gene | open | 418875-421541 | gyrA | ||
| 1032 | RCJS01000001.1 | GCA009378755_00426 | gene | open | 421608-422315 | gstA | ||
| 1033 | RCJS01000001.1 | GCA009378755_00427 | gene | open | 422344-422538 | |||
| 1034 | RCJS01000001.1 | GCA009378755_00428 | gene | open | 422578-424731 | dnaG | ||
| 1035 | RCJS01000001.1 | GCA009378755_00429 | gene | open | 424774-425844 | bamD | ||
| 1036 | RCJS01000001.1 | GCA009378755_00430 | gene | open | 426090-427157 | rluD | ||
| 1037 | RCJS01000001.1 | GCA009378755_00431 | gene | open | 427144-427983 | |||
| 1038 | RCJS01000001.1 | GCA009378755_00432 | gene | open | 428086-428853 | nIF3 | ||
| 1039 | RCJS01000001.1 | GCA009378755_00433 | gene | open | 429003-431213 | zntA | ||
| 1040 | RCJS01000001.1 | GCA009378755_00434 | gene | open | 431340-432101 | |||
| 1041 | RCJS01000001.1 | GCA009378755_00435 | gene | open | 432210-432575 | clpS | ||
| 1042 | RCJS01000001.1 | GCA009378755_00436 | gene | open | 432603-434903 | clpA | ||
| 1043 | RCJS01000001.1 | GCA009378755_00437 | gene | open | 434962-435813 | folD | ||
| 1044 | RCJS01000001.1 | GCA009378755_00438 | gene | open | 436176-436580 | |||
| 1045 | RCJS01000001.1 | GCA009378755_00439 | gene | open | 436662-438083 | sdaA | ||
| 1046 | RCJS01000001.1 | GCA009378755_00440 | gene | open | 438417-438611 | bfd | ||
| 1047 | RCJS01000001.1 | GCA009378755_00441 | gene | open | 438991-439485 | bfr | ||
| 1048 | RCJS01000001.1 | GCA009378755_00442 | gene | open | 439498-439974 | bfr | ||
| 1049 | RCJS01000001.1 | GCA009378755_00443 | gene | open | 440074-440832 | ompV | ||
| 1050 | RCJS01000001.1 | GCA009378755_00444 | gene | open | 440829-441971 | alr | ||
| 1051 | RCJS01000001.1 | GCA009378755_00445 | gene | open | 441992-443509 | dnaB | ||
| 1052 | RCJS01000001.1 | GCA009378755_00446 | gene | open | 443535-444695 | pdxA | ||
| 1053 | RCJS01000001.1 | GCA009378755_00447 | gene | open | 444786-445640 | rsmA | ||
| 1054 | RCJS01000001.1 | GCA009378755_00448 | gene | open | 445657-446502 | |||
| 1055 | RCJS01000001.1 | GCA009378755_00449 | gene | open | 446611-447813 | pgk | ||
| 1056 | RCJS01000001.1 | GCA009378755_00450 | gene | open | 447972-448262 | virB7 | ||
| 1057 | RCJS01000001.1 | GCA009378755_00451 | gene | open | 448386-449423 | fba | ||
| 1058 | RCJS01000001.1 | GCA009378755_00452 | gene | open | 449420-450034 | ruvA | ||
| 1059 | RCJS01000001.1 | GCA009378755_00453 | gene | open | 450083-450955 | lysR | ||
| 1060 | RCJS01000001.1 | GCA009378755_00454 | gene | open | 451193-452611 | leuC | ||
| 1061 | RCJS01000001.1 | GCA009378755_00455 | gene | open | 452771-453421 | leuD | ||
| 1062 | RCJS01000001.1 | GCA009378755_00456 | gene | open | 453426-453911 | |||
| 1063 | RCJS01000001.1 | GCA009378755_00457 | gene | open | 453936-455006 | leuB | ||
| 1064 | RCJS01000001.1 | GCA009378755_00458 | gene | open | 455095-455580 | fadM | ||
| 1065 | RCJS01000001.1 | GCA009378755_00459 | gene | open | 455733-456548 | xthA | ||
| 1066 | RCJS01000001.1 | GCA009378755_00460 | gene | open | 456543-456656 | |||
| 1067 | RCJS01000001.1 | GCA009378755_00461 | gene | open | 456894-458417 | lysS | ||
| 1068 | RCJS01000001.1 | GCA009378755_00462 | gene | open | 458431-460677 | dnaX | ||
| 1069 | RCJS01000001.1 | GCA009378755_00463 | gene | open | 461128-461997 | lysR | ||
| 1070 | RCJS01000001.1 | GCA009378755_00464 | gene | open | 462150-462827 | lysR | ||
| 1071 | RCJS01000001.1 | GCA009378755_00465 | gene | open | 463181-463738 | hppD | ||
| 1072 | RCJS01000001.1 | GCA009378755_00466 | gene | open | 463793-464260 | |||
| 1073 | RCJS01000001.1 | GCA009378755_00467 | gene | open | 464562-465956 | nhaC | ||
| 1074 | RCJS01000001.1 | GCA009378755_00468 | gene | open | 466130-467290 | dacC | ||
| 1075 | RCJS01000001.1 | GCA009378755_00469 | gene | open | 467463-468599 | secF | ||
| 1076 | RCJS01000001.1 | GCA009378755_00470 | gene | open | 468609-470486 | secD | ||
| 1077 | RCJS01000001.1 | GCA009378755_00471 | gene | open | 470606-470941 | yajC | ||
| 1078 | RCJS01000001.1 | GCA009378755_00472 | gene | open | 471215-472423 | mpfA | ||
| 1079 | RCJS01000001.1 | GCA009378755_00473 | gene | open | 472577-473134 | |||
| 1080 | RCJS01000001.1 | GCA009378755_00474 | gene | open | 473329-476208 | mltF | ||
| 1081 | RCJS01000001.1 | GCA009378755_00475 | gene | open | 476366-478198 | pepCK | ||
| 1082 | RCJS01000001.1 | GCA009378755_00476 | gene | open | 478496-479914 | radA | ||
| 1083 | RCJS01000001.1 | GCA009378755_00477 | gene | open | 479956-480675 | cysA | ||
| 1084 | RCJS01000001.1 | GCA009378755_00478 | gene | open | 480768-481607 | cysW | ||
| 1085 | RCJS01000001.1 | GCA009378755_00479 | gene | open | 481652-482530 | cysT | ||
| 1086 | RCJS01000001.1 | GCA009378755_00480 | gene | open | 482880-483320 | |||
| 1087 | RCJS01000001.1 | GCA009378755_00481 | gene | open | 483351-484526 | srmB | ||
| 1088 | RCJS01000001.1 | GCA009378755_00482 | gene | open | 484513-485715 | hemW | ||
| 1089 | RCJS01000001.1 | GCA009378755_00483 | gene | open | 485797-485937 | ecnA | ||
| 1090 | RCJS01000001.1 | GCA009378755_00484 | gene | open | 486185-486730 | trmL | ||
| 1091 | RCJS01000001.1 | GCA009378755_00485 | gene | open | 486846-487061 | |||
| 1092 | RCJS01000001.1 | GCA009378755_00486 | gene | open | 487464-487754 | hicB | ||
| 1093 | RCJS01000001.1 | GCA009378755_00487 | gene | open | 488079-488276 | copG | ||
| 1094 | RCJS01000001.1 | GCA009378755_00488 | gene | open | 488852-489289 | hinT | ||
| 1095 | RCJS01000001.1 | GCA009378755_00489 | gene | open | 489443-490105 | thiE | ||
| 1096 | RCJS01000001.1 | GCA009378755_00490 | gene | open | 490110-493664 | mfd | ||
| 1097 | RCJS01000001.1 | GCA009378755_00491 | gene | open | 493930-495192 | tolB | ||
| 1098 | RCJS01000001.1 | GCA009378755_00492 | gene | open | 495209-496003 | tonB | ||
| 1099 | RCJS01000001.1 | GCA009378755_00493 | gene | open | 496034-496468 | tolR | ||
| 1100 | RCJS01000001.1 | GCA009378755_00494 | gene | open | 496494-497183 | tolQ | ||
| 1101 | RCJS01000001.1 | GCA009378755_00495 | gene | open | 497458-498258 | |||
| 1102 | RCJS01000001.1 | GCA009378755_00496 | gene | open | 498304-501630 | hrpA | ||
| 1103 | RCJS01000001.1 | GCA009378755_00497 | gene | open | 501892-503388 | tolC | ||
| 1104 | RCJS01000001.1 | GCA009378755_00498 | gene | open | 503435-504598 | emrA | ||
| 1105 | RCJS01000001.1 | GCA009378755_00499 | gene | open | 504626-505804 | |||
| 1106 | RCJS01000001.1 | GCA009378755_00500 | gene | open | 505804-506904 | |||
| 1107 | RCJS01000001.1 | GCA009378755_00501 | gene | open | 507540-507722 | hicB | ||
| 1108 | RCJS01000001.1 | GCA009378755_00502 | gene | open | 507933-508727 | |||
| 1109 | RCJS01000001.1 | GCA009378755_00503 | gene | open | 508844-509506 | |||
| 1110 | RCJS01000001.1 | GCA009378755_00504 | gene | open | 509699-509899 | copG | ||
| 1111 | RCJS01000001.1 | GCA009378755_00505 | gene | open | 509896-510243 | |||
| 1112 | RCJS01000001.1 | GCA009378755_00506 | gene | open | 510233-510592 | |||
| 1113 | RCJS01000001.1 | GCA009378755_00507 | gene | open | 510721-511113 | |||
| 1114 | RCJS01000001.1 | GCA009378755_00508 | gene | open | 511161-511370 | |||
| 1115 | RCJS01000001.1 | GCA009378755_00509 | gene | open | 511367-511726 | |||
| 1116 | RCJS01000001.1 | GCA009378755_00510 | gene | open | 511787-511990 | |||
| 1117 | RCJS01000001.1 | GCA009378755_00511 | gene | open | 512001-513017 | |||
| 1118 | RCJS01000001.1 | GCA009378755_00512 | gene | open | 513020-513655 | |||
| 1119 | RCJS01000001.1 | GCA009378755_00513 | gene | open | 513875-515629 | |||
| 1120 | RCJS01000001.1 | GCA009378755_00514 | gene | open | 515932-516300 | arsR | ||
| 1121 | RCJS01000001.1 | GCA009378755_00515 | gene | open | 516503-517153 | |||
| 1122 | RCJS01000001.1 | GCA009378755_00516 | gene | open | 517205-518101 | |||
| 1123 | RCJS01000001.1 | GCA009378755_00517 | gene | open | 518130-518336 | |||
| 1124 | RCJS01000001.1 | GCA009378755_00518 | gene | open | 518398-518799 | |||
| 1125 | RCJS01000001.1 | GCA009378755_00520 | gene | open | 519622-520758 | ppk2 | ||
| 1126 | RCJS01000001.1 | GCA009378755_00521 | gene | open | 520912-522465 | xseA | ||
| 1127 | RCJS01000001.1 | GCA009378755_00522 | gene | open | 522473-523495 | dusB | ||
| 1128 | RCJS01000001.1 | GCA009378755_00523 | gene | open | 523618-525675 | recD | ||
| 1129 | RCJS01000001.1 | GCA009378755_00524 | gene | open | 525709-529656 | recB | ||
| 1130 | RCJS01000001.1 | GCA009378755_00525 | gene | open | 529720-530322 | mug | ||
| 1131 | RCJS01000001.1 | GCA009378755_00526 | gene | open | 530402-532516 | uvrB | ||
| 1132 | RCJS01000001.1 | GCA009378755_00527 | gene | open | 532636-534042 | mltB | ||
| 1133 | RCJS01000001.1 | GCA009378755_00528 | gene | open | 534203-535732 | purF | ||
| 1134 | RCJS01000001.1 | GCA009378755_00529 | gene | open | 535798-536310 | cvpA | ||
| 1135 | RCJS01000001.1 | GCA009378755_00530 | gene | open | 536315-537340 | pyrD | ||
| 1136 | RCJS01000001.1 | GCA009378755_00531 | gene | open | 537398-537991 | adaB | ||
| 1137 | RCJS01000001.1 | GCA009378755_00532 | gene | open | 537988-538929 | ftsY | ||
| 1138 | RCJS01000001.1 | GCA009378755_00533 | gene | open | 539057-541180 | phoX | ||
| 1139 | RCJS01000001.1 | GCA009378755_00534 | gene | open | 541462-541575 | |||
| 1140 | RCJS01000001.1 | GCA009378755_00535 | gene | open | 541595-543007 | pqqL | ||
| 1141 | RCJS01000001.1 | GCA009378755_00536 | gene | open | 543023-544468 | |||
| 1142 | RCJS01000001.1 | GCA009378755_00537 | gene | open | 544516-545274 | yoaK | ||
| 1143 | RCJS01000001.1 | GCA009378755_00538 | gene | open | 545610-549194 | putA | ||
| 1144 | RCJS01000001.1 | GCA009378755_00539 | gene | open | 549275-550003 | lptB | ||
| 1145 | RCJS01000001.1 | GCA009378755_00540 | gene | open | 550013-550540 | lptA | ||
| 1146 | RCJS01000001.1 | GCA009378755_00541 | gene | open | 550572-551147 | lptC | ||
| 1147 | RCJS01000001.1 | GCA009378755_00542 | gene | open | 551157-551678 | kdsC | ||
| 1148 | RCJS01000001.1 | GCA009378755_00543 | gene | open | 551733-552752 | |||
| 1149 | RCJS01000001.1 | GCA009378755_00544 | gene | open | 552899-553531 | hfq | ||
| 1150 | RCJS01000001.1 | GCA009378755_00545 | gene | open | 553587-554696 | miaA | ||
| 1151 | RCJS01000001.1 | GCA009378755_00546 | gene | open | 554696-555142 | tsaE | ||
| 1152 | RCJS01000001.1 | GCA009378755_00547 | gene | open | 555139-555735 | queD | ||
| 1153 | RCJS01000001.1 | GCA009378755_00548 | gene | open | 555858-557108 | lys9 | ||
| 1154 | RCJS01000001.1 | GCA009378755_00549 | gene | open | 557300-558502 | lysA | ||
| 1155 | RCJS01000001.1 | GCA009378755_00550 | gene | open | 558814-559659 | |||
| 1156 | RCJS01000001.1 | GCA009378755_00551 | gene | open | 559724-560035 | fdx | ||
| 1157 | RCJS01000001.1 | GCA009378755_00552 | gene | open | 560114-561244 | nrdB | ||
| 1158 | RCJS01000001.1 | GCA009378755_00553 | gene | open | 561483-562718 | metC | ||
| 1159 | RCJS01000001.1 | GCA009378755_00554 | gene | open | 562924-564003 | sbp | ||
| 1160 | RCJS01000001.1 | GCA009378755_00555 | gene | open | 564139-568272 | recC | ||
| 1161 | RCJS01000001.1 | GCA009378755_00556 | gene | open | 568294-569100 | yghU | ||
| 1162 | RCJS01000001.1 | GCA009378755_00557 | gene | open | 569447-571117 | aceF | ||
| 1163 | RCJS01000001.1 | GCA009378755_00558 | gene | open | 571145-573892 | aceE | ||
| 1164 | RCJS01000001.1 | GCA009378755_00559 | gene | open | 574182-574613 | |||
| 1165 | RCJS01000001.1 | GCA009378755_00560 | gene | open | 574610-574969 | folB | ||
| 1166 | RCJS01000001.1 | GCA009378755_00561 | gene | open | 574970-575869 | rarD | ||
| 1167 | RCJS01000001.1 | GCA009378755_00562 | gene | open | 575905-578220 | tyrA | ||
| 1168 | RCJS01000001.1 | GCA009378755_00563 | gene | open | 578241-579353 | pheA | ||
| 1169 | RCJS01000001.1 | GCA009378755_00564 | gene | open | 579681-579845 | |||
| 1170 | RCJS01000001.1 | GCA009378755_00565 | gene | open | 579852-580841 | menH | ||
| 1171 | RCJS01000001.1 | GCA009378755_00566 | gene | open | 580905-581537 | ycgM | ||
| 1172 | RCJS01000001.1 | GCA009378755_00567 | gene | open | 581644-582915 | purD | ||
| 1173 | RCJS01000001.1 | GCA009378755_00568 | gene | open | 583052-584419 | aarF | ||
| 1174 | RCJS01000001.1 | GCA009378755_00569 | gene | open | 584496-585704 | yhiN | ||
| 1175 | RCJS01000001.1 | GCA009378755_00570 | gene | open | 585710-586411 | trmB | ||
| 1176 | RCJS01000001.1 | GCA009378755_00571 | gene | open | 586512-587810 | dnaQ | ||
| 1177 | RCJS01000001.1 | GCA009378755_00572 | gene | open | 587786-588658 | nudC | ||
| 1178 | RCJS01000001.1 | GCA009378755_00573 | gene | open | 588672-589499 | rnfB | ||
| 1179 | RCJS01000001.1 | GCA009378755_00574 | gene | open | 589518-590789 | |||
| 1180 | RCJS01000001.1 | GCA009378755_00575 | gene | open | 590808-591101 | yciI | ||
| 1181 | RCJS01000001.1 | GCA009378755_00576 | gene | open | 591115-593061 | mnmC | ||
| 1182 | RCJS01000001.1 | GCA009378755_00577 | gene | open | 593093-593740 | marC | ||
| 1183 | RCJS01000001.1 | GCA009378755_00578 | gene | open | 593898-594596 | queC | ||
| 1184 | RCJS01000001.1 | GCA009378755_00579 | gene | open | 594662-595354 | pyrF | ||
| 1185 | RCJS01000001.1 | GCA009378755_00580 | gene | open | 595484-595885 | |||
| 1186 | RCJS01000001.1 | GCA009378755_00581 | gene | open | 595904-596203 | hupA | ||
| 1187 | RCJS01000001.1 | GCA009378755_00582 | gene | open | 596416-598089 | rpsA | ||
| 1188 | RCJS01000001.1 | GCA009378755_00583 | gene | open | 598323-599054 | cmk | ||
| 1189 | RCJS01000001.1 | GCA009378755_00584 | gene | open | 599080-599559 | tadA | ||
| 1190 | RCJS01000001.1 | GCA009378755_00585 | gene | open | 599635-600342 | ung | ||
| 1191 | RCJS01000001.1 | GCA009378755_00586 | gene | open | 600350-601303 | |||
| 1192 | RCJS01000001.1 | GCA009378755_00587 | gene | open | 601680-602825 | fabH | ||
| 1193 | RCJS01000001.1 | GCA009378755_00588 | gene | open | 603134-604057 | argF | ||
| 1194 | RCJS01000001.1 | GCA009378755_00589 | gene | open | 604281-605342 | erfK | ||
| 1195 | RCJS01000001.1 | GCA009378755_00590 | gene | open | 605426-606805 | fadL | ||
| 1196 | RCJS01000001.1 | GCA009378755_00591 | gene | open | 607006-607236 | slyX | ||
| 1197 | RCJS01000001.1 | GCA009378755_00592 | gene | open | 607431-609374 | abc-f | ||
| 1198 | RCJS01000001.1 | GCA009378755_00593 | gene | open | 609423-610466 | lpxP | ||
| 1199 | RCJS01000001.1 | GCA009378755_00594 | gene | open | 610496-610879 | panD | ||
| 1200 | RCJS01000001.1 | GCA009378755_00595 | gene | open | 611104-611727 | pabA | ||
| 1201 | RCJS01000001.1 | GCA009378755_00596 | gene | open | 611860-612951 | trpD | ||
| 1202 | RCJS01000001.1 | GCA009378755_00597 | gene | open | 612984-613808 | trpC | ||
| 1203 | RCJS01000001.1 | GCA009378755_00598 | gene | open | 613850-614911 | trpS | ||
| 1204 | RCJS01000001.1 | GCA009378755_00599 | gene | open | 614908-615765 | scpA | ||
| 1205 | RCJS01000001.1 | GCA009378755_00600 | gene | open | 615838-616404 | scpB | ||
| 1206 | RCJS01000001.1 | GCA009378755_00601 | gene | open | 616555-617541 | rluB | ||
| 1207 | RCJS01000001.1 | GCA009378755_00602 | gene | open | 618009-620285 | nrdA | ||
| 1208 | RCJS01000001.1 | GCA009378755_00603 | gene | open | 620462-620794 | ybaB | ||
| 1209 | RCJS01000001.1 | GCA009378755_00604 | gene | open | 620795-621391 | recR | ||
| 1210 | RCJS01000001.1 | GCA009378755_00605 | gene | open | 621411-622634 | rnd | ||
| 1211 | RCJS01000001.1 | GCA009378755_00606 | gene | open | 622643-623278 | ppnN | ||
| 1212 | RCJS01000001.1 | GCA009378755_00607 | gene | open | 623482-623904 | accB | ||
| 1213 | RCJS01000001.1 | GCA009378755_00608 | gene | open | 623917-625260 | accC | ||
| 1214 | RCJS01000001.1 | GCA009378755_00609 | gene | open | 625502-626599 | phoH | ||
| 1215 | RCJS01000001.1 | GCA009378755_00610 | gene | open | 626589-627131 | ybeY | ||
| 1216 | RCJS01000001.1 | GCA009378755_00612 | gene | open | 627358-627852 | sixA | ||
| 1217 | RCJS01000001.1 | GCA009378755_00613 | gene | open | 627885-629213 | gpsA | ||
| 1218 | RCJS01000001.1 | GCA009378755_00614 | gene | open | 629250-629825 | nfnB | ||
| 1219 | RCJS01000001.1 | GCA009378755_00615 | gene | open | 629873-630973 | zapE | ||
| 1220 | RCJS01000001.1 | GCA009378755_00616 | gene | open | 631009-631653 | |||
| 1221 | RCJS01000001.1 | GCA009378755_00617 | gene | open | 631821-632174 | |||
| 1222 | RCJS01000001.1 | GCA009378755_00618 | gene | open | 632339-632770 | ndk | ||
| 1223 | RCJS01000001.1 | GCA009378755_00619 | gene | open | 633014-634105 | ychF | ||
| 1224 | RCJS01000001.1 | GCA009378755_00620 | gene | open | 634281-634754 | |||
| 1225 | RCJS01000001.1 | GCA009378755_00621 | gene | open | 634973-635689 | acrR | ||
| 1226 | RCJS01000001.1 | GCA009378755_00622 | gene | open | 635744-636754 | |||
| 1227 | RCJS01000001.1 | GCA009378755_00623 | gene | open | 637156-638910 | lldP | ||
| 1228 | RCJS01000001.1 | GCA009378755_00624 | gene | open | 639125-640333 | lldD | ||
| 1229 | RCJS01000001.1 | GCA009378755_00625 | gene | open | 640537-641508 | holB | ||
| 1230 | RCJS01000001.1 | GCA009378755_00626 | gene | open | 641505-642086 | phoE | ||
| 1231 | RCJS01000001.1 | GCA009378755_00627 | gene | open | 642095-642856 | kdsB | ||
| 1232 | RCJS01000001.1 | GCA009378755_00628 | gene | open | 642967-644004 | lpxK | ||
| 1233 | RCJS01000001.1 | GCA009378755_00629 | gene | open | 644038-645078 | parB | ||
| 1234 | RCJS01000001.1 | GCA009378755_00630 | gene | open | 645148-645429 | |||
| 1235 | RCJS01000001.1 | GCA009378755_00631 | gene | open | 645436-646221 | parA | ||
| 1236 | RCJS01000001.1 | GCA009378755_00632 | gene | open | 646271-646945 | rsmG | ||
| 1237 | RCJS01000001.1 | GCA009378755_00633 | gene | open | 647152-649533 | lonB | ||
| 1238 | RCJS01000001.1 | GCA009378755_00634 | gene | open | 649573-650286 | nth | ||
| 1239 | RCJS01000001.1 | GCA009378755_00635 | gene | open | 650712-651281 | hemO | ||
| 1240 | RCJS01000001.1 | GCA009378755_00636 | gene | open | 651408-652433 | ycgM | ||
| 1241 | RCJS01000001.1 | GCA009378755_00637 | gene | open | 652451-652894 | |||
| 1242 | RCJS01000001.1 | GCA009378755_00638 | gene | open | 653421-654710 | purA | ||
| 1243 | RCJS01000001.1 | GCA009378755_00639 | gene | open | 654766-656058 | hisZ | ||
| 1244 | RCJS01000001.1 | GCA009378755_00640 | gene | open | 656472-657767 | corA | ||
| 1245 | RCJS01000001.1 | GCA009378755_00641 | gene | open | 657931-659784 | kefB | ||
| 1246 | RCJS01000001.1 | GCA009378755_00642 | gene | open | 659842-661212 | yuiF | ||
| 1247 | RCJS01000001.1 | GCA009378755_00643 | gene | open | 661410-663872 | lon | ||
| 1248 | RCJS01000001.1 | GCA009378755_00644 | gene | open | 663934-664572 | yciB | ||
| 1249 | RCJS01000001.1 | GCA009378755_00645 | gene | open | 664679-665080 | exbD | ||
| 1250 | RCJS01000001.1 | GCA009378755_00646 | gene | open | 665092-665640 | exbB | ||
| 1251 | RCJS01000001.1 | GCA009378755_00647 | gene | open | 665746-666645 | tonB | ||
| 1252 | RCJS01000001.1 | GCA009378755_00648 | gene | open | 667062-668621 | nadB | ||
| 1253 | RCJS01000001.1 | GCA009378755_00649 | gene | open | 668622-669734 | nadA | ||
| 1254 | RCJS01000001.1 | GCA009378755_00650 | gene | open | 669943-670881 | nadQ | ||
| 1255 | RCJS01000001.1 | GCA009378755_00651 | gene | open | 670931-671788 | nadC | ||
| 1256 | RCJS01000001.1 | GCA009378755_00652 | gene | open | 672075-673154 | prfA | ||
| 1257 | RCJS01000001.1 | GCA009378755_00653 | gene | open | 673410-674660 | mntH | ||
| 1258 | RCJS01000001.1 | GCA009378755_00654 | gene | open | 674802-676298 | |||
| 1259 | RCJS01000001.1 | GCA009378755_00655 | gene | open | 676585-676836 | iclR | ||
| 1260 | RCJS01000001.1 | GCA009378755_00656 | gene | open | 677155-678036 | osmF | ||
| 1261 | RCJS01000001.1 | GCA009378755_00657 | gene | open | 678029-678673 | |||
| 1262 | RCJS01000001.1 | GCA009378755_00658 | gene | open | 679207-679884 | yajL | ||
| 1263 | RCJS01000001.1 | GCA009378755_00028 | gene | open | 14514-14590 | trnR | ||
| 1264 | RCJS01000001.1 | GCA009378755_00050 | gene | open | 36875-36951 | trnI | ||
| 1265 | RCJS01000001.1 | GCA009378755_00051 | gene | open | 37004-37088 | trnL | ||
| 1266 | RCJS01000001.1 | GCA009378755_00053 | gene | open | 38654-38730 | trnP | ||
| 1267 | RCJS01000001.1 | GCA009378755_00054 | gene | open | 38785-38861 | trnR | ||
| 1268 | RCJS01000001.1 | GCA009378755_00055 | gene | open | 38880-38955 | trnH | ||
| 1269 | RCJS01000001.1 | GCA009378755_00118 | gene | open | 108381-108456 | trnE | ||
| 1270 | RCJS01000001.1 | GCA009378755_00151 | gene | open | 144895-144970 | trnN | ||
| 1271 | RCJS01000001.1 | GCA009378755_00152 | gene | open | 144975-145050 | trnK | ||
| 1272 | RCJS01000001.1 | GCA009378755_00153 | gene | open | 145071-145146 | trnK | ||
| 1273 | RCJS01000001.1 | GCA009378755_00358 | gene | open | 344864-344948 | trnL | ||
| 1274 | RCJS01000001.1 | GCA009378755_00380 | gene | open | 369146-369221 | trnV | ||
| 1275 | RCJS01000001.1 | GCA009378755_00381 | gene | open | 369225-369301 | trnD | ||
| 1276 | RCJS01000001.1 | GCA009378755_00519 | gene | open | 519254-519340 | trnL | ||
| 1277 | RCJS01000001.1 | GCA009378755_00028 | tRNA | open | 14514-14590 | trnR | tRNA-Arg(ccg) | |
| 1278 | RCJS01000001.1 | GCA009378755_00050 | tRNA | open | 36875-36951 | trnI | tRNA-Ile2(cat) | |
| 1279 | RCJS01000001.1 | GCA009378755_00051 | tRNA | open | 37004-37088 | trnL | tRNA-Leu(tag) | |
| 1280 | RCJS01000001.1 | GCA009378755_00053 | tRNA | open | 38654-38730 | trnP | tRNA-Pro(tgg) | |
| 1281 | RCJS01000001.1 | GCA009378755_00054 | tRNA | open | 38785-38861 | trnR | tRNA-Arg(tct) | |
| 1282 | RCJS01000001.1 | GCA009378755_00055 | tRNA | open | 38880-38955 | trnH | tRNA-His(gtg) | |
| 1283 | RCJS01000001.1 | GCA009378755_00118 | tRNA | open | 108381-108456 | trnE | tRNA-Glu(ttc) | |
| 1284 | RCJS01000001.1 | GCA009378755_00151 | tRNA | open | 144895-144970 | trnN | tRNA-Asn(gtt) | |
| 1285 | RCJS01000001.1 | GCA009378755_00152 | tRNA | open | 144975-145050 | trnK | tRNA-Lys(ttt) | |
| 1286 | RCJS01000001.1 | GCA009378755_00153 | tRNA | open | 145071-145146 | trnK | tRNA-Lys(ttt) | |
| 1287 | RCJS01000001.1 | GCA009378755_00358 | tRNA | open | 344864-344948 | trnL | tRNA-Leu(tag) | |
| 1288 | RCJS01000001.1 | GCA009378755_00380 | tRNA | open | 369146-369221 | trnV | tRNA-Val(tac) | |
| 1289 | RCJS01000001.1 | GCA009378755_00381 | tRNA | open | 369225-369301 | trnD | tRNA-Asp(gtc) | |
| 1290 | RCJS01000001.1 | GCA009378755_00519 | tRNA | open | 519254-519340 | trnL | tRNA-Leu(caa) | |
| 1291 | RCJS01000002.1 | rep_origin | open | 33318-33916 | ||||
| 1292 | RCJS01000002.1 | repeat_region | open | 60713-64241 | CRISPR array with 59 repeats of length 28%2C consensus sequence TTTCTAAGCGACCTGTGCGGTCGTGAAG and spacer length 32 | |||
| 1293 | RCJS01000002.1 | GCA009378755_00660 | CDS | open | 466-723 | _na 85_aa | hypothetical protein | |
| 1294 | RCJS01000002.1 | GCA009378755_00661 | CDS | open | 720-875 | _na 51_aa | hypothetical protein | |
| 1295 | RCJS01000002.1 | GCA009378755_00662 | CDS | open | 1011-1100 | _na 29_aa | hypothetical protein | |
| 1296 | RCJS01000002.1 | GCA009378755_00663 | CDS | open | 1408-2334 | _na 308_aa | znuA | Manganese ABC transporter%2C periplasmic-binding protein SitA |
| 1297 | RCJS01000002.1 | GCA009378755_00664 | CDS | open | 2334-3239 | _na 301_aa | znuC | Manganese ABC transporter%2C ATP-binding protein SitB |
| 1298 | RCJS01000002.1 | GCA009378755_00665 | CDS | open | 3236-4078 | _na 280_aa | znuB | Iron ABC transporter permease |
| 1299 | RCJS01000002.1 | GCA009378755_00666 | CDS | open | 4253-4957 | _na 234_aa | znuB | Manganese ABC transporter%2C inner membrane permease protein SitD |
| 1300 | RCJS01000002.1 | GCA009378755_00667 | CDS | open | 5465-6685 | _na 406_aa | tyrS | tyrosine--tRNA ligase |
| 1301 | RCJS01000002.1 | GCA009378755_00668 | CDS | open | 6847-8082 | _na 411_aa | anmK | anhydro-N-acetylmuramic acid kinase |
| 1302 | RCJS01000002.1 | GCA009378755_00669 | CDS | open | 8332-9111 | _na 259_aa | Protein NO VEIN C-terminal domain-containing protein | |
| 1303 | RCJS01000002.1 | GCA009378755_00670 | CDS | open | 9105-9353 | _na 82_aa | hypothetical protein | |
| 1304 | RCJS01000002.1 | GCA009378755_00671 | CDS | open | 9841-10641 | _na 266_aa | czcD | Cadmium%2C cobalt and zinc/H(+)-K(+) antiporter |
| 1305 | RCJS01000002.1 | GCA009378755_00672 | CDS | open | 10881-12134 | _na 417_aa | rocD | ornithine--oxo-acid transaminase |
| 1306 | RCJS01000002.1 | GCA009378755_00673 | CDS | open | 12176-13108 | _na 310_aa | rocF | arginase |
| 1307 | RCJS01000002.1 | GCA009378755_00674 | CDS | open | 13680-14030 | _na 116_aa | Methylitaconate delta2-delta3-isomerase | |
| 1308 | RCJS01000002.1 | GCA009378755_00675 | CDS | open | 14057-15838 | _na 593_aa | aF0785 | DUF389 domain-containing protein |
| 1309 | RCJS01000002.1 | GCA009378755_00676 | CDS | open | 16071-16679 | _na 202_aa | rsmC | Ribosomal RNA small subunit methyltransferase C |
| 1310 | RCJS01000002.1 | GCA009378755_00677 | CDS | open | 16772-17194 | _na 140_aa | Putative vgr related protein | |
| 1311 | RCJS01000002.1 | GCA009378755_00678 | CDS | open | 17350-18588 | _na 412_aa | rarA | Replication-associated recombination protein A |
| 1312 | RCJS01000002.1 | GCA009378755_00679 | CDS | open | 18703-19797 | _na 364_aa | ribBA | bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II |
| 1313 | RCJS01000002.1 | GCA009378755_00680 | CDS | open | 19964-20224 | _na 86_aa | yeaQ | Transglycosylase |
| 1314 | RCJS01000002.1 | GCA009378755_00681 | CDS | open | 20292-20906 | _na 204_aa | tsaC | Threonylcarbamoyl-AMP synthase |
| 1315 | RCJS01000002.1 | GCA009378755_00682 | CDS | open | 20893-22104 | _na 403_aa | dprA | DNA-processing protein DprA |
| 1316 | RCJS01000002.1 | GCA009378755_00683 | CDS | open | 22141-23556 | _na 471_aa | thrC | threonine synthase |
| 1317 | RCJS01000002.1 | GCA009378755_00684 | CDS | open | 23874-25220 | _na 448_aa | rsmB | 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB |
| 1318 | RCJS01000002.1 | GCA009378755_00685 | CDS | open | 25210-26235 | _na 341_aa | fmt | methionyl-tRNA formyltransferase |
| 1319 | RCJS01000002.1 | GCA009378755_00686 | CDS | open | 26366-27034 | _na 222_aa | ribC | riboflavin synthase |
| 1320 | RCJS01000002.1 | GCA009378755_00687 | CDS | open | 27317-28369 | _na 350_aa | ribD | bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD |
| 1321 | RCJS01000002.1 | GCA009378755_00688 | CDS | open | 28366-28836 | _na 156_aa | nrdR | transcriptional regulator NrdR |
| 1322 | RCJS01000002.1 | GCA009378755_00689 | CDS | open | 28941-30341 | _na 466_aa | mnmE | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE |
| 1323 | RCJS01000002.1 | GCA009378755_00690 | CDS | open | 30508-32181 | _na 557_aa | yidC | membrane protein insertase YidC |
| 1324 | RCJS01000002.1 | GCA009378755_00691 | CDS | open | 32320-32640 | _na 106_aa | yidD | membrane protein insertion efficiency factor YidD |
| 1325 | RCJS01000002.1 | GCA009378755_00692 | CDS | open | 32658-33071 | _na 137_aa | rnpA | ribonuclease P protein component |
| 1326 | RCJS01000002.1 | GCA009378755_00693 | CDS | open | 33183-33317 | _na 44_aa | rpmH | 50S ribosomal protein L34 |
| 1327 | RCJS01000002.1 | GCA009378755_00694 | CDS | open | 33917-35320 | _na 467_aa | dnaA | chromosomal replication initiator protein DnaA |
| 1328 | RCJS01000002.1 | GCA009378755_00695 | CDS | open | 35357-36514 | _na 385_aa | dnaN | DNA polymerase III subunit beta |
| 1329 | RCJS01000002.1 | GCA009378755_00696 | CDS | open | 36518-37726 | _na 402_aa | recF | DNA replication/repair protein RecF |
| 1330 | RCJS01000002.1 | GCA009378755_00697 | CDS | open | 37864-40323 | _na 819_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 1331 | RCJS01000002.1 | GCA009378755_00698 | CDS | open | 40497-42056 | _na 519_aa | guaA | glutamine-hydrolyzing GMP synthase |
| 1332 | RCJS01000002.1 | GCA009378755_00699 | CDS | open | 42209-43426 | _na 405_aa | Esterase-like activity of phytase family protein | |
| 1333 | RCJS01000002.1 | GCA009378755_00700 | CDS | open | 43693-44187 | _na 164_aa | rlpA | RlpA-like protein double-psi beta-barrel domain-containing protein |
| 1334 | RCJS01000002.1 | GCA009378755_00701 | CDS | open | 44201-44560 | _na 119_aa | fkpA | Peptidyl-prolyl cis-trans isomerase |
| 1335 | RCJS01000002.1 | GCA009378755_00702 | CDS | open | 44702-45877 | _na 391_aa | lysA | Ornithine decarboxylase |
| 1336 | RCJS01000002.1 | GCA009378755_00703 | CDS | open | 46314-47195 | _na 293_aa | aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme | |
| 1337 | RCJS01000002.1 | GCA009378755_00704 | CDS | open | 47233-47589 | _na 118_aa | ridA | Aminoacrylate peracid reductase |
| 1338 | RCJS01000002.1 | GCA009378755_00705 | CDS | open | 47598-48854 | _na 418_aa | dadA | D-amino acid dehydrogenase |
| 1339 | RCJS01000002.1 | GCA009378755_00706 | CDS | open | 49196-51067 | _na 623_aa | thiC | phosphomethylpyrimidine synthase ThiC |
| 1340 | RCJS01000002.1 | GCA009378755_00707 | CDS | open | 51181-53022 | _na 613_aa | mdlB | ABC transporter%2C ATP-binding protein |
| 1341 | RCJS01000002.1 | GCA009378755_00708 | CDS | open | 53204-54604 | _na 466_aa | argH | argininosuccinate lyase |
| 1342 | RCJS01000002.1 | GCA009378755_00709 | CDS | open | 54828-55793 | _na 321_aa | hemC | hydroxymethylbilane synthase |
| 1343 | RCJS01000002.1 | GCA009378755_00710 | CDS | open | 55793-56548 | _na 251_aa | hemD | Uroporphyrinogen-III synthase |
| 1344 | RCJS01000002.1 | GCA009378755_00711 | CDS | open | 56620-57492 | _na 290_aa | rlmB | 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB |
| 1345 | RCJS01000002.1 | GCA009378755_00712 | CDS | open | 57558-57815 | _na 85_aa | nqrM | (Na+)-NQR maturation NqrM |
| 1346 | RCJS01000002.1 | GCA009378755_00713 | CDS | open | 57969-59876 | _na 635_aa | dnaK | molecular chaperone DnaK |
| 1347 | RCJS01000002.1 | GCA009378755_00714 | CDS | open | 60078-60599 | _na 173_aa | grpE | nucleotide exchange factor GrpE |
| 1348 | RCJS01000002.1 | GCA009378755_00715 | CDS | open | 64542-65492 | _na 316_aa | cas1f | type I-F CRISPR-associated endonuclease Cas1f |
| 1349 | RCJS01000002.1 | GCA009378755_00716 | CDS | open | 65494-68907 | _na 1137_aa | cas3f | type I-F CRISPR-associated helicase Cas3f |
| 1350 | RCJS01000002.1 | GCA009378755_00717 | CDS | open | 69075-70445 | _na 456_aa | csy1 | type I-F CRISPR-associated protein Csy1 |
| 1351 | RCJS01000002.1 | GCA009378755_00718 | CDS | open | 70442-71377 | _na 311_aa | csy2 | type I-F CRISPR-associated protein Csy2 |
| 1352 | RCJS01000002.1 | GCA009378755_00719 | CDS | open | 71412-72419 | _na 335_aa | csy3 | type I-F CRISPR-associated protein Csy3 |
| 1353 | RCJS01000002.1 | GCA009378755_00720 | CDS | open | 72416-73006 | _na 196_aa | cas6f | type I-F CRISPR-associated endoribonuclease Cas6/Csy4 |
| 1354 | RCJS01000002.1 | GCA009378755_00721 | CDS | open | 73184-73474 | _na 96_aa | yggX | oxidative damage protection protein |
| 1355 | RCJS01000002.1 | GCA009378755_00722 | CDS | open | 73548-74024 | _na 158_aa | fadM | Thioesterase-like superfamily protein |
| 1356 | RCJS01000002.1 | GCA009378755_00723 | CDS | open | 74343-75725 | _na 460_aa | mpl | UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase |
| 1357 | RCJS01000002.1 | GCA009378755_00724 | CDS | open | 75817-76326 | _na 169_aa | dsbB | Disulfide bond formation protein B |
| 1358 | RCJS01000002.1 | GCA009378755_00725 | CDS | open | 76432-77982 | _na 516_aa | gshA | glutamate--cysteine ligase |
| 1359 | RCJS01000002.1 | GCA009378755_00726 | CDS | open | 78132-78464 | _na 110_aa | erpA | iron-sulfur cluster insertion protein ErpA |
| 1360 | RCJS01000002.1 | GCA009378755_00727 | CDS | open | 78611-79471 | _na 286_aa | tauB | Cyanate ABC transporter%2C ATP-binding protein |
| 1361 | RCJS01000002.1 | GCA009378755_00728 | CDS | open | 79461-80345 | _na 294_aa | ntrB | nitrate ABC transporter permease |
| 1362 | RCJS01000002.1 | GCA009378755_00729 | CDS | open | 80335-81750 | _na 471_aa | tauA | Cyanate ABC transporter%2C substrate binding protein |
| 1363 | RCJS01000002.1 | GCA009378755_00730 | CDS | open | 81833-83221 | _na 462_aa | norV | Rubredoxin-NAD+ reductase |
| 1364 | RCJS01000002.1 | GCA009378755_00731 | CDS | open | 83218-84390 | _na 390_aa | caiA | Butyryl-CoA dehydrogenase |
| 1365 | RCJS01000002.1 | GCA009378755_00732 | CDS | open | 84647-85192 | _na 181_aa | yciW | Carboxymuconolactone decarboxylase-like domain-containing protein |
| 1366 | RCJS01000002.1 | GCA009378755_00733 | CDS | open | 85411-87360 | _na 649_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 1367 | RCJS01000002.1 | GCA009378755_00734 | CDS | open | 87368-88207 | _na 279_aa | dnaJ | DnaJ-class molecular chaperone CbpA |
| 1368 | RCJS01000002.1 | GCA009378755_00735 | CDS | open | 88292-89272 | _na 326_aa | yheT | Hydrolase%2C alpha/beta fold family functionally coupled to Phosphoribulokinase |
| 1369 | RCJS01000002.1 | GCA009378755_00736 | CDS | open | 89332-90129 | _na 265_aa | dapB | 4-hydroxy-tetrahydrodipicolinate reductase |
| 1370 | RCJS01000002.1 | GCA009378755_00737 | CDS | open | 90174-91367 | _na 397_aa | metC | Cystathionine beta-lyase |
| 1371 | RCJS01000002.1 | GCA009378755_00738 | CDS | open | 91385-92332 | _na 315_aa | yfeH | Sodium-dependent transporter |
| 1372 | RCJS01000002.1 | GCA009378755_00739 | CDS | open | 92494-93645 | _na 383_aa | dnaJ | molecular chaperone DnaJ |
| 1373 | RCJS01000002.1 | GCA009378755_00740 | CDS | open | 93889-94890 | _na 333_aa | dsbG | Thiol:disulfide interchange protein |
| 1374 | RCJS01000002.1 | GCA009378755_00741 | CDS | open | 94904-95608 | _na 234_aa | rsuA | Pseudouridine synthase |
| 1375 | RCJS01000002.1 | GCA009378755_00742 | CDS | open | 95777-96370 | _na 197_aa | yIH1 | Putative translation regulator%2C IMPACT (imprinted ancient) protein family |
| 1376 | RCJS01000002.1 | GCA009378755_00743 | CDS | open | 96824-97150 | _na 108_aa | dksA | Conjugal transfer protein TraR |
| 1377 | RCJS01000002.1 | GCA009378755_00744 | CDS | open | 97150-98046 | _na 298_aa | rluA | Pseudouridylate synthase |
| 1378 | RCJS01000002.1 | GCA009378755_00745 | CDS | open | 98384-98677 | _na 97_aa | SHOCT domain-containing protein | |
| 1379 | RCJS01000002.1 | GCA009378755_00746 | CDS | open | 98727-99938 | _na 403_aa | sstT | serine/threonine transporter SstT |
| 1380 | RCJS01000002.1 | GCA009378755_00747 | CDS | open | 100075-101034 | _na 319_aa | yejR | Cobalamin biosynthesis protein P47K |
| 1381 | RCJS01000002.1 | GCA009378755_00748 | CDS | open | 101101-101835 | _na 244_aa | ompR | two-component system response regulator OmpR |
| 1382 | RCJS01000002.1 | GCA009378755_00749 | CDS | open | 102098-104464 | _na 788_aa | tex | Transcription accessory protein S1 RNA-binding domain |
| 1383 | RCJS01000002.1 | GCA009378755_00750 | CDS | open | 104525-104950 | _na 141_aa | DUF305 domain-containing protein | |
| 1384 | RCJS01000002.1 | GCA009378755_00751 | CDS | open | 105158-106435 | _na 425_aa | gltA | citrate synthase |
| 1385 | RCJS01000002.1 | GCA009378755_00752 | CDS | open | 107257-107637 | _na 126_aa | sdhC | succinate dehydrogenase%2C cytochrome b556 subunit |
| 1386 | RCJS01000002.1 | GCA009378755_00753 | CDS | open | 107637-107990 | _na 117_aa | sdhD | succinate dehydrogenase%2C hydrophobic membrane anchor protein |
| 1387 | RCJS01000002.1 | GCA009378755_00754 | CDS | open | 108049-109899 | _na 616_aa | sdhA | succinate dehydrogenase flavoprotein subunit |
| 1388 | RCJS01000002.1 | GCA009378755_00755 | CDS | open | 109970-110680 | _na 236_aa | sdhB | Fumarate reductase iron-sulfur subunit |
| 1389 | RCJS01000002.1 | GCA009378755_00756 | CDS | open | 111068-113923 | _na 951_aa | sucA | 2-oxoglutarate dehydrogenase E1 component |
| 1390 | RCJS01000002.1 | GCA009378755_00757 | CDS | open | 114017-115255 | _na 412_aa | odhB | 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase |
| 1391 | RCJS01000002.1 | GCA009378755_00758 | CDS | open | 115345-116793 | _na 482_aa | lpdA | dihydrolipoyl dehydrogenase |
| 1392 | RCJS01000002.1 | GCA009378755_00759 | CDS | open | 116994-117311 | _na 105_aa | hypothetical protein | |
| 1393 | RCJS01000002.1 | GCA009378755_00760 | CDS | open | 117327-117764 | _na 145_aa | hypothetical protein | |
| 1394 | RCJS01000002.1 | GCA009378755_00761 | CDS | open | 118355-121096 | _na 913_aa | cirA | TonB-dependent Receptor Plug domain protein |
| 1395 | RCJS01000002.1 | GCA009378755_00762 | CDS | open | 121148-121243 | _na 31_aa | hypothetical protein | |
| 1396 | RCJS01000002.1 | GCA009378755_00763 | CDS | open | 121512-122729 | _na 405_aa | Porin | |
| 1397 | RCJS01000002.1 | GCA009378755_00764 | CDS | open | 122828-124060 | _na 410_aa | Porin | |
| 1398 | RCJS01000002.1 | GCA009378755_00765 | CDS | open | 124296-126983 | _na 895_aa | preP | prolyl oligopeptidase |
| 1399 | RCJS01000002.1 | GCA009378755_00766 | CDS | open | 127172-127405 | _na 77_aa | Metal-binding protein | |
| 1400 | RCJS01000002.1 | GCA009378755_00767 | CDS | open | 127410-129533 | _na 707_aa | dcp | oligopeptidase A |
| 1401 | RCJS01000002.1 | GCA009378755_00768 | CDS | open | 129750-130499 | _na 249_aa | elsH | Endonuclease/exonuclease/phosphatase domain-containing protein |
| 1402 | RCJS01000002.1 | GCA009378755_00769 | CDS | open | 130633-131244 | _na 203_aa | rdgB | RdgB/HAM1 family non-canonical purine NTP pyrophosphatase |
| 1403 | RCJS01000002.1 | GCA009378755_00770 | CDS | open | 131429-132763 | _na 444_aa | tig | trigger factor |
| 1404 | RCJS01000002.1 | GCA009378755_00771 | CDS | open | 132928-133581 | _na 217_aa | clpP | ATP-dependent Clp endopeptidase proteolytic subunit ClpP |
| 1405 | RCJS01000002.1 | GCA009378755_00772 | CDS | open | 133591-134907 | _na 438_aa | clpX | ATP-dependent protease ATP-binding subunit ClpX |
| 1406 | RCJS01000002.1 | GCA009378755_00773 | CDS | open | 135070-136194 | _na 374_aa | dnaJ | J domain-containing protein |
| 1407 | RCJS01000002.1 | GCA009378755_00774 | CDS | open | 136544-138697 | _na 717_aa | fadB | fatty acid oxidation complex subunit alpha FadB |
| 1408 | RCJS01000002.1 | GCA009378755_00775 | CDS | open | 138727-139899 | _na 390_aa | fadA | acetyl-CoA C-acyltransferase FadA |
| 1409 | RCJS01000002.1 | GCA009378755_00776 | CDS | open | 140035-140430 | _na 131_aa | patatin-like phospholipase family protein | |
| 1410 | RCJS01000002.1 | GCA009378755_00777 | CDS | open | 140618-140947 | _na 109_aa | Patatin | |
| 1411 | RCJS01000002.1 | GCA009378755_00778 | CDS | open | 140922-141188 | _na 88_aa | Patatin | |
| 1412 | RCJS01000002.1 | GCA009378755_00779 | CDS | open | 141534-142265 | _na 243_aa | cysH | phosphoadenylyl-sulfate reductase |
| 1413 | RCJS01000002.1 | GCA009378755_00780 | CDS | open | 142349-143272 | _na 307_aa | cysD | sulfate adenylyltransferase subunit CysD |
| 1414 | RCJS01000002.1 | GCA009378755_00781 | CDS | open | 143423-144727 | _na 434_aa | cysN | sulfate adenylyltransferase |
| 1415 | RCJS01000002.1 | GCA009378755_00782 | CDS | open | 144838-146934 | _na 698_aa | recG | ATP-dependent DNA helicase RecG |
| 1416 | RCJS01000002.1 | GCA009378755_00783 | CDS | open | 146921-147574 | _na 217_aa | crp | Cyclic nucleotide-binding domain-containing protein |
| 1417 | RCJS01000002.1 | GCA009378755_00784 | CDS | open | 147747-148217 | _na 156_aa | hlyD | HlyD secretion family protein |
| 1418 | RCJS01000002.1 | GCA009378755_00785 | CDS | open | 148322-148609 | _na 95_aa | hlyD | HlyD family secretion protein |
| 1419 | RCJS01000002.1 | GCA009378755_00786 | CDS | open | 148877-148987 | _na 36_aa | hypothetical protein | |
| 1420 | RCJS01000002.1 | GCA009378755_00787 | CDS | open | 148965-149315 | _na 116_aa | AcrB/AcrD/AcrF family | |
| 1421 | RCJS01000002.1 | GCA009378755_00788 | CDS | open | 149312-149584 | _na 90_aa | AcrB/AcrD/AcrF family protein | |
| 1422 | RCJS01000002.1 | GCA009378755_00789 | CDS | open | 149633-150016 | _na 127_aa | AcrB/AcrD/AcrF family protein | |
| 1423 | RCJS01000002.1 | GCA009378755_00790 | CDS | open | 149992-150753 | _na 253_aa | AcrB/AcrD/AcrF family protein | |
| 1424 | RCJS01000002.1 | GCA009378755_00791 | CDS | open | 150775-151215 | _na 146_aa | AcrB/AcrD/AcrF family protein | |
| 1425 | RCJS01000002.1 | GCA009378755_00792 | CDS | open | 151303-151950 | _na 215_aa | RND transporter | |
| 1426 | RCJS01000002.1 | GCA009378755_00793 | CDS | open | 152195-152740 | _na 181_aa | DUF924 domain-containing protein | |
| 1427 | RCJS01000002.1 | GCA009378755_00794 | CDS | open | 152732-153367 | _na 211_aa | coaE | dephospho-CoA kinase |
| 1428 | RCJS01000002.1 | GCA009378755_00795 | CDS | open | 153519-154295 | _na 258_aa | pilD | Peptidase |
| 1429 | RCJS01000002.1 | GCA009378755_00796 | CDS | open | 154295-155554 | _na 419_aa | pilC | Type II secretion system (T2SS)%2C F family protein |
| 1430 | RCJS01000002.1 | GCA009378755_00797 | CDS | open | 155593-157257 | _na 554_aa | pilB | type IV-A pilus assembly ATPase PilB |
| 1431 | RCJS01000002.1 | GCA009378755_00798 | CDS | open | 157412-158635 | _na 407_aa | araJ | Bcr/CflA family efflux transporter |
| 1432 | RCJS01000002.1 | GCA009378755_00799 | CDS | open | 158805-162749 | _na 1314_aa | purL | phosphoribosylformylglycinamidine synthase |
| 1433 | RCJS01000002.1 | GCA009378755_00800 | CDS | open | 163031-164302 | _na 423_aa | gltS | sodium/glutamate symporter |
| 1434 | RCJS01000002.1 | GCA009378755_00801 | CDS | open | 164371-165702 | _na 443_aa | argA | amino-acid N-acetyltransferase |
| 1435 | RCJS01000002.1 | GCA009378755_00802 | CDS | open | 166012-166590 | _na 192_aa | DUF11 domain-containing protein | |
| 1436 | RCJS01000002.1 | GCA009378755_00803 | CDS | open | 167288-167872 | _na 194_aa | efeO | iron uptake system protein EfeO |
| 1437 | RCJS01000002.1 | GCA009378755_00804 | CDS | open | 167976-169268 | _na 430_aa | efeB | iron uptake transporter deferrochelatase/peroxidase subunit |
| 1438 | RCJS01000002.1 | GCA009378755_00805 | CDS | open | 169413-170384 | _na 323_aa | dusA | tRNA-dihydrouridine(16) synthase |
| 1439 | RCJS01000002.1 | GCA009378755_00806 | CDS | open | 170389-171876 | _na 495_aa | uvrD | Putative DNA helicase |
| 1440 | RCJS01000002.1 | GCA009378755_00807 | CDS | open | 172044-172787 | _na 247_aa | mngR | GntR family transcriptional regulator |
| 1441 | RCJS01000002.1 | GCA009378755_00808 | CDS | open | 173292-174980 | _na 562_aa | gltB2 | Ferredoxin-dependent glutamate synthase |
| 1442 | RCJS01000002.1 | GCA009378755_00809 | CDS | open | 175184-175927 | _na 247_aa | tatC | Sec-independent protein translocase protein TatC |
| 1443 | RCJS01000002.1 | GCA009378755_00810 | CDS | open | 175924-176460 | _na 178_aa | tatA | Preprotein translocase subunit TatA |
| 1444 | RCJS01000002.1 | GCA009378755_00811 | CDS | open | 176457-176690 | _na 77_aa | tatA | Sec-independent protein translocase subunit TatA |
| 1445 | RCJS01000002.1 | GCA009378755_00812 | CDS | open | 176762-177571 | _na 269_aa | hisIE | bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE |
| 1446 | RCJS01000002.1 | GCA009378755_00813 | CDS | open | 177832-178023 | _na 63_aa | rpmI | 50S ribosomal protein L35 |
| 1447 | RCJS01000002.1 | GCA009378755_00814 | CDS | open | 178052-178408 | _na 118_aa | rplT | 50S ribosomal protein L20 |
| 1448 | RCJS01000002.1 | GCA009378755_00815 | CDS | open | 178778-181054 | _na 758_aa | norB | Nitric-oxide reductase%2C quinol-dependent |
| 1449 | RCJS01000002.1 | GCA009378755_00816 | CDS | open | 181230-181763 | _na 177_aa | iscR | Nitrite-sensitive transcriptional repressor NsrR |
| 1450 | RCJS01000002.1 | GCA009378755_00817 | CDS | open | 182144-183652 | _na 502_aa | Copper-containing nitrite reductase | |
| 1451 | RCJS01000002.1 | GCA009378755_00818 | CDS | open | 183961-184797 | _na 278_aa | yfmG | Sulfatase-modifying factor enzyme domain-containing protein |
| 1452 | RCJS01000002.1 | GCA009378755_00819 | CDS | open | 184934-185629 | _na 231_aa | sco1 | SCO1/SenC family protein |
| 1453 | RCJS01000002.1 | GCA009378755_00820 | CDS | open | 185922-186953 | _na 343_aa | pheS | phenylalanine--tRNA ligase subunit alpha |
| 1454 | RCJS01000002.1 | GCA009378755_00821 | CDS | open | 187006-189402 | _na 798_aa | pheT | phenylalanine--tRNA ligase subunit beta |
| 1455 | RCJS01000002.1 | GCA009378755_00822 | CDS | open | 189551-189847 | _na 98_aa | hupA | integration host factor subunit alpha |
| 1456 | RCJS01000002.1 | GCA009378755_00823 | CDS | open | 190060-190320 | _na 86_aa | rpmE | type B 50S ribosomal protein L31 |
| 1457 | RCJS01000002.1 | GCA009378755_00824 | CDS | open | 190645-191613 | _na 322_aa | zipA | Cell division protein ZipA |
| 1458 | RCJS01000002.1 | GCA009378755_00825 | CDS | open | 191660-192568 | _na 302_aa | mutM | bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase |
| 1459 | RCJS01000002.1 | GCA009378755_00826 | CDS | open | 192598-194964 | _na 788_aa | spoT | GTP pyrophosphokinase |
| 1460 | RCJS01000002.1 | GCA009378755_00827 | CDS | open | 195639-197372 | _na 577_aa | srmB | ATP-dependent RNA helicase |
| 1461 | RCJS01000002.1 | GCA009378755_00828 | CDS | open | 197428-198921 | _na 497_aa | rlmD | 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD |
| 1462 | RCJS01000002.1 | GCA009378755_00829 | CDS | open | 199022-199150 | _na 42_aa | hypothetical protein | |
| 1463 | RCJS01000002.1 | GCA009378755_00830 | CDS | open | 199208-199432 | _na 74_aa | hypothetical protein | |
| 1464 | RCJS01000002.1 | GCA009378755_00831 | CDS | open | 199444-200217 | _na 257_aa | polB | Putative 3'-5' exonuclease related to the exonuclease domain of PolB family protein |
| 1465 | RCJS01000002.1 | GCA009378755_00832 | CDS | open | 200226-201134 | _na 302_aa | cysM | cysteine synthase CysM |
| 1466 | RCJS01000002.1 | GCA009378755_00833 | CDS | open | 201273-204239 | _na 988_aa | hPtr | histidine kinase |
| 1467 | RCJS01000002.1 | GCA009378755_00834 | CDS | open | 204322-204516 | _na 64_aa | Inner membrane protein YgaP-like transmembrane domain-containing protein | |
| 1468 | RCJS01000002.1 | GCA009378755_00835 | CDS | open | 204834-205667 | _na 277_aa | asd | archaetidylserine decarboxylase |
| 1469 | RCJS01000002.1 | GCA009378755_00836 | CDS | open | 205907-206356 | _na 149_aa | ybaN | Inner membrane protein |
| 1470 | RCJS01000002.1 | GCA009378755_00837 | CDS | open | 206528-207850 | _na 440_aa | bioA | adenosylmethionine--8-amino-7-oxononanoate transaminase |
| 1471 | RCJS01000002.1 | GCA009378755_00838 | CDS | open | 207850-209049 | _na 399_aa | bioF | Aminotransferase class I and II family protein |
| 1472 | RCJS01000002.1 | GCA009378755_00839 | CDS | open | 209046-209903 | _na 285_aa | tam | Malonyl-[acyl-carrier protein] O-methyltransferase |
| 1473 | RCJS01000002.1 | GCA009378755_00840 | CDS | open | 209900-210604 | _na 234_aa | bioD | dethiobiotin synthase |
| 1474 | RCJS01000002.1 | GCA009378755_00841 | CDS | open | 210617-211069 | _na 150_aa | dtd | D-aminoacyl-tRNA deacylase |
| 1475 | RCJS01000002.1 | GCA009378755_00842 | CDS | open | 211119-211694 | _na 191_aa | yjhB | MutT/nudix family protein |
| 1476 | RCJS01000002.1 | GCA009378755_00843 | CDS | open | 211837-212619 | _na 260_aa | mutT | Coenzyme A pyrophosphatase |
| 1477 | RCJS01000002.1 | GCA009378755_00844 | CDS | open | 212652-213017 | _na 121_aa | rsfS | ribosome silencing factor |
| 1478 | RCJS01000002.1 | GCA009378755_00845 | CDS | open | 213050-213814 | _na 254_aa | nadD | nicotinate (nicotinamide) nucleotide adenylyltransferase |
| 1479 | RCJS01000002.1 | GCA009378755_00846 | CDS | open | 213887-216760 | _na 957_aa | uvrA | excinuclease ABC subunit UvrA |
| 1480 | RCJS01000002.1 | GCA009378755_00847 | CDS | open | 216922-217644 | _na 240_aa | ssb | Single-stranded DNA-binding protein |
| 1481 | RCJS01000002.1 | GCA009378755_00848 | CDS | open | 217736-218887 | _na 383_aa | gsp | Glutathionylspermidine synthase preATP-grasp family protein |
| 1482 | RCJS01000002.1 | GCA009378755_00849 | CDS | open | 218884-219429 | _na 181_aa | Glycine zipper domain-containing protein | |
| 1483 | RCJS01000002.1 | GCA009378755_00850 | CDS | open | 219627-220436 | _na 269_aa | ccmC | Heme exporter protein C |
| 1484 | RCJS01000002.1 | GCA009378755_00851 | CDS | open | 220436-220636 | _na 66_aa | ccmD | heme exporter protein CcmD |
| 1485 | RCJS01000002.1 | GCA009378755_00852 | CDS | open | 220706-221227 | _na 173_aa | ccmE | cytochrome c maturation protein CcmE |
| 1486 | RCJS01000002.1 | GCA009378755_00853 | CDS | open | 221297-222127 | _na 276_aa | nlpA | Lipoprotein |
| 1487 | RCJS01000002.1 | GCA009378755_00854 | CDS | open | 222319-223008 | _na 229_aa | metP | Methionine ABC transporter permease protein |
| 1488 | RCJS01000002.1 | GCA009378755_00855 | CDS | open | 222998-224068 | _na 356_aa | metN | methionine ABC transporter ATP-binding protein MetN |
| 1489 | RCJS01000002.1 | GCA009378755_00856 | CDS | open | 224190-225755 | _na 521_aa | baeS | histidine kinase |
| 1490 | RCJS01000002.1 | GCA009378755_00857 | CDS | open | 225891-226613 | _na 240_aa | ompR | Transcriptional regulatory protein YycF |
| 1491 | RCJS01000002.1 | GCA009378755_00858 | CDS | open | 226808-227812 | _na 334_aa | accB | HlyD family secretion protein |
| 1492 | RCJS01000002.1 | GCA009378755_00859 | CDS | open | 228026-228541 | _na 171_aa | cybB | Prokaryotic cytochrome b561 family protein |
| 1493 | RCJS01000002.1 | GCA009378755_00860 | CDS | open | 228588-229541 | _na 317_aa | prsA | Ribose-phosphate pyrophosphokinase |
| 1494 | RCJS01000002.1 | GCA009378755_00863 | CDS | open | 230110-230982 | _na 290_aa | ispE | 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase |
| 1495 | RCJS01000002.1 | GCA009378755_00864 | CDS | open | 230987-231559 | _na 190_aa | lolB | Outer-membrane lipoprotein LolB |
| 1496 | RCJS01000002.1 | GCA009378755_00865 | CDS | open | 231588-233603 | _na 671_aa | hemYx | Tetratricopeptide repeat protein |
| 1497 | RCJS01000002.1 | GCA009378755_00866 | CDS | open | 233938-235281 | _na 447_aa | hemA | glutamyl-tRNA reductase |
| 1498 | RCJS01000002.1 | GCA009378755_00867 | CDS | open | 235397-237058 | _na 553_aa | fixX | Electron transfer flavoprotein-ubiquinone oxidoreductase |
| 1499 | RCJS01000002.1 | GCA009378755_00868 | CDS | open | 237426-238052 | _na 208_aa | Proteophosphoglycan | |
| 1500 | RCJS01000002.1 | GCA009378755_00869 | CDS | open | 238118-238975 | _na 285_aa | murI | glutamate racemase |

