BAKTAGenome Explorer: Lentilactobacillus buchneri (GCA_009495475.1)
Select a Genome:
|
BAKTA Annotations for GCA_009495475.1
|
Search & Sort all 4938 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | VFBO01000002.1 | GCA009495475_00001 | CDS | open | 885-1703 | _na 272_aa | acm | Lysozyme |
| 2 | VFBO01000002.1 | GCA009495475_00002 | CDS | open | 1696-2232 | _na 178_aa | Phage holin%2C LL-H family | |
| 3 | VFBO01000002.1 | GCA009495475_00003 | CDS | open | 2245-2535 | _na 96_aa | Mobilization protein | |
| 4 | VFBO01000002.1 | GCA009495475_00004 | CDS | open | 2871-4478 | _na 535_aa | Lower baseplate protein N-terminal domain-containing protein | |
| 5 | VFBO01000002.1 | GCA009495475_00005 | CDS | open | 4493-5059 | _na 188_aa | hypothetical protein | |
| 6 | VFBO01000002.1 | GCA009495475_00006 | CDS | open | 5071-6312 | _na 413_aa | jayE | Baseplate protein J-like domain-containing protein |
| 7 | VFBO01000002.1 | GCA009495475_00007 | CDS | open | 6302-6685 | _na 127_aa | DUF2634 domain-containing protein | |
| 8 | VFBO01000002.1 | GCA009495475_00008 | CDS | open | 6686-7108 | _na 140_aa | hypothetical protein | |
| 9 | VFBO01000002.1 | GCA009495475_00009 | CDS | open | 7109-8143 | _na 344_aa | MucBP domain-containing protein | |
| 10 | VFBO01000002.1 | GCA009495475_00010 | CDS | open | 8140-8553 | _na 137_aa | Cyanophage baseplate Pam3 plug gp18 domain-containing protein | |
| 11 | VFBO01000002.1 | GCA009495475_00011 | CDS | open | 8608-9558 | _na 316_aa | lysM | LysM domain-containing protein |
| 12 | VFBO01000002.1 | GCA009495475_00012 | CDS | open | 9571-15021 | _na 1816_aa | Phage tail tape measure protein domain-containing protein | |
| 13 | VFBO01000002.1 | GCA009495475_00013 | CDS | open | 15040-15177 | _na 45_aa | hypothetical protein | |
| 14 | VFBO01000002.1 | GCA009495475_00014 | CDS | open | 15263-15640 | _na 125_aa | hypothetical protein | |
| 15 | VFBO01000002.1 | GCA009495475_00015 | CDS | open | 15710-16147 | _na 145_aa | Bacteriophage KPP10%2C Structural protein ORF10 | |
| 16 | VFBO01000002.1 | GCA009495475_00016 | CDS | open | 16235-17371 | _na 378_aa | DUF3383 domain-containing protein | |
| 17 | VFBO01000002.1 | GCA009495475_00017 | CDS | open | 17383-17916 | _na 177_aa | Phage protein | |
| 18 | VFBO01000002.1 | GCA009495475_00018 | CDS | open | 17894-18277 | _na 127_aa | Minor capsid protein | |
| 19 | VFBO01000002.1 | GCA009495475_00019 | CDS | open | 18277-18906 | _na 209_aa | Morphogenesis protein | |
| 20 | VFBO01000002.1 | GCA009495475_00020 | CDS | open | 18903-19310 | _na 135_aa | DUF4054 domain-containing protein | |
| 21 | VFBO01000002.1 | GCA009495475_00021 | CDS | open | 19329-20213 | _na 294_aa | DUF2184 domain-containing protein | |
| 22 | VFBO01000002.1 | GCA009495475_00022 | CDS | open | 20273-21265 | _na 330_aa | yjdB | Fibronectin type-III domain-containing protein |
| 23 | VFBO01000002.1 | GCA009495475_00023 | CDS | open | 21339-21818 | _na 159_aa | Structural cement protein (E217 gp24/Pam3 gp6) | |
| 24 | VFBO01000002.1 | GCA009495475_00024 | CDS | open | 21834-22979 | _na 381_aa | DUF2213 domain-containing protein | |
| 25 | VFBO01000002.1 | GCA009495475_00025 | CDS | open | 22982-23227 | _na 81_aa | lysM | LysM domain protein |
| 26 | VFBO01000002.1 | GCA009495475_00026 | CDS | open | 23317-24129 | _na 270_aa | Phage head morphogenesis domain-containing protein | |
| 27 | VFBO01000002.1 | GCA009495475_00027 | CDS | open | 24134-25477 | _na 447_aa | DUF1073 domain-containing protein | |
| 28 | VFBO01000002.1 | GCA009495475_00028 | CDS | open | 25491-26927 | _na 478_aa | Terminase large subunit gp17-like C-terminal domain-containing protein | |
| 29 | VFBO01000002.1 | GCA009495475_00029 | CDS | open | 26917-27360 | _na 147_aa | Terminase small subunit | |
| 30 | VFBO01000002.1 | GCA009495475_00030 | CDS | open | 27415-27732 | _na 105_aa | hypothetical protein | |
| 31 | VFBO01000002.1 | GCA009495475_00031 | CDS | open | 27729-27899 | _na 56_aa | hypothetical protein | |
| 32 | VFBO01000002.1 | GCA009495475_00032 | CDS | open | 28031-28162 | _na 43_aa | 30S ribosomal protein S20 | |
| 33 | VFBO01000002.1 | GCA009495475_00033 | CDS | open | 28244-28519 | _na 91_aa | hypothetical protein | |
| 34 | VFBO01000002.1 | GCA009495475_00034 | CDS | open | 29263-29727 | _na 154_aa | arpU | Phage transcriptional regulator%2C ArpU family |
| 35 | VFBO01000002.1 | GCA009495475_00035 | CDS | open | 29828-30097 | _na 89_aa | Phage protein | |
| 36 | VFBO01000002.1 | GCA009495475_00036 | CDS | open | 30094-30525 | _na 143_aa | yopX | YopX protein domain-containing protein |
| 37 | VFBO01000002.1 | GCA009495475_00037 | CDS | open | 30522-30953 | _na 143_aa | Helix-turn-helix domain-containing protein | |
| 38 | VFBO01000002.1 | GCA009495475_00038 | CDS | open | 31117-31464 | _na 115_aa | yopX | YopX protein domain-containing protein |
| 39 | VFBO01000002.1 | GCA009495475_00039 | CDS | open | 31504-32106 | _na 200_aa | HNH nuclease domain-containing protein | |
| 40 | VFBO01000002.1 | GCA009495475_00040 | CDS | open | 32118-32576 | _na 152_aa | DUF1064 domain-containing protein | |
| 41 | VFBO01000002.1 | GCA009495475_00041 | CDS | open | 32569-33351 | _na 260_aa | HNH nuclease domain-containing protein | |
| 42 | VFBO01000002.1 | GCA009495475_00042 | CDS | open | 33348-34046 | _na 232_aa | Putative HNHc nuclease | |
| 43 | VFBO01000002.1 | GCA009495475_00043 | CDS | open | 34105-34521 | _na 138_aa | ssb | Single-stranded DNA-binding protein |
| 44 | VFBO01000002.1 | GCA009495475_00044 | CDS | open | 34535-34930 | _na 131_aa | Phage protein | |
| 45 | VFBO01000002.1 | GCA009495475_00045 | CDS | open | 34905-36185 | _na 426_aa | dnaB | Replicative DNA helicase |
| 46 | VFBO01000002.1 | GCA009495475_00046 | CDS | open | 36175-37062 | _na 295_aa | Helix-turn-helix domain-containing protein | |
| 47 | VFBO01000002.1 | GCA009495475_00047 | CDS | open | 37076-37795 | _na 239_aa | Single-stranded DNA-binding protein | |
| 48 | VFBO01000002.1 | GCA009495475_00048 | CDS | open | 37782-38297 | _na 171_aa | Bacteriophage Mu Gam like protein | |
| 49 | VFBO01000002.1 | GCA009495475_00049 | CDS | open | 38300-38485 | _na 61_aa | hypothetical protein | |
| 50 | VFBO01000002.1 | GCA009495475_00050 | CDS | open | 38482-38625 | _na 47_aa | hypothetical protein | |
| 51 | VFBO01000002.1 | GCA009495475_00051 | CDS | open | 38618-38773 | _na 51_aa | hypothetical protein | |
| 52 | VFBO01000002.1 | GCA009495475_00052 | CDS | open | 38779-38961 | _na 60_aa | hypothetical protein | |
| 53 | VFBO01000002.1 | GCA009495475_00053 | CDS | open | 38978-39187 | _na 69_aa | Helix-turn-helix domain protein | |
| 54 | VFBO01000002.1 | GCA009495475_00054 | CDS | open | 39191-39697 | _na 168_aa | HTH cro/C1-type domain-containing protein | |
| 55 | VFBO01000002.1 | GCA009495475_00055 | CDS | open | 39775-40512 | _na 245_aa | kilAC | Toxin-antitoxin system%2C toxin component%2C Bro family |
| 56 | VFBO01000002.1 | GCA009495475_00056 | CDS | open | 40564-40773 | _na 69_aa | hipB | HTH cro/C1-type domain-containing protein |
| 57 | VFBO01000002.1 | GCA009495475_00057 | CDS | open | 40912-41145 | _na 77_aa | hipB | HTH cro/C1-type domain-containing protein |
| 58 | VFBO01000002.1 | GCA009495475_00058 | CDS | open | 41161-41451 | _na 96_aa | Bacteriocin immunity protein | |
| 59 | VFBO01000002.1 | GCA009495475_00059 | CDS | open | 41455-41640 | _na 61_aa | hypothetical protein | |
| 60 | VFBO01000002.1 | GCA009495475_00060 | CDS | open | 41731-41985 | _na 84_aa | hypothetical protein | |
| 61 | VFBO01000002.1 | GCA009495475_00061 | CDS | open | 41924-42103 | _na 59_aa | hypothetical protein | |
| 62 | VFBO01000002.1 | GCA009495475_00062 | CDS | open | 42103-42297 | _na 64_aa | hypothetical protein | |
| 63 | VFBO01000002.1 | GCA009495475_00063 | CDS | open | 42294-42539 | _na 81_aa | xRE | HTH cro/C1-type domain-containing protein |
| 64 | VFBO01000002.1 | GCA009495475_00064 | CDS | open | 42685-43065 | _na 126_aa | hipB | HTH cro/C1-type domain-containing protein |
| 65 | VFBO01000002.1 | GCA009495475_00065 | CDS | open | 43160-43474 | _na 104_aa | immA | IrrE N-terminal-like domain-containing protein |
| 66 | VFBO01000002.1 | GCA009495475_00066 | CDS | open | 43504-43974 | _na 156_aa | Phage head morphogenesis domain-containing protein | |
| 67 | VFBO01000002.1 | GCA009495475_00067 | CDS | open | 43993-44565 | _na 190_aa | hypothetical protein | |
| 68 | VFBO01000002.1 | GCA009495475_00068 | CDS | open | 44582-44833 | _na 83_aa | yvbJ | Zinc-ribbon domain-containing protein |
| 69 | VFBO01000002.1 | GCA009495475_00069 | CDS | open | 44857-45201 | _na 114_aa | D-alanyl-D-alanine carboxypeptidase | |
| 70 | VFBO01000002.1 | GCA009495475_00070 | CDS | open | 45221-45493 | _na 90_aa | hypothetical protein | |
| 71 | VFBO01000002.1 | GCA009495475_00071 | CDS | open | 45564-46727 | _na 387_aa | xerD | Tyr recombinase domain-containing protein |
| 72 | VFBO01000002.1 | GCA009495475_00001 | gene | open | 885-1703 | acm | ||
| 73 | VFBO01000002.1 | GCA009495475_00002 | gene | open | 1696-2232 | |||
| 74 | VFBO01000002.1 | GCA009495475_00003 | gene | open | 2245-2535 | |||
| 75 | VFBO01000002.1 | GCA009495475_00004 | gene | open | 2871-4478 | |||
| 76 | VFBO01000002.1 | GCA009495475_00005 | gene | open | 4493-5059 | |||
| 77 | VFBO01000002.1 | GCA009495475_00006 | gene | open | 5071-6312 | jayE | ||
| 78 | VFBO01000002.1 | GCA009495475_00007 | gene | open | 6302-6685 | |||
| 79 | VFBO01000002.1 | GCA009495475_00008 | gene | open | 6686-7108 | |||
| 80 | VFBO01000002.1 | GCA009495475_00009 | gene | open | 7109-8143 | |||
| 81 | VFBO01000002.1 | GCA009495475_00010 | gene | open | 8140-8553 | |||
| 82 | VFBO01000002.1 | GCA009495475_00011 | gene | open | 8608-9558 | lysM | ||
| 83 | VFBO01000002.1 | GCA009495475_00012 | gene | open | 9571-15021 | |||
| 84 | VFBO01000002.1 | GCA009495475_00013 | gene | open | 15040-15177 | |||
| 85 | VFBO01000002.1 | GCA009495475_00014 | gene | open | 15263-15640 | |||
| 86 | VFBO01000002.1 | GCA009495475_00015 | gene | open | 15710-16147 | |||
| 87 | VFBO01000002.1 | GCA009495475_00016 | gene | open | 16235-17371 | |||
| 88 | VFBO01000002.1 | GCA009495475_00017 | gene | open | 17383-17916 | |||
| 89 | VFBO01000002.1 | GCA009495475_00018 | gene | open | 17894-18277 | |||
| 90 | VFBO01000002.1 | GCA009495475_00019 | gene | open | 18277-18906 | |||
| 91 | VFBO01000002.1 | GCA009495475_00020 | gene | open | 18903-19310 | |||
| 92 | VFBO01000002.1 | GCA009495475_00021 | gene | open | 19329-20213 | |||
| 93 | VFBO01000002.1 | GCA009495475_00022 | gene | open | 20273-21265 | yjdB | ||
| 94 | VFBO01000002.1 | GCA009495475_00023 | gene | open | 21339-21818 | |||
| 95 | VFBO01000002.1 | GCA009495475_00024 | gene | open | 21834-22979 | |||
| 96 | VFBO01000002.1 | GCA009495475_00025 | gene | open | 22982-23227 | lysM | ||
| 97 | VFBO01000002.1 | GCA009495475_00026 | gene | open | 23317-24129 | |||
| 98 | VFBO01000002.1 | GCA009495475_00027 | gene | open | 24134-25477 | |||
| 99 | VFBO01000002.1 | GCA009495475_00028 | gene | open | 25491-26927 | |||
| 100 | VFBO01000002.1 | GCA009495475_00029 | gene | open | 26917-27360 | |||
| 101 | VFBO01000002.1 | GCA009495475_00030 | gene | open | 27415-27732 | |||
| 102 | VFBO01000002.1 | GCA009495475_00031 | gene | open | 27729-27899 | |||
| 103 | VFBO01000002.1 | GCA009495475_00032 | gene | open | 28031-28162 | |||
| 104 | VFBO01000002.1 | GCA009495475_00033 | gene | open | 28244-28519 | |||
| 105 | VFBO01000002.1 | GCA009495475_00034 | gene | open | 29263-29727 | arpU | ||
| 106 | VFBO01000002.1 | GCA009495475_00035 | gene | open | 29828-30097 | |||
| 107 | VFBO01000002.1 | GCA009495475_00036 | gene | open | 30094-30525 | yopX | ||
| 108 | VFBO01000002.1 | GCA009495475_00037 | gene | open | 30522-30953 | |||
| 109 | VFBO01000002.1 | GCA009495475_00038 | gene | open | 31117-31464 | yopX | ||
| 110 | VFBO01000002.1 | GCA009495475_00039 | gene | open | 31504-32106 | |||
| 111 | VFBO01000002.1 | GCA009495475_00040 | gene | open | 32118-32576 | |||
| 112 | VFBO01000002.1 | GCA009495475_00041 | gene | open | 32569-33351 | |||
| 113 | VFBO01000002.1 | GCA009495475_00042 | gene | open | 33348-34046 | |||
| 114 | VFBO01000002.1 | GCA009495475_00043 | gene | open | 34105-34521 | ssb | ||
| 115 | VFBO01000002.1 | GCA009495475_00044 | gene | open | 34535-34930 | |||
| 116 | VFBO01000002.1 | GCA009495475_00045 | gene | open | 34905-36185 | dnaB | ||
| 117 | VFBO01000002.1 | GCA009495475_00046 | gene | open | 36175-37062 | |||
| 118 | VFBO01000002.1 | GCA009495475_00047 | gene | open | 37076-37795 | |||
| 119 | VFBO01000002.1 | GCA009495475_00048 | gene | open | 37782-38297 | |||
| 120 | VFBO01000002.1 | GCA009495475_00049 | gene | open | 38300-38485 | |||
| 121 | VFBO01000002.1 | GCA009495475_00050 | gene | open | 38482-38625 | |||
| 122 | VFBO01000002.1 | GCA009495475_00051 | gene | open | 38618-38773 | |||
| 123 | VFBO01000002.1 | GCA009495475_00052 | gene | open | 38779-38961 | |||
| 124 | VFBO01000002.1 | GCA009495475_00053 | gene | open | 38978-39187 | |||
| 125 | VFBO01000002.1 | GCA009495475_00054 | gene | open | 39191-39697 | |||
| 126 | VFBO01000002.1 | GCA009495475_00055 | gene | open | 39775-40512 | kilAC | ||
| 127 | VFBO01000002.1 | GCA009495475_00056 | gene | open | 40564-40773 | hipB | ||
| 128 | VFBO01000002.1 | GCA009495475_00057 | gene | open | 40912-41145 | hipB | ||
| 129 | VFBO01000002.1 | GCA009495475_00058 | gene | open | 41161-41451 | |||
| 130 | VFBO01000002.1 | GCA009495475_00059 | gene | open | 41455-41640 | |||
| 131 | VFBO01000002.1 | GCA009495475_00060 | gene | open | 41731-41985 | |||
| 132 | VFBO01000002.1 | GCA009495475_00061 | gene | open | 41924-42103 | |||
| 133 | VFBO01000002.1 | GCA009495475_00062 | gene | open | 42103-42297 | |||
| 134 | VFBO01000002.1 | GCA009495475_00063 | gene | open | 42294-42539 | xRE | ||
| 135 | VFBO01000002.1 | GCA009495475_00064 | gene | open | 42685-43065 | hipB | ||
| 136 | VFBO01000002.1 | GCA009495475_00065 | gene | open | 43160-43474 | immA | ||
| 137 | VFBO01000002.1 | GCA009495475_00066 | gene | open | 43504-43974 | |||
| 138 | VFBO01000002.1 | GCA009495475_00067 | gene | open | 43993-44565 | |||
| 139 | VFBO01000002.1 | GCA009495475_00068 | gene | open | 44582-44833 | yvbJ | ||
| 140 | VFBO01000002.1 | GCA009495475_00069 | gene | open | 44857-45201 | |||
| 141 | VFBO01000002.1 | GCA009495475_00070 | gene | open | 45221-45493 | |||
| 142 | VFBO01000002.1 | GCA009495475_00071 | gene | open | 45564-46727 | xerD | ||
| 143 | VFBO01000003.1 | GCA009495475_00873 | gene | open | 781200-781563 | ssrA | ||
| 144 | VFBO01000003.1 | GCA009495475_00873 | tmRNA | open | 781200-781563 | ssrA | transfer-messenger RNA%2C SsrA | |
| 145 | VFBO01000003.1 | rep_origin | open | 2340295-2340795 | ||||
| 146 | VFBO01000003.1 | rep_origin | open | 2342149-2342337 | ||||
| 147 | VFBO01000003.1 | GCA009495475_00665 | gene | open | 596938-597054 | rrf | ||
| 148 | VFBO01000003.1 | GCA009495475_00798 | gene | open | 715835-715951 | rrf | ||
| 149 | VFBO01000003.1 | GCA009495475_01114 | gene | open | 1023682-1024054 | RNaseP_bact_b | ||
| 150 | VFBO01000003.1 | GCA009495475_01393 | gene | open | 1301085-1301171 | Bacteria_small_SRP | ||
| 151 | VFBO01000003.1 | GCA009495475_01514 | gene | open | 1406375-1406491 | rrf | ||
| 152 | VFBO01000003.1 | GCA009495475_01584 | gene | open | 1483215-1484667 | rrs | ||
| 153 | VFBO01000003.1 | GCA009495475_01585 | gene | open | 1483325-1483441 | rrf | ||
| 154 | VFBO01000003.1 | GCA009495475_02100 | gene | open | 2048780-2048902 | Ref68 | ||
| 155 | VFBO01000003.1 | GCA009495475_02150 | gene | open | 2109018-2109134 | rrf | ||
| 156 | VFBO01000003.1 | GCA009495475_02151 | gene | open | 2109211-2112131 | rrl | ||
| 157 | VFBO01000003.1 | GCA009495475_02152 | gene | open | 2112354-2113928 | rrs | ||
| 158 | VFBO01000003.1 | GCA009495475_02186 | gene | open | 2153944-2154033 | ratA | ||
| 159 | VFBO01000003.1 | GCA009495475_02228 | gene | open | 2195006-2195191 | rli28 | ||
| 160 | VFBO01000003.1 | GCA009495475_01114 | ncRNA | open | 1023682-1024054 | Bacterial RNase P class B | ||
| 161 | VFBO01000003.1 | GCA009495475_01393 | ncRNA | open | 1301085-1301171 | Bacterial small signal recognition particle RNA | ||
| 162 | VFBO01000003.1 | GCA009495475_02100 | ncRNA | open | 2048780-2048902 | Enterococcus sRNA 68 (Lacto-3 RNA) | ||
| 163 | VFBO01000003.1 | GCA009495475_02186 | ncRNA | open | 2153944-2154033 | ratA | RNA anti-toxin A | |
| 164 | VFBO01000003.1 | GCA009495475_02228 | ncRNA | open | 2195006-2195191 | Listeria sRNA rli28 | ||
| 165 | VFBO01000003.1 | regulatory_region | open | 91671-91912 | T-box leader | |||
| 166 | VFBO01000003.1 | regulatory_region | open | 112804-113033 | T-box leader | |||
| 167 | VFBO01000003.1 | regulatory_region | open | 150698-150797 | TPP riboswitch aptamer (THI element) | |||
| 168 | VFBO01000003.1 | regulatory_region | open | 186698-186804 | PyrR binding site | |||
| 169 | VFBO01000003.1 | regulatory_region | open | 478761-478851 | TPP riboswitch aptamer (THI element) | |||
| 170 | VFBO01000003.1 | regulatory_region | open | 543216-543589 | cspA thermoregulator | |||
| 171 | VFBO01000003.1 | regulatory_region | open | 580231-580484 | T-box leader | |||
| 172 | VFBO01000003.1 | regulatory_region | open | 645500-645754 | T-box leader | |||
| 173 | VFBO01000003.1 | regulatory_region | open | 728822-729058 | T-box leader | |||
| 174 | VFBO01000003.1 | regulatory_region | open | 835535-835743 | T-box leader | |||
| 175 | VFBO01000003.1 | regulatory_region | open | 977613-977734 | FMN riboswitch aptamer (RFN element) | |||
| 176 | VFBO01000003.1 | regulatory_region | open | 1038006-1038120 | THF (Tetrahydrofolate) riboswitch aptamer | |||
| 177 | VFBO01000003.1 | regulatory_region | open | 1097552-1097634 | Ribosomal protein L21 leader | |||
| 178 | VFBO01000003.1 | regulatory_region | open | 1121649-1121865 | T-box leader | |||
| 179 | VFBO01000003.1 | regulatory_region | open | 1139104-1139241 | Ribosomal protein L20 leader | |||
| 180 | VFBO01000003.1 | regulatory_region | open | 1207415-1207616 | T-box leader | |||
| 181 | VFBO01000003.1 | regulatory_region | open | 1212236-1212319 | SAM-III riboswitch aptamer (SMK box) | |||
| 182 | VFBO01000003.1 | regulatory_region | open | 1314915-1315033 | Ribosomal protein L10 leader | |||
| 183 | VFBO01000003.1 | regulatory_region | open | 1561590-1561647 | Ribosomal protein L13 leader | |||
| 184 | VFBO01000003.1 | regulatory_region | open | 1579085-1579191 | S10-Clostridia ribosomal protein leader | |||
| 185 | VFBO01000003.1 | regulatory_region | open | 1600723-1600894 | Lysine riboswitch aptamer | |||
| 186 | VFBO01000003.1 | regulatory_region | open | 1806966-1807209 | T-box leader | |||
| 187 | VFBO01000003.1 | regulatory_region | open | 1808385-1808628 | T-box leader | |||
| 188 | VFBO01000003.1 | regulatory_region | open | 1858424-1858513 | TPP riboswitch aptamer (THI element) | |||
| 189 | VFBO01000003.1 | regulatory_region | open | 1893773-1893954 | Lysine riboswitch aptamer | |||
| 190 | VFBO01000003.1 | regulatory_region | open | 1952206-1952621 | cspA thermoregulator | |||
| 191 | VFBO01000003.1 | regulatory_region | open | 2069082-2069266 | Cobalamin riboswitch aptamer | |||
| 192 | VFBO01000003.1 | regulatory_region | open | 2099635-2099727 | TPP riboswitch aptamer (THI element) | |||
| 193 | VFBO01000003.1 | regulatory_region | open | 2106803-2106968 | M-box riboswitch aptamer (ykoK leader) | |||
| 194 | VFBO01000003.1 | regulatory_region | open | 2237503-2237601 | TPP riboswitch aptamer (THI element) | |||
| 195 | VFBO01000003.1 | regulatory_region | open | 2296701-2296950 | T-box leader | |||
| 196 | VFBO01000003.1 | regulatory_region | open | 2322228-2322320 | TPP riboswitch aptamer (THI element) | |||
| 197 | VFBO01000003.1 | GCA009495475_00665 | rRNA | open | 596938-597054 | rrf | 5S ribosomal RNA | |
| 198 | VFBO01000003.1 | GCA009495475_00798 | rRNA | open | 715835-715951 | rrf | 5S ribosomal RNA | |
| 199 | VFBO01000003.1 | GCA009495475_01514 | rRNA | open | 1406375-1406491 | rrf | 5S ribosomal RNA | |
| 200 | VFBO01000003.1 | GCA009495475_01584 | rRNA | open | 1483215-1484667 | rrs | 16S ribosomal RNA | |
| 201 | VFBO01000003.1 | GCA009495475_01585 | rRNA | open | 1483325-1483441 | rrf | 5S ribosomal RNA | |
| 202 | VFBO01000003.1 | GCA009495475_02150 | rRNA | open | 2109018-2109134 | rrf | 5S ribosomal RNA | |
| 203 | VFBO01000003.1 | GCA009495475_02151 | rRNA | open | 2109211-2112131 | rrl | 23S ribosomal RNA | |
| 204 | VFBO01000003.1 | GCA009495475_02152 | rRNA | open | 2112354-2113928 | rrs | 16S ribosomal RNA | |
| 205 | VFBO01000003.1 | repeat_region | open | 1750546-1750854 | CRISPR array with 5 repeats of length 36%2C consensus sequence GGGTTTAACCTTATTGATTTAACATCCTTCTAAAAC and spacer length 30 | |||
| 206 | VFBO01000003.1 | repeat_region | open | 1750940-1751119 | CRISPR array with 3 repeats of length 39%2C consensus sequence TGGGGTTTAACCTTATTGATTTAACATCCTTCTAAAACA and spacer length 28 | |||
| 207 | VFBO01000003.1 | GCA009495475_00099 | CDS | open | 231-749 | _na 172_aa | ECF transporter S component | |
| 208 | VFBO01000003.1 | GCA009495475_00100 | CDS | open | 1135-2682 | _na 515_aa | yfcC | YfcC family protein |
| 209 | VFBO01000003.1 | GCA009495475_00101 | CDS | open | 2833-3249 | _na 138_aa | yhfA | OsmC family protein |
| 210 | VFBO01000003.1 | GCA009495475_00102 | CDS | open | 3260-4891 | _na 543_aa | oppA | Solute-binding protein family 5 domain-containing protein |
| 211 | VFBO01000003.1 | GCA009495475_00103 | CDS | open | 5104-6771 | _na 555_aa | amyA | Oligo-1%2C6-glucosidase |
| 212 | VFBO01000003.1 | GCA009495475_00104 | CDS | open | 6796-8187 | _na 463_aa | melB | MFS transporter |
| 213 | VFBO01000003.1 | GCA009495475_00105 | CDS | open | 8580-9566 | _na 328_aa | purR | HTH lacI-type domain-containing protein |
| 214 | VFBO01000003.1 | GCA009495475_00106 | CDS | open | 9807-10274 | _na 155_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 215 | VFBO01000003.1 | GCA009495475_00107 | CDS | open | 10538-11632 | _na 364_aa | frmA | Enoyl reductase (ER) domain-containing protein |
| 216 | VFBO01000003.1 | GCA009495475_00108 | CDS | open | 11702-11947 | _na 81_aa | Lactococcin 972 family bacteriocin | |
| 217 | VFBO01000003.1 | GCA009495475_00109 | CDS | open | 12055-12642 | _na 195_aa | udg4 | Uracil-DNA glycosylase-like domain-containing protein |
| 218 | VFBO01000003.1 | GCA009495475_00110 | CDS | open | 12775-13209 | _na 144_aa | arsC | arsenate reductase (thioredoxin) |
| 219 | VFBO01000003.1 | GCA009495475_00111 | CDS | open | 13642-15042 | _na 466_aa | ansP | Amino acid permease/ SLC12A domain-containing protein |
| 220 | VFBO01000003.1 | GCA009495475_00112 | CDS | open | 15107-16036 | _na 309_aa | uRH1 | Pyrimidine-specific ribonucleoside hydrolase RihB |
| 221 | VFBO01000003.1 | GCA009495475_00113 | CDS | open | 16126-17085 | _na 319_aa | fadB | L-gulonate 3-dehydrogenase |
| 222 | VFBO01000003.1 | GCA009495475_00114 | CDS | open | 17240-17362 | _na 40_aa | hypothetical protein | |
| 223 | VFBO01000003.1 | GCA009495475_00115 | CDS | open | 17927-18457 | _na 176_aa | Acid-resistance membrane protein | |
| 224 | VFBO01000003.1 | GCA009495475_00116 | CDS | open | 18534-19283 | _na 249_aa | sfsA | DNA/RNA nuclease SfsA |
| 225 | VFBO01000003.1 | GCA009495475_00117 | CDS | open | 19464-20111 | _na 215_aa | ugpQ | Glycerophosphodiester phosphodiesterase |
| 226 | VFBO01000003.1 | GCA009495475_00118 | CDS | open | 20267-22198 | _na 643_aa | Peptidase S53 domain-containing protein | |
| 227 | VFBO01000003.1 | GCA009495475_00119 | CDS | open | 22282-22491 | _na 69_aa | yozG | Cro/CI transcriptional regulator |
| 228 | VFBO01000003.1 | GCA009495475_00120 | CDS | open | 22658-23086 | _na 142_aa | Integral membrane protein | |
| 229 | VFBO01000003.1 | GCA009495475_00121 | CDS | open | 23430-24518 | _na 362_aa | malK | Glycerol-3-phosphate-transporting ATPase |
| 230 | VFBO01000003.1 | GCA009495475_00122 | CDS | open | 24511-25473 | _na 320_aa | ugpA | ABC transmembrane type-1 domain-containing protein |
| 231 | VFBO01000003.1 | GCA009495475_00123 | CDS | open | 25473-26303 | _na 276_aa | ugpE | ABC transmembrane type-1 domain-containing protein |
| 232 | VFBO01000003.1 | GCA009495475_00124 | CDS | open | 26303-27664 | _na 453_aa | ugpB | Glycerol-3-phosphate ABC transporter substrate-binding protein |
| 233 | VFBO01000003.1 | GCA009495475_00125 | CDS | open | 27754-28449 | _na 231_aa | ugpQ | Glycerophosphodiester phosphodiesterase |
| 234 | VFBO01000003.1 | GCA009495475_00126 | CDS | open | 28505-30151 | _na 548_aa | oppA | Solute-binding protein family 5 domain-containing protein |
| 235 | VFBO01000003.1 | GCA009495475_00127 | CDS | open | 30444-31307 | _na 287_aa | aRA1 | 2%2C5-didehydrogluconate reductase |
| 236 | VFBO01000003.1 | GCA009495475_00128 | CDS | open | 31352-31657 | _na 101_aa | hypothetical protein | |
| 237 | VFBO01000003.1 | GCA009495475_00129 | CDS | open | 31837-32811 | _na 324_aa | hemH | ferrochelatase |
| 238 | VFBO01000003.1 | GCA009495475_00130 | CDS | open | 32789-34117 | _na 442_aa | mntH | Nramp family divalent metal transporter |
| 239 | VFBO01000003.1 | GCA009495475_00131 | CDS | open | 34159-34920 | _na 253_aa | wrbA | Putative NAD(P)H-dependent FMN-containing oxidoreductase YwqN |
| 240 | VFBO01000003.1 | GCA009495475_00132 | CDS | open | 35103-36482 | _na 459_aa | hypothetical protein | |
| 241 | VFBO01000003.1 | GCA009495475_00133 | CDS | open | 36851-38650 | _na 599_aa | ddpA | ABC transporter periplasmic protein |
| 242 | VFBO01000003.1 | GCA009495475_00134 | CDS | open | 38871-39689 | _na 272_aa | ydiL | CPBP family intramembrane metalloprotease |
| 243 | VFBO01000003.1 | GCA009495475_00135 | CDS | open | 39686-40114 | _na 142_aa | soxR | HTH merR-type domain-containing protein |
| 244 | VFBO01000003.1 | GCA009495475_00136 | CDS | open | 40201-41205 | _na 334_aa | pdxI | NADP-dependent oxidoreductase domain-containing protein |
| 245 | VFBO01000003.1 | GCA009495475_00137 | CDS | open | 41350-41745 | _na 131_aa | hypothetical protein | |
| 246 | VFBO01000003.1 | GCA009495475_00138 | CDS | open | 41977-42711 | _na 244_aa | tauE | putative membrane transporter protein |
| 247 | VFBO01000003.1 | GCA009495475_00139 | CDS | open | 42881-43609 | _na 242_aa | soxR | HTH merR-type domain-containing protein |
| 248 | VFBO01000003.1 | GCA009495475_00140 | CDS | open | 43696-44613 | _na 305_aa | Anti-sigma factor | |
| 249 | VFBO01000003.1 | GCA009495475_00141 | CDS | open | 44613-45095 | _na 160_aa | rpoE | RNA polymerase sigma factor 70 region 4 type 2 domain-containing protein |
| 250 | VFBO01000003.1 | GCA009495475_00142 | CDS | open | 45204-46061 | _na 285_aa | fN3K | Fructosamine-3-kinase |
| 251 | VFBO01000003.1 | GCA009495475_00143 | CDS | open | 46199-47392 | _na 397_aa | fadH | NADH:flavin oxidoreductase/NADH oxidase N-terminal domain-containing protein |
| 252 | VFBO01000003.1 | GCA009495475_00144 | CDS | open | 47417-48799 | _na 460_aa | sdhA | flavocytochrome c |
| 253 | VFBO01000003.1 | GCA009495475_00145 | CDS | open | 48890-49798 | _na 302_aa | pdxI | NADP-dependent oxidoreductase domain-containing protein |
| 254 | VFBO01000003.1 | GCA009495475_00146 | CDS | open | 49894-50373 | _na 159_aa | dps | Ferritin/DPS protein domain-containing protein |
| 255 | VFBO01000003.1 | GCA009495475_00147 | CDS | open | 50474-51814 | _na 446_aa | araJ | Putative proline/betaine transporter |
| 256 | VFBO01000003.1 | GCA009495475_00148 | CDS | open | 52015-52695 | _na 226_aa | yigB | YjjG family noncanonical pyrimidine nucleotidase |
| 257 | VFBO01000003.1 | GCA009495475_00149 | CDS | open | 52853-53563 | _na 236_aa | budA | acetolactate decarboxylase |
| 258 | VFBO01000003.1 | GCA009495475_00150 | CDS | open | 53980-55365 | _na 461_aa | proP | Putative metabolite transport protein CsbC |
| 259 | VFBO01000003.1 | GCA009495475_00151 | CDS | open | 55511-56197 | _na 228_aa | yajL | DJ-1/PfpI domain-containing protein |
| 260 | VFBO01000003.1 | GCA009495475_00152 | CDS | open | 56407-57318 | _na 303_aa | rbbA | ABC transporter domain-containing protein |
| 261 | VFBO01000003.1 | GCA009495475_00153 | CDS | open | 57320-58096 | _na 258_aa | ABC transporter permease | |
| 262 | VFBO01000003.1 | GCA009495475_00154 | CDS | open | 58333-59478 | _na 381_aa | chb | Glycoside hydrolase family 20 catalytic domain-containing protein |
| 263 | VFBO01000003.1 | GCA009495475_00155 | CDS | open | 59493-60134 | _na 213_aa | Intercellular adhesion protein | |
| 264 | VFBO01000003.1 | GCA009495475_00156 | CDS | open | 60321-60707 | _na 128_aa | hypothetical protein | |
| 265 | VFBO01000003.1 | GCA009495475_00157 | CDS | open | 60710-61021 | _na 103_aa | hypothetical protein | |
| 266 | VFBO01000003.1 | GCA009495475_00158 | CDS | open | 61002-61892 | _na 296_aa | pgaB | Intercellular adhesion protein |
| 267 | VFBO01000003.1 | GCA009495475_00159 | CDS | open | 61940-62392 | _na 150_aa | DUF3290 domain-containing protein | |
| 268 | VFBO01000003.1 | GCA009495475_00160 | CDS | open | 62394-63032 | _na 212_aa | ycaP | DUF421 domain-containing protein |
| 269 | VFBO01000003.1 | GCA009495475_00161 | CDS | open | 63238-64413 | _na 391_aa | aspB | Aminotransferase |
| 270 | VFBO01000003.1 | GCA009495475_00162 | CDS | open | 64751-64963 | _na 70_aa | Transposase IS204/IS1001/IS1096/IS1165 DDE domain-containing protein | |
| 271 | VFBO01000003.1 | GCA009495475_00163 | CDS | open | 65031-65966 | _na 311_aa | araC | Bifunctional transcriptional activator/DNA repair enzyme AdaA |
| 272 | VFBO01000003.1 | GCA009495475_00164 | CDS | open | 66960-68306 | _na 448_aa | gdhA | NADP-specific glutamate dehydrogenase |
| 273 | VFBO01000003.1 | GCA009495475_00165 | CDS | open | 68604-70067 | _na 487_aa | hisJ | ABC transmembrane type-1 domain-containing protein |
| 274 | VFBO01000003.1 | GCA009495475_00166 | CDS | open | 70145-71401 | _na 418_aa | argE | Succinyl-diaminopimelate desuccinylase |
| 275 | VFBO01000003.1 | GCA009495475_00167 | CDS | open | 71408-72574 | _na 388_aa | abgB | Peptidase M20 dimerisation domain-containing protein |
| 276 | VFBO01000003.1 | GCA009495475_00168 | CDS | open | 72773-73324 | _na 183_aa | lemA | LemA family protein |
| 277 | VFBO01000003.1 | GCA009495475_00169 | CDS | open | 73341-74345 | _na 334_aa | htpX | Heat shock protein HtpX |
| 278 | VFBO01000003.1 | GCA009495475_00170 | CDS | open | 74423-76348 | _na 641_aa | zntA | P-type Cu(+) transporter |
| 279 | VFBO01000003.1 | GCA009495475_00171 | CDS | open | 76348-76620 | _na 90_aa | EfeO-type cupredoxin-like domain-containing protein | |
| 280 | VFBO01000003.1 | GCA009495475_00172 | CDS | open | 76636-77004 | _na 122_aa | EfeO-type cupredoxin-like domain-containing protein | |
| 281 | VFBO01000003.1 | GCA009495475_00173 | CDS | open | 77537-78538 | _na 333_aa | panE | 2-dehydropantoate 2-reductase |
| 282 | VFBO01000003.1 | GCA009495475_00174 | CDS | open | 78526-79368 | _na 280_aa | pheA2 | prephenate dehydratase |
| 283 | VFBO01000003.1 | GCA009495475_00175 | CDS | open | 79599-80546 | _na 315_aa | frsA | Alpha beta fold family hydrolase |
| 284 | VFBO01000003.1 | GCA009495475_00176 | CDS | open | 80781-82535 | _na 584_aa | spxB | pyruvate oxidase |
| 285 | VFBO01000003.1 | GCA009495475_00177 | CDS | open | 82896-83300 | _na 134_aa | Surface layer protein A domain-containing protein | |
| 286 | VFBO01000003.1 | GCA009495475_00178 | CDS | open | 83419-84165 | _na 248_aa | fabG | Short chain dehydrogenase |
| 287 | VFBO01000003.1 | GCA009495475_00179 | CDS | open | 84235-85428 | _na 397_aa | cdaR | PucR C-terminal helix-turn-helix domain-containing protein |
| 288 | VFBO01000003.1 | GCA009495475_00180 | CDS | open | 86712-87686 | _na 324_aa | ldhA | Putative glyoxylate reductase |
| 289 | VFBO01000003.1 | GCA009495475_00181 | CDS | open | 87879-88100 | _na 73_aa | hypothetical protein | |
| 290 | VFBO01000003.1 | GCA009495475_00182 | CDS | open | 88193-88387 | _na 64_aa | hypothetical protein | |
| 291 | VFBO01000003.1 | GCA009495475_00183 | CDS | open | 88401-88589 | _na 62_aa | Bacteriocin | |
| 292 | VFBO01000003.1 | GCA009495475_00184 | CDS | open | 88761-88892 | _na 43_aa | hypothetical protein | |
| 293 | VFBO01000003.1 | GCA009495475_00185 | CDS | open | 88896-91064 | _na 722_aa | sunT | Peptide cleavage/export ABC transporter |
| 294 | VFBO01000003.1 | GCA009495475_00186 | CDS | open | 91264-91488 | _na 74_aa | xRE | HTH cro/C1-type domain-containing protein |
| 295 | VFBO01000003.1 | GCA009495475_00187 | CDS | open | 92086-93489 | _na 467_aa | brnQ | branched-chain amino acid transport system II carrier protein |
| 296 | VFBO01000003.1 | GCA009495475_00188 | CDS | open | 93582-94199 | _na 205_aa | pncA | Isochorismatase |
| 297 | VFBO01000003.1 | GCA009495475_00189 | CDS | open | 94361-95071 | _na 236_aa | N-acetylmuramoyl-L-alanine amidase domain-containing protein | |
| 298 | VFBO01000003.1 | GCA009495475_00190 | CDS | open | 95166-96068 | _na 300_aa | znuA | ABC transporter substrate-binding protein |
| 299 | VFBO01000003.1 | GCA009495475_00191 | CDS | open | 96147-97289 | _na 380_aa | acm | Lysozyme |
| 300 | VFBO01000003.1 | GCA009495475_00192 | CDS | open | 97365-97562 | _na 65_aa | Integral membrane protein | |
| 301 | VFBO01000003.1 | GCA009495475_00193 | CDS | open | 97579-98529 | _na 316_aa | araC | HTH araC/xylS-type domain-containing protein |
| 302 | VFBO01000003.1 | GCA009495475_00194 | CDS | open | 98938-100356 | _na 472_aa | melB | Transporter%2C major facilitator family protein |
| 303 | VFBO01000003.1 | GCA009495475_00195 | CDS | open | 100396-102366 | _na 656_aa | hybA1 | Non-reducing end beta-L-arabinofuranosidase |
| 304 | VFBO01000003.1 | GCA009495475_00196 | CDS | open | 102744-103928 | _na 394_aa | araJ | Major facilitator superfamily (MFS) profile domain-containing protein |
| 305 | VFBO01000003.1 | GCA009495475_00197 | CDS | open | 104091-105098 | _na 335_aa | purR | HTH lacI-type domain-containing protein |
| 306 | VFBO01000003.1 | GCA009495475_00198 | CDS | open | 105689-107500 | _na 603_aa | uidA | beta-glucuronidase |
| 307 | VFBO01000003.1 | GCA009495475_00199 | CDS | open | 107595-110147 | _na 850_aa | xynC | Glycosyl hydrolase family 59 |
| 308 | VFBO01000003.1 | GCA009495475_00200 | CDS | open | 110193-110765 | _na 190_aa | ppnN | Cytokinin riboside 5'-monophosphate phosphoribohydrolase |
| 309 | VFBO01000003.1 | GCA009495475_00201 | CDS | open | 110890-111330 | _na 146_aa | yhbS | N-acetyltransferase domain-containing protein |
| 310 | VFBO01000003.1 | GCA009495475_00202 | CDS | open | 111355-112557 | _na 400_aa | cynX | Major facilitator superfamily (MFS) profile domain-containing protein |
| 311 | VFBO01000003.1 | GCA009495475_00203 | CDS | open | 113108-114727 | _na 539_aa | oppA | Solute-binding protein family 5 domain-containing protein |
| 312 | VFBO01000003.1 | GCA009495475_00204 | CDS | open | 114746-115468 | _na 240_aa | puuD | Putative glutamine amidotransferase |
| 313 | VFBO01000003.1 | GCA009495475_00205 | CDS | open | 115713-116627 | _na 304_aa | rhaT | EamA domain-containing protein |
| 314 | VFBO01000003.1 | GCA009495475_00206 | CDS | open | 116769-117038 | _na 89_aa | Glutamate--cysteine ligase | |
| 315 | VFBO01000003.1 | GCA009495475_00207 | CDS | open | 117087-118151 | _na 354_aa | Glutamate--cysteine ligase | |
| 316 | VFBO01000003.1 | GCA009495475_00208 | CDS | open | 118292-119614 | _na 440_aa | gshA | Glutamate--cysteine ligase |
| 317 | VFBO01000003.1 | GCA009495475_00209 | CDS | open | 120046-120684 | _na 212_aa | ybjT | NAD(P)-binding domain-containing protein |
| 318 | VFBO01000003.1 | GCA009495475_00210 | CDS | open | 120703-121569 | _na 288_aa | aRA1 | Methylglyoxal reductase |
| 319 | VFBO01000003.1 | GCA009495475_00211 | CDS | open | 121575-122012 | _na 145_aa | soxR | HTH merR-type domain-containing protein |
| 320 | VFBO01000003.1 | GCA009495475_00212 | CDS | open | 122172-123155 | _na 327_aa | yxeI | Choloylglycine hydrolase |
| 321 | VFBO01000003.1 | GCA009495475_00213 | CDS | open | 123269-124009 | _na 246_aa | puuD | Gamma-glutamyl-gamma-aminobutyrate hydrolase family protein |
| 322 | VFBO01000003.1 | GCA009495475_00214 | CDS | open | 124111-125487 | _na 458_aa | gshA | Glutamate--cysteine ligase |
| 323 | VFBO01000003.1 | GCA009495475_00215 | CDS | open | 125640-127391 | _na 583_aa | mdlB | Multidrug ABC superfamily ATP binding cassette transporter |
| 324 | VFBO01000003.1 | GCA009495475_00216 | CDS | open | 127391-129187 | _na 598_aa | mdlB | Multidrug ABC superfamily ATP binding cassette transporter |
| 325 | VFBO01000003.1 | GCA009495475_00217 | CDS | open | 129271-129705 | _na 144_aa | ibpA | Acid shock protein |
| 326 | VFBO01000003.1 | GCA009495475_00218 | CDS | open | 129868-130302 | _na 144_aa | ibpA | SHSP domain-containing protein |
| 327 | VFBO01000003.1 | GCA009495475_00219 | CDS | open | 130556-131257 | _na 233_aa | Peptidase M10 metallopeptidase domain-containing protein | |
| 328 | VFBO01000003.1 | GCA009495475_00220 | CDS | open | 131362-132066 | _na 234_aa | ccc1 | Integral membrane protein |
| 329 | VFBO01000003.1 | GCA009495475_00221 | CDS | open | 132099-132779 | _na 226_aa | ccc1 | VIT family protein |
| 330 | VFBO01000003.1 | GCA009495475_00222 | CDS | open | 132976-133725 | _na 249_aa | nfnB | Nitro/flavin reductase |
| 331 | VFBO01000003.1 | GCA009495475_00223 | CDS | open | 134072-134734 | _na 220_aa | hisM | ABC transmembrane type-1 domain-containing protein |
| 332 | VFBO01000003.1 | GCA009495475_00224 | CDS | open | 134715-135404 | _na 229_aa | hisM | ABC-type amino acid transport system%2C permease component |
| 333 | VFBO01000003.1 | GCA009495475_00225 | CDS | open | 135397-136137 | _na 246_aa | glnQ | ABC transporter domain-containing protein |
| 334 | VFBO01000003.1 | GCA009495475_00226 | CDS | open | 136158-137012 | _na 284_aa | hisJ | ABC transporter%2C substrate-binding protein%2C family 3 |
| 335 | VFBO01000003.1 | GCA009495475_00227 | CDS | open | 137840-138052 | _na 70_aa | Transposase IS204/IS1001/IS1096/IS1165 DDE domain-containing protein | |
| 336 | VFBO01000003.1 | GCA009495475_00228 | CDS | open | 138172-139428 | _na 418_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 337 | VFBO01000003.1 | GCA009495475_00229 | CDS | open | 139470-140228 | _na 252_aa | aroD | 3-dehydroquinate dehydratase |
| 338 | VFBO01000003.1 | GCA009495475_00230 | CDS | open | 140339-141355 | _na 338_aa | pgaB | NodB-like y domain-containing protein |
| 339 | VFBO01000003.1 | GCA009495475_00231 | CDS | open | 141911-143548 | _na 545_aa | oppA | Solute-binding protein family 5 domain-containing protein |
| 340 | VFBO01000003.1 | GCA009495475_00232 | CDS | open | 143854-143982 | _na 42_aa | hypothetical protein | |
| 341 | VFBO01000003.1 | GCA009495475_00233 | CDS | open | 143939-145204 | _na 421_aa | hutI | Imidazolonepropionase |
| 342 | VFBO01000003.1 | GCA009495475_00234 | CDS | open | 145554-145874 | _na 106_aa | pheA | Chorismate mutase domain-containing protein |
| 343 | VFBO01000003.1 | GCA009495475_00235 | CDS | open | 145871-147040 | _na 389_aa | aroC | chorismate synthase |
| 344 | VFBO01000003.1 | GCA009495475_00236 | CDS | open | 147050-148366 | _na 438_aa | aroA | 3-phosphoshikimate 1-carboxyvinyltransferase |
| 345 | VFBO01000003.1 | GCA009495475_00237 | CDS | open | 148373-149224 | _na 283_aa | tyrA | Putative prephenate dehydrogenase |
| 346 | VFBO01000003.1 | GCA009495475_00238 | CDS | open | 149236-149757 | _na 173_aa | aroK | Shikimate kinase |
| 347 | VFBO01000003.1 | GCA009495475_00239 | CDS | open | 149759-150631 | _na 290_aa | aroE | Shikimate dehydrogenase (NADP(+)) |
| 348 | VFBO01000003.1 | GCA009495475_00240 | CDS | open | 150836-151366 | _na 176_aa | thiW | energy coupling factor transporter S component ThiW |
| 349 | VFBO01000003.1 | GCA009495475_00241 | CDS | open | 151353-152366 | _na 337_aa | purR | HTH lacI-type domain-containing protein |
| 350 | VFBO01000003.1 | GCA009495475_00242 | CDS | open | 152534-154504 | _na 656_aa | melB | PTS EIIA type-1 domain-containing protein |
| 351 | VFBO01000003.1 | GCA009495475_00243 | CDS | open | 154538-156763 | _na 741_aa | galA | Alpha-galactosidase |
| 352 | VFBO01000003.1 | GCA009495475_00244 | CDS | open | 156842-157450 | _na 202_aa | wbbJ | Acetyltransferase |
| 353 | VFBO01000003.1 | GCA009495475_00245 | CDS | open | 157622-159112 | _na 496_aa | proP | Major facilitator superfamily (MFS) profile domain-containing protein |
| 354 | VFBO01000003.1 | GCA009495475_00246 | CDS | open | 159173-161017 | _na 614_aa | DNA-binding protein | |
| 355 | VFBO01000003.1 | GCA009495475_00247 | CDS | open | 161100-161975 | _na 291_aa | degV | DegV family protein |
| 356 | VFBO01000003.1 | GCA009495475_00248 | CDS | open | 162387-163475 | _na 362_aa | pfoR | Phosphotransferase system EIIC domain-containing protein |
| 357 | VFBO01000003.1 | GCA009495475_00249 | CDS | open | 163576-164040 | _na 154_aa | DUF5626 domain-containing protein | |
| 358 | VFBO01000003.1 | GCA009495475_00250 | CDS | open | 164380-165117 | _na 245_aa | hypothetical protein | |
| 359 | VFBO01000003.1 | GCA009495475_00251 | CDS | open | 165143-165940 | _na 265_aa | hypothetical protein | |
| 360 | VFBO01000003.1 | GCA009495475_00252 | CDS | open | 165906-166835 | _na 309_aa | tnp | IS30 family ISLpl1 transposase |
| 361 | VFBO01000003.1 | GCA009495475_00253 | CDS | open | 166941-167699 | _na 252_aa | tpiA | triose-phosphate isomerase |
| 362 | VFBO01000003.1 | GCA009495475_00254 | CDS | open | 167830-169044 | _na 404_aa | pgk | Phosphoglycerate kinase |
| 363 | VFBO01000003.1 | GCA009495475_00255 | CDS | open | 169147-170157 | _na 336_aa | gap | type I glyceraldehyde-3-phosphate dehydrogenase |
| 364 | VFBO01000003.1 | GCA009495475_00257 | CDS | open | 170665-171111 | _na 148_aa | rimI | N-acetyltransferase domain-containing protein |
| 365 | VFBO01000003.1 | GCA009495475_00258 | CDS | open | 171356-172288 | _na 310_aa | catE | VOC domain-containing protein |
| 366 | VFBO01000003.1 | GCA009495475_00259 | CDS | open | 172515-173108 | _na 197_aa | clpP | ATP-dependent Clp protease proteolytic subunit |
| 367 | VFBO01000003.1 | GCA009495475_00260 | CDS | open | 173278-174354 | _na 358_aa | adhP | alcohol dehydrogenase |
| 368 | VFBO01000003.1 | GCA009495475_00261 | CDS | open | 174475-175419 | _na 314_aa | whiA | DNA-binding protein WhiA |
| 369 | VFBO01000003.1 | GCA009495475_00262 | CDS | open | 175450-176454 | _na 334_aa | cofD | Putative gluconeogenesis factor |
| 370 | VFBO01000003.1 | GCA009495475_00263 | CDS | open | 177010-177441 | _na 143_aa | Putative amidase domain-containing protein | |
| 371 | VFBO01000003.1 | GCA009495475_00264 | CDS | open | 177459-177761 | _na 100_aa | Secreted protein | |
| 372 | VFBO01000003.1 | GCA009495475_00265 | CDS | open | 177840-178277 | _na 145_aa | hypothetical protein | |
| 373 | VFBO01000003.1 | GCA009495475_00266 | CDS | open | 178572-178868 | _na 98_aa | hypothetical protein | |
| 374 | VFBO01000003.1 | GCA009495475_00267 | CDS | open | 179161-179529 | _na 122_aa | mazF | Type II toxin-antitoxin system PemK/MazF family toxin |
| 375 | VFBO01000003.1 | GCA009495475_00268 | CDS | open | 179522-179764 | _na 80_aa | mazE | type II toxin-antitoxin system PemI/MazE family antitoxin |
| 376 | VFBO01000003.1 | GCA009495475_00269 | CDS | open | 179928-180521 | _na 197_aa | lepB | signal peptidase I |
| 377 | VFBO01000003.1 | GCA009495475_00270 | CDS | open | 180771-180986 | _na 71_aa | hypothetical protein | |
| 378 | VFBO01000003.1 | GCA009495475_00271 | CDS | open | 180986-181261 | _na 91_aa | abrB | AbrB/MazE/SpoVT family DNA-binding domain-containing protein |
| 379 | VFBO01000003.1 | GCA009495475_00272 | CDS | open | 181408-181758 | _na 116_aa | Glycosyl hydrolase family 92 domain-containing protein | |
| 380 | VFBO01000003.1 | GCA009495475_00273 | CDS | open | 181932-182183 | _na 83_aa | DUF3955 domain-containing protein | |
| 381 | VFBO01000003.1 | GCA009495475_00274 | CDS | open | 182250-185315 | _na 1021_aa | carB | carbamoyl-phosphate synthase large subunit |
| 382 | VFBO01000003.1 | GCA009495475_00275 | CDS | open | 185315-186373 | _na 352_aa | carA | carbamoyl phosphate synthase small subunit |
| 383 | VFBO01000003.1 | GCA009495475_00276 | CDS | open | 186938-187885 | _na 315_aa | pyrB | aspartate carbamoyltransferase catalytic subunit |
| 384 | VFBO01000003.1 | GCA009495475_00277 | CDS | open | 187907-189181 | _na 424_aa | allB | dihydroorotase |
| 385 | VFBO01000003.1 | GCA009495475_00278 | CDS | open | 189271-189822 | _na 183_aa | mutT | ADP-ribose pyrophosphatase |
| 386 | VFBO01000003.1 | GCA009495475_00279 | CDS | open | 189944-190258 | _na 104_aa | emrE | Quaternary ammonium compound-resistance protein |
| 387 | VFBO01000003.1 | GCA009495475_00280 | CDS | open | 190403-190813 | _na 136_aa | hicB | HicB-like antitoxin of toxin-antitoxin system domain-containing protein |
| 388 | VFBO01000003.1 | GCA009495475_00281 | CDS | open | 190834-191007 | _na 57_aa | hicA | Addiction module toxin%2C HicA family |
| 389 | VFBO01000003.1 | GCA009495475_00282 | CDS | open | 191202-192368 | _na 388_aa | serA | D-3-phosphoglycerate dehydrogenase |
| 390 | VFBO01000003.1 | GCA009495475_00283 | CDS | open | 192380-193456 | _na 358_aa | serC | 3-phosphoserine/phosphohydroxythreonine transaminase |
| 391 | VFBO01000003.1 | GCA009495475_00284 | CDS | open | 193824-194453 | _na 209_aa | phoE | Phosphoglycerate mutase |
| 392 | VFBO01000003.1 | GCA009495475_00285 | CDS | open | 194525-194632 | _na 35_aa | hypothetical protein | |
| 393 | VFBO01000003.1 | GCA009495475_00286 | CDS | open | 194838-196478 | _na 546_aa | oppA | Solute-binding protein family 5 domain-containing protein |
| 394 | VFBO01000003.1 | GCA009495475_00287 | CDS | open | 196610-197536 | _na 308_aa | mdh | Putative L-lactate/malate dehydrogenase |
| 395 | VFBO01000003.1 | GCA009495475_00288 | CDS | open | 198061-199131 | _na 356_aa | hypothetical protein | |
| 396 | VFBO01000003.1 | GCA009495475_00289 | CDS | open | 199225-200169 | _na 314_aa | mdh | Putative L-lactate/malate dehydrogenase |
| 397 | VFBO01000003.1 | GCA009495475_00290 | CDS | open | 200378-200977 | _na 199_aa | tMEM175 | Integral membrane protein |
| 398 | VFBO01000003.1 | GCA009495475_00291 | CDS | open | 200974-201888 | _na 304_aa | menA | 1%2C4-dihydroxy-2-naphthoateoctaprenyltransferase |
| 399 | VFBO01000003.1 | GCA009495475_00292 | CDS | open | 201957-202670 | _na 237_aa | ubiE | demethylmenaquinone methyltransferase |
| 400 | VFBO01000003.1 | GCA009495475_00293 | CDS | open | 202951-204129 | _na 392_aa | aspB | Aminotransferase |
| 401 | VFBO01000003.1 | GCA009495475_00294 | CDS | open | 204147-205139 | _na 330_aa | ldhA | D-lactate dehydrogenase |
| 402 | VFBO01000003.1 | GCA009495475_00295 | CDS | open | 205140-205568 | _na 142_aa | Phosphotransferase system EIIC domain-containing protein | |
| 403 | VFBO01000003.1 | GCA009495475_00296 | CDS | open | 205581-205889 | _na 102_aa | sdpI | SdpI family protein |
| 404 | VFBO01000003.1 | GCA009495475_00297 | CDS | open | 206873-208198 | _na 441_aa | lpd | Glutathione-disulfide reductase |
| 405 | VFBO01000003.1 | GCA009495475_00298 | CDS | open | 208378-208884 | _na 168_aa | nimA | Putative flavin-nucleotide-binding protein |
| 406 | VFBO01000003.1 | GCA009495475_00299 | CDS | open | 208977-209210 | _na 77_aa | hypothetical protein | |
| 407 | VFBO01000003.1 | GCA009495475_00300 | CDS | open | 209263-210219 | _na 318_aa | ABC transporter permease | |
| 408 | VFBO01000003.1 | GCA009495475_00301 | CDS | open | 210447-211484 | _na 345_aa | lplA | lipoate--protein ligase |
| 409 | VFBO01000003.1 | GCA009495475_00302 | CDS | open | 211668-213335 | _na 555_aa | mdlB | ABC transmembrane type-1 domain-containing protein |
| 410 | VFBO01000003.1 | GCA009495475_00303 | CDS | open | 214018-214872 | _na 284_aa | Abi family protein | |
| 411 | VFBO01000003.1 | GCA009495475_00304 | CDS | open | 215091-215573 | _na 160_aa | btuE | Glutathione peroxidase |
| 412 | VFBO01000003.1 | GCA009495475_00305 | CDS | open | 215586-216341 | _na 251_aa | ABC transporter permease | |
| 413 | VFBO01000003.1 | GCA009495475_00306 | CDS | open | 216360-218111 | _na 583_aa | lolE | ABC3 transporter permease protein domain-containing protein |
| 414 | VFBO01000003.1 | GCA009495475_00307 | CDS | open | 218234-219085 | _na 283_aa | Alpha/beta hydrolase | |
| 415 | VFBO01000003.1 | GCA009495475_00308 | CDS | open | 219355-220470 | _na 371_aa | Extracellular protein | |
| 416 | VFBO01000003.1 | GCA009495475_00309 | CDS | open | 221010-222074 | _na 354_aa | Extracellular protein | |
| 417 | VFBO01000003.1 | GCA009495475_00310 | CDS | open | 222213-222737 | _na 174_aa | acrR | Transcriptional regulator%2C TetR family |
| 418 | VFBO01000003.1 | GCA009495475_00311 | CDS | open | 222737-223801 | _na 354_aa | hrtB | Putative hemin transport system permease protein HrtB |
| 419 | VFBO01000003.1 | GCA009495475_00312 | CDS | open | 223804-224499 | _na 231_aa | hrtA | Putative hemin import ATP-binding protein HrtA |
| 420 | VFBO01000003.1 | GCA009495475_00313 | CDS | open | 224733-225104 | _na 123_aa | paaI | Aromatic compounds catabolism protein |
| 421 | VFBO01000003.1 | GCA009495475_00314 | CDS | open | 225140-225961 | _na 273_aa | menB | 1%2C4-dihydroxy-2-naphthoyl-CoA synthase |
| 422 | VFBO01000003.1 | GCA009495475_00315 | CDS | open | 225970-227394 | _na 474_aa | menE | o-succinylbenzoate--CoA ligase |
| 423 | VFBO01000003.1 | GCA009495475_00316 | CDS | open | 227665-228699 | _na 344_aa | ptcA | putrescine carbamoyltransferase |
| 424 | VFBO01000003.1 | GCA009495475_00317 | CDS | open | 228733-230148 | _na 471_aa | potE | Putative glutamate/gamma-aminobutyrate antiporter |
| 425 | VFBO01000003.1 | GCA009495475_00318 | CDS | open | 230181-231278 | _na 365_aa | aguA | agmatine deiminase |
| 426 | VFBO01000003.1 | GCA009495475_00319 | CDS | open | 231290-232249 | _na 319_aa | arcC | carbamate kinase |
| 427 | VFBO01000003.1 | GCA009495475_00320 | CDS | open | 232388-233476 | _na 362_aa | aguA | agmatine deiminase |
| 428 | VFBO01000003.1 | GCA009495475_00321 | CDS | open | 233486-234271 | _na 261_aa | rpiR | HTH rpiR-type domain-containing protein |
| 429 | VFBO01000003.1 | GCA009495475_00322 | CDS | open | 234375-235862 | _na 495_aa | hypothetical protein | |
| 430 | VFBO01000003.1 | GCA009495475_00323 | CDS | open | 235987-236136 | _na 49_aa | rpmG | 50S ribosomal protein L33 |
| 431 | VFBO01000003.1 | GCA009495475_00324 | CDS | open | 236261-238084 | _na 607_aa | zntA | Cd(2+)-exporting ATPase |
| 432 | VFBO01000003.1 | GCA009495475_00325 | CDS | open | 238239-239108 | _na 289_aa | pdxI | Putative oxidoreductase YdbC |
| 433 | VFBO01000003.1 | GCA009495475_00326 | CDS | open | 239352-240896 | _na 514_aa | gppA | Exopolyphosphatase |
| 434 | VFBO01000003.1 | GCA009495475_00327 | CDS | open | 240893-243070 | _na 725_aa | ppk | RNA degradosome polyphosphate kinase |
| 435 | VFBO01000003.1 | GCA009495475_00328 | CDS | open | 243070-244017 | _na 315_aa | ppx | exopolyphosphatase |
| 436 | VFBO01000003.1 | GCA009495475_00329 | CDS | open | 244132-245235 | _na 367_aa | vanZ | VanZ-like domain-containing protein |
| 437 | VFBO01000003.1 | GCA009495475_00330 | CDS | open | 245257-246324 | _na 355_aa | elyC | DUF218 domain-containing protein |
| 438 | VFBO01000003.1 | GCA009495475_00331 | CDS | open | 246409-246819 | _na 136_aa | arsC | Arsenate reductase |
| 439 | VFBO01000003.1 | GCA009495475_00332 | CDS | open | 247045-248163 | _na 372_aa | aspB | aminotransferase |
| 440 | VFBO01000003.1 | GCA009495475_00333 | CDS | open | 248621-249520 | _na 299_aa | metF | methylenetetrahydrofolate reductase [NAD(P)H] |
| 441 | VFBO01000003.1 | GCA009495475_00334 | CDS | open | 249498-251783 | _na 761_aa | metE | 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase |
| 442 | VFBO01000003.1 | GCA009495475_00335 | CDS | open | 252159-252632 | _na 157_aa | luxS | S-ribosylhomocysteine lyase |
| 443 | VFBO01000003.1 | GCA009495475_00336 | CDS | open | 253042-253719 | _na 225_aa | acrR | HTH tetR-type domain-containing protein |
| 444 | VFBO01000003.1 | GCA009495475_00337 | CDS | open | 253729-254898 | _na 389_aa | yadH | ABC transmembrane type-2 domain-containing protein |
| 445 | VFBO01000003.1 | GCA009495475_00338 | CDS | open | 254876-255613 | _na 245_aa | rbbA | ABC transporter ATP-binding protein |
| 446 | VFBO01000003.1 | GCA009495475_00339 | CDS | open | 255914-257287 | _na 457_aa | fUI1 | Cytosine permease |
| 447 | VFBO01000003.1 | GCA009495475_00340 | CDS | open | 257289-257888 | _na 199_aa | dotG | Pentapeptide repeat-containing protein |
| 448 | VFBO01000003.1 | GCA009495475_00341 | CDS | open | 258071-258886 | _na 271_aa | ecfT | ABC transmembrane type-1 domain-containing protein |
| 449 | VFBO01000003.1 | GCA009495475_00342 | CDS | open | 258874-260535 | _na 553_aa | rbbA | energy-coupling factor transporter ATPase |
| 450 | VFBO01000003.1 | GCA009495475_00343 | CDS | open | 260525-261235 | _na 236_aa | ECF transporter S component | |
| 451 | VFBO01000003.1 | GCA009495475_00344 | CDS | open | 261252-262298 | _na 348_aa | Fucose-binding lectin II | |
| 452 | VFBO01000003.1 | GCA009495475_00345 | CDS | open | 262316-263017 | _na 233_aa | Transcobalamin-like C-terminal domain-containing protein | |
| 453 | VFBO01000003.1 | GCA009495475_00346 | CDS | open | 263283-264248 | _na 321_aa | fixB | Electron transfer flavoprotein alpha/beta-subunit N-terminal domain-containing protein |
| 454 | VFBO01000003.1 | GCA009495475_00347 | CDS | open | 264262-265035 | _na 257_aa | fixA | Electron transfer flavoprotein small subunit |
| 455 | VFBO01000003.1 | GCA009495475_00348 | CDS | open | 265049-266167 | _na 372_aa | caiA | Acyl-CoA dehydrogenase |
| 456 | VFBO01000003.1 | GCA009495475_00349 | CDS | open | 266344-267201 | _na 285_aa | hipB | HTH cro/C1-type domain-containing protein |
| 457 | VFBO01000003.1 | GCA009495475_00350 | CDS | open | 267472-268338 | _na 288_aa | oca4 | Protein-tyrosine-phosphatase |
| 458 | VFBO01000003.1 | GCA009495475_00351 | CDS | open | 268378-268971 | _na 197_aa | mdaB | Flavodoxin-like fold domain-containing protein |
| 459 | VFBO01000003.1 | GCA009495475_00352 | CDS | open | 269087-269572 | _na 161_aa | marR | HTH marR-type domain-containing protein |
| 460 | VFBO01000003.1 | GCA009495475_00353 | CDS | open | 269709-271301 | _na 530_aa | mntH | Nramp family divalent metal transporter |
| 461 | VFBO01000003.1 | GCA009495475_00354 | CDS | open | 271374-271820 | _na 148_aa | uspA | Universal stress protein%2C UspA family protein |
| 462 | VFBO01000003.1 | GCA009495475_00355 | CDS | open | 271901-273250 | _na 449_aa | araJ | Major facilitator superfamily (MFS) profile domain-containing protein |
| 463 | VFBO01000003.1 | GCA009495475_00356 | CDS | open | 273442-274866 | _na 474_aa | adhE | Succinate-semialdehyde dehydrogenase (NADP+) |
| 464 | VFBO01000003.1 | GCA009495475_00357 | CDS | open | 274976-275881 | _na 301_aa | lCB5 | Diacylglycerol kinase |
| 465 | VFBO01000003.1 | GCA009495475_00358 | CDS | open | 275927-276418 | _na 163_aa | yjhB | Nudix hydrolase domain-containing protein |
| 466 | VFBO01000003.1 | GCA009495475_00359 | CDS | open | 276415-276825 | _na 136_aa | hxlR | HTH hxlR-type domain-containing protein |
| 467 | VFBO01000003.1 | GCA009495475_00360 | CDS | open | 276929-277438 | _na 169_aa | yajL | Intracellular protease C56%2C PfpI family |
| 468 | VFBO01000003.1 | GCA009495475_00361 | CDS | open | 277535-278869 | _na 444_aa | amtB | Ammonium transporter |
| 469 | VFBO01000003.1 | GCA009495475_00362 | CDS | open | 279151-279783 | _na 210_aa | ywnB | Flavin reductase |
| 470 | VFBO01000003.1 | GCA009495475_00363 | CDS | open | 280147-282066 | _na 639_aa | zntA | Cd(2+)-exporting ATPase |
| 471 | VFBO01000003.1 | GCA009495475_00364 | CDS | open | 282087-282308 | _na 73_aa | copZ | Copper chaperone |
| 472 | VFBO01000003.1 | GCA009495475_00365 | CDS | open | 282318-282866 | _na 182_aa | dps | DNA protection during starvation protein |
| 473 | VFBO01000003.1 | GCA009495475_00366 | CDS | open | 282941-283252 | _na 103_aa | DUF3899 domain-containing protein | |
| 474 | VFBO01000003.1 | GCA009495475_00367 | CDS | open | 283320-283772 | _na 150_aa | Oxidoreductase | |
| 475 | VFBO01000003.1 | GCA009495475_00368 | CDS | open | 283733-284296 | _na 187_aa | NADP-dependent oxidoreductase domain-containing protein | |
| 476 | VFBO01000003.1 | GCA009495475_00369 | CDS | open | 284567-285055 | _na 162_aa | purE | N5-carboxyaminoimidazole ribonucleotide mutase |
| 477 | VFBO01000003.1 | GCA009495475_00370 | CDS | open | 285036-286169 | _na 377_aa | purK | 5-(carboxyamino)imidazole ribonucleotide synthase |
| 478 | VFBO01000003.1 | GCA009495475_00371 | CDS | open | 286171-286902 | _na 243_aa | purC | phosphoribosylaminoimidazolesuccinocarboxamide synthase |
| 479 | VFBO01000003.1 | GCA009495475_00372 | CDS | open | 286902-287165 | _na 87_aa | purS | phosphoribosylformylglycinamidine synthase subunit PurS |
| 480 | VFBO01000003.1 | GCA009495475_00373 | CDS | open | 287162-287845 | _na 227_aa | purQ | phosphoribosylformylglycinamidine synthase subunit PurQ |
| 481 | VFBO01000003.1 | GCA009495475_00374 | CDS | open | 287838-290072 | _na 744_aa | purL | phosphoribosylformylglycinamidine synthase subunit PurL |
| 482 | VFBO01000003.1 | GCA009495475_00375 | CDS | open | 290057-291499 | _na 480_aa | purF | amidophosphoribosyltransferase |
| 483 | VFBO01000003.1 | GCA009495475_00376 | CDS | open | 291510-292526 | _na 338_aa | purM | Phosphoribosylformylglycinamidine cyclo-ligase |
| 484 | VFBO01000003.1 | GCA009495475_00377 | CDS | open | 292523-293110 | _na 195_aa | purN | phosphoribosylglycinamide formyltransferase |
| 485 | VFBO01000003.1 | GCA009495475_00378 | CDS | open | 293110-294639 | _na 509_aa | purH | bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase |
| 486 | VFBO01000003.1 | GCA009495475_00379 | CDS | open | 295132-296364 | _na 410_aa | purD | Phosphoribosylamine--glycine ligase |
| 487 | VFBO01000003.1 | GCA009495475_00380 | CDS | open | 296562-297302 | _na 246_aa | yaaA | peroxide stress protein YaaA |
| 488 | VFBO01000003.1 | GCA009495475_00381 | CDS | open | 297305-298183 | _na 292_aa | pepI | proline iminopeptidase |
| 489 | VFBO01000003.1 | GCA009495475_00382 | CDS | open | 298461-299096 | _na 211_aa | gph | Putative phosphoglycolate phosphatase |
| 490 | VFBO01000003.1 | GCA009495475_00383 | CDS | open | 299274-300524 | _na 416_aa | araJ | Major facilitator superfamily (MFS) profile domain-containing protein |
| 491 | VFBO01000003.1 | GCA009495475_00384 | CDS | open | 300611-300976 | _na 121_aa | mazF | Type II toxin-antitoxin system PemK/MazF family toxin |
| 492 | VFBO01000003.1 | GCA009495475_00385 | CDS | open | 300951-301181 | _na 76_aa | Antitoxin of toxin-antitoxin stability system | |
| 493 | VFBO01000003.1 | GCA009495475_00386 | CDS | open | 301446-302165 | _na 239_aa | pyrF | orotidine-5'-phosphate decarboxylase |
| 494 | VFBO01000003.1 | GCA009495475_00387 | CDS | open | 302155-302802 | _na 215_aa | pyrE | Orotate phosphoribosyltransferase |
| 495 | VFBO01000003.1 | GCA009495475_00388 | CDS | open | 302792-303736 | _na 314_aa | pyrD | dihydroorotate oxidase |
| 496 | VFBO01000003.1 | GCA009495475_00389 | CDS | open | 303841-306366 | _na 841_aa | uvrA | excinuclease ABC subunit UvrA |
| 497 | VFBO01000003.1 | GCA009495475_00390 | CDS | open | 306647-307813 | _na 388_aa | nagC | ROK family protein |
| 498 | VFBO01000003.1 | GCA009495475_00391 | CDS | open | 307919-308377 | _na 152_aa | araC | AraC family transcriptional regulator |
| 499 | VFBO01000003.1 | GCA009495475_00392 | CDS | open | 308867-310012 | _na 381_aa | Right handed beta helix domain-containing protein | |
| 500 | VFBO01000003.1 | GCA009495475_00393 | CDS | open | 310473-311774 | _na 433_aa | btlA | Major facilitator superfamily (MFS) profile domain-containing protein |

