BAKTAGenome Explorer: Eikenella corrodens (GCA_009650825.1)
Select a Genome:
|
BAKTA Annotations for GCA_009650825.1
|
Search & Sort all 4614 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1001 | VYYO01000005.1 | GCA009650825_01832 | CDS | open | 34282-34917 | _na 211_aa | Serine aminopeptidase S33 domain-containing protein | |
| 1002 | VYYO01000005.1 | GCA009650825_01833 | CDS | open | 35031-36557 | _na 508_aa | ilvA | threonine ammonia-lyase%2C biosynthetic |
| 1003 | VYYO01000005.1 | GCA009650825_01834 | CDS | open | 36839-38083 | _na 414_aa | dacC | serine-type D-Ala-D-Ala carboxypeptidase |
| 1004 | VYYO01000005.1 | GCA009650825_01835 | CDS | open | 38163-38939 | _na 258_aa | Gram-negative pili assembly chaperone domain protein | |
| 1005 | VYYO01000005.1 | GCA009650825_01836 | CDS | open | 39015-40097 | _na 360_aa | Methyltransferase | |
| 1006 | VYYO01000005.1 | GCA009650825_01837 | CDS | open | 40252-40950 | _na 232_aa | murU | N-acetylmuramate alpha-1-phosphate uridylyltransferase MurU |
| 1007 | VYYO01000005.1 | GCA009650825_01838 | CDS | open | 41229-41480 | _na 83_aa | ydhL | DUF1289 domain-containing protein |
| 1008 | VYYO01000005.1 | GCA009650825_01839 | CDS | open | 41526-42443 | _na 305_aa | eamA | EamA domain-containing protein |
| 1009 | VYYO01000005.1 | GCA009650825_01840 | CDS | open | 42550-43566 | _na 338_aa | mutY | A/G-specific adenine glycosylase |
| 1010 | VYYO01000005.1 | GCA009650825_01841 | CDS | open | 43727-44884 | _na 385_aa | rlmL | THUMP domain-containing protein |
| 1011 | VYYO01000005.1 | GCA009650825_01842 | CDS | open | 44967-46364 | _na 465_aa | aspA | aspartate ammonia-lyase |
| 1012 | VYYO01000005.1 | GCA009650825_01843 | CDS | open | 46599-47537 | _na 312_aa | pip | prolyl aminopeptidase |
| 1013 | VYYO01000005.1 | GCA009650825_01844 | CDS | open | 47922-48173 | _na 83_aa | hypothetical protein | |
| 1014 | VYYO01000005.1 | GCA009650825_01845 | CDS | open | 48249-48536 | _na 95_aa | feoA | Ferrous iron transporter FeoA-like domain-containing protein |
| 1015 | VYYO01000005.1 | GCA009650825_01846 | CDS | open | 48698-50560 | _na 620_aa | ferrous iron transporter B | |
| 1016 | VYYO01000005.1 | GCA009650825_01847 | CDS | open | 50560-50688 | _na 42_aa | FeoB-associated Cys-rich membrane protein | |
| 1017 | VYYO01000005.1 | GCA009650825_01848 | CDS | open | 51001-52110 | _na 369_aa | gldA | Glycerol dehydrogenase |
| 1018 | VYYO01000005.1 | GCA009650825_01849 | CDS | open | 52705-53475 | _na 256_aa | glpC | Cysteine-rich domain-containing protein |
| 1019 | VYYO01000005.1 | GCA009650825_01850 | CDS | open | 53472-54170 | _na 232_aa | lutC | LUD domain-containing protein |
| 1020 | VYYO01000005.1 | GCA009650825_01851 | CDS | open | 54167-55621 | _na 484_aa | lutB | LutB/LldF family L-lactate oxidation iron-sulfur protein |
| 1021 | VYYO01000005.1 | GCA009650825_01852 | CDS | open | 55825-57381 | _na 518_aa | lldP | L-lactate permease |
| 1022 | VYYO01000005.1 | GCA009650825_01853 | CDS | open | 57501-57851 | _na 116_aa | phnB | Glyoxalase |
| 1023 | VYYO01000005.1 | GCA009650825_01854 | CDS | open | 57956-60577 | _na 873_aa | alaS | alanine--tRNA ligase |
| 1024 | VYYO01000005.1 | GCA009650825_01855 | CDS | open | 60829-61902 | _na 357_aa | rlhA | Ubiquinone biosynthesis protein UbiU |
| 1025 | VYYO01000005.1 | GCA009650825_01856 | CDS | open | 62155-63024 | _na 289_aa | BAAT/Acyl-CoA thioester hydrolase C-terminal domain-containing protein | |
| 1026 | VYYO01000005.1 | GCA009650825_01857 | CDS | open | 63118-63450 | _na 110_aa | DNA-binding protein | |
| 1027 | VYYO01000005.1 | GCA009650825_01858 | CDS | open | 63462-63713 | _na 83_aa | hypothetical protein | |
| 1028 | VYYO01000005.1 | GCA009650825_01859 | CDS | open | 63756-64676 | _na 306_aa | rlhA | U32 family peptidase |
| 1029 | VYYO01000005.1 | GCA009650825_01860 | CDS | open | 64688-65131 | _na 147_aa | ubiT | Ubiquinone biosynthesis accessory factor UbiT |
| 1030 | VYYO01000005.1 | GCA009650825_01861 | CDS | open | 65376-66173 | _na 265_aa | focA | Formate/nitrite transporter |
| 1031 | VYYO01000005.1 | GCA009650825_01862 | CDS | open | 66355-66783 | _na 142_aa | paaI | Thioesterase domain-containing protein |
| 1032 | VYYO01000005.1 | GCA009650825_01863 | CDS | open | 66780-67250 | _na 156_aa | paaI | Thioesterase domain-containing protein |
| 1033 | VYYO01000005.1 | GCA009650825_01864 | CDS | open | 67381-68238 | _na 285_aa | scpA | Segregation and condensation protein A |
| 1034 | VYYO01000005.1 | GCA009650825_01865 | CDS | open | 68404-68847 | _na 147_aa | Sugar-phosphate isomerase%2C RpiB/LacA/LacB family | |
| 1035 | VYYO01000005.1 | GCA009650825_01866 | CDS | open | 68949-70427 | _na 492_aa | 2'-5' RNA ligase | |
| 1036 | VYYO01000005.1 | GCA009650825_01867 | CDS | open | 70525-71112 | _na 195_aa | hypothetical protein | |
| 1037 | VYYO01000005.1 | GCA009650825_01868 | CDS | open | 71191-71910 | _na 239_aa | hypothetical protein | |
| 1038 | VYYO01000005.1 | GCA009650825_01869 | CDS | open | 72362-72757 | _na 131_aa | Secreted protein | |
| 1039 | VYYO01000005.1 | GCA009650825_01870 | CDS | open | 73040-74416 | _na 458_aa | uraA | Xanthine permease |
| 1040 | VYYO01000005.1 | GCA009650825_01871 | CDS | open | 74549-75850 | _na 433_aa | ATPase | |
| 1041 | VYYO01000005.1 | GCA009650825_01872 | CDS | open | 76285-77853 | _na 522_aa | TROVE domain-containing protein | |
| 1042 | VYYO01000005.1 | GCA009650825_01874 | CDS | open | 78298-78405 | _na 35_aa | hypothetical protein | |
| 1043 | VYYO01000005.1 | GCA009650825_01876 | CDS | open | 78985-80613 | _na 542_aa | rtcR | RNA repair transcriptional activator RtcR |
| 1044 | VYYO01000005.1 | GCA009650825_01877 | CDS | open | 80690-81130 | _na 146_aa | yciA | acyl-CoA thioester hydrolase YciA |
| 1045 | VYYO01000005.1 | GCA009650825_01878 | CDS | open | 81326-82381 | _na 351_aa | hemE | uroporphyrinogen decarboxylase |
| 1046 | VYYO01000005.1 | GCA009650825_01879 | CDS | open | 82527-84065 | _na 512_aa | Surface lipoprotein assembly modifier C-terminal beta-barrel domain-containing protein | |
| 1047 | VYYO01000005.1 | GCA009650825_01880 | CDS | open | 84212-85186 | _na 324_aa | Slam-dependent surface lipoprotein | |
| 1048 | VYYO01000005.1 | GCA009650825_01881 | CDS | open | 85236-87674 | _na 812_aa | TonB-dependent hemoglobin/transferrin/lactoferrin receptor family protein | |
| 1049 | VYYO01000005.1 | GCA009650825_01882 | CDS | open | 87798-88382 | _na 194_aa | hemO | Heme oxygenase |
| 1050 | VYYO01000005.1 | GCA009650825_01883 | CDS | open | 88454-91123 | _na 889_aa | pepN | aminopeptidase N |
| 1051 | VYYO01000005.1 | GCA009650825_01884 | CDS | open | 91442-92560 | _na 372_aa | asd | aspartate-semialdehyde dehydrogenase |
| 1052 | VYYO01000005.1 | GCA009650825_01885 | CDS | open | 92787-93815 | _na 342_aa | gap | type I glyceraldehyde-3-phosphate dehydrogenase |
| 1053 | VYYO01000005.1 | GCA009650825_01886 | CDS | open | 94034-95818 | _na 594_aa | dsbD | Thiol:disulfide interchange protein DsbD |
| 1054 | VYYO01000005.1 | GCA009650825_01887 | CDS | open | 96101-96679 | _na 192_aa | grpE | nucleotide exchange factor GrpE |
| 1055 | VYYO01000005.1 | GCA009650825_01888 | CDS | open | 96854-97447 | _na 197_aa | 5-formyltetrahydrofolate cyclo-ligase | |
| 1056 | VYYO01000005.1 | GCA009650825_01889 | CDS | open | 97463-99343 | _na 626_aa | kch | RCK N-terminal domain-containing protein |
| 1057 | VYYO01000005.1 | GCA009650825_01890 | CDS | open | 99481-100170 | _na 229_aa | sIR2 | NAD-dependent protein deacylase |
| 1058 | VYYO01000005.1 | GCA009650825_01891 | CDS | open | 100276-101082 | _na 268_aa | nit1 | CN hydrolase domain-containing protein |
| 1059 | VYYO01000005.1 | GCA009650825_01892 | CDS | open | 101215-102189 | _na 324_aa | fbp | class 1 fructose-bisphosphatase |
| 1060 | VYYO01000005.1 | GCA009650825_01893 | CDS | open | 102405-102998 | _na 197_aa | DUF2059 domain-containing protein | |
| 1061 | VYYO01000005.1 | GCA009650825_01894 | CDS | open | 103724-105511 | _na 595_aa | leuA | 2-isopropylmalate synthase |
| 1062 | VYYO01000005.1 | GCA009650825_01794 | gene | open | 787-978 | |||
| 1063 | VYYO01000005.1 | GCA009650825_01795 | gene | open | 1574-1801 | |||
| 1064 | VYYO01000005.1 | GCA009650825_01796 | gene | open | 2118-2798 | |||
| 1065 | VYYO01000005.1 | GCA009650825_01797 | gene | open | 3114-4022 | mMP0362 | ||
| 1066 | VYYO01000005.1 | GCA009650825_01798 | gene | open | 4019-4927 | mMP0363 | ||
| 1067 | VYYO01000005.1 | GCA009650825_01799 | gene | open | 5039-5410 | rbfA | ||
| 1068 | VYYO01000005.1 | GCA009650825_01800 | gene | open | 5434-5766 | |||
| 1069 | VYYO01000005.1 | GCA009650825_01801 | gene | open | 6058-8823 | infB | ||
| 1070 | VYYO01000005.1 | GCA009650825_01802 | gene | open | 8839-10335 | nusA | ||
| 1071 | VYYO01000005.1 | GCA009650825_01803 | gene | open | 10372-10797 | rimP | ||
| 1072 | VYYO01000005.1 | GCA009650825_01804 | gene | open | 11093-11539 | |||
| 1073 | VYYO01000005.1 | GCA009650825_01805 | gene | open | 11647-11853 | |||
| 1074 | VYYO01000005.1 | GCA009650825_01807 | gene | open | 12621-13028 | |||
| 1075 | VYYO01000005.1 | GCA009650825_01808 | gene | open | 13236-14696 | trkG | ||
| 1076 | VYYO01000005.1 | GCA009650825_01809 | gene | open | 14913-15350 | nusB | ||
| 1077 | VYYO01000005.1 | GCA009650825_01810 | gene | open | 15375-15860 | ribH | ||
| 1078 | VYYO01000005.1 | GCA009650825_01811 | gene | open | 16011-16511 | folA | ||
| 1079 | VYYO01000005.1 | GCA009650825_01812 | gene | open | 16533-17564 | lpxK | ||
| 1080 | VYYO01000005.1 | GCA009650825_01813 | gene | open | 17707-17889 | trm112 | ||
| 1081 | VYYO01000005.1 | GCA009650825_01814 | gene | open | 17886-18665 | kdsB | ||
| 1082 | VYYO01000005.1 | GCA009650825_01815 | gene | open | 18793-19533 | rsuA | ||
| 1083 | VYYO01000005.1 | GCA009650825_01816 | gene | open | 19622-20596 | |||
| 1084 | VYYO01000005.1 | GCA009650825_01817 | gene | open | 20603-20845 | |||
| 1085 | VYYO01000005.1 | GCA009650825_01818 | gene | open | 20922-21413 | ppiB | ||
| 1086 | VYYO01000005.1 | GCA009650825_01819 | gene | open | 21500-22060 | yceI | ||
| 1087 | VYYO01000005.1 | GCA009650825_01820 | gene | open | 22087-22662 | ppiB | ||
| 1088 | VYYO01000005.1 | GCA009650825_01821 | gene | open | 22937-24562 | uup | ||
| 1089 | VYYO01000005.1 | GCA009650825_01822 | gene | open | 24628-25410 | wGR | ||
| 1090 | VYYO01000005.1 | GCA009650825_01823 | gene | open | 25506-26000 | |||
| 1091 | VYYO01000005.1 | GCA009650825_01824 | gene | open | 26057-26305 | |||
| 1092 | VYYO01000005.1 | GCA009650825_01825 | gene | open | 26506-27771 | gdhA | ||
| 1093 | VYYO01000005.1 | GCA009650825_01826 | gene | open | 28109-28369 | arfA | ||
| 1094 | VYYO01000005.1 | GCA009650825_01827 | gene | open | 28506-29342 | rlmJ | ||
| 1095 | VYYO01000005.1 | GCA009650825_01828 | gene | open | 29899-31404 | tPR | ||
| 1096 | VYYO01000005.1 | GCA009650825_01829 | gene | open | 31654-32004 | erpA | ||
| 1097 | VYYO01000005.1 | GCA009650825_01830 | gene | open | 32184-33434 | glyA | ||
| 1098 | VYYO01000005.1 | GCA009650825_01831 | gene | open | 33817-34200 | cutA | ||
| 1099 | VYYO01000005.1 | GCA009650825_01832 | gene | open | 34282-34917 | |||
| 1100 | VYYO01000005.1 | GCA009650825_01833 | gene | open | 35031-36557 | ilvA | ||
| 1101 | VYYO01000005.1 | GCA009650825_01834 | gene | open | 36839-38083 | dacC | ||
| 1102 | VYYO01000005.1 | GCA009650825_01835 | gene | open | 38163-38939 | |||
| 1103 | VYYO01000005.1 | GCA009650825_01836 | gene | open | 39015-40097 | |||
| 1104 | VYYO01000005.1 | GCA009650825_01837 | gene | open | 40252-40950 | murU | ||
| 1105 | VYYO01000005.1 | GCA009650825_01838 | gene | open | 41229-41480 | ydhL | ||
| 1106 | VYYO01000005.1 | GCA009650825_01839 | gene | open | 41526-42443 | eamA | ||
| 1107 | VYYO01000005.1 | GCA009650825_01840 | gene | open | 42550-43566 | mutY | ||
| 1108 | VYYO01000005.1 | GCA009650825_01841 | gene | open | 43727-44884 | rlmL | ||
| 1109 | VYYO01000005.1 | GCA009650825_01842 | gene | open | 44967-46364 | aspA | ||
| 1110 | VYYO01000005.1 | GCA009650825_01843 | gene | open | 46599-47537 | pip | ||
| 1111 | VYYO01000005.1 | GCA009650825_01844 | gene | open | 47922-48173 | |||
| 1112 | VYYO01000005.1 | GCA009650825_01845 | gene | open | 48249-48536 | feoA | ||
| 1113 | VYYO01000005.1 | GCA009650825_01846 | gene | open | 48698-50560 | |||
| 1114 | VYYO01000005.1 | GCA009650825_01847 | gene | open | 50560-50688 | |||
| 1115 | VYYO01000005.1 | GCA009650825_01848 | gene | open | 51001-52110 | gldA | ||
| 1116 | VYYO01000005.1 | GCA009650825_01849 | gene | open | 52705-53475 | glpC | ||
| 1117 | VYYO01000005.1 | GCA009650825_01850 | gene | open | 53472-54170 | lutC | ||
| 1118 | VYYO01000005.1 | GCA009650825_01851 | gene | open | 54167-55621 | lutB | ||
| 1119 | VYYO01000005.1 | GCA009650825_01852 | gene | open | 55825-57381 | lldP | ||
| 1120 | VYYO01000005.1 | GCA009650825_01853 | gene | open | 57501-57851 | phnB | ||
| 1121 | VYYO01000005.1 | GCA009650825_01854 | gene | open | 57956-60577 | alaS | ||
| 1122 | VYYO01000005.1 | GCA009650825_01855 | gene | open | 60829-61902 | rlhA | ||
| 1123 | VYYO01000005.1 | GCA009650825_01856 | gene | open | 62155-63024 | |||
| 1124 | VYYO01000005.1 | GCA009650825_01857 | gene | open | 63118-63450 | |||
| 1125 | VYYO01000005.1 | GCA009650825_01858 | gene | open | 63462-63713 | |||
| 1126 | VYYO01000005.1 | GCA009650825_01859 | gene | open | 63756-64676 | rlhA | ||
| 1127 | VYYO01000005.1 | GCA009650825_01860 | gene | open | 64688-65131 | ubiT | ||
| 1128 | VYYO01000005.1 | GCA009650825_01861 | gene | open | 65376-66173 | focA | ||
| 1129 | VYYO01000005.1 | GCA009650825_01862 | gene | open | 66355-66783 | paaI | ||
| 1130 | VYYO01000005.1 | GCA009650825_01863 | gene | open | 66780-67250 | paaI | ||
| 1131 | VYYO01000005.1 | GCA009650825_01864 | gene | open | 67381-68238 | scpA | ||
| 1132 | VYYO01000005.1 | GCA009650825_01865 | gene | open | 68404-68847 | |||
| 1133 | VYYO01000005.1 | GCA009650825_01866 | gene | open | 68949-70427 | |||
| 1134 | VYYO01000005.1 | GCA009650825_01867 | gene | open | 70525-71112 | |||
| 1135 | VYYO01000005.1 | GCA009650825_01868 | gene | open | 71191-71910 | |||
| 1136 | VYYO01000005.1 | GCA009650825_01869 | gene | open | 72362-72757 | |||
| 1137 | VYYO01000005.1 | GCA009650825_01870 | gene | open | 73040-74416 | uraA | ||
| 1138 | VYYO01000005.1 | GCA009650825_01871 | gene | open | 74549-75850 | |||
| 1139 | VYYO01000005.1 | GCA009650825_01872 | gene | open | 76285-77853 | |||
| 1140 | VYYO01000005.1 | GCA009650825_01874 | gene | open | 78298-78405 | |||
| 1141 | VYYO01000005.1 | GCA009650825_01876 | gene | open | 78985-80613 | rtcR | ||
| 1142 | VYYO01000005.1 | GCA009650825_01877 | gene | open | 80690-81130 | yciA | ||
| 1143 | VYYO01000005.1 | GCA009650825_01878 | gene | open | 81326-82381 | hemE | ||
| 1144 | VYYO01000005.1 | GCA009650825_01879 | gene | open | 82527-84065 | |||
| 1145 | VYYO01000005.1 | GCA009650825_01880 | gene | open | 84212-85186 | |||
| 1146 | VYYO01000005.1 | GCA009650825_01881 | gene | open | 85236-87674 | |||
| 1147 | VYYO01000005.1 | GCA009650825_01882 | gene | open | 87798-88382 | hemO | ||
| 1148 | VYYO01000005.1 | GCA009650825_01883 | gene | open | 88454-91123 | pepN | ||
| 1149 | VYYO01000005.1 | GCA009650825_01884 | gene | open | 91442-92560 | asd | ||
| 1150 | VYYO01000005.1 | GCA009650825_01885 | gene | open | 92787-93815 | gap | ||
| 1151 | VYYO01000005.1 | GCA009650825_01886 | gene | open | 94034-95818 | dsbD | ||
| 1152 | VYYO01000005.1 | GCA009650825_01887 | gene | open | 96101-96679 | grpE | ||
| 1153 | VYYO01000005.1 | GCA009650825_01888 | gene | open | 96854-97447 | |||
| 1154 | VYYO01000005.1 | GCA009650825_01889 | gene | open | 97463-99343 | kch | ||
| 1155 | VYYO01000005.1 | GCA009650825_01890 | gene | open | 99481-100170 | sIR2 | ||
| 1156 | VYYO01000005.1 | GCA009650825_01891 | gene | open | 100276-101082 | nit1 | ||
| 1157 | VYYO01000005.1 | GCA009650825_01892 | gene | open | 101215-102189 | fbp | ||
| 1158 | VYYO01000005.1 | GCA009650825_01893 | gene | open | 102405-102998 | |||
| 1159 | VYYO01000005.1 | GCA009650825_01894 | gene | open | 103724-105511 | leuA | ||
| 1160 | VYYO01000005.1 | GCA009650825_01790 | gene | open | 1-72 | trnG | ||
| 1161 | VYYO01000005.1 | GCA009650825_01791 | gene | open | 115-188 | trnC | ||
| 1162 | VYYO01000005.1 | GCA009650825_01792 | gene | open | 270-347 | trnC | ||
| 1163 | VYYO01000005.1 | GCA009650825_01793 | gene | open | 376-466 | trnL | ||
| 1164 | VYYO01000005.1 | GCA009650825_01790 | tRNA | open | 1-72 | trnG | tRNA-Gly(gcc) | |
| 1165 | VYYO01000005.1 | GCA009650825_01791 | tRNA | open | 115-188 | trnC | tRNA-Cys(gca) | |
| 1166 | VYYO01000005.1 | GCA009650825_01792 | tRNA | open | 270-347 | trnC | tRNA-Cys(gca) | |
| 1167 | VYYO01000005.1 | GCA009650825_01793 | tRNA | open | 376-466 | trnL | tRNA-Leu(taa) | |
| 1168 | VYYO01000006.1 | GCA009650825_01961 | CDS | open | 381-1088 | _na 235_aa | ispD | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase |
| 1169 | VYYO01000006.1 | GCA009650825_01962 | CDS | open | 1085-1807 | _na 240_aa | dnaQ | DNA polymerase III subunit epsilon |
| 1170 | VYYO01000006.1 | GCA009650825_01963 | CDS | open | 2247-2717 | _na 156_aa | rlmH | 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH |
| 1171 | VYYO01000006.1 | GCA009650825_01964 | CDS | open | 2913-4148 | _na 411_aa | brkB | UPF0761 membrane protein HMPREF1177_00789 |
| 1172 | VYYO01000006.1 | GCA009650825_01965 | CDS | open | 4489-5799 | _na 436_aa | nlpD | Peptidase%2C M23 family |
| 1173 | VYYO01000006.1 | GCA009650825_01966 | CDS | open | 6093-6950 | _na 285_aa | htpX | protease HtpX |
| 1174 | VYYO01000006.1 | GCA009650825_01967 | CDS | open | 7004-7438 | _na 144_aa | hypothetical protein | |
| 1175 | VYYO01000006.1 | GCA009650825_01968 | CDS | open | 7658-8917 | _na 419_aa | xkdP | Peptidoglycan-binding protein LysM |
| 1176 | VYYO01000006.1 | GCA009650825_01969 | CDS | open | 9105-9608 | _na 167_aa | def | peptide deformylase |
| 1177 | VYYO01000006.1 | GCA009650825_01970 | CDS | open | 9634-10569 | _na 311_aa | fmt | methionyl-tRNA formyltransferase |
| 1178 | VYYO01000006.1 | GCA009650825_01971 | CDS | open | 10566-11825 | _na 419_aa | rsmB | 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB |
| 1179 | VYYO01000006.1 | GCA009650825_01972 | CDS | open | 11788-12384 | _na 198_aa | DUF4390 domain-containing protein | |
| 1180 | VYYO01000006.1 | GCA009650825_01973 | CDS | open | 12394-14508 | _na 704_aa | ntrY | histidine kinase |
| 1181 | VYYO01000006.1 | GCA009650825_01974 | CDS | open | 14495-15769 | _na 424_aa | ntrX | Nitrogen assimilation regulatory protein ntrX |
| 1182 | VYYO01000006.1 | GCA009650825_01975 | CDS | open | 16273-17232 | _na 319_aa | accA | acetyl-CoA carboxylase carboxyltransferase subunit alpha |
| 1183 | VYYO01000006.1 | GCA009650825_01976 | CDS | open | 17210-18514 | _na 434_aa | ttcA | tRNA(Ile)-lysidine synthase |
| 1184 | VYYO01000006.1 | GCA009650825_01977 | CDS | open | 18772-19227 | _na 151_aa | hypothetical protein | |
| 1185 | VYYO01000006.1 | GCA009650825_01978 | CDS | open | 19295-19489 | _na 64_aa | DUF1737 domain-containing protein | |
| 1186 | VYYO01000006.1 | GCA009650825_01979 | CDS | open | 19615-20100 | _na 161_aa | tonB | Energy transducer TonB |
| 1187 | VYYO01000006.1 | GCA009650825_01980 | CDS | open | 20132-20740 | _na 202_aa | osmY | BON domain-containing protein |
| 1188 | VYYO01000006.1 | GCA009650825_01981 | CDS | open | 20778-21368 | _na 196_aa | gmhA | phosphoheptose isomerase |
| 1189 | VYYO01000006.1 | GCA009650825_01982 | CDS | open | 21603-21950 | _na 115_aa | yraN | YraN family protein |
| 1190 | VYYO01000006.1 | GCA009650825_01983 | CDS | open | 22077-22955 | _na 292_aa | rsmI | 16S rRNA (cytidine(1402)-2'-O)-methyltransferase |
| 1191 | VYYO01000006.1 | GCA009650825_01984 | CDS | open | 23206-23820 | _na 204_aa | SMI1/KNR4 family protein | |
| 1192 | VYYO01000006.1 | GCA009650825_01985 | CDS | open | 23904-24509 | _na 201_aa | L%2CD-TPase catalytic domain-containing protein | |
| 1193 | VYYO01000006.1 | GCA009650825_01986 | CDS | open | 24591-24872 | _na 93_aa | hypothetical protein | |
| 1194 | VYYO01000006.1 | GCA009650825_01987 | CDS | open | 24869-25291 | _na 140_aa | hypothetical protein | |
| 1195 | VYYO01000006.1 | GCA009650825_01988 | CDS | open | 25505-26239 | _na 244_aa | traD | Conjugal transfer protein TraD |
| 1196 | VYYO01000006.1 | GCA009650825_01989 | CDS | open | 26232-28280 | _na 682_aa | traD | type IV conjugative transfer system coupling protein TraD |
| 1197 | VYYO01000006.1 | GCA009650825_01990 | CDS | open | 28281-30785 | _na 834_aa | mobH | MobH family relaxase |
| 1198 | VYYO01000006.1 | GCA009650825_01991 | CDS | open | 30806-31291 | _na 161_aa | hypothetical protein | |
| 1199 | VYYO01000006.1 | GCA009650825_01992 | CDS | open | 32001-33302 | _na 433_aa | Bacterial type II secretion system protein E domain-containing protein | |
| 1200 | VYYO01000006.1 | GCA009650825_01993 | CDS | open | 33302-33964 | _na 220_aa | Thioredoxin-like fold domain-containing protein | |
| 1201 | VYYO01000006.1 | GCA009650825_01994 | CDS | open | 34053-34349 | _na 98_aa | hypothetical protein | |
| 1202 | VYYO01000006.1 | GCA009650825_01995 | CDS | open | 34346-34867 | _na 173_aa | OmpA-like domain-containing protein | |
| 1203 | VYYO01000006.1 | GCA009650825_01996 | CDS | open | 34864-35169 | _na 101_aa | traL | Type IV conjugative transfer system protein TraL |
| 1204 | VYYO01000006.1 | GCA009650825_01997 | CDS | open | 35169-36059 | _na 296_aa | traE | Type IV conjugative transfer system protein TraE |
| 1205 | VYYO01000006.1 | GCA009650825_01998 | CDS | open | 36073-36885 | _na 270_aa | traK | Conjugal transfer protein TraK |
| 1206 | VYYO01000006.1 | GCA009650825_01999 | CDS | open | 36890-38161 | _na 423_aa | traB | Conjugal transfer protein TraB |
| 1207 | VYYO01000006.1 | GCA009650825_02000 | CDS | open | 38158-38766 | _na 202_aa | traV | type IV conjugative transfer system lipoprotein TraV |
| 1208 | VYYO01000006.1 | GCA009650825_02001 | CDS | open | 38815-39144 | _na 109_aa | trbC | Conjugal transfer protein TrbC |
| 1209 | VYYO01000006.1 | GCA009650825_02002 | CDS | open | 39198-41105 | _na 635_aa | DNA topoisomerase | |
| 1210 | VYYO01000006.1 | GCA009650825_02003 | CDS | open | 41108-41686 | _na 192_aa | Tat pathway signal protein | |
| 1211 | VYYO01000006.1 | GCA009650825_02004 | CDS | open | 41942-42415 | _na 157_aa | DUF3577 domain-containing protein | |
| 1212 | VYYO01000006.1 | GCA009650825_02005 | CDS | open | 42552-42818 | _na 88_aa | Integral membrane protein | |
| 1213 | VYYO01000006.1 | GCA009650825_02006 | CDS | open | 42815-42970 | _na 51_aa | hypothetical protein | |
| 1214 | VYYO01000006.1 | GCA009650825_02007 | CDS | open | 43688-43891 | _na 67_aa | hypothetical protein | |
| 1215 | VYYO01000006.1 | GCA009650825_02008 | CDS | open | 43973-44587 | _na 204_aa | hypothetical protein | |
| 1216 | VYYO01000006.1 | GCA009650825_02009 | CDS | open | 44620-44946 | _na 108_aa | hypothetical protein | |
| 1217 | VYYO01000006.1 | GCA009650825_02010 | CDS | open | 45181-45414 | _na 77_aa | hypothetical protein | |
| 1218 | VYYO01000006.1 | GCA009650825_02011 | CDS | open | 45634-46209 | _na 191_aa | DUF3275 domain-containing protein | |
| 1219 | VYYO01000006.1 | GCA009650825_02012 | CDS | open | 46219-46809 | _na 196_aa | DUF4123 domain-containing protein | |
| 1220 | VYYO01000006.1 | GCA009650825_02013 | CDS | open | 47045-47377 | _na 110_aa | hypothetical protein | |
| 1221 | VYYO01000006.1 | GCA009650825_02014 | CDS | open | 47374-47724 | _na 116_aa | hypothetical protein | |
| 1222 | VYYO01000006.1 | GCA009650825_02015 | CDS | open | 47821-50175 | _na 784_aa | Helicase | |
| 1223 | VYYO01000006.1 | GCA009650825_02016 | CDS | open | 50395-51504 | _na 369_aa | DNA methylase | |
| 1224 | VYYO01000006.1 | GCA009650825_02017 | CDS | open | 51795-52565 | _na 256_aa | hypothetical protein | |
| 1225 | VYYO01000006.1 | GCA009650825_02018 | CDS | open | 52699-53457 | _na 252_aa | yubB | YubB ferredoxin-like domain-containing protein |
| 1226 | VYYO01000006.1 | GCA009650825_02019 | CDS | open | 53603-54076 | _na 157_aa | DUF695 domain-containing protein | |
| 1227 | VYYO01000006.1 | GCA009650825_02020 | CDS | open | 54160-55641 | _na 493_aa | Surface lipoprotein assembly modifier C-terminal beta-barrel domain-containing protein | |
| 1228 | VYYO01000006.1 | GCA009650825_02021 | CDS | open | 55811-56773 | _na 320_aa | Slam-dependent surface lipoprotein | |
| 1229 | VYYO01000006.1 | GCA009650825_02022 | CDS | open | 57007-60444 | _na 1145_aa | TonB-dependent receptor | |
| 1230 | VYYO01000006.1 | GCA009650825_02023 | CDS | open | 60774-60956 | _na 60_aa | Stability determinant | |
| 1231 | VYYO01000006.1 | GCA009650825_02024 | CDS | open | 61155-61853 | _na 232_aa | Resolvase | |
| 1232 | VYYO01000006.1 | GCA009650825_02025 | CDS | open | 61924-62289 | _na 121_aa | hypothetical protein | |
| 1233 | VYYO01000006.1 | GCA009650825_02026 | CDS | open | 62331-63272 | _na 313_aa | Integrase | |
| 1234 | VYYO01000006.1 | GCA009650825_02027 | CDS | open | 63337-64020 | _na 227_aa | lytic transglycosylase domain-containing protein | |
| 1235 | VYYO01000006.1 | GCA009650825_02028 | CDS | open | 64398-64898 | _na 166_aa | hypothetical protein | |
| 1236 | VYYO01000006.1 | GCA009650825_02029 | CDS | open | 64932-65450 | _na 172_aa | hypothetical protein | |
| 1237 | VYYO01000006.1 | GCA009650825_02030 | CDS | open | 65484-70139 | _na 1551_aa | traG | TraG N-terminal Proteobacteria domain-containing protein |
| 1238 | VYYO01000006.1 | GCA009650825_02031 | CDS | open | 70175-71707 | _na 510_aa | traH | Conjugal transfer protein TraH |
| 1239 | VYYO01000006.1 | GCA009650825_02032 | CDS | open | 71720-72409 | _na 229_aa | Cytochrome c domain-containing protein | |
| 1240 | VYYO01000006.1 | GCA009650825_02033 | CDS | open | 72406-72615 | _na 69_aa | hypothetical protein | |
| 1241 | VYYO01000006.1 | GCA009650825_02034 | CDS | open | 72698-73750 | _na 350_aa | Sel1 repeat family protein | |
| 1242 | VYYO01000006.1 | GCA009650825_02035 | CDS | open | 73761-74993 | _na 410_aa | traU | TraU family protein |
| 1243 | VYYO01000006.1 | GCA009650825_02036 | CDS | open | 75007-75894 | _na 295_aa | trbC | Type-F conjugative transfer system pilin assembly protein TrbC |
| 1244 | VYYO01000006.1 | GCA009650825_02037 | CDS | open | 76034-76555 | _na 173_aa | lepB | signal peptidase I |
| 1245 | VYYO01000006.1 | GCA009650825_02038 | CDS | open | 76567-77139 | _na 190_aa | Type-F conjugative transfer system protein (TrbI_Ftype) | |
| 1246 | VYYO01000006.1 | GCA009650825_02039 | CDS | open | 77160-79649 | _na 829_aa | virB4 | TraC family protein |
| 1247 | VYYO01000006.1 | GCA009650825_02040 | CDS | open | 79708-80139 | _na 143_aa | ssb | Single-stranded DNA-binding protein |
| 1248 | VYYO01000006.1 | GCA009650825_02041 | CDS | open | 80263-80691 | _na 142_aa | vapC | Ribonuclease VapC |
| 1249 | VYYO01000006.1 | GCA009650825_02042 | CDS | open | 80688-80927 | _na 79_aa | stbC1 | Antitoxin FitA-like ribbon-helix-helix domain-containing protein |
| 1250 | VYYO01000006.1 | GCA009650825_02043 | CDS | open | 81055-81345 | _na 96_aa | DUF2721 domain-containing protein | |
| 1251 | VYYO01000006.1 | GCA009650825_02044 | CDS | open | 81510-82016 | _na 168_aa | hypothetical protein | |
| 1252 | VYYO01000006.1 | GCA009650825_02045 | CDS | open | 82033-83133 | _na 366_aa | DUF1845 domain-containing protein | |
| 1253 | VYYO01000006.1 | GCA009650825_02046 | CDS | open | 83486-85105 | _na 539_aa | Replication protein | |
| 1254 | VYYO01000006.1 | GCA009650825_02047 | CDS | open | 85105-85857 | _na 250_aa | Helix-turn-helix domain-containing protein | |
| 1255 | VYYO01000006.1 | GCA009650825_02048 | CDS | open | 85854-86456 | _na 200_aa | DUF2857 domain-containing protein | |
| 1256 | VYYO01000006.1 | GCA009650825_02049 | CDS | open | 86449-88065 | _na 538_aa | ParB/Sulfiredoxin domain-containing protein | |
| 1257 | VYYO01000006.1 | GCA009650825_02050 | CDS | open | 88062-88982 | _na 306_aa | parA | Cobyrinic acid a%2Cc-diamide synthase |
| 1258 | VYYO01000006.1 | GCA009650825_01961 | gene | open | 381-1088 | ispD | ||
| 1259 | VYYO01000006.1 | GCA009650825_01962 | gene | open | 1085-1807 | dnaQ | ||
| 1260 | VYYO01000006.1 | GCA009650825_01963 | gene | open | 2247-2717 | rlmH | ||
| 1261 | VYYO01000006.1 | GCA009650825_01964 | gene | open | 2913-4148 | brkB | ||
| 1262 | VYYO01000006.1 | GCA009650825_01965 | gene | open | 4489-5799 | nlpD | ||
| 1263 | VYYO01000006.1 | GCA009650825_01966 | gene | open | 6093-6950 | htpX | ||
| 1264 | VYYO01000006.1 | GCA009650825_01967 | gene | open | 7004-7438 | |||
| 1265 | VYYO01000006.1 | GCA009650825_01968 | gene | open | 7658-8917 | xkdP | ||
| 1266 | VYYO01000006.1 | GCA009650825_01969 | gene | open | 9105-9608 | def | ||
| 1267 | VYYO01000006.1 | GCA009650825_01970 | gene | open | 9634-10569 | fmt | ||
| 1268 | VYYO01000006.1 | GCA009650825_01971 | gene | open | 10566-11825 | rsmB | ||
| 1269 | VYYO01000006.1 | GCA009650825_01972 | gene | open | 11788-12384 | |||
| 1270 | VYYO01000006.1 | GCA009650825_01973 | gene | open | 12394-14508 | ntrY | ||
| 1271 | VYYO01000006.1 | GCA009650825_01974 | gene | open | 14495-15769 | ntrX | ||
| 1272 | VYYO01000006.1 | GCA009650825_01975 | gene | open | 16273-17232 | accA | ||
| 1273 | VYYO01000006.1 | GCA009650825_01976 | gene | open | 17210-18514 | ttcA | ||
| 1274 | VYYO01000006.1 | GCA009650825_01977 | gene | open | 18772-19227 | |||
| 1275 | VYYO01000006.1 | GCA009650825_01978 | gene | open | 19295-19489 | |||
| 1276 | VYYO01000006.1 | GCA009650825_01979 | gene | open | 19615-20100 | tonB | ||
| 1277 | VYYO01000006.1 | GCA009650825_01980 | gene | open | 20132-20740 | osmY | ||
| 1278 | VYYO01000006.1 | GCA009650825_01981 | gene | open | 20778-21368 | gmhA | ||
| 1279 | VYYO01000006.1 | GCA009650825_01982 | gene | open | 21603-21950 | yraN | ||
| 1280 | VYYO01000006.1 | GCA009650825_01983 | gene | open | 22077-22955 | rsmI | ||
| 1281 | VYYO01000006.1 | GCA009650825_01984 | gene | open | 23206-23820 | |||
| 1282 | VYYO01000006.1 | GCA009650825_01985 | gene | open | 23904-24509 | |||
| 1283 | VYYO01000006.1 | GCA009650825_01986 | gene | open | 24591-24872 | |||
| 1284 | VYYO01000006.1 | GCA009650825_01987 | gene | open | 24869-25291 | |||
| 1285 | VYYO01000006.1 | GCA009650825_01988 | gene | open | 25505-26239 | traD | ||
| 1286 | VYYO01000006.1 | GCA009650825_01989 | gene | open | 26232-28280 | traD | ||
| 1287 | VYYO01000006.1 | GCA009650825_01990 | gene | open | 28281-30785 | mobH | ||
| 1288 | VYYO01000006.1 | GCA009650825_01991 | gene | open | 30806-31291 | |||
| 1289 | VYYO01000006.1 | GCA009650825_01992 | gene | open | 32001-33302 | |||
| 1290 | VYYO01000006.1 | GCA009650825_01993 | gene | open | 33302-33964 | |||
| 1291 | VYYO01000006.1 | GCA009650825_01994 | gene | open | 34053-34349 | |||
| 1292 | VYYO01000006.1 | GCA009650825_01995 | gene | open | 34346-34867 | |||
| 1293 | VYYO01000006.1 | GCA009650825_01996 | gene | open | 34864-35169 | traL | ||
| 1294 | VYYO01000006.1 | GCA009650825_01997 | gene | open | 35169-36059 | traE | ||
| 1295 | VYYO01000006.1 | GCA009650825_01998 | gene | open | 36073-36885 | traK | ||
| 1296 | VYYO01000006.1 | GCA009650825_01999 | gene | open | 36890-38161 | traB | ||
| 1297 | VYYO01000006.1 | GCA009650825_02000 | gene | open | 38158-38766 | traV | ||
| 1298 | VYYO01000006.1 | GCA009650825_02001 | gene | open | 38815-39144 | trbC | ||
| 1299 | VYYO01000006.1 | GCA009650825_02002 | gene | open | 39198-41105 | |||
| 1300 | VYYO01000006.1 | GCA009650825_02003 | gene | open | 41108-41686 | |||
| 1301 | VYYO01000006.1 | GCA009650825_02004 | gene | open | 41942-42415 | |||
| 1302 | VYYO01000006.1 | GCA009650825_02005 | gene | open | 42552-42818 | |||
| 1303 | VYYO01000006.1 | GCA009650825_02006 | gene | open | 42815-42970 | |||
| 1304 | VYYO01000006.1 | GCA009650825_02007 | gene | open | 43688-43891 | |||
| 1305 | VYYO01000006.1 | GCA009650825_02008 | gene | open | 43973-44587 | |||
| 1306 | VYYO01000006.1 | GCA009650825_02009 | gene | open | 44620-44946 | |||
| 1307 | VYYO01000006.1 | GCA009650825_02010 | gene | open | 45181-45414 | |||
| 1308 | VYYO01000006.1 | GCA009650825_02011 | gene | open | 45634-46209 | |||
| 1309 | VYYO01000006.1 | GCA009650825_02012 | gene | open | 46219-46809 | |||
| 1310 | VYYO01000006.1 | GCA009650825_02013 | gene | open | 47045-47377 | |||
| 1311 | VYYO01000006.1 | GCA009650825_02014 | gene | open | 47374-47724 | |||
| 1312 | VYYO01000006.1 | GCA009650825_02015 | gene | open | 47821-50175 | |||
| 1313 | VYYO01000006.1 | GCA009650825_02016 | gene | open | 50395-51504 | |||
| 1314 | VYYO01000006.1 | GCA009650825_02017 | gene | open | 51795-52565 | |||
| 1315 | VYYO01000006.1 | GCA009650825_02018 | gene | open | 52699-53457 | yubB | ||
| 1316 | VYYO01000006.1 | GCA009650825_02019 | gene | open | 53603-54076 | |||
| 1317 | VYYO01000006.1 | GCA009650825_02020 | gene | open | 54160-55641 | |||
| 1318 | VYYO01000006.1 | GCA009650825_02021 | gene | open | 55811-56773 | |||
| 1319 | VYYO01000006.1 | GCA009650825_02022 | gene | open | 57007-60444 | |||
| 1320 | VYYO01000006.1 | GCA009650825_02023 | gene | open | 60774-60956 | |||
| 1321 | VYYO01000006.1 | GCA009650825_02024 | gene | open | 61155-61853 | |||
| 1322 | VYYO01000006.1 | GCA009650825_02025 | gene | open | 61924-62289 | |||
| 1323 | VYYO01000006.1 | GCA009650825_02026 | gene | open | 62331-63272 | |||
| 1324 | VYYO01000006.1 | GCA009650825_02027 | gene | open | 63337-64020 | |||
| 1325 | VYYO01000006.1 | GCA009650825_02028 | gene | open | 64398-64898 | |||
| 1326 | VYYO01000006.1 | GCA009650825_02029 | gene | open | 64932-65450 | |||
| 1327 | VYYO01000006.1 | GCA009650825_02030 | gene | open | 65484-70139 | traG | ||
| 1328 | VYYO01000006.1 | GCA009650825_02031 | gene | open | 70175-71707 | traH | ||
| 1329 | VYYO01000006.1 | GCA009650825_02032 | gene | open | 71720-72409 | |||
| 1330 | VYYO01000006.1 | GCA009650825_02033 | gene | open | 72406-72615 | |||
| 1331 | VYYO01000006.1 | GCA009650825_02034 | gene | open | 72698-73750 | |||
| 1332 | VYYO01000006.1 | GCA009650825_02035 | gene | open | 73761-74993 | traU | ||
| 1333 | VYYO01000006.1 | GCA009650825_02036 | gene | open | 75007-75894 | trbC | ||
| 1334 | VYYO01000006.1 | GCA009650825_02037 | gene | open | 76034-76555 | lepB | ||
| 1335 | VYYO01000006.1 | GCA009650825_02038 | gene | open | 76567-77139 | |||
| 1336 | VYYO01000006.1 | GCA009650825_02039 | gene | open | 77160-79649 | virB4 | ||
| 1337 | VYYO01000006.1 | GCA009650825_02040 | gene | open | 79708-80139 | ssb | ||
| 1338 | VYYO01000006.1 | GCA009650825_02041 | gene | open | 80263-80691 | vapC | ||
| 1339 | VYYO01000006.1 | GCA009650825_02042 | gene | open | 80688-80927 | stbC1 | ||
| 1340 | VYYO01000006.1 | GCA009650825_02043 | gene | open | 81055-81345 | |||
| 1341 | VYYO01000006.1 | GCA009650825_02044 | gene | open | 81510-82016 | |||
| 1342 | VYYO01000006.1 | GCA009650825_02045 | gene | open | 82033-83133 | |||
| 1343 | VYYO01000006.1 | GCA009650825_02046 | gene | open | 83486-85105 | |||
| 1344 | VYYO01000006.1 | GCA009650825_02047 | gene | open | 85105-85857 | |||
| 1345 | VYYO01000006.1 | GCA009650825_02048 | gene | open | 85854-86456 | |||
| 1346 | VYYO01000006.1 | GCA009650825_02049 | gene | open | 86449-88065 | |||
| 1347 | VYYO01000006.1 | GCA009650825_02050 | gene | open | 88062-88982 | parA | ||
| 1348 | VYYO01000007.1 | repeat_region | open | 25395-25857 | CRISPR array with 7 repeats of length 36%2C consensus sequence GTCGGAAGACTTGCCCCACTCATCGGGGATTAAGAC and spacer length 33 | |||
| 1349 | VYYO01000007.1 | repeat_region | open | 69994-70526 | CRISPR array with 8 repeats of length 36%2C consensus sequence GTCTTAATCCCCGATGAGTGGGGCAAGTCTTCCGAC and spacer length 33 | |||
| 1350 | VYYO01000007.1 | GCA009650825_02076 | CDS | open | 974-1411 | _na 145_aa | hypothetical protein | |
| 1351 | VYYO01000007.1 | GCA009650825_02077 | CDS | open | 1368-2174 | _na 268_aa | hypothetical protein | |
| 1352 | VYYO01000007.1 | GCA009650825_02078 | CDS | open | 2022-2648 | _na 208_aa | hypothetical protein | |
| 1353 | VYYO01000007.1 | GCA009650825_02079 | CDS | open | 3183-4319 | _na 378_aa | tnpB | 2-isopropylmalate synthase |
| 1354 | VYYO01000007.1 | GCA009650825_02080 | CDS | open | 5032-5205 | _na 57_aa | hypothetical protein | |
| 1355 | VYYO01000007.1 | GCA009650825_02081 | CDS | open | 5963-7192 | _na 409_aa | ATPase | |
| 1356 | VYYO01000007.1 | GCA009650825_02082 | CDS | open | 7226-8074 | _na 282_aa | Nudix hydrolase domain-containing protein | |
| 1357 | VYYO01000007.1 | GCA009650825_02083 | CDS | open | 8187-8846 | _na 219_aa | Ser/Thr phosphatase family protein | |
| 1358 | VYYO01000007.1 | GCA009650825_02084 | CDS | open | 8952-9824 | _na 290_aa | Ser/Thr phosphatase family protein | |
| 1359 | VYYO01000007.1 | GCA009650825_02085 | CDS | open | 10370-12982 | _na 870_aa | type I restriction-modification system subunit M | |
| 1360 | VYYO01000007.1 | GCA009650825_02086 | CDS | open | 12992-14212 | _na 406_aa | restriction endonuclease subunit S | |
| 1361 | VYYO01000007.1 | GCA009650825_02087 | CDS | open | 14279-17359 | _na 1026_aa | Type I restriction enzyme endonuclease subunit | |
| 1362 | VYYO01000007.1 | GCA009650825_02088 | CDS | open | 18142-19389 | _na 415_aa | CRISPR-associated RAMP protein%2C Cmr1 family | |
| 1363 | VYYO01000007.1 | GCA009650825_02089 | CDS | open | 19407-21254 | _na 615_aa | cas10 | type III-B CRISPR-associated protein Cas10/Cmr2 |
| 1364 | VYYO01000007.1 | GCA009650825_02090 | CDS | open | 21251-22414 | _na 387_aa | cmr3 | type III-B CRISPR module-associated protein Cmr3 |
| 1365 | VYYO01000007.1 | GCA009650825_02091 | CDS | open | 22467-23372 | _na 301_aa | cmr4 | type III-B CRISPR module RAMP protein Cmr4 |
| 1366 | VYYO01000007.1 | GCA009650825_02092 | CDS | open | 23374-23748 | _na 124_aa | cmr5 | type III-B CRISPR module-associated protein Cmr5 |
| 1367 | VYYO01000007.1 | GCA009650825_02093 | CDS | open | 23745-24866 | _na 373_aa | cmr6 | type III-B CRISPR module RAMP protein Cmr6 |
| 1368 | VYYO01000007.1 | GCA009650825_02094 | CDS | open | 26053-26331 | _na 92_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 1369 | VYYO01000007.1 | GCA009650825_02095 | CDS | open | 26334-27311 | _na 325_aa | cas1 | CRISPR-associated endonuclease Cas1 |
| 1370 | VYYO01000007.1 | GCA009650825_02096 | CDS | open | 27314-27703 | _na 129_aa | DUF4041 domain-containing protein | |
| 1371 | VYYO01000007.1 | GCA009650825_02097 | CDS | open | 27706-27906 | _na 66_aa | hypothetical protein | |
| 1372 | VYYO01000007.1 | GCA009650825_02098 | CDS | open | 27917-28459 | _na 180_aa | hypothetical protein | |
| 1373 | VYYO01000007.1 | GCA009650825_02099 | CDS | open | 28495-28917 | _na 140_aa | hypothetical protein | |
| 1374 | VYYO01000007.1 | GCA009650825_02100 | CDS | open | 29112-29387 | _na 91_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 1375 | VYYO01000007.1 | GCA009650825_02101 | CDS | open | 29706-30533 | _na 275_aa | D12 class N6 adenine-specific DNA methyltransferase | |
| 1376 | VYYO01000007.1 | GCA009650825_02102 | CDS | open | 30598-30720 | _na 40_aa | hypothetical protein | |
| 1377 | VYYO01000007.1 | GCA009650825_02103 | CDS | open | 31027-31254 | _na 75_aa | hypothetical protein | |
| 1378 | VYYO01000007.1 | GCA009650825_02104 | CDS | open | 31268-33100 | _na 610_aa | Phage tail protein | |
| 1379 | VYYO01000007.1 | GCA009650825_02105 | CDS | open | 33110-33478 | _na 122_aa | Carboxypeptidase regulatory-like domain-containing protein | |
| 1380 | VYYO01000007.1 | GCA009650825_02106 | CDS | open | 33484-34410 | _na 308_aa | hypothetical protein | |
| 1381 | VYYO01000007.1 | GCA009650825_02107 | CDS | open | 34435-37932 | _na 1165_aa | Tape measure domain protein | |
| 1382 | VYYO01000007.1 | GCA009650825_02108 | CDS | open | 38040-38444 | _na 134_aa | Phage tail protein | |
| 1383 | VYYO01000007.1 | GCA009650825_02109 | CDS | open | 38445-42260 | _na 1271_aa | Tape measure protein N-terminal domain-containing protein | |
| 1384 | VYYO01000007.1 | GCA009650825_02110 | CDS | open | 42403-43158 | _na 251_aa | Phage tail protein | |
| 1385 | VYYO01000007.1 | GCA009650825_02111 | CDS | open | 43192-43662 | _na 156_aa | Bacterial transcription activator effector binding domain-containing protein | |
| 1386 | VYYO01000007.1 | GCA009650825_02112 | CDS | open | 43662-44105 | _na 147_aa | phage virion morphogenesis protein | |
| 1387 | VYYO01000007.1 | GCA009650825_02113 | CDS | open | 44102-44521 | _na 139_aa | DUF1320 domain-containing protein | |
| 1388 | VYYO01000007.1 | GCA009650825_02114 | CDS | open | 44535-45524 | _na 329_aa | Major capsid protein E | |
| 1389 | VYYO01000007.1 | GCA009650825_02115 | CDS | open | 45614-45949 | _na 111_aa | Oxaloacetate decarboxylase alpha chain | |
| 1390 | VYYO01000007.1 | GCA009650825_02116 | CDS | open | 45942-46874 | _na 310_aa | Capsid maturation protease | |
| 1391 | VYYO01000007.1 | GCA009650825_02117 | CDS | open | 47183-47389 | _na 68_aa | hypothetical protein | |
| 1392 | VYYO01000007.1 | GCA009650825_02118 | CDS | open | 47395-49071 | _na 558_aa | phage minor head protein | |
| 1393 | VYYO01000007.1 | GCA009650825_02119 | CDS | open | 49064-50521 | _na 485_aa | DUF935 domain-containing protein | |
| 1394 | VYYO01000007.1 | GCA009650825_02120 | CDS | open | 50514-50726 | _na 70_aa | hypothetical protein | |
| 1395 | VYYO01000007.1 | GCA009650825_02121 | CDS | open | 50736-52385 | _na 549_aa | Phage protein | |
| 1396 | VYYO01000007.1 | GCA009650825_02122 | CDS | open | 52397-52897 | _na 166_aa | DNA-binding protein | |
| 1397 | VYYO01000007.1 | GCA009650825_02123 | CDS | open | 52901-53110 | _na 69_aa | DUF3618 domain-containing protein | |
| 1398 | VYYO01000007.1 | GCA009650825_02124 | CDS | open | 53107-53388 | _na 93_aa | Phage protein | |
| 1399 | VYYO01000007.1 | GCA009650825_02125 | CDS | open | 53375-53734 | _na 119_aa | hypothetical protein | |
| 1400 | VYYO01000007.1 | GCA009650825_02126 | CDS | open | 53930-54367 | _na 145_aa | Phage associated protein | |
| 1401 | VYYO01000007.1 | GCA009650825_02127 | CDS | open | 54342-54608 | _na 88_aa | Phage protein | |
| 1402 | VYYO01000007.1 | GCA009650825_02128 | CDS | open | 54605-54826 | _na 73_aa | hypothetical protein | |
| 1403 | VYYO01000007.1 | GCA009650825_02129 | CDS | open | 54823-55353 | _na 176_aa | N-acetylmuramoyl-L-alanine amidase | |
| 1404 | VYYO01000007.1 | GCA009650825_02130 | CDS | open | 55500-55985 | _na 161_aa | Mor transcription activator domain-containing protein | |
| 1405 | VYYO01000007.1 | GCA009650825_02131 | CDS | open | 55982-56398 | _na 138_aa | gemA | Regulatory protein GemA |
| 1406 | VYYO01000007.1 | GCA009650825_02132 | CDS | open | 56513-56719 | _na 68_aa | hypothetical protein | |
| 1407 | VYYO01000007.1 | GCA009650825_02133 | CDS | open | 56766-57215 | _na 149_aa | hypothetical protein | |
| 1408 | VYYO01000007.1 | GCA009650825_02134 | CDS | open | 57303-57575 | _na 90_aa | DNA-binding protein | |
| 1409 | VYYO01000007.1 | GCA009650825_02135 | CDS | open | 57579-57719 | _na 46_aa | Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein | |
| 1410 | VYYO01000007.1 | GCA009650825_02136 | CDS | open | 57781-58665 | _na 294_aa | rdgC | recombination-associated protein RdgC |
| 1411 | VYYO01000007.1 | GCA009650825_02137 | CDS | open | 58655-58969 | _na 104_aa | hypothetical protein | |
| 1412 | VYYO01000007.1 | GCA009650825_02138 | CDS | open | 58966-59232 | _na 88_aa | hypothetical protein | |
| 1413 | VYYO01000007.1 | GCA009650825_02139 | CDS | open | 59234-59773 | _na 179_aa | Host-nuclease inhibitor protein Gam | |
| 1414 | VYYO01000007.1 | GCA009650825_02140 | CDS | open | 59776-60177 | _na 133_aa | Replicative helicase inhibitor G39P N-terminal domain-containing protein | |
| 1415 | VYYO01000007.1 | GCA009650825_02141 | CDS | open | 60183-60668 | _na 161_aa | DUF2752 domain-containing protein | |
| 1416 | VYYO01000007.1 | GCA009650825_02142 | CDS | open | 60665-60982 | _na 105_aa | hypothetical protein | |
| 1417 | VYYO01000007.1 | GCA009650825_02143 | CDS | open | 60994-61677 | _na 227_aa | DUF2786 domain-containing protein | |
| 1418 | VYYO01000007.1 | GCA009650825_02144 | CDS | open | 61679-62209 | _na 176_aa | Morphogenetic protein | |
| 1419 | VYYO01000007.1 | GCA009650825_02145 | CDS | open | 62211-62930 | _na 239_aa | hypothetical protein | |
| 1420 | VYYO01000007.1 | GCA009650825_02146 | CDS | open | 62933-63088 | _na 51_aa | hypothetical protein | |
| 1421 | VYYO01000007.1 | GCA009650825_02147 | CDS | open | 63085-63384 | _na 99_aa | Lipoprotein | |
| 1422 | VYYO01000007.1 | GCA009650825_02148 | CDS | open | 63436-63612 | _na 58_aa | hypothetical protein | |
| 1423 | VYYO01000007.1 | GCA009650825_02149 | CDS | open | 63614-64531 | _na 305_aa | ORC1/DEAH AAA+ ATPase domain-containing protein | |
| 1424 | VYYO01000007.1 | GCA009650825_02150 | CDS | open | 64574-66478 | _na 634_aa | Transposase | |
| 1425 | VYYO01000007.1 | GCA009650825_02151 | CDS | open | 66606-67082 | _na 158_aa | DNA-binding protein | |
| 1426 | VYYO01000007.1 | GCA009650825_02152 | CDS | open | 67611-68450 | _na 279_aa | Peptidase S24-like protein | |
| 1427 | VYYO01000007.1 | GCA009650825_02153 | CDS | open | 68932-69867 | _na 311_aa | CRISPR-associated protein Cas6 C-terminal domain-containing protein | |
| 1428 | VYYO01000007.1 | GCA009650825_02154 | CDS | open | 70753-72033 | _na 426_aa | DUF1887 domain-containing protein | |
| 1429 | VYYO01000007.1 | GCA009650825_02155 | CDS | open | 72101-74731 | _na 876_aa | Tetratricopeptide repeat protein | |
| 1430 | VYYO01000007.1 | GCA009650825_02156 | CDS | open | 74789-75979 | _na 396_aa | csm6 | CRISPR-associated ring nuclease Csm6 |
| 1431 | VYYO01000007.1 | GCA009650825_02076 | gene | open | 974-1411 | |||
| 1432 | VYYO01000007.1 | GCA009650825_02077 | gene | open | 1368-2174 | |||
| 1433 | VYYO01000007.1 | GCA009650825_02078 | gene | open | 2022-2648 | |||
| 1434 | VYYO01000007.1 | GCA009650825_02079 | gene | open | 3183-4319 | tnpB | ||
| 1435 | VYYO01000007.1 | GCA009650825_02080 | gene | open | 5032-5205 | |||
| 1436 | VYYO01000007.1 | GCA009650825_02081 | gene | open | 5963-7192 | |||
| 1437 | VYYO01000007.1 | GCA009650825_02082 | gene | open | 7226-8074 | |||
| 1438 | VYYO01000007.1 | GCA009650825_02083 | gene | open | 8187-8846 | |||
| 1439 | VYYO01000007.1 | GCA009650825_02084 | gene | open | 8952-9824 | |||
| 1440 | VYYO01000007.1 | GCA009650825_02085 | gene | open | 10370-12982 | |||
| 1441 | VYYO01000007.1 | GCA009650825_02086 | gene | open | 12992-14212 | |||
| 1442 | VYYO01000007.1 | GCA009650825_02087 | gene | open | 14279-17359 | |||
| 1443 | VYYO01000007.1 | GCA009650825_02088 | gene | open | 18142-19389 | |||
| 1444 | VYYO01000007.1 | GCA009650825_02089 | gene | open | 19407-21254 | cas10 | ||
| 1445 | VYYO01000007.1 | GCA009650825_02090 | gene | open | 21251-22414 | cmr3 | ||
| 1446 | VYYO01000007.1 | GCA009650825_02091 | gene | open | 22467-23372 | cmr4 | ||
| 1447 | VYYO01000007.1 | GCA009650825_02092 | gene | open | 23374-23748 | cmr5 | ||
| 1448 | VYYO01000007.1 | GCA009650825_02093 | gene | open | 23745-24866 | cmr6 | ||
| 1449 | VYYO01000007.1 | GCA009650825_02094 | gene | open | 26053-26331 | cas2 | ||
| 1450 | VYYO01000007.1 | GCA009650825_02095 | gene | open | 26334-27311 | cas1 | ||
| 1451 | VYYO01000007.1 | GCA009650825_02096 | gene | open | 27314-27703 | |||
| 1452 | VYYO01000007.1 | GCA009650825_02097 | gene | open | 27706-27906 | |||
| 1453 | VYYO01000007.1 | GCA009650825_02098 | gene | open | 27917-28459 | |||
| 1454 | VYYO01000007.1 | GCA009650825_02099 | gene | open | 28495-28917 | |||
| 1455 | VYYO01000007.1 | GCA009650825_02100 | gene | open | 29112-29387 | cas2 | ||
| 1456 | VYYO01000007.1 | GCA009650825_02101 | gene | open | 29706-30533 | |||
| 1457 | VYYO01000007.1 | GCA009650825_02102 | gene | open | 30598-30720 | |||
| 1458 | VYYO01000007.1 | GCA009650825_02103 | gene | open | 31027-31254 | |||
| 1459 | VYYO01000007.1 | GCA009650825_02104 | gene | open | 31268-33100 | |||
| 1460 | VYYO01000007.1 | GCA009650825_02105 | gene | open | 33110-33478 | |||
| 1461 | VYYO01000007.1 | GCA009650825_02106 | gene | open | 33484-34410 | |||
| 1462 | VYYO01000007.1 | GCA009650825_02107 | gene | open | 34435-37932 | |||
| 1463 | VYYO01000007.1 | GCA009650825_02108 | gene | open | 38040-38444 | |||
| 1464 | VYYO01000007.1 | GCA009650825_02109 | gene | open | 38445-42260 | |||
| 1465 | VYYO01000007.1 | GCA009650825_02110 | gene | open | 42403-43158 | |||
| 1466 | VYYO01000007.1 | GCA009650825_02111 | gene | open | 43192-43662 | |||
| 1467 | VYYO01000007.1 | GCA009650825_02112 | gene | open | 43662-44105 | |||
| 1468 | VYYO01000007.1 | GCA009650825_02113 | gene | open | 44102-44521 | |||
| 1469 | VYYO01000007.1 | GCA009650825_02114 | gene | open | 44535-45524 | |||
| 1470 | VYYO01000007.1 | GCA009650825_02115 | gene | open | 45614-45949 | |||
| 1471 | VYYO01000007.1 | GCA009650825_02116 | gene | open | 45942-46874 | |||
| 1472 | VYYO01000007.1 | GCA009650825_02117 | gene | open | 47183-47389 | |||
| 1473 | VYYO01000007.1 | GCA009650825_02118 | gene | open | 47395-49071 | |||
| 1474 | VYYO01000007.1 | GCA009650825_02119 | gene | open | 49064-50521 | |||
| 1475 | VYYO01000007.1 | GCA009650825_02120 | gene | open | 50514-50726 | |||
| 1476 | VYYO01000007.1 | GCA009650825_02121 | gene | open | 50736-52385 | |||
| 1477 | VYYO01000007.1 | GCA009650825_02122 | gene | open | 52397-52897 | |||
| 1478 | VYYO01000007.1 | GCA009650825_02123 | gene | open | 52901-53110 | |||
| 1479 | VYYO01000007.1 | GCA009650825_02124 | gene | open | 53107-53388 | |||
| 1480 | VYYO01000007.1 | GCA009650825_02125 | gene | open | 53375-53734 | |||
| 1481 | VYYO01000007.1 | GCA009650825_02126 | gene | open | 53930-54367 | |||
| 1482 | VYYO01000007.1 | GCA009650825_02127 | gene | open | 54342-54608 | |||
| 1483 | VYYO01000007.1 | GCA009650825_02128 | gene | open | 54605-54826 | |||
| 1484 | VYYO01000007.1 | GCA009650825_02129 | gene | open | 54823-55353 | |||
| 1485 | VYYO01000007.1 | GCA009650825_02130 | gene | open | 55500-55985 | |||
| 1486 | VYYO01000007.1 | GCA009650825_02131 | gene | open | 55982-56398 | gemA | ||
| 1487 | VYYO01000007.1 | GCA009650825_02132 | gene | open | 56513-56719 | |||
| 1488 | VYYO01000007.1 | GCA009650825_02133 | gene | open | 56766-57215 | |||
| 1489 | VYYO01000007.1 | GCA009650825_02134 | gene | open | 57303-57575 | |||
| 1490 | VYYO01000007.1 | GCA009650825_02135 | gene | open | 57579-57719 | |||
| 1491 | VYYO01000007.1 | GCA009650825_02136 | gene | open | 57781-58665 | rdgC | ||
| 1492 | VYYO01000007.1 | GCA009650825_02137 | gene | open | 58655-58969 | |||
| 1493 | VYYO01000007.1 | GCA009650825_02138 | gene | open | 58966-59232 | |||
| 1494 | VYYO01000007.1 | GCA009650825_02139 | gene | open | 59234-59773 | |||
| 1495 | VYYO01000007.1 | GCA009650825_02140 | gene | open | 59776-60177 | |||
| 1496 | VYYO01000007.1 | GCA009650825_02141 | gene | open | 60183-60668 | |||
| 1497 | VYYO01000007.1 | GCA009650825_02142 | gene | open | 60665-60982 | |||
| 1498 | VYYO01000007.1 | GCA009650825_02143 | gene | open | 60994-61677 | |||
| 1499 | VYYO01000007.1 | GCA009650825_02144 | gene | open | 61679-62209 | |||
| 1500 | VYYO01000007.1 | GCA009650825_02145 | gene | open | 62211-62930 |

