HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Moraxella catarrhalis (GCA_009378925.1)

Select a Genome:
BAKTA Annotations for GCA_009378925.1
Genome Selected: Moraxella catarrhalis
ContigsBases CDSrRNA tmRNAtRNA
26 1969511 1820 3 1 44
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3755 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 3755 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 NXCX01000008.1 GCA009378925_01693 gene open 142210-143628 der
2002 NXCX01000008.1 GCA009378925_01694 gene open 143696-144415 rnhB
2003 NXCX01000008.1 GCA009378925_01695 gene open 144408-145688 lpxB
2004 NXCX01000008.1 GCA009378925_01696 gene open 145902-146606 smrB
2005 NXCX01000008.1 GCA009378925_01697 gene open 146756-147853 aroG1
2006 NXCX01000008.1 GCA009378925_01698 gene open 148131-149126 ispA
2007 NXCX01000008.1 GCA009378925_01699 gene open 149326-149730
2008 NXCX01000008.1 GCA009378925_01700 gene open 149805-150476 mtgA
2009 NXCX01000008.1 GCA009378925_01701 gene open 150633-152855
2010 NXCX01000008.1 GCA009378925_01702 gene open 152862-153350 ychJ
2011 NXCX01000008.1 GCA009378925_01703 gene open 153467-154573 aroC
2012 NXCX01000008.1 GCA009378925_01704 gene open 154693-155223 ppa
2013 NXCX01000008.1 GCA009378925_01705 gene open 155264-156007 lipB
2014 NXCX01000008.1 GCA009378925_01706 gene open 156220-157452 pncB
2015 NXCX01000008.1 GCA009378925_01707 gene open 157556-157798 xseB
2016 NXCX01000008.1 GCA009378925_01708 gene open 158014-159459 citT
2017 NXCX01000008.1 GCA009378925_01709 gene open 159596-160540 lysR
2018 NXCX01000008.1 GCA009378925_01710 gene open 160745-162289
2019 NXCX01000008.1 GCA009378925_01711 gene open 162293-163180 prmC
2020 NXCX01000008.1 GCA009378925_01712 gene open 163204-163965 thiF
2021 NXCX01000008.1 GCA009378925_01713 gene open 164055-165374 aarF
2022 NXCX01000008.1 GCA009378925_01714 gene open 165454-166848 der
2023 NXCX01000008.1 GCA009378925_01715 gene open 166854-167336 yciA
2024 NXCX01000008.1 GCA009378925_01716 gene open 167359-167679 dsrC
2025 NXCX01000008.1 GCA009378925_01717 gene open 167695-168000
2026 NXCX01000008.1 GCA009378925_01718 gene open 168010-168387 tusD
2027 NXCX01000008.1 GCA009378925_01719 gene open 168503-171316 glnE
2028 NXCX01000008.1 GCA009378925_01720 gene open 171486-172418 ilvE
2029 NXCX01000008.1 GCA009378925_01721 gene open 172560-172742
2030 NXCX01000008.1 GCA009378925_01723 gene open 173177-174253 terC2
2031 NXCX01000008.1 GCA009378925_01724 gene open 174309-174947 maiA
2032 NXCX01000008.1 GCA009378925_01725 gene open 175097-176446 cysG
2033 NXCX01000008.1 GCA009378925_01726 gene open 176471-176848
2034 NXCX01000008.1 GCA009378925_01727 gene open 176910-178586 cysI
2035 NXCX01000008.1 GCA009378925_01728 gene open 178762-180354 hipB
2036 NXCX01000008.1 GCA009378925_01729 gene open 180498-180911 msrB
2037 NXCX01000008.1 GCA009378925_01730 gene open 181026-181115
2038 NXCX01000008.1 GCA009378925_01731 gene open 181248-182480 carA
2039 NXCX01000008.1 GCA009378925_01732 gene open 182572-183516
2040 NXCX01000008.1 GCA009378925_01733 gene open 183608-183907
2041 NXCX01000008.1 GCA009378925_01734 gene open 184038-184547 ypbQ
2042 NXCX01000008.1 GCA009378925_01735 gene open 184602-187838 carB
2043 NXCX01000008.1 GCA009378925_01736 gene open 188119-188595 greA
2044 NXCX01000008.1 GCA009378925_01737 gene open 188611-188973 sirB
2045 NXCX01000008.1 GCA009378925_01572 gene open 10315-10390 trnN
2046 NXCX01000008.1 GCA009378925_01573 gene open 10395-10470 trnK
2047 NXCX01000008.1 GCA009378925_01574 gene open 10491-10566 trnK
2048 NXCX01000008.1 GCA009378925_01722 gene open 172765-172849 trnL
2049 NXCX01000008.1 GCA009378925_01572 tRNA open 10315-10390 trnN tRNA-Asn(gtt)
2050 NXCX01000008.1 GCA009378925_01573 tRNA open 10395-10470 trnK tRNA-Lys(ttt)
2051 NXCX01000008.1 GCA009378925_01574 tRNA open 10491-10566 trnK tRNA-Lys(ttt)
2052 NXCX01000008.1 GCA009378925_01722 tRNA open 172765-172849 trnL tRNA-Leu(tag)
2053 NXCX01000009.1 GCA009378925_01739 gene open 341-679 RNaseP_bact_a
2054 NXCX01000009.1 GCA009378925_01739 ncRNA open 341-679 Bacterial RNase P class A
2055 NXCX01000009.1 GCA009378925_01740 CDS open 699-950 _na     83_aa nuoI YfhL family 4Fe-4S dicluster ferredoxin
2056 NXCX01000009.1 GCA009378925_01741 CDS open 959-1453 _na     164_aa coaD pantetheine-phosphate adenylyltransferase
2057 NXCX01000009.1 GCA009378925_01742 CDS open 1614-2396 _na     260_aa nfsA oxygen-insensitive NADPH nitroreductase
2058 NXCX01000009.1 GCA009378925_01743 CDS open 2677-3141 _na     154_aa smpB SsrA-binding protein SmpB
2059 NXCX01000009.1 GCA009378925_01744 CDS open 3209-3826 _na     205_aa Lipoprotein
2060 NXCX01000009.1 GCA009378925_01745 CDS open 3862-4746 _na     294_aa rhaT EamA domain-containing protein
2061 NXCX01000009.1 GCA009378925_01746 CDS open 4749-6824 _na     691_aa ligA NAD-dependent DNA ligase LigA
2062 NXCX01000009.1 GCA009378925_01747 CDS open 7089-8111 _na     340_aa pfoR Putative nicotinate-regulated transporter
2063 NXCX01000009.1 GCA009378925_01748 CDS open 8291-8938 _na     215_aa upp uracil phosphoribosyltransferase
2064 NXCX01000009.1 GCA009378925_01749 CDS open 9053-10045 _na     330_aa ssuD Luciferase oxidoreductase%2C group 1 family protein
2065 NXCX01000009.1 GCA009378925_01750 CDS open 10612-11313 _na     233_aa serB Hydrolase
2066 NXCX01000009.1 GCA009378925_01751 CDS open 11387-12382 _na     331_aa potA ABC transporter ATP-binding protein
2067 NXCX01000009.1 GCA009378925_01752 CDS open 12379-13224 _na     281_aa potC ABC transporter permease
2068 NXCX01000009.1 GCA009378925_01753 CDS open 13240-14157 _na     305_aa Polyamine ABC transporter permease
2069 NXCX01000009.1 GCA009378925_01754 CDS open 14154-14969 _na     271_aa ataC Nucleotide pyrophosphatase
2070 NXCX01000009.1 GCA009378925_01755 CDS open 15039-16145 _na     368_aa afuA ABC transporter substrate-binding protein
2071 NXCX01000009.1 GCA009378925_01757 CDS open 16998-18488 _na     496_aa gppA Exopolyphosphatase
2072 NXCX01000009.1 GCA009378925_01758 CDS open 18501-19550 _na     349_aa phoR phosphate regulon sensor histidine kinase PhoR
2073 NXCX01000009.1 GCA009378925_01759 CDS open 19547-20239 _na     230_aa phoB phosphate regulon transcriptional regulator PhoB
2074 NXCX01000009.1 GCA009378925_01760 CDS open 20470-21309 _na     279_aa pstB phosphate ABC transporter ATP-binding protein PstB
2075 NXCX01000009.1 GCA009378925_01761 CDS open 21378-22250 _na     290_aa pstA phosphate ABC transporter permease PstA
2076 NXCX01000009.1 GCA009378925_01762 CDS open 22261-23223 _na     320_aa pstC phosphate ABC transporter permease subunit PstC
2077 NXCX01000009.1 GCA009378925_01763 CDS open 23331-24470 _na     379_aa pstS phosphate ABC transporter substrate-binding protein PstS
2078 NXCX01000009.1 GCA009378925_01764 CDS open 24819-25646 _na     275_aa bepA Peptidase M48
2079 NXCX01000009.1 GCA009378925_01765 CDS open 25679-25999 _na     106_aa bolA BolA-like family protein
2080 NXCX01000009.1 GCA009378925_01766 CDS open 26440-28149 _na     569_aa sUL1 Sulfate transporter family protein
2081 NXCX01000009.1 GCA009378925_01767 CDS open 28288-28614 _na     108_aa Beta-lactamase hydrolase-like protein phosphatase-like domain-containing protein
2082 NXCX01000009.1 GCA009378925_01768 CDS open 28663-29391 _na     242_aa rluA Dual-specificity RNA pseudouridine synthase RluA
2083 NXCX01000009.1 GCA009378925_01769 CDS open 29589-29909 _na     106_aa trxA thioredoxin
2084 NXCX01000009.1 GCA009378925_01770 CDS open 30143-31411 _na     422_aa rho transcription termination factor Rho
2085 NXCX01000009.1 GCA009378925_01771 CDS open 31778-32131 _na     117_aa Entericidin
2086 NXCX01000009.1 GCA009378925_01772 CDS open 32300-32713 _na     137_aa osmC Osmotically inducible protein OsmC
2087 NXCX01000009.1 GCA009378925_01773 CDS open 32890-34416 _na     508_aa ttdA Fumarate hydratase class I
2088 NXCX01000009.1 GCA009378925_01774 CDS open 34605-35702 _na     365_aa hisC histidinol-phosphate transaminase
2089 NXCX01000009.1 GCA009378925_01775 CDS open 35791-37098 _na     435_aa hisD Histidinol dehydrogenase
2090 NXCX01000009.1 GCA009378925_01776 CDS open 37297-37953 _na     218_aa hisG ATP phosphoribosyltransferase
2091 NXCX01000009.1 GCA009378925_01777 CDS open 38032-39294 _na     420_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
2092 NXCX01000009.1 GCA009378925_01778 CDS open 39310-39570 _na     86_aa ibaG BolA family transcriptional regulator
2093 NXCX01000009.1 GCA009378925_01779 CDS open 39686-40447 _na     253_aa osmY Phospholipid-binding protein
2094 NXCX01000009.1 GCA009378925_01780 CDS open 40532-40945 _na     137_aa yraN YraN family protein
2095 NXCX01000009.1 GCA009378925_01781 CDS open 40945-41439 _na     164_aa yckC RDD domain-containing protein
2096 NXCX01000009.1 GCA009378925_01782 CDS open 41614-42096 _na     160_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
2097 NXCX01000009.1 GCA009378925_01783 CDS open 42226-44313 _na     695_aa pnp polyribonucleotide nucleotidyltransferase
2098 NXCX01000009.1 GCA009378925_01784 CDS open 44408-44617 _na     69_aa hypothetical protein
2099 NXCX01000009.1 GCA009378925_01785 CDS open 44526-44792 _na     88_aa rpsO 30S ribosomal protein S15
2100 NXCX01000009.1 GCA009378925_01786 CDS open 45010-45654 _na     214_aa lomR Porin opacity type domain-containing protein
2101 NXCX01000009.1 GCA009378925_01787 CDS open 45766-46701 _na     311_aa truB tRNA pseudouridine(55) synthase TruB
2102 NXCX01000009.1 GCA009378925_01788 CDS open 46698-47123 _na     141_aa rbfA ribosome-binding factor A
2103 NXCX01000009.1 GCA009378925_01789 CDS open 47699-48547 _na     282_aa ysnF DUF2382 domain-containing protein
2104 NXCX01000009.1 GCA009378925_01790 CDS open 48727-49233 _na     168_aa ysnF DUF2382 domain-containing protein
2105 NXCX01000009.1 GCA009378925_01791 CDS open 49474-52212 _na     912_aa infB translation initiation factor IF-2
2106 NXCX01000009.1 GCA009378925_01792 CDS open 52368-53849 _na     493_aa nusA Transcription termination/antitermination protein NusA
2107 NXCX01000009.1 GCA009378925_01793 CDS open 53949-54446 _na     165_aa rimP ribosome maturation factor RimP
2108 NXCX01000009.1 GCA009378925_01796 CDS open 55084-55386 _na     100_aa secG preprotein translocase subunit SecG
2109 NXCX01000009.1 GCA009378925_01797 CDS open 55425-56177 _na     250_aa tpiA triose-phosphate isomerase
2110 NXCX01000009.1 GCA009378925_01798 CDS open 56371-57468 _na     365_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
2111 NXCX01000009.1 GCA009378925_01799 CDS open 57486-58970 _na     494_aa murF UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
2112 NXCX01000009.1 GCA009378925_01800 CDS open 58992-60554 _na     520_aa murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
2113 NXCX01000009.1 GCA009378925_01801 CDS open 60590-62548 _na     652_aa ftsI Septum formation%2C penicillin binding protein 3%2C peptidoglycan synthetase
2114 NXCX01000009.1 GCA009378925_01802 CDS open 62552-62902 _na     116_aa ftsL Cell division protein FtsL
2115 NXCX01000009.1 GCA009378925_01803 CDS open 62933-63925 _na     330_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
2116 NXCX01000009.1 GCA009378925_01804 CDS open 64213-65709 _na     498_aa gltX glutamate--tRNA ligase
2117 NXCX01000009.1 GCA009378925_01807 CDS open 66251-66925 _na     224_aa Hydrolase
2118 NXCX01000009.1 GCA009378925_01808 CDS open 67015-67911 _na     298_aa Transmembrane protein
2119 NXCX01000009.1 GCA009378925_01809 CDS open 67908-68792 _na     294_aa yafJ Putative glutamine amidotransferase%2C class-II protein
2120 NXCX01000009.1 GCA009378925_01810 CDS open 68800-69165 _na     121_aa hypothetical protein
2121 NXCX01000009.1 GCA009378925_01811 CDS open 69170-69637 _na     155_aa hypothetical protein
2122 NXCX01000009.1 GCA009378925_01812 CDS open 69634-70632 _na     332_aa srkA homoserine kinase
2123 NXCX01000009.1 GCA009378925_01813 CDS open 70938-71711 _na     257_aa hisF Imidazole glycerol phosphate synthase subunit HisF
2124 NXCX01000009.1 GCA009378925_01814 CDS open 71875-72369 _na     164_aa ribE 6%2C7-dimethyl-8-ribityllumazine synthase
2125 NXCX01000009.1 GCA009378925_01815 CDS open 72475-73002 _na     175_aa nusB transcription antitermination factor NusB
2126 NXCX01000009.1 GCA009378925_01816 CDS open 73059-74033 _na     324_aa thiL thiamine-phosphate kinase
2127 NXCX01000009.1 GCA009378925_01817 CDS open 74167-74772 _na     201_aa pgpA Phosphatidylglycerophosphatase A
2128 NXCX01000009.1 GCA009378925_01818 CDS open 75154-75828 _na     224_aa Type III restriction system methylase
2129 NXCX01000009.1 GCA009378925_01819 CDS open 75830-76306 _na     158_aa DNA methyltransferase
2130 NXCX01000009.1 GCA009378925_01820 CDS open 76299-77408 _na     369_aa HNH endonuclease
2131 NXCX01000009.1 GCA009378925_01821 CDS open 77410-78642 _na     410_aa dcm DNA cytosine methyltransferase
2132 NXCX01000009.1 GCA009378925_01822 CDS open 78752-80482 _na     576_aa Restriction endonuclease
2133 NXCX01000009.1 GCA009378925_01823 CDS open 80651-81583 _na     310_aa hslO Heat-shock protein Hsp33
2134 NXCX01000009.1 GCA009378925_01824 CDS open 81774-83612 _na     612_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
2135 NXCX01000009.1 GCA009378925_01825 CDS open 83693-84763 _na     356_aa galE UDP-glucose 4-epimerase GalE
2136 NXCX01000009.1 GCA009378925_01826 CDS open 84952-85410 _na     152_aa surface-adhesin E family protein
2137 NXCX01000009.1 GCA009378925_01827 CDS open 85419-85931 _na     170_aa Lipoprotein
2138 NXCX01000009.1 GCA009378925_01828 CDS open 86422-86667 _na     81_aa hypothetical protein
2139 NXCX01000009.1 GCA009378925_01829 CDS open 87040-88308 _na     422_aa ugd UDP-glucose 6-dehydrogenase
2140 NXCX01000009.1 GCA009378925_01830 CDS open 88301-89929 _na     542_aa pgi glucose-6-phosphate isomerase
2141 NXCX01000009.1 GCA009378925_01831 CDS open 89962-90834 _na     290_aa galU UTP--glucose-1-phosphate uridylyltransferase
2142 NXCX01000009.1 GCA009378925_01832 CDS open 90902-93481 _na     859_aa plsB glycerol-3-phosphate 1-O-acyltransferase PlsB
2143 NXCX01000009.1 GCA009378925_01833 CDS open 93658-94629 _na     323_aa tesB Acyl-CoA thioesterase II
2144 NXCX01000009.1 GCA009378925_01834 CDS open 94828-95988 _na     386_aa DUF1615 domain-containing protein
2145 NXCX01000009.1 GCA009378925_01835 CDS open 96007-97116 _na     369_aa lptG LPS export ABC transporter permease LptG
2146 NXCX01000009.1 GCA009378925_01836 CDS open 97113-98276 _na     387_aa lptF LPS export ABC transporter permease LptF
2147 NXCX01000009.1 GCA009378925_01837 CDS open 98634-100145 _na     503_aa pepB leucyl aminopeptidase
2148 NXCX01000009.1 GCA009378925_01838 CDS open 100452-101648 _na     398_aa tyrB Aminotransferase
2149 NXCX01000009.1 GCA009378925_01839 CDS open 101769-102692 _na     307_aa lysR Cyn operon transcriptional activator
2150 NXCX01000009.1 GCA009378925_01840 CDS open 102892-103971 _na     359_aa chaA Calcium/proton antiporter
2151 NXCX01000009.1 GCA009378925_01841 CDS open 104074-105396 _na     440_aa mpfA Polyamine export protein
2152 NXCX01000009.1 GCA009378925_01842 CDS open 105500-106279 _na     259_aa fabG YciK family oxidoreductase
2153 NXCX01000009.1 GCA009378925_01843 CDS open 106414-107106 _na     230_aa gph Phosphoglycolate phosphatase%2C bacterial
2154 NXCX01000009.1 GCA009378925_01844 CDS open 107116-107928 _na     270_aa ubiG bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG
2155 NXCX01000009.1 GCA009378925_01845 CDS open 108272-108892 _na     206_aa frnE Thiol:disulfide interchange protein
2156 NXCX01000009.1 GCA009378925_01846 CDS open 109021-109524 _na     167_aa yjgA ribosome biogenesis factor YjgA
2157 NXCX01000009.1 GCA009378925_01847 CDS open 109567-110169 _na     200_aa hypothetical protein
2158 NXCX01000009.1 GCA009378925_01848 CDS open 110213-110539 _na     108_aa hsdS Type I restriction modification DNA specificity domain protein
2159 NXCX01000009.1 GCA009378925_01849 CDS open 110536-110832 _na     98_aa restriction endonuclease subunit S
2160 NXCX01000009.1 GCA009378925_01850 CDS open 110846-111733 _na     295_aa rapZ RNase adapter RapZ
2161 NXCX01000009.1 GCA009378925_01851 CDS open 111814-112656 _na     280_aa panC pantoate--beta-alanine ligase
2162 NXCX01000009.1 GCA009378925_01852 CDS open 112666-113508 _na     280_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
2163 NXCX01000009.1 GCA009378925_01853 CDS open 113655-114143 _na     162_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
2164 NXCX01000009.1 GCA009378925_01854 CDS open 114140-115939 _na     599_aa pcnB Poly(A) polymerase I
2165 NXCX01000009.1 GCA009378925_01855 CDS open 116118-116456 _na     112_aa comEA DNA uptake protein
2166 NXCX01000009.1 GCA009378925_01856 CDS open 116446-117285 _na     279_aa mazG nucleoside triphosphate pyrophosphohydrolase
2167 NXCX01000009.1 GCA009378925_01857 CDS open 117356-118285 _na     309_aa cysK cysteine synthase A
2168 NXCX01000009.1 GCA009378925_01858 CDS open 118791-120215 _na     474_aa manB phosphomannomutase
2169 NXCX01000009.1 GCA009378925_01859 CDS open 120284-121141 _na     285_aa hflK FtsH protease regulator HflK
2170 NXCX01000009.1 GCA009378925_01860 CDS open 121197-121646 _na     149_aa ybbJ NfeD-like C-terminal domain-containing protein
2171 NXCX01000009.1 GCA009378925_01861 CDS open 121700-122932 _na     410_aa cynX Cyanate permease
2172 NXCX01000009.1 GCA009378925_01862 CDS open 123080-124408 _na     442_aa fabF beta-ketoacyl-ACP synthase II
2173 NXCX01000009.1 GCA009378925_01863 CDS open 124578-125501 _na     307_aa xerD site-specific tyrosine recombinase XerD
2174 NXCX01000009.1 GCA009378925_01864 CDS open 125521-125760 _na     79_aa tusA sulfurtransferase TusA
2175 NXCX01000009.1 GCA009378925_01865 CDS open 125865-126332 _na     155_aa DUF3021 domain-containing protein
2176 NXCX01000009.1 GCA009378925_01866 CDS open 126350-126826 _na     158_aa ruvX Holliday junction resolvase RuvX
2177 NXCX01000009.1 GCA009378925_01867 CDS open 126826-127383 _na     185_aa algH UPF0301 protein AO384_1363
2178 NXCX01000009.1 GCA009378925_01868 CDS open 127380-129086 _na     568_aa recN DNA repair protein RecN
2179 NXCX01000009.1 GCA009378925_01869 CDS open 129171-129725 _na     184_aa def peptide deformylase
2180 NXCX01000009.1 GCA009378925_01870 CDS open 129949-130539 _na     196_aa hisB imidazoleglycerol-phosphate dehydratase HisB
2181 NXCX01000009.1 GCA009378925_01871 CDS open 130549-131175 _na     208_aa hisH imidazole glycerol phosphate synthase subunit HisH
2182 NXCX01000009.1 GCA009378925_01872 CDS open 131257-133146 _na     629_aa parE DNA topoisomerase IV subunit B
2183 NXCX01000009.1 GCA009378925_01873 CDS open 133344-133952 _na     202_aa ycfP Esterase
2184 NXCX01000009.1 GCA009378925_01874 CDS open 134124-134900 _na     258_aa hypothetical protein
2185 NXCX01000009.1 GCA009378925_01875 CDS open 135009-136076 _na     355_aa Permease of the major facilitator superfamily
2186 NXCX01000009.1 GCA009378925_01740 gene open 699-950 nuoI
2187 NXCX01000009.1 GCA009378925_01741 gene open 959-1453 coaD
2188 NXCX01000009.1 GCA009378925_01742 gene open 1614-2396 nfsA
2189 NXCX01000009.1 GCA009378925_01743 gene open 2677-3141 smpB
2190 NXCX01000009.1 GCA009378925_01744 gene open 3209-3826
2191 NXCX01000009.1 GCA009378925_01745 gene open 3862-4746 rhaT
2192 NXCX01000009.1 GCA009378925_01746 gene open 4749-6824 ligA
2193 NXCX01000009.1 GCA009378925_01747 gene open 7089-8111 pfoR
2194 NXCX01000009.1 GCA009378925_01748 gene open 8291-8938 upp
2195 NXCX01000009.1 GCA009378925_01749 gene open 9053-10045 ssuD
2196 NXCX01000009.1 GCA009378925_01750 gene open 10612-11313 serB
2197 NXCX01000009.1 GCA009378925_01751 gene open 11387-12382 potA
2198 NXCX01000009.1 GCA009378925_01752 gene open 12379-13224 potC
2199 NXCX01000009.1 GCA009378925_01753 gene open 13240-14157
2200 NXCX01000009.1 GCA009378925_01754 gene open 14154-14969 ataC
2201 NXCX01000009.1 GCA009378925_01755 gene open 15039-16145 afuA
2202 NXCX01000009.1 GCA009378925_01757 gene open 16998-18488 gppA
2203 NXCX01000009.1 GCA009378925_01758 gene open 18501-19550 phoR
2204 NXCX01000009.1 GCA009378925_01759 gene open 19547-20239 phoB
2205 NXCX01000009.1 GCA009378925_01760 gene open 20470-21309 pstB
2206 NXCX01000009.1 GCA009378925_01761 gene open 21378-22250 pstA
2207 NXCX01000009.1 GCA009378925_01762 gene open 22261-23223 pstC
2208 NXCX01000009.1 GCA009378925_01763 gene open 23331-24470 pstS
2209 NXCX01000009.1 GCA009378925_01764 gene open 24819-25646 bepA
2210 NXCX01000009.1 GCA009378925_01765 gene open 25679-25999 bolA
2211 NXCX01000009.1 GCA009378925_01766 gene open 26440-28149 sUL1
2212 NXCX01000009.1 GCA009378925_01767 gene open 28288-28614
2213 NXCX01000009.1 GCA009378925_01768 gene open 28663-29391 rluA
2214 NXCX01000009.1 GCA009378925_01769 gene open 29589-29909 trxA
2215 NXCX01000009.1 GCA009378925_01770 gene open 30143-31411 rho
2216 NXCX01000009.1 GCA009378925_01771 gene open 31778-32131
2217 NXCX01000009.1 GCA009378925_01772 gene open 32300-32713 osmC
2218 NXCX01000009.1 GCA009378925_01773 gene open 32890-34416 ttdA
2219 NXCX01000009.1 GCA009378925_01774 gene open 34605-35702 hisC
2220 NXCX01000009.1 GCA009378925_01775 gene open 35791-37098 hisD
2221 NXCX01000009.1 GCA009378925_01776 gene open 37297-37953 hisG
2222 NXCX01000009.1 GCA009378925_01777 gene open 38032-39294 murA
2223 NXCX01000009.1 GCA009378925_01778 gene open 39310-39570 ibaG
2224 NXCX01000009.1 GCA009378925_01779 gene open 39686-40447 osmY
2225 NXCX01000009.1 GCA009378925_01780 gene open 40532-40945 yraN
2226 NXCX01000009.1 GCA009378925_01781 gene open 40945-41439 yckC
2227 NXCX01000009.1 GCA009378925_01782 gene open 41614-42096 rlmH
2228 NXCX01000009.1 GCA009378925_01783 gene open 42226-44313 pnp
2229 NXCX01000009.1 GCA009378925_01784 gene open 44408-44617
2230 NXCX01000009.1 GCA009378925_01785 gene open 44526-44792 rpsO
2231 NXCX01000009.1 GCA009378925_01786 gene open 45010-45654 lomR
2232 NXCX01000009.1 GCA009378925_01787 gene open 45766-46701 truB
2233 NXCX01000009.1 GCA009378925_01788 gene open 46698-47123 rbfA
2234 NXCX01000009.1 GCA009378925_01789 gene open 47699-48547 ysnF
2235 NXCX01000009.1 GCA009378925_01790 gene open 48727-49233 ysnF
2236 NXCX01000009.1 GCA009378925_01791 gene open 49474-52212 infB
2237 NXCX01000009.1 GCA009378925_01792 gene open 52368-53849 nusA
2238 NXCX01000009.1 GCA009378925_01793 gene open 53949-54446 rimP
2239 NXCX01000009.1 GCA009378925_01796 gene open 55084-55386 secG
2240 NXCX01000009.1 GCA009378925_01797 gene open 55425-56177 tpiA
2241 NXCX01000009.1 GCA009378925_01798 gene open 56371-57468 mraY
2242 NXCX01000009.1 GCA009378925_01799 gene open 57486-58970 murF
2243 NXCX01000009.1 GCA009378925_01800 gene open 58992-60554 murE
2244 NXCX01000009.1 GCA009378925_01801 gene open 60590-62548 ftsI
2245 NXCX01000009.1 GCA009378925_01802 gene open 62552-62902 ftsL
2246 NXCX01000009.1 GCA009378925_01803 gene open 62933-63925 rsmH
2247 NXCX01000009.1 GCA009378925_01804 gene open 64213-65709 gltX
2248 NXCX01000009.1 GCA009378925_01807 gene open 66251-66925
2249 NXCX01000009.1 GCA009378925_01808 gene open 67015-67911
2250 NXCX01000009.1 GCA009378925_01809 gene open 67908-68792 yafJ
2251 NXCX01000009.1 GCA009378925_01810 gene open 68800-69165
2252 NXCX01000009.1 GCA009378925_01811 gene open 69170-69637
2253 NXCX01000009.1 GCA009378925_01812 gene open 69634-70632 srkA
2254 NXCX01000009.1 GCA009378925_01813 gene open 70938-71711 hisF
2255 NXCX01000009.1 GCA009378925_01814 gene open 71875-72369 ribE
2256 NXCX01000009.1 GCA009378925_01815 gene open 72475-73002 nusB
2257 NXCX01000009.1 GCA009378925_01816 gene open 73059-74033 thiL
2258 NXCX01000009.1 GCA009378925_01817 gene open 74167-74772 pgpA
2259 NXCX01000009.1 GCA009378925_01818 gene open 75154-75828
2260 NXCX01000009.1 GCA009378925_01819 gene open 75830-76306
2261 NXCX01000009.1 GCA009378925_01820 gene open 76299-77408
2262 NXCX01000009.1 GCA009378925_01821 gene open 77410-78642 dcm
2263 NXCX01000009.1 GCA009378925_01822 gene open 78752-80482
2264 NXCX01000009.1 GCA009378925_01823 gene open 80651-81583 hslO
2265 NXCX01000009.1 GCA009378925_01824 gene open 81774-83612 glmS
2266 NXCX01000009.1 GCA009378925_01825 gene open 83693-84763 galE
2267 NXCX01000009.1 GCA009378925_01826 gene open 84952-85410
2268 NXCX01000009.1 GCA009378925_01827 gene open 85419-85931
2269 NXCX01000009.1 GCA009378925_01828 gene open 86422-86667
2270 NXCX01000009.1 GCA009378925_01829 gene open 87040-88308 ugd
2271 NXCX01000009.1 GCA009378925_01830 gene open 88301-89929 pgi
2272 NXCX01000009.1 GCA009378925_01831 gene open 89962-90834 galU
2273 NXCX01000009.1 GCA009378925_01832 gene open 90902-93481 plsB
2274 NXCX01000009.1 GCA009378925_01833 gene open 93658-94629 tesB
2275 NXCX01000009.1 GCA009378925_01834 gene open 94828-95988
2276 NXCX01000009.1 GCA009378925_01835 gene open 96007-97116 lptG
2277 NXCX01000009.1 GCA009378925_01836 gene open 97113-98276 lptF
2278 NXCX01000009.1 GCA009378925_01837 gene open 98634-100145 pepB
2279 NXCX01000009.1 GCA009378925_01838 gene open 100452-101648 tyrB
2280 NXCX01000009.1 GCA009378925_01839 gene open 101769-102692 lysR
2281 NXCX01000009.1 GCA009378925_01840 gene open 102892-103971 chaA
2282 NXCX01000009.1 GCA009378925_01841 gene open 104074-105396 mpfA
2283 NXCX01000009.1 GCA009378925_01842 gene open 105500-106279 fabG
2284 NXCX01000009.1 GCA009378925_01843 gene open 106414-107106 gph
2285 NXCX01000009.1 GCA009378925_01844 gene open 107116-107928 ubiG
2286 NXCX01000009.1 GCA009378925_01845 gene open 108272-108892 frnE
2287 NXCX01000009.1 GCA009378925_01846 gene open 109021-109524 yjgA
2288 NXCX01000009.1 GCA009378925_01847 gene open 109567-110169
2289 NXCX01000009.1 GCA009378925_01848 gene open 110213-110539 hsdS
2290 NXCX01000009.1 GCA009378925_01849 gene open 110536-110832
2291 NXCX01000009.1 GCA009378925_01850 gene open 110846-111733 rapZ
2292 NXCX01000009.1 GCA009378925_01851 gene open 111814-112656 panC
2293 NXCX01000009.1 GCA009378925_01852 gene open 112666-113508 panB
2294 NXCX01000009.1 GCA009378925_01853 gene open 113655-114143 folK
2295 NXCX01000009.1 GCA009378925_01854 gene open 114140-115939 pcnB
2296 NXCX01000009.1 GCA009378925_01855 gene open 116118-116456 comEA
2297 NXCX01000009.1 GCA009378925_01856 gene open 116446-117285 mazG
2298 NXCX01000009.1 GCA009378925_01857 gene open 117356-118285 cysK
2299 NXCX01000009.1 GCA009378925_01858 gene open 118791-120215 manB
2300 NXCX01000009.1 GCA009378925_01859 gene open 120284-121141 hflK
2301 NXCX01000009.1 GCA009378925_01860 gene open 121197-121646 ybbJ
2302 NXCX01000009.1 GCA009378925_01861 gene open 121700-122932 cynX
2303 NXCX01000009.1 GCA009378925_01862 gene open 123080-124408 fabF
2304 NXCX01000009.1 GCA009378925_01863 gene open 124578-125501 xerD
2305 NXCX01000009.1 GCA009378925_01864 gene open 125521-125760 tusA
2306 NXCX01000009.1 GCA009378925_01865 gene open 125865-126332
2307 NXCX01000009.1 GCA009378925_01866 gene open 126350-126826 ruvX
2308 NXCX01000009.1 GCA009378925_01867 gene open 126826-127383 algH
2309 NXCX01000009.1 GCA009378925_01868 gene open 127380-129086 recN
2310 NXCX01000009.1 GCA009378925_01869 gene open 129171-129725 def
2311 NXCX01000009.1 GCA009378925_01870 gene open 129949-130539 hisB
2312 NXCX01000009.1 GCA009378925_01871 gene open 130549-131175 hisH
2313 NXCX01000009.1 GCA009378925_01872 gene open 131257-133146 parE
2314 NXCX01000009.1 GCA009378925_01873 gene open 133344-133952 ycfP
2315 NXCX01000009.1 GCA009378925_01874 gene open 134124-134900
2316 NXCX01000009.1 GCA009378925_01875 gene open 135009-136076
2317 NXCX01000009.1 GCA009378925_01738 gene open 130-206 trnM
2318 NXCX01000009.1 GCA009378925_01756 gene open 16774-16849 trnG
2319 NXCX01000009.1 GCA009378925_01794 gene open 54698-54774 trnfM
2320 NXCX01000009.1 GCA009378925_01795 gene open 54948-55032 trnL
2321 NXCX01000009.1 GCA009378925_01805 gene open 65870-65945 trnA
2322 NXCX01000009.1 GCA009378925_01806 gene open 66067-66142 trnE
2323 NXCX01000009.1 GCA009378925_01738 tRNA open 130-206 trnM tRNA-Met(cat)
2324 NXCX01000009.1 GCA009378925_01756 tRNA open 16774-16849 trnG tRNA-Gly(gcc)
2325 NXCX01000009.1 GCA009378925_01794 tRNA open 54698-54774 trnfM tRNA-fMet(cat)
2326 NXCX01000009.1 GCA009378925_01795 tRNA open 54948-55032 trnL tRNA-Leu(gag)
2327 NXCX01000009.1 GCA009378925_01805 tRNA open 65870-65945 trnA tRNA-Ala(ggc)
2328 NXCX01000009.1 GCA009378925_01806 tRNA open 66067-66142 trnE tRNA-Glu(ttc)
2329 NXCX01000010.1 rep_origin open 70340-70938
2330 NXCX01000010.1 repeat_region open 40359-40576 CRISPR array with 4 repeats of length 28%2C consensus sequence CTTCACGACCGCACAGGTCGCTTAGAAA and spacer length 32
2331 NXCX01000010.1 repeat_region open 41954-43550 CRISPR array with 27 repeats of length 28%2C consensus sequence CTTCACGACCGCACAGGTCGCTTAGAAA and spacer length 31
2332 NXCX01000010.1 GCA009378925_00082 CDS open 144-2510 _na     788_aa tex Transcription accessory protein S1 RNA-binding domain
2333 NXCX01000010.1 GCA009378925_00083 CDS open 2758-3492 _na     244_aa ompR two-component system response regulator OmpR
2334 NXCX01000010.1 GCA009378925_00084 CDS open 3558-4562 _na     334_aa yejR Cobalamin biosynthesis protein P47K
2335 NXCX01000010.1 GCA009378925_00085 CDS open 4653-5864 _na     403_aa sstT serine/threonine transporter SstT
2336 NXCX01000010.1 GCA009378925_00086 CDS open 5914-6207 _na     97_aa SHOCT domain-containing protein
2337 NXCX01000010.1 GCA009378925_00087 CDS open 6545-7441 _na     298_aa rluA Pseudouridylate synthase
2338 NXCX01000010.1 GCA009378925_00088 CDS open 7441-7767 _na     108_aa dksA Conjugal transfer protein TraR
2339 NXCX01000010.1 GCA009378925_00089 CDS open 8221-8814 _na     197_aa yIH1 YigZ family protein
2340 NXCX01000010.1 GCA009378925_00090 CDS open 8983-9687 _na     234_aa rsuA Pseudouridine synthase
2341 NXCX01000010.1 GCA009378925_00091 CDS open 9701-10702 _na     333_aa dsbG Thiol:disulfide interchange protein
2342 NXCX01000010.1 GCA009378925_00092 CDS open 10945-12096 _na     383_aa dnaJ molecular chaperone DnaJ
2343 NXCX01000010.1 GCA009378925_00093 CDS open 12258-13205 _na     315_aa yfeH Sodium-dependent transporter
2344 NXCX01000010.1 GCA009378925_00094 CDS open 13223-14416 _na     397_aa metC Cystathionine beta-lyase
2345 NXCX01000010.1 GCA009378925_00095 CDS open 14461-15258 _na     265_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
2346 NXCX01000010.1 GCA009378925_00096 CDS open 15318-16298 _na     326_aa yheT Hydrolase%2C alpha/beta fold family functionally coupled to Phosphoribulokinase
2347 NXCX01000010.1 GCA009378925_00097 CDS open 16383-17222 _na     279_aa dnaJ DnaJ-class molecular chaperone CbpA
2348 NXCX01000010.1 GCA009378925_00098 CDS open 17230-19179 _na     649_aa abc-f ribosomal protection-like ABC-F family protein
2349 NXCX01000010.1 GCA009378925_00099 CDS open 19398-19943 _na     181_aa yciW Carboxymuconolactone decarboxylase-like domain-containing protein
2350 NXCX01000010.1 GCA009378925_00100 CDS open 20200-21372 _na     390_aa caiA Butyryl-CoA dehydrogenase
2351 NXCX01000010.1 GCA009378925_00101 CDS open 21369-22757 _na     462_aa norV Rubredoxin-NAD+ reductase
2352 NXCX01000010.1 GCA009378925_00102 CDS open 22840-24255 _na     471_aa tauA Cyanate ABC transporter%2C substrate binding protein
2353 NXCX01000010.1 GCA009378925_00103 CDS open 24245-25129 _na     294_aa ntrB nitrate ABC transporter permease
2354 NXCX01000010.1 GCA009378925_00104 CDS open 25119-25979 _na     286_aa tauB Cyanate ABC transporter%2C ATP-binding protein
2355 NXCX01000010.1 GCA009378925_00105 CDS open 26126-26458 _na     110_aa erpA iron-sulfur cluster insertion protein ErpA
2356 NXCX01000010.1 GCA009378925_00106 CDS open 26608-28158 _na     516_aa gshA glutamate--cysteine ligase
2357 NXCX01000010.1 GCA009378925_00107 CDS open 28264-28773 _na     169_aa dsbB Disulfide bond formation protein B
2358 NXCX01000010.1 GCA009378925_00108 CDS open 28865-30247 _na     460_aa mpl UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase
2359 NXCX01000010.1 GCA009378925_00109 CDS open 30566-31042 _na     158_aa fadM Thioesterase-like superfamily protein
2360 NXCX01000010.1 GCA009378925_00110 CDS open 31116-31406 _na     96_aa yggX oxidative damage protection protein
2361 NXCX01000010.1 GCA009378925_00111 CDS open 31584-32174 _na     196_aa cas6f type I-F CRISPR-associated endoribonuclease Cas6/Csy4
2362 NXCX01000010.1 GCA009378925_00112 CDS open 32174-33178 _na     334_aa csy3 type I-F CRISPR-associated protein Csy3
2363 NXCX01000010.1 GCA009378925_00113 CDS open 33213-34148 _na     311_aa csy2 type I-F CRISPR-associated protein Csy2
2364 NXCX01000010.1 GCA009378925_00114 CDS open 34145-35515 _na     456_aa csy1 type I-F CRISPR-associated protein Csy1
2365 NXCX01000010.1 GCA009378925_00115 CDS open 35683-39096 _na     1137_aa cas3f type I-F CRISPR-associated helicase Cas3f
2366 NXCX01000010.1 GCA009378925_00116 CDS open 39098-40048 _na     316_aa cas1f type I-F CRISPR-associated endonuclease Cas1f
2367 NXCX01000010.1 GCA009378925_00117 CDS open 44377-46284 _na     635_aa dnaK molecular chaperone DnaK
2368 NXCX01000010.1 GCA009378925_00118 CDS open 46438-46695 _na     85_aa nqrM (Na+)-NQR maturation NqrM
2369 NXCX01000010.1 GCA009378925_00119 CDS open 46761-47633 _na     290_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
2370 NXCX01000010.1 GCA009378925_00120 CDS open 47705-48460 _na     251_aa hemD Uroporphyrinogen-III synthase
2371 NXCX01000010.1 GCA009378925_00121 CDS open 48460-49425 _na     321_aa hemC hydroxymethylbilane synthase
2372 NXCX01000010.1 GCA009378925_00122 CDS open 49649-51049 _na     466_aa argH argininosuccinate lyase
2373 NXCX01000010.1 GCA009378925_00123 CDS open 51231-53072 _na     613_aa mdlB ABC transporter%2C ATP-binding protein
2374 NXCX01000010.1 GCA009378925_00124 CDS open 53186-55057 _na     623_aa thiC phosphomethylpyrimidine synthase ThiC
2375 NXCX01000010.1 GCA009378925_00125 CDS open 55400-56656 _na     418_aa dadA D-amino acid dehydrogenase
2376 NXCX01000010.1 GCA009378925_00126 CDS open 56665-57021 _na     118_aa ridA Aminoacrylate peracid reductase
2377 NXCX01000010.1 GCA009378925_00127 CDS open 57059-57940 _na     293_aa aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme
2378 NXCX01000010.1 GCA009378925_00128 CDS open 58377-59552 _na     391_aa lysA Ornithine decarboxylase
2379 NXCX01000010.1 GCA009378925_00129 CDS open 59694-60053 _na     119_aa fkpA Peptidyl-prolyl cis-trans isomerase
2380 NXCX01000010.1 GCA009378925_00130 CDS open 60067-60561 _na     164_aa rlpA RlpA-like protein double-psi beta-barrel domain-containing protein
2381 NXCX01000010.1 GCA009378925_00131 CDS open 60830-62047 _na     405_aa Esterase-like activity of phytase family protein
2382 NXCX01000010.1 GCA009378925_00132 CDS open 62200-63759 _na     519_aa guaA glutamine-hydrolyzing GMP synthase
2383 NXCX01000010.1 GCA009378925_00133 CDS open 63933-66392 _na     819_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
2384 NXCX01000010.1 GCA009378925_00134 CDS open 66530-67738 _na     402_aa recF DNA replication/repair protein RecF
2385 NXCX01000010.1 GCA009378925_00135 CDS open 67742-68899 _na     385_aa dnaN DNA polymerase III subunit beta
2386 NXCX01000010.1 GCA009378925_00136 CDS open 68936-70339 _na     467_aa dnaA chromosomal replication initiator protein DnaA
2387 NXCX01000010.1 GCA009378925_00137 CDS open 70939-71073 _na     44_aa rpmH 50S ribosomal protein L34
2388 NXCX01000010.1 GCA009378925_00138 CDS open 71185-71598 _na     137_aa rnpA ribonuclease P protein component
2389 NXCX01000010.1 GCA009378925_00139 CDS open 71616-71936 _na     106_aa yidD membrane protein insertion efficiency factor YidD
2390 NXCX01000010.1 GCA009378925_00140 CDS open 72105-73748 _na     547_aa yidC membrane protein insertase YidC
2391 NXCX01000010.1 GCA009378925_00141 CDS open 73915-75315 _na     466_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
2392 NXCX01000010.1 GCA009378925_00142 CDS open 75419-75889 _na     156_aa nrdR transcriptional regulator NrdR
2393 NXCX01000010.1 GCA009378925_00143 CDS open 75886-76938 _na     350_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
2394 NXCX01000010.1 GCA009378925_00082 gene open 144-2510 tex
2395 NXCX01000010.1 GCA009378925_00083 gene open 2758-3492 ompR
2396 NXCX01000010.1 GCA009378925_00084 gene open 3558-4562 yejR
2397 NXCX01000010.1 GCA009378925_00085 gene open 4653-5864 sstT
2398 NXCX01000010.1 GCA009378925_00086 gene open 5914-6207
2399 NXCX01000010.1 GCA009378925_00087 gene open 6545-7441 rluA
2400 NXCX01000010.1 GCA009378925_00088 gene open 7441-7767 dksA
2401 NXCX01000010.1 GCA009378925_00089 gene open 8221-8814 yIH1
2402 NXCX01000010.1 GCA009378925_00090 gene open 8983-9687 rsuA
2403 NXCX01000010.1 GCA009378925_00091 gene open 9701-10702 dsbG
2404 NXCX01000010.1 GCA009378925_00092 gene open 10945-12096 dnaJ
2405 NXCX01000010.1 GCA009378925_00093 gene open 12258-13205 yfeH
2406 NXCX01000010.1 GCA009378925_00094 gene open 13223-14416 metC
2407 NXCX01000010.1 GCA009378925_00095 gene open 14461-15258 dapB
2408 NXCX01000010.1 GCA009378925_00096 gene open 15318-16298 yheT
2409 NXCX01000010.1 GCA009378925_00097 gene open 16383-17222 dnaJ
2410 NXCX01000010.1 GCA009378925_00098 gene open 17230-19179 abc-f
2411 NXCX01000010.1 GCA009378925_00099 gene open 19398-19943 yciW
2412 NXCX01000010.1 GCA009378925_00100 gene open 20200-21372 caiA
2413 NXCX01000010.1 GCA009378925_00101 gene open 21369-22757 norV
2414 NXCX01000010.1 GCA009378925_00102 gene open 22840-24255 tauA
2415 NXCX01000010.1 GCA009378925_00103 gene open 24245-25129 ntrB
2416 NXCX01000010.1 GCA009378925_00104 gene open 25119-25979 tauB
2417 NXCX01000010.1 GCA009378925_00105 gene open 26126-26458 erpA
2418 NXCX01000010.1 GCA009378925_00106 gene open 26608-28158 gshA
2419 NXCX01000010.1 GCA009378925_00107 gene open 28264-28773 dsbB
2420 NXCX01000010.1 GCA009378925_00108 gene open 28865-30247 mpl
2421 NXCX01000010.1 GCA009378925_00109 gene open 30566-31042 fadM
2422 NXCX01000010.1 GCA009378925_00110 gene open 31116-31406 yggX
2423 NXCX01000010.1 GCA009378925_00111 gene open 31584-32174 cas6f
2424 NXCX01000010.1 GCA009378925_00112 gene open 32174-33178 csy3
2425 NXCX01000010.1 GCA009378925_00113 gene open 33213-34148 csy2
2426 NXCX01000010.1 GCA009378925_00114 gene open 34145-35515 csy1
2427 NXCX01000010.1 GCA009378925_00115 gene open 35683-39096 cas3f
2428 NXCX01000010.1 GCA009378925_00116 gene open 39098-40048 cas1f
2429 NXCX01000010.1 GCA009378925_00117 gene open 44377-46284 dnaK
2430 NXCX01000010.1 GCA009378925_00118 gene open 46438-46695 nqrM
2431 NXCX01000010.1 GCA009378925_00119 gene open 46761-47633 rlmB
2432 NXCX01000010.1 GCA009378925_00120 gene open 47705-48460 hemD
2433 NXCX01000010.1 GCA009378925_00121 gene open 48460-49425 hemC
2434 NXCX01000010.1 GCA009378925_00122 gene open 49649-51049 argH
2435 NXCX01000010.1 GCA009378925_00123 gene open 51231-53072 mdlB
2436 NXCX01000010.1 GCA009378925_00124 gene open 53186-55057 thiC
2437 NXCX01000010.1 GCA009378925_00125 gene open 55400-56656 dadA
2438 NXCX01000010.1 GCA009378925_00126 gene open 56665-57021 ridA
2439 NXCX01000010.1 GCA009378925_00127 gene open 57059-57940
2440 NXCX01000010.1 GCA009378925_00128 gene open 58377-59552 lysA
2441 NXCX01000010.1 GCA009378925_00129 gene open 59694-60053 fkpA
2442 NXCX01000010.1 GCA009378925_00130 gene open 60067-60561 rlpA
2443 NXCX01000010.1 GCA009378925_00131 gene open 60830-62047
2444 NXCX01000010.1 GCA009378925_00132 gene open 62200-63759 guaA
2445 NXCX01000010.1 GCA009378925_00133 gene open 63933-66392 gyrB
2446 NXCX01000010.1 GCA009378925_00134 gene open 66530-67738 recF
2447 NXCX01000010.1 GCA009378925_00135 gene open 67742-68899 dnaN
2448 NXCX01000010.1 GCA009378925_00136 gene open 68936-70339 dnaA
2449 NXCX01000010.1 GCA009378925_00137 gene open 70939-71073 rpmH
2450 NXCX01000010.1 GCA009378925_00138 gene open 71185-71598 rnpA
2451 NXCX01000010.1 GCA009378925_00139 gene open 71616-71936 yidD
2452 NXCX01000010.1 GCA009378925_00140 gene open 72105-73748 yidC
2453 NXCX01000010.1 GCA009378925_00141 gene open 73915-75315 mnmE
2454 NXCX01000010.1 GCA009378925_00142 gene open 75419-75889 nrdR
2455 NXCX01000010.1 GCA009378925_00143 gene open 75886-76938 ribD
2456 NXCX01000011.1 GCA009378925_00408 gene open 278928-279119 6S
2457 NXCX01000011.1 GCA009378925_00408 ncRNA open 278928-279119 6S / SsrS RNA
2458 NXCX01000011.1 GCA009378925_00144 CDS open 628-822 _na     64_aa cof Hydrolase
2459 NXCX01000011.1 GCA009378925_00145 CDS open 812-1438 _na     208_aa dedA Alkaline phosphatase
2460 NXCX01000011.1 GCA009378925_00146 CDS open 1859-2527 _na     222_aa ftsQ Cell division protein FtsQ
2461 NXCX01000011.1 GCA009378925_00147 CDS open 2596-3894 _na     432_aa ftsA cell division protein FtsA
2462 NXCX01000011.1 GCA009378925_00148 CDS open 4084-5217 _na     377_aa ftsZ cell division protein FtsZ
2463 NXCX01000011.1 GCA009378925_00149 CDS open 5305-6207 _na     300_aa yciV Phosphatase
2464 NXCX01000011.1 GCA009378925_00150 CDS open 6237-7169 _na     310_aa recX Regulatory protein RecX
2465 NXCX01000011.1 GCA009378925_00151 CDS open 7179-8228 _na     349_aa recA recombinase RecA
2466 NXCX01000011.1 GCA009378925_00152 CDS open 8405-8635 _na     76_aa hypothetical protein
2467 NXCX01000011.1 GCA009378925_00153 CDS open 9084-10502 _na     472_aa glcD D-lactate dehydrogenase (cytochrome)
2468 NXCX01000011.1 GCA009378925_00154 CDS open 10486-11028 _na     180_aa fimT Type II secretion system protein H
2469 NXCX01000011.1 GCA009378925_00155 CDS open 11110-12159 _na     349_aa 5'-nucleotidase
2470 NXCX01000011.1 GCA009378925_00156 CDS open 12156-12287 _na     43_aa hypothetical protein
2471 NXCX01000011.1 GCA009378925_00157 CDS open 12271-13110 _na     279_aa tatD Hydrolase
2472 NXCX01000011.1 GCA009378925_00158 CDS open 13103-13888 _na     261_aa tcdA tRNA threonylcarbamoyladenosine dehydratase
2473 NXCX01000011.1 GCA009378925_00159 CDS open 14105-14926 _na     273_aa dapD 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-succinyltransferase
2474 NXCX01000011.1 GCA009378925_00160 CDS open 15075-16013 _na     312_aa pldB Lysophospholipase
2475 NXCX01000011.1 GCA009378925_00161 CDS open 16173-17237 _na     354_aa lipA lipoyl synthase
2476 NXCX01000011.1 GCA009378925_00162 CDS open 17792-18733 _na     313_aa hemH ferrochelatase
2477 NXCX01000011.1 GCA009378925_00163 CDS open 19032-19337 _na     101_aa hypothetical protein
2478 NXCX01000011.1 GCA009378925_00164 CDS open 19334-20140 _na     268_aa Bacterial archaeo-eukaryotic release factor family 3
2479 NXCX01000011.1 GCA009378925_00165 CDS open 20324-22549 _na     741_aa icdM NADP-dependent isocitrate dehydrogenase
2480 NXCX01000011.1 GCA009378925_00166 CDS open 22935-23981 _na     348_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
2481 NXCX01000011.1 GCA009378925_00167 CDS open 24322-26256 _na     644_aa Ubiquitous surface protein A2
2482 NXCX01000011.1 GCA009378925_00168 CDS open 26402-27289 _na     295_aa lysR HTH-type transcriptional regulator MetR
2483 NXCX01000011.1 GCA009378925_00169 CDS open 27553-28113 _na     186_aa dedA DedA family protein
2484 NXCX01000011.1 GCA009378925_00170 CDS open 28254-28622 _na     122_aa bamE Outer membrane protein assembly factor BamE
2485 NXCX01000011.1 GCA009378925_00171 CDS open 28856-29296 _na     146_aa fur ferric iron uptake transcriptional regulator
2486 NXCX01000011.1 GCA009378925_00172 CDS open 29476-30525 _na     349_aa pilT Type IV pilus retraction ATPase PilT
2487 NXCX01000011.1 GCA009378925_00173 CDS open 30814-31524 _na     236_aa yggS Pyridoxal phosphate homeostasis protein
2488 NXCX01000011.1 GCA009378925_00174 CDS open 31578-33269 _na     563_aa nit1 NAD+ synthase
2489 NXCX01000011.1 GCA009378925_00175 CDS open 33518-33793 _na     91_aa yajC Preprotein translocase subunit YajC
2490 NXCX01000011.1 GCA009378925_00176 CDS open 33855-34202 _na     115_aa zapA Z ring-associated protein ZapA
2491 NXCX01000011.1 GCA009378925_00177 CDS open 34238-34597 _na     119_aa hypothetical protein
2492 NXCX01000011.1 GCA009378925_00178 CDS open 34892-35530 _na     212_aa ygfB YecA family protein
2493 NXCX01000011.1 GCA009378925_00179 CDS open 35545-36516 _na     323_aa ribF riboflavin biosynthesis protein RibF
2494 NXCX01000011.1 GCA009378925_00180 CDS open 36631-37461 _na     276_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
2495 NXCX01000011.1 GCA009378925_00181 CDS open 37580-38518 _na     312_aa DUF2628 domain-containing protein
2496 NXCX01000011.1 GCA009378925_00182 CDS open 38568-39296 _na     242_aa Conserved membrane protein
2497 NXCX01000011.1 GCA009378925_00183 CDS open 39315-41603 _na     762_aa priA primosomal protein N'
2498 NXCX01000011.1 GCA009378925_00184 CDS open 41614-42519 _na     301_aa efeB Putative iron-dependent peroxidase%2C Dyp-type family
2499 NXCX01000011.1 GCA009378925_00185 CDS open 42734-43114 _na     126_aa ridA Reactive intermediate/imine deaminase
2500 NXCX01000011.1 GCA009378925_00186 CDS open 43143-43322 _na     59_aa hypothetical protein