BAKTAGenome Explorer: Prevotella vespertina (GCA_009728485.1)
Select a Genome:
|
BAKTA Annotations for GCA_009728485.1
|
Search & Sort all 4807 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 501 | VVIQ01000001.1 | GCA009728485_00710 | gene | open | 257614-258060 | coaD | ||
| 502 | VVIQ01000001.1 | GCA009728485_00711 | gene | open | 258215-259249 | ruvB | ||
| 503 | VVIQ01000001.1 | GCA009728485_00712 | gene | open | 259512-260432 | |||
| 504 | VVIQ01000001.1 | GCA009728485_00713 | gene | open | 260717-261328 | |||
| 505 | VVIQ01000001.1 | GCA009728485_00714 | gene | open | 261403-262095 | |||
| 506 | VVIQ01000001.1 | GCA009728485_00715 | gene | open | 262214-262819 | |||
| 507 | VVIQ01000001.1 | GCA009728485_00716 | gene | open | 262914-263840 | |||
| 508 | VVIQ01000001.1 | GCA009728485_00717 | gene | open | 264062-265123 | |||
| 509 | VVIQ01000001.1 | GCA009728485_00718 | gene | open | 265333-265797 | lrp | ||
| 510 | VVIQ01000001.1 | GCA009728485_00719 | gene | open | 265855-267714 | |||
| 511 | VVIQ01000001.1 | GCA009728485_00720 | gene | open | 267736-268761 | |||
| 512 | VVIQ01000001.1 | GCA009728485_00721 | gene | open | 269130-269855 | |||
| 513 | VVIQ01000001.1 | GCA009728485_00722 | gene | open | 270172-271491 | |||
| 514 | VVIQ01000001.1 | GCA009728485_00723 | gene | open | 271582-272637 | ansB | ||
| 515 | VVIQ01000001.1 | GCA009728485_00724 | gene | open | 272722-274029 | |||
| 516 | VVIQ01000001.1 | GCA009728485_00725 | gene | open | 274082-275494 | aspA | ||
| 517 | VVIQ01000001.1 | GCA009728485_00726 | gene | open | 275728-276801 | |||
| 518 | VVIQ01000001.1 | GCA009728485_00727 | gene | open | 277032-279602 | |||
| 519 | VVIQ01000001.1 | GCA009728485_00728 | gene | open | 279791-279967 | |||
| 520 | VVIQ01000001.1 | GCA009728485_00729 | gene | open | 280090-281295 | |||
| 521 | VVIQ01000001.1 | GCA009728485_00730 | gene | open | 281738-282553 | |||
| 522 | VVIQ01000001.1 | GCA009728485_00731 | gene | open | 282678-284549 | mnmG | ||
| 523 | VVIQ01000001.1 | GCA009728485_00732 | gene | open | 284667-285197 | apt | ||
| 524 | VVIQ01000001.1 | GCA009728485_00733 | gene | open | 285421-287253 | uvrC | ||
| 525 | VVIQ01000001.1 | GCA009728485_00734 | gene | open | 287288-287740 | dtd | ||
| 526 | VVIQ01000001.1 | GCA009728485_00735 | gene | open | 287740-288075 | mazG | ||
| 527 | VVIQ01000001.1 | GCA009728485_00736 | gene | open | 288131-289078 | deoC | ||
| 528 | VVIQ01000001.1 | GCA009728485_00737 | gene | open | 289468-290481 | |||
| 529 | VVIQ01000001.1 | GCA009728485_00738 | gene | open | 290543-293305 | polA | ||
| 530 | VVIQ01000001.1 | GCA009728485_00739 | gene | open | 293759-295270 | |||
| 531 | VVIQ01000001.1 | GCA009728485_00740 | gene | open | 295350-297350 | sbsA | ||
| 532 | VVIQ01000001.1 | GCA009728485_00741 | gene | open | 297388-297513 | |||
| 533 | VVIQ01000001.1 | GCA009728485_00742 | gene | open | 297572-298546 | |||
| 534 | VVIQ01000001.1 | GCA009728485_00743 | gene | open | 298620-300638 | porZ | ||
| 535 | VVIQ01000001.1 | GCA009728485_00744 | gene | open | 300663-301559 | |||
| 536 | VVIQ01000001.1 | GCA009728485_00745 | gene | open | 301573-302154 | |||
| 537 | VVIQ01000001.1 | GCA009728485_00746 | gene | open | 302168-303202 | |||
| 538 | VVIQ01000001.1 | GCA009728485_00747 | gene | open | 303224-306136 | leuS | ||
| 539 | VVIQ01000001.1 | GCA009728485_00748 | gene | open | 306666-308441 | |||
| 540 | VVIQ01000001.1 | GCA009728485_00749 | gene | open | 308513-308839 | |||
| 541 | VVIQ01000001.1 | GCA009728485_00750 | gene | open | 308926-309573 | |||
| 542 | VVIQ01000001.1 | GCA009728485_00751 | gene | open | 309622-311136 | rpoN | ||
| 543 | VVIQ01000001.1 | GCA009728485_00752 | gene | open | 311133-311783 | |||
| 544 | VVIQ01000001.1 | GCA009728485_00753 | gene | open | 311827-312333 | |||
| 545 | VVIQ01000001.1 | GCA009728485_00754 | gene | open | 312459-314393 | |||
| 546 | VVIQ01000001.1 | GCA009728485_00755 | gene | open | 314577-315641 | |||
| 547 | VVIQ01000001.1 | GCA009728485_00756 | gene | open | 315698-316336 | |||
| 548 | VVIQ01000001.1 | GCA009728485_00757 | gene | open | 316383-317372 | |||
| 549 | VVIQ01000001.1 | GCA009728485_00758 | gene | open | 317356-317952 | |||
| 550 | VVIQ01000001.1 | GCA009728485_00759 | gene | open | 318625-318918 | |||
| 551 | VVIQ01000001.1 | GCA009728485_00760 | gene | open | 318997-321657 | mutS | ||
| 552 | VVIQ01000001.1 | GCA009728485_00761 | gene | open | 321983-322588 | |||
| 553 | VVIQ01000001.1 | GCA009728485_00762 | gene | open | 323520-323756 | acpP | ||
| 554 | VVIQ01000001.1 | GCA009728485_00763 | gene | open | 323847-325109 | fabF | ||
| 555 | VVIQ01000001.1 | GCA009728485_00764 | gene | open | 325099-326163 | rnc | ||
| 556 | VVIQ01000001.1 | GCA009728485_00765 | gene | open | 326192-326329 | |||
| 557 | VVIQ01000001.1 | GCA009728485_00766 | gene | open | 326333-327436 | ychF | ||
| 558 | VVIQ01000001.1 | GCA009728485_00767 | gene | open | 327455-328297 | lgt | ||
| 559 | VVIQ01000001.1 | GCA009728485_00768 | gene | open | 328931-331453 | |||
| 560 | VVIQ01000001.1 | GCA009728485_00769 | gene | open | 331842-332888 | nrdB | ||
| 561 | VVIQ01000001.1 | GCA009728485_00770 | gene | open | 333007-333150 | |||
| 562 | VVIQ01000001.1 | GCA009728485_00771 | gene | open | 333439-334248 | |||
| 563 | VVIQ01000001.1 | GCA009728485_00772 | gene | open | 335260-336855 | |||
| 564 | VVIQ01000001.1 | GCA009728485_00773 | gene | open | 337220-337726 | |||
| 565 | VVIQ01000001.1 | GCA009728485_00774 | gene | open | 337734-338954 | |||
| 566 | VVIQ01000001.1 | GCA009728485_00775 | gene | open | 339016-341952 | |||
| 567 | VVIQ01000001.1 | GCA009728485_00776 | gene | open | 341992-343557 | susD | ||
| 568 | VVIQ01000001.1 | GCA009728485_00777 | gene | open | 344071-345303 | |||
| 569 | VVIQ01000001.1 | GCA009728485_00778 | gene | open | 345324-347345 | |||
| 570 | VVIQ01000001.1 | GCA009728485_00779 | gene | open | 347492-349963 | |||
| 571 | VVIQ01000001.1 | GCA009728485_00780 | gene | open | 350495-351466 | |||
| 572 | VVIQ01000001.1 | GCA009728485_00781 | gene | open | 351548-352564 | |||
| 573 | VVIQ01000001.1 | GCA009728485_00782 | gene | open | 352622-354901 | rnr | ||
| 574 | VVIQ01000001.1 | GCA009728485_00783 | gene | open | 355265-356080 | |||
| 575 | VVIQ01000001.1 | GCA009728485_00784 | gene | open | 356112-357113 | |||
| 576 | VVIQ01000001.1 | GCA009728485_00785 | gene | open | 357289-357837 | trmH | ||
| 577 | VVIQ01000001.1 | GCA009728485_00786 | gene | open | 357838-358254 | sufE | ||
| 578 | VVIQ01000001.1 | GCA009728485_00787 | gene | open | 358421-359674 | rlhA | ||
| 579 | VVIQ01000001.1 | GCA009728485_00788 | gene | open | 359977-361305 | miaB | ||
| 580 | VVIQ01000001.1 | GCA009728485_00789 | gene | open | 361339-363198 | mdlB | ||
| 581 | VVIQ01000001.1 | GCA009728485_00790 | gene | open | 363500-364027 | |||
| 582 | VVIQ01000001.1 | GCA009728485_00791 | gene | open | 364232-364621 | |||
| 583 | VVIQ01000001.1 | GCA009728485_00792 | gene | open | 364625-366523 | porG | ||
| 584 | VVIQ01000001.1 | GCA009728485_00793 | gene | open | 366562-367569 | porB | ||
| 585 | VVIQ01000001.1 | GCA009728485_00794 | gene | open | 367648-368481 | |||
| 586 | VVIQ01000001.1 | GCA009728485_00795 | gene | open | 368824-369141 | |||
| 587 | VVIQ01000001.1 | GCA009728485_00796 | gene | open | 369202-369732 | |||
| 588 | VVIQ01000001.1 | GCA009728485_00797 | gene | open | 369764-370492 | |||
| 589 | VVIQ01000001.1 | GCA009728485_00798 | gene | open | 370774-371424 | |||
| 590 | VVIQ01000001.1 | GCA009728485_00799 | gene | open | 371599-372348 | lemA | ||
| 591 | VVIQ01000001.1 | GCA009728485_00800 | gene | open | 372358-374088 | |||
| 592 | VVIQ01000001.1 | GCA009728485_00801 | gene | open | 374340-375602 | |||
| 593 | VVIQ01000001.1 | GCA009728485_00802 | gene | open | 375790-376449 | upp | ||
| 594 | VVIQ01000001.1 | GCA009728485_00803 | gene | open | 376728-378341 | pckA | ||
| 595 | VVIQ01000001.1 | GCA009728485_00804 | gene | open | 378594-379049 | |||
| 596 | VVIQ01000001.1 | GCA009728485_00805 | gene | open | 379787-381169 | |||
| 597 | VVIQ01000001.1 | GCA009728485_00806 | gene | open | 381188-381880 | |||
| 598 | VVIQ01000001.1 | GCA009728485_00807 | gene | open | 381931-382683 | |||
| 599 | VVIQ01000001.1 | GCA009728485_00808 | gene | open | 382698-385319 | yaeT | ||
| 600 | VVIQ01000001.1 | GCA009728485_00809 | gene | open | 385440-385988 | hlpA | ||
| 601 | VVIQ01000001.1 | GCA009728485_00810 | gene | open | 386074-386577 | hlpA | ||
| 602 | VVIQ01000001.1 | GCA009728485_00811 | gene | open | 386728-387243 | |||
| 603 | VVIQ01000001.1 | GCA009728485_00812 | gene | open | 387329-388168 | murI | ||
| 604 | VVIQ01000001.1 | GCA009728485_00813 | gene | open | 388220-389686 | |||
| 605 | VVIQ01000001.1 | GCA009728485_00814 | gene | open | 389767-390246 | cdd | ||
| 606 | VVIQ01000001.1 | GCA009728485_00815 | gene | open | 390277-390477 | |||
| 607 | VVIQ01000001.1 | GCA009728485_00816 | gene | open | 391205-392914 | nptA | ||
| 608 | VVIQ01000001.1 | GCA009728485_00817 | gene | open | 393094-394698 | |||
| 609 | VVIQ01000001.1 | GCA009728485_00818 | gene | open | 394784-394996 | |||
| 610 | VVIQ01000001.1 | GCA009728485_00819 | gene | open | 395073-396560 | cysS | ||
| 611 | VVIQ01000001.1 | GCA009728485_00820 | gene | open | 397199-398152 | |||
| 612 | VVIQ01000001.1 | GCA009728485_00821 | gene | open | 398251-399198 | |||
| 613 | VVIQ01000001.1 | GCA009728485_00822 | gene | open | 399282-399623 | rsiV | ||
| 614 | VVIQ01000001.1 | GCA009728485_00823 | gene | open | 399760-400458 | |||
| 615 | VVIQ01000001.1 | GCA009728485_00596 | gene | open | 98559-98632 | trnN | ||
| 616 | VVIQ01000001.1 | GCA009728485_00596 | tRNA | open | 98559-98632 | trnN | tRNA-Asn(gtt) | |
| 617 | VVIQ01000002.1 | repeat_region | open | 323509-324945 | CRISPR array with 19 repeats of length 47%2C consensus sequence GTTGTGATTAGCTTTAAAATTAGTATCTTTGCATTATCAAATACAAC and spacer length 29 | |||
| 618 | VVIQ01000002.1 | GCA009728485_00843 | CDS | open | 932-1744 | _na 270_aa | RNA polymerase subunit sigma | |
| 619 | VVIQ01000002.1 | GCA009728485_00844 | CDS | open | 1914-2027 | _na 37_aa | hypothetical protein | |
| 620 | VVIQ01000002.1 | GCA009728485_00845 | CDS | open | 2526-3143 | _na 205_aa | DNA alkylation repair enzyme | |
| 621 | VVIQ01000002.1 | GCA009728485_00846 | CDS | open | 3991-4281 | _na 96_aa | DUF721 domain-containing protein | |
| 622 | VVIQ01000002.1 | GCA009728485_00847 | CDS | open | 4286-5392 | _na 368_aa | recF | DNA replication/repair protein RecF |
| 623 | VVIQ01000002.1 | GCA009728485_00848 | CDS | open | 5578-6252 | _na 224_aa | Tetratricopeptide repeat protein | |
| 624 | VVIQ01000002.1 | GCA009728485_00849 | CDS | open | 6262-6738 | _na 158_aa | ribH | 6%2C7-dimethyl-8-ribityllumazine synthase |
| 625 | VVIQ01000002.1 | GCA009728485_00850 | CDS | open | 6972-9203 | _na 743_aa | Putative alpha-1%2C2-mannosidase | |
| 626 | VVIQ01000002.1 | GCA009728485_00851 | CDS | open | 9569-11206 | _na 545_aa | hcp | hydroxylamine reductase |
| 627 | VVIQ01000002.1 | GCA009728485_00852 | CDS | open | 11599-12057 | _na 152_aa | araC | HTH araC/xylS-type domain-containing protein |
| 628 | VVIQ01000002.1 | GCA009728485_00853 | CDS | open | 12084-14189 | _na 701_aa | Peptidase family M49 domain protein | |
| 629 | VVIQ01000002.1 | GCA009728485_00854 | CDS | open | 14536-15627 | _na 363_aa | gmd | GDP-mannose 4%2C6-dehydratase |
| 630 | VVIQ01000002.1 | GCA009728485_00855 | CDS | open | 15645-16847 | _na 400_aa | wcaG | GDP-L-fucose synthase |
| 631 | VVIQ01000002.1 | GCA009728485_00856 | CDS | open | 16869-18983 | _na 704_aa | prolyl oligopeptidase | |
| 632 | VVIQ01000002.1 | GCA009728485_00857 | CDS | open | 19154-19924 | _na 256_aa | UPF0246 protein HMPREF0973_00515 | |
| 633 | VVIQ01000002.1 | GCA009728485_00858 | CDS | open | 19958-20155 | _na 65_aa | Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein | |
| 634 | VVIQ01000002.1 | GCA009728485_00859 | CDS | open | 20178-20573 | _na 131_aa | Integral membrane protein | |
| 635 | VVIQ01000002.1 | GCA009728485_00860 | CDS | open | 20797-21450 | _na 217_aa | DUF218 domain-containing protein | |
| 636 | VVIQ01000002.1 | GCA009728485_00864 | CDS | open | 22691-23731 | _na 346_aa | asparaginase | |
| 637 | VVIQ01000002.1 | GCA009728485_00865 | CDS | open | 23986-24549 | _na 187_aa | Zinc ribbon domain-containing protein | |
| 638 | VVIQ01000002.1 | GCA009728485_00866 | CDS | open | 25188-26132 | _na 314_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 639 | VVIQ01000002.1 | GCA009728485_00867 | CDS | open | 26143-28995 | _na 950_aa | Peptidase%2C S8/S53 family | |
| 640 | VVIQ01000002.1 | GCA009728485_00868 | CDS | open | 29008-30729 | _na 573_aa | BACON domain-containing protein | |
| 641 | VVIQ01000002.1 | GCA009728485_00869 | CDS | open | 30757-32379 | _na 540_aa | susD | SusD family protein |
| 642 | VVIQ01000002.1 | GCA009728485_00870 | CDS | open | 32394-35393 | _na 999_aa | TonB-linked outer membrane protein%2C SusC/RagA family | |
| 643 | VVIQ01000002.1 | GCA009728485_00871 | CDS | open | 35904-37523 | _na 539_aa | Outer membrane lipoprotein BamD-like domain-containing protein | |
| 644 | VVIQ01000002.1 | GCA009728485_00872 | CDS | open | 38217-40358 | _na 713_aa | nrdD | anaerobic ribonucleoside-triphosphate reductase |
| 645 | VVIQ01000002.1 | GCA009728485_00873 | CDS | open | 40304-40771 | _na 155_aa | nrdG | anaerobic ribonucleoside-triphosphate reductase activating protein |
| 646 | VVIQ01000002.1 | GCA009728485_00874 | CDS | open | 40920-41453 | _na 177_aa | FHA domain protein | |
| 647 | VVIQ01000002.1 | GCA009728485_00875 | CDS | open | 41504-42502 | _na 332_aa | Sporulation and cell division repeat protein | |
| 648 | VVIQ01000002.1 | GCA009728485_00876 | CDS | open | 42666-43220 | _na 184_aa | rfbC | dTDP-4-dehydrorhamnose 3%2C5-epimerase |
| 649 | VVIQ01000002.1 | GCA009728485_00877 | CDS | open | 43247-44041 | _na 264_aa | Lipoprotein | |
| 650 | VVIQ01000002.1 | GCA009728485_00878 | CDS | open | 44073-44876 | _na 267_aa | pflA | pyruvate formate-lyase-activating protein |
| 651 | VVIQ01000002.1 | GCA009728485_00879 | CDS | open | 44842-47088 | _na 748_aa | pflB | formate C-acetyltransferase |
| 652 | VVIQ01000002.1 | GCA009728485_00880 | CDS | open | 47577-48008 | _na 143_aa | Ferric uptake regulator family protein | |
| 653 | VVIQ01000002.1 | GCA009728485_00881 | CDS | open | 48760-50961 | _na 733_aa | peptidoglycan glycosyltransferase | |
| 654 | VVIQ01000002.1 | GCA009728485_00882 | CDS | open | 51027-52175 | _na 382_aa | pyrB | aspartate carbamoyltransferase |
| 655 | VVIQ01000002.1 | GCA009728485_00883 | CDS | open | 52210-52629 | _na 139_aa | BACON domain-containing protein | |
| 656 | VVIQ01000002.1 | GCA009728485_00884 | CDS | open | 52643-53098 | _na 151_aa | pyrI | aspartate carbamoyltransferase regulatory subunit |
| 657 | VVIQ01000002.1 | GCA009728485_00885 | CDS | open | 53352-54704 | _na 450_aa | mepA | Multidrug export protein MepA |
| 658 | VVIQ01000002.1 | GCA009728485_00886 | CDS | open | 54741-55358 | _na 205_aa | Cytidylate kinase | |
| 659 | VVIQ01000002.1 | GCA009728485_00887 | CDS | open | 55355-55870 | _na 171_aa | Phosphoesterase | |
| 660 | VVIQ01000002.1 | GCA009728485_00888 | CDS | open | 55882-57036 | _na 384_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 661 | VVIQ01000002.1 | GCA009728485_00889 | CDS | open | 57121-58305 | _na 394_aa | purT | formate-dependent phosphoribosylglycinamide formyltransferase |
| 662 | VVIQ01000002.1 | GCA009728485_00890 | CDS | open | 58331-58750 | _na 139_aa | WxcM-like protein | |
| 663 | VVIQ01000002.1 | GCA009728485_00891 | CDS | open | 58797-59783 | _na 328_aa | Acetyltransferase (GNAT) domain protein | |
| 664 | VVIQ01000002.1 | GCA009728485_00892 | CDS | open | 59808-60905 | _na 365_aa | DegT/DnrJ/EryC1/StrS aminotransferase family protein | |
| 665 | VVIQ01000002.1 | GCA009728485_00893 | CDS | open | 60925-62400 | _na 491_aa | Glycoside hydrolase family 125 protein | |
| 666 | VVIQ01000002.1 | GCA009728485_00894 | CDS | open | 63033-64454 | _na 473_aa | cls | cardiolipin synthase |
| 667 | VVIQ01000002.1 | GCA009728485_00895 | CDS | open | 64515-66212 | _na 565_aa | Tetratricopeptide repeat protein | |
| 668 | VVIQ01000002.1 | GCA009728485_00896 | CDS | open | 66209-68146 | _na 645_aa | DNA primase | |
| 669 | VVIQ01000002.1 | GCA009728485_00897 | CDS | open | 68514-69425 | _na 303_aa | Putative membrane protein | |
| 670 | VVIQ01000002.1 | GCA009728485_00898 | CDS | open | 69432-70085 | _na 217_aa | luxR | Transcriptional regulator%2C LuxR family |
| 671 | VVIQ01000002.1 | GCA009728485_00899 | CDS | open | 70188-71651 | _na 487_aa | Type I phosphodiesterase / nucleotide pyrophosphatase | |
| 672 | VVIQ01000002.1 | GCA009728485_00900 | CDS | open | 71766-72380 | _na 204_aa | dck | Deoxynucleoside kinase |
| 673 | VVIQ01000002.1 | GCA009728485_00901 | CDS | open | 72509-73177 | _na 222_aa | dck | Deoxyadenosine/deoxycytidine kinase |
| 674 | VVIQ01000002.1 | GCA009728485_00902 | CDS | open | 73260-74225 | _na 321_aa | trxB | thioredoxin-disulfide reductase |
| 675 | VVIQ01000002.1 | GCA009728485_00903 | CDS | open | 74454-75440 | _na 328_aa | bifunctional methionine sulfoxide reductase B/A protein | |
| 676 | VVIQ01000002.1 | GCA009728485_00904 | CDS | open | 75624-76424 | _na 266_aa | trmB | tRNA (guanosine(46)-N7)-methyltransferase TrmB |
| 677 | VVIQ01000002.1 | GCA009728485_00905 | CDS | open | 76569-76745 | _na 58_aa | hypothetical protein | |
| 678 | VVIQ01000002.1 | GCA009728485_00906 | CDS | open | 76791-77582 | _na 263_aa | Cof-like hydrolase | |
| 679 | VVIQ01000002.1 | GCA009728485_00907 | CDS | open | 77582-78214 | _na 210_aa | Cation diffusion facilitator family transporter | |
| 680 | VVIQ01000002.1 | GCA009728485_00908 | CDS | open | 78257-80269 | _na 670_aa | MG2 domain / TonB-dependent receptor plug domain multi-domain protein | |
| 681 | VVIQ01000002.1 | GCA009728485_00909 | CDS | open | 80448-83156 | _na 902_aa | mutS2 | endonuclease MutS2 |
| 682 | VVIQ01000002.1 | GCA009728485_00910 | CDS | open | 83258-85345 | _na 695_aa | ompA | Tetratricopeptide repeat / OmpA family multi-domain protein |
| 683 | VVIQ01000002.1 | GCA009728485_00911 | CDS | open | 85382-86779 | _na 465_aa | NOL1/NOP2/sun family / pre-rRNA processing/ribosome biogenesis multi-domain protein | |
| 684 | VVIQ01000002.1 | GCA009728485_00912 | CDS | open | 86793-87587 | _na 264_aa | thymidylate synthase | |
| 685 | VVIQ01000002.1 | GCA009728485_00913 | CDS | open | 87593-88078 | _na 161_aa | Dihydrofolate reductase | |
| 686 | VVIQ01000002.1 | GCA009728485_00914 | CDS | open | 88183-88785 | _na 200_aa | DUF4890 domain-containing protein | |
| 687 | VVIQ01000002.1 | GCA009728485_00915 | CDS | open | 89050-89541 | _na 163_aa | DUF4112 domain-containing protein | |
| 688 | VVIQ01000002.1 | GCA009728485_00916 | CDS | open | 89569-90324 | _na 251_aa | ydfG | NADP-dependent L-serine/L-allo-threonine dehydrogenase YdfG |
| 689 | VVIQ01000002.1 | GCA009728485_00917 | CDS | open | 90355-91224 | _na 289_aa | EamA-like transporter family protein | |
| 690 | VVIQ01000002.1 | GCA009728485_00918 | CDS | open | 91238-92155 | _na 305_aa | Putative membrane protein | |
| 691 | VVIQ01000002.1 | GCA009728485_00919 | CDS | open | 92781-93257 | _na 158_aa | protein-tyrosine-phosphatase | |
| 692 | VVIQ01000002.1 | GCA009728485_00920 | CDS | open | 93458-98566 | _na 1702_aa | Phage tail protein | |
| 693 | VVIQ01000002.1 | GCA009728485_00921 | CDS | open | 98553-100967 | _na 804_aa | Outer membrane protein%2C OMP85 family | |
| 694 | VVIQ01000002.1 | GCA009728485_00922 | CDS | open | 100985-101674 | _na 229_aa | peptidylprolyl isomerase | |
| 695 | VVIQ01000002.1 | GCA009728485_00923 | CDS | open | 101753-104251 | _na 832_aa | Zinc-dependent metalloprotease | |
| 696 | VVIQ01000002.1 | GCA009728485_00924 | CDS | open | 104661-105092 | _na 143_aa | Lipoprotein | |
| 697 | VVIQ01000002.1 | GCA009728485_00925 | CDS | open | 105252-106673 | _na 473_aa | PepSY domain protein | |
| 698 | VVIQ01000002.1 | GCA009728485_00926 | CDS | open | 106707-107429 | _na 240_aa | PAP2 family protein | |
| 699 | VVIQ01000002.1 | GCA009728485_00927 | CDS | open | 107543-108088 | _na 181_aa | Carbonate dehydratase | |
| 700 | VVIQ01000002.1 | GCA009728485_00928 | CDS | open | 108112-108852 | _na 246_aa | Haloacid dehalogenase-like hydrolase | |
| 701 | VVIQ01000002.1 | GCA009728485_00929 | CDS | open | 108856-109893 | _na 345_aa | hypothetical protein | |
| 702 | VVIQ01000002.1 | GCA009728485_00930 | CDS | open | 110320-111066 | _na 248_aa | ABC transporter%2C ATP-binding protein | |
| 703 | VVIQ01000002.1 | GCA009728485_00931 | CDS | open | 111112-112428 | _na 438_aa | Aspartokinase | |
| 704 | VVIQ01000002.1 | GCA009728485_00932 | CDS | open | 112557-113714 | _na 385_aa | lysA | diaminopimelate decarboxylase |
| 705 | VVIQ01000002.1 | GCA009728485_00933 | CDS | open | 113735-114940 | _na 401_aa | Glycosyltransferase%2C group 2 family protein | |
| 706 | VVIQ01000002.1 | GCA009728485_00934 | CDS | open | 114941-116098 | _na 385_aa | Glycosyltransferase 4-like domain protein | |
| 707 | VVIQ01000002.1 | GCA009728485_00935 | CDS | open | 116160-118172 | _na 670_aa | Fructose-1%2C6-bisphosphatase class 3 | |
| 708 | VVIQ01000002.1 | GCA009728485_00936 | CDS | open | 118561-119868 | _na 435_aa | hypothetical protein | |
| 709 | VVIQ01000002.1 | GCA009728485_00937 | CDS | open | 119908-121737 | _na 609_aa | fliS | Flagellar protein FliS |
| 710 | VVIQ01000002.1 | GCA009728485_00938 | CDS | open | 121892-122683 | _na 263_aa | pgpB | Acid phosphatase |
| 711 | VVIQ01000002.1 | GCA009728485_00939 | CDS | open | 122729-123886 | _na 385_aa | Phosphate-selective porin O and P | |
| 712 | VVIQ01000002.1 | GCA009728485_00940 | CDS | open | 124044-125333 | _na 429_aa | Histidine acid phosphatase | |
| 713 | VVIQ01000002.1 | GCA009728485_00941 | CDS | open | 125648-126838 | _na 396_aa | yihS | N-acylglucosamine 2-epimerase |
| 714 | VVIQ01000002.1 | GCA009728485_00942 | CDS | open | 127265-127510 | _na 81_aa | Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein | |
| 715 | VVIQ01000002.1 | GCA009728485_00943 | CDS | open | 127566-128120 | _na 184_aa | Hydrolase%2C NUDIX family | |
| 716 | VVIQ01000002.1 | GCA009728485_00944 | CDS | open | 128420-128521 | _na 33_aa | Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein | |
| 717 | VVIQ01000002.1 | GCA009728485_00945 | CDS | open | 128818-129213 | _na 131_aa | rplU | 50S ribosomal protein L21 |
| 718 | VVIQ01000002.1 | GCA009728485_00946 | CDS | open | 129230-129520 | _na 96_aa | rpmA | 50S ribosomal protein L27 |
| 719 | VVIQ01000002.1 | GCA009728485_00947 | CDS | open | 129807-130007 | _na 66_aa | hypothetical protein | |
| 720 | VVIQ01000002.1 | GCA009728485_00948 | CDS | open | 130298-131605 | _na 435_aa | eno | phosphopyruvate hydratase |
| 721 | VVIQ01000002.1 | GCA009728485_00949 | CDS | open | 131731-132306 | _na 191_aa | LUD domain-containing protein | |
| 722 | VVIQ01000002.1 | GCA009728485_00950 | CDS | open | 132299-133681 | _na 460_aa | lutB | 4Fe-4S ferredoxin-type domain-containing protein |
| 723 | VVIQ01000002.1 | GCA009728485_00951 | CDS | open | 133718-134449 | _na 243_aa | Cysteine-rich domain protein | |
| 724 | VVIQ01000002.1 | GCA009728485_00952 | CDS | open | 134629-136536 | _na 635_aa | DNA topoisomerase | |
| 725 | VVIQ01000002.1 | GCA009728485_00953 | CDS | open | 137154-140486 | _na 1110_aa | DUF2723 domain-containing protein | |
| 726 | VVIQ01000002.1 | GCA009728485_00954 | CDS | open | 140626-141258 | _na 210_aa | pgaB | NodB-like y domain-containing protein |
| 727 | VVIQ01000002.1 | GCA009728485_00955 | CDS | open | 141255-142232 | _na 325_aa | queG | tRNA epoxyqueuosine(34) reductase QueG |
| 728 | VVIQ01000002.1 | GCA009728485_00956 | CDS | open | 142316-142639 | _na 107_aa | Cupin domain protein | |
| 729 | VVIQ01000002.1 | GCA009728485_00957 | CDS | open | 142765-143145 | _na 126_aa | yjbR | YjbR protein |
| 730 | VVIQ01000002.1 | GCA009728485_00958 | CDS | open | 143355-144635 | _na 426_aa | glyA | Serine hydroxymethyltransferase |
| 731 | VVIQ01000002.1 | GCA009728485_00959 | CDS | open | 144848-145258 | _na 136_aa | Lipoprotein | |
| 732 | VVIQ01000002.1 | GCA009728485_00961 | CDS | open | 145963-147162 | _na 399_aa | hypothetical protein | |
| 733 | VVIQ01000002.1 | GCA009728485_00962 | CDS | open | 147770-148075 | _na 101_aa | hypothetical protein | |
| 734 | VVIQ01000002.1 | GCA009728485_00963 | CDS | open | 148066-150060 | _na 664_aa | leucine-rich repeat domain-containing protein | |
| 735 | VVIQ01000002.1 | GCA009728485_00964 | CDS | open | 150063-153377 | _na 1104_aa | cotH | CotH protein |
| 736 | VVIQ01000002.1 | GCA009728485_00965 | CDS | open | 153380-153601 | _na 73_aa | HU domain-containing protein | |
| 737 | VVIQ01000002.1 | GCA009728485_00966 | CDS | open | 153649-154164 | _na 171_aa | Lipoprotein | |
| 738 | VVIQ01000002.1 | GCA009728485_00967 | CDS | open | 154176-154619 | _na 147_aa | N-acetylmuramoyl-L-alanine amidase | |
| 739 | VVIQ01000002.1 | GCA009728485_00968 | CDS | open | 154626-155087 | _na 153_aa | hypothetical protein | |
| 740 | VVIQ01000002.1 | GCA009728485_00969 | CDS | open | 155136-155408 | _na 90_aa | FUSC family protein | |
| 741 | VVIQ01000002.1 | GCA009728485_00970 | CDS | open | 155561-159427 | _na 1288_aa | hypothetical protein | |
| 742 | VVIQ01000002.1 | GCA009728485_00971 | CDS | open | 159524-159970 | _na 148_aa | SprT-like family | |
| 743 | VVIQ01000002.1 | GCA009728485_00972 | CDS | open | 159974-160300 | _na 108_aa | DUF2693 domain-containing protein | |
| 744 | VVIQ01000002.1 | GCA009728485_00973 | CDS | open | 160324-160635 | _na 103_aa | Phage protein | |
| 745 | VVIQ01000002.1 | GCA009728485_00974 | CDS | open | 160888-161154 | _na 88_aa | Helix-turn-helix transcriptional regulator | |
| 746 | VVIQ01000002.1 | GCA009728485_00975 | CDS | open | 161202-161753 | _na 183_aa | hypothetical protein | |
| 747 | VVIQ01000002.1 | GCA009728485_00976 | CDS | open | 161780-162196 | _na 138_aa | Phage tail protein | |
| 748 | VVIQ01000002.1 | GCA009728485_00977 | CDS | open | 162199-167307 | _na 1702_aa | Tape measure protein N-terminal domain-containing protein | |
| 749 | VVIQ01000002.1 | GCA009728485_00978 | CDS | open | 167344-168054 | _na 236_aa | hypothetical protein | |
| 750 | VVIQ01000002.1 | GCA009728485_00980 | CDS | open | 168223-168741 | _na 172_aa | Phage tail protein | |
| 751 | VVIQ01000002.1 | GCA009728485_00981 | CDS | open | 168745-169161 | _na 138_aa | Phage protein | |
| 752 | VVIQ01000002.1 | GCA009728485_00982 | CDS | open | 169158-169640 | _na 160_aa | HK97 gp10 family phage protein | |
| 753 | VVIQ01000002.1 | GCA009728485_00983 | CDS | open | 169642-169935 | _na 97_aa | DUF3599 domain-containing protein | |
| 754 | VVIQ01000002.1 | GCA009728485_00984 | CDS | open | 169982-170308 | _na 108_aa | hypothetical protein | |
| 755 | VVIQ01000002.1 | GCA009728485_00985 | CDS | open | 170311-171627 | _na 438_aa | Phage major capsid protein E | |
| 756 | VVIQ01000002.1 | GCA009728485_00986 | CDS | open | 171643-172050 | _na 135_aa | hypothetical protein | |
| 757 | VVIQ01000002.1 | GCA009728485_00987 | CDS | open | 172084-172836 | _na 250_aa | hypothetical protein | |
| 758 | VVIQ01000002.1 | GCA009728485_00988 | CDS | open | 173125-174558 | _na 477_aa | DUF4942 domain-containing protein | |
| 759 | VVIQ01000002.1 | GCA009728485_00989 | CDS | open | 174610-174972 | _na 120_aa | hypothetical protein | |
| 760 | VVIQ01000002.1 | GCA009728485_00990 | CDS | open | 175275-175796 | _na 173_aa | DUF3298 domain-containing protein | |
| 761 | VVIQ01000002.1 | GCA009728485_00991 | CDS | open | 175842-176057 | _na 71_aa | RNA polymerase sigma factor | |
| 762 | VVIQ01000002.1 | GCA009728485_00992 | CDS | open | 176073-178847 | _na 924_aa | hypothetical protein | |
| 763 | VVIQ01000002.1 | GCA009728485_00993 | CDS | open | 178840-179046 | _na 68_aa | hypothetical protein | |
| 764 | VVIQ01000002.1 | GCA009728485_00994 | CDS | open | 179024-179356 | _na 110_aa | 50S ribosomal protein L22 | |
| 765 | VVIQ01000002.1 | GCA009728485_00995 | CDS | open | 179353-179541 | _na 62_aa | hypothetical protein | |
| 766 | VVIQ01000002.1 | GCA009728485_00996 | CDS | open | 179538-180983 | _na 481_aa | Phage portal protein | |
| 767 | VVIQ01000002.1 | GCA009728485_00997 | CDS | open | 181121-181357 | _na 78_aa | hypothetical protein | |
| 768 | VVIQ01000002.1 | GCA009728485_00998 | CDS | open | 181335-181598 | _na 87_aa | hypothetical protein | |
| 769 | VVIQ01000002.1 | GCA009728485_00999 | CDS | open | 181589-181834 | _na 81_aa | hypothetical protein | |
| 770 | VVIQ01000002.1 | GCA009728485_01000 | CDS | open | 181847-182233 | _na 128_aa | hypothetical protein | |
| 771 | VVIQ01000002.1 | GCA009728485_01001 | CDS | open | 182442-183956 | _na 504_aa | Terminase | |
| 772 | VVIQ01000002.1 | GCA009728485_01002 | CDS | open | 183946-184290 | _na 114_aa | Homeodomain phBC6A51-type domain-containing protein | |
| 773 | VVIQ01000002.1 | GCA009728485_01003 | CDS | open | 184295-185131 | _na 278_aa | ATP-grasp domain-containing protein | |
| 774 | VVIQ01000002.1 | GCA009728485_01004 | CDS | open | 185139-185858 | _na 239_aa | ParB/Sulfiredoxin domain-containing protein | |
| 775 | VVIQ01000002.1 | GCA009728485_01005 | CDS | open | 185842-187926 | _na 694_aa | Amidoligase enzyme | |
| 776 | VVIQ01000002.1 | GCA009728485_01006 | CDS | open | 187911-188996 | _na 361_aa | NAD/NADP octopine/nopaline dehydrogenase | |
| 777 | VVIQ01000002.1 | GCA009728485_01009 | CDS | open | 189227-189634 | _na 135_aa | DUF488 domain-containing protein | |
| 778 | VVIQ01000002.1 | GCA009728485_01010 | CDS | open | 189719-189874 | _na 51_aa | hypothetical protein | |
| 779 | VVIQ01000002.1 | GCA009728485_01011 | CDS | open | 189876-191042 | _na 388_aa | PcfJ-like protein | |
| 780 | VVIQ01000002.1 | GCA009728485_01012 | CDS | open | 191046-191453 | _na 135_aa | PcfK-like protein | |
| 781 | VVIQ01000002.1 | GCA009728485_01013 | CDS | open | 191456-191812 | _na 118_aa | DUF4288 domain-containing protein | |
| 782 | VVIQ01000002.1 | GCA009728485_01014 | CDS | open | 191809-192012 | _na 67_aa | DpnD/PcfM-like C-terminal domain-containing protein | |
| 783 | VVIQ01000002.1 | GCA009728485_01015 | CDS | open | 191993-192232 | _na 79_aa | hypothetical protein | |
| 784 | VVIQ01000002.1 | GCA009728485_01016 | CDS | open | 192243-193097 | _na 284_aa | hypothetical protein | |
| 785 | VVIQ01000002.1 | GCA009728485_01017 | CDS | open | 193090-193404 | _na 104_aa | hypothetical protein | |
| 786 | VVIQ01000002.1 | GCA009728485_01018 | CDS | open | 193416-193781 | _na 121_aa | Phage protein | |
| 787 | VVIQ01000002.1 | GCA009728485_01019 | CDS | open | 193793-194182 | _na 129_aa | hypothetical protein | |
| 788 | VVIQ01000002.1 | GCA009728485_01020 | CDS | open | 194192-194383 | _na 63_aa | hypothetical protein | |
| 789 | VVIQ01000002.1 | GCA009728485_01021 | CDS | open | 194396-194575 | _na 59_aa | KTSC domain-containing protein | |
| 790 | VVIQ01000002.1 | GCA009728485_01022 | CDS | open | 194673-194846 | _na 57_aa | hypothetical protein | |
| 791 | VVIQ01000002.1 | GCA009728485_01023 | CDS | open | 194924-196291 | _na 455_aa | DNA 5'-3' helicase | |
| 792 | VVIQ01000002.1 | GCA009728485_01024 | CDS | open | 196403-196819 | _na 138_aa | DNA helicase | |
| 793 | VVIQ01000002.1 | GCA009728485_01025 | CDS | open | 196816-197385 | _na 189_aa | dnaC | DNA replication protein DnaC |
| 794 | VVIQ01000002.1 | GCA009728485_01026 | CDS | open | 197376-198293 | _na 305_aa | hypothetical protein | |
| 795 | VVIQ01000002.1 | GCA009728485_01027 | CDS | open | 198499-198987 | _na 162_aa | ninG | Bacteriophage Lambda NinG protein |
| 796 | VVIQ01000002.1 | GCA009728485_01028 | CDS | open | 198984-199340 | _na 118_aa | DUF4406 domain-containing protein | |
| 797 | VVIQ01000002.1 | GCA009728485_01029 | CDS | open | 199324-199581 | _na 85_aa | DUF3310 domain-containing protein | |
| 798 | VVIQ01000002.1 | GCA009728485_01030 | CDS | open | 199562-199981 | _na 139_aa | dut | dUTP diphosphatase |
| 799 | VVIQ01000002.1 | GCA009728485_01031 | CDS | open | 199978-200376 | _na 132_aa | hypothetical protein | |
| 800 | VVIQ01000002.1 | GCA009728485_01032 | CDS | open | 200383-200712 | _na 109_aa | hypothetical protein | |
| 801 | VVIQ01000002.1 | GCA009728485_01033 | CDS | open | 200714-201931 | _na 405_aa | DEAD/DEAH box helicase | |
| 802 | VVIQ01000002.1 | GCA009728485_01034 | CDS | open | 201950-202600 | _na 216_aa | hypothetical protein | |
| 803 | VVIQ01000002.1 | GCA009728485_01035 | CDS | open | 202622-203170 | _na 182_aa | Endonuclease | |
| 804 | VVIQ01000002.1 | GCA009728485_01036 | CDS | open | 203170-203610 | _na 146_aa | Phage integrase SAM-like domain-containing protein | |
| 805 | VVIQ01000002.1 | GCA009728485_01037 | CDS | open | 203597-203833 | _na 78_aa | Winged helix-turn-helix domain-containing protein | |
| 806 | VVIQ01000002.1 | GCA009728485_01038 | CDS | open | 203837-204283 | _na 148_aa | DUF3127 domain-containing protein | |
| 807 | VVIQ01000002.1 | GCA009728485_01039 | CDS | open | 204285-205223 | _na 312_aa | HNH endonuclease | |
| 808 | VVIQ01000002.1 | GCA009728485_01040 | CDS | open | 205216-206142 | _na 308_aa | Phage nucleotide-binding protein | |
| 809 | VVIQ01000002.1 | GCA009728485_01041 | CDS | open | 206157-206708 | _na 183_aa | Helix-turn-helix transcriptional regulator | |
| 810 | VVIQ01000002.1 | GCA009728485_01042 | CDS | open | 206696-206923 | _na 75_aa | XRE family transcriptional regulator | |
| 811 | VVIQ01000002.1 | GCA009728485_01043 | CDS | open | 207058-207792 | _na 244_aa | Peptidase S24/S26A/S26B/S26C domain-containing protein | |
| 812 | VVIQ01000002.1 | GCA009728485_01044 | CDS | open | 208081-208338 | _na 85_aa | XRE family transcriptional regulator | |
| 813 | VVIQ01000002.1 | GCA009728485_01045 | CDS | open | 208354-208470 | _na 38_aa | hypothetical protein | |
| 814 | VVIQ01000002.1 | GCA009728485_01046 | CDS | open | 208467-208742 | _na 91_aa | hypothetical protein | |
| 815 | VVIQ01000002.1 | GCA009728485_01047 | CDS | open | 208739-209659 | _na 306_aa | hypothetical protein | |
| 816 | VVIQ01000002.1 | GCA009728485_01048 | CDS | open | 209652-209918 | _na 88_aa | hypothetical protein | |
| 817 | VVIQ01000002.1 | GCA009728485_01049 | CDS | open | 209958-210149 | _na 63_aa | hypothetical protein | |
| 818 | VVIQ01000002.1 | GCA009728485_01050 | CDS | open | 210246-210788 | _na 180_aa | hypothetical protein | |
| 819 | VVIQ01000002.1 | GCA009728485_01051 | CDS | open | 211087-211464 | _na 125_aa | hypothetical protein | |
| 820 | VVIQ01000002.1 | GCA009728485_01052 | CDS | open | 211466-212389 | _na 307_aa | hypothetical protein | |
| 821 | VVIQ01000002.1 | GCA009728485_01053 | CDS | open | 212406-212603 | _na 65_aa | Excisionase family DNA binding domain-containing protein | |
| 822 | VVIQ01000002.1 | GCA009728485_01055 | CDS | open | 213617-213964 | _na 115_aa | HTH cro/C1-type domain-containing protein | |
| 823 | VVIQ01000002.1 | GCA009728485_01056 | CDS | open | 213955-214335 | _na 126_aa | Helix-turn-helix domain-containing protein | |
| 824 | VVIQ01000002.1 | GCA009728485_01057 | CDS | open | 214332-216392 | _na 686_aa | dnaG | Toprim domain-containing protein |
| 825 | VVIQ01000002.1 | GCA009728485_01058 | CDS | open | 216380-216688 | _na 102_aa | Helix-turn-helix domain-containing protein | |
| 826 | VVIQ01000002.1 | GCA009728485_01059 | CDS | open | 216804-217391 | _na 195_aa | AbiEi antitoxin C-terminal domain-containing protein | |
| 827 | VVIQ01000002.1 | GCA009728485_01060 | CDS | open | 217395-218417 | _na 340_aa | Nucleotidyl transferase%2C PF08843 family | |
| 828 | VVIQ01000002.1 | GCA009728485_01061 | CDS | open | 218470-220026 | _na 518_aa | Helicase C-terminal domain-containing protein | |
| 829 | VVIQ01000002.1 | GCA009728485_01062 | CDS | open | 220319-221539 | _na 406_aa | xerD | Tyr recombinase domain-containing protein |
| 830 | VVIQ01000002.1 | GCA009728485_01063 | CDS | open | 221544-222812 | _na 422_aa | Tyr recombinase domain-containing protein | |
| 831 | VVIQ01000002.1 | GCA009728485_01064 | CDS | open | 222865-223350 | _na 161_aa | DUF1896 domain-containing protein | |
| 832 | VVIQ01000002.1 | GCA009728485_01065 | CDS | open | 224064-224333 | _na 89_aa | Helix-turn-helix domain-containing protein | |
| 833 | VVIQ01000002.1 | GCA009728485_01066 | CDS | open | 224341-224655 | _na 104_aa | Helix-turn-helix domain-containing protein | |
| 834 | VVIQ01000002.1 | GCA009728485_01067 | CDS | open | 224643-225149 | _na 168_aa | DUF3408 domain-containing protein | |
| 835 | VVIQ01000002.1 | GCA009728485_01068 | CDS | open | 225357-225776 | _na 139_aa | Bacterial mobilisation domain-containing protein | |
| 836 | VVIQ01000002.1 | GCA009728485_01069 | CDS | open | 225793-226275 | _na 160_aa | hlyD | HlyD family secretion protein |
| 837 | VVIQ01000002.1 | GCA009728485_01070 | CDS | open | 226277-228460 | _na 727_aa | ABC transporter ATP-binding protein | |
| 838 | VVIQ01000002.1 | GCA009728485_01071 | CDS | open | 228518-230815 | _na 765_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 839 | VVIQ01000002.1 | GCA009728485_01072 | CDS | open | 230812-232062 | _na 416_aa | Radical SAM additional 4Fe4S-binding domain protein | |
| 840 | VVIQ01000002.1 | GCA009728485_01073 | CDS | open | 232131-232349 | _na 72_aa | Natural product | |
| 841 | VVIQ01000002.1 | GCA009728485_01074 | CDS | open | 232587-233726 | _na 379_aa | Beta-ketoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein | |
| 842 | VVIQ01000002.1 | GCA009728485_01075 | CDS | open | 233734-234360 | _na 208_aa | HTH tetR-type domain-containing protein | |
| 843 | VVIQ01000002.1 | GCA009728485_01076 | CDS | open | 235580-236170 | _na 196_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 844 | VVIQ01000002.1 | GCA009728485_01077 | CDS | open | 236175-237470 | _na 431_aa | DUF4848 domain-containing protein | |
| 845 | VVIQ01000002.1 | GCA009728485_01078 | CDS | open | 238900-241401 | _na 833_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 846 | VVIQ01000002.1 | GCA009728485_01079 | CDS | open | 241469-242896 | _na 475_aa | Leucine Rich Repeat (LRR)-containing protein | |
| 847 | VVIQ01000002.1 | GCA009728485_01080 | CDS | open | 242912-243382 | _na 156_aa | Lipocalin-like protein | |
| 848 | VVIQ01000002.1 | GCA009728485_01081 | CDS | open | 243428-244024 | _na 198_aa | Lipoprotein | |
| 849 | VVIQ01000002.1 | GCA009728485_01082 | CDS | open | 244103-246454 | _na 783_aa | TonB-dependent receptor | |
| 850 | VVIQ01000002.1 | GCA009728485_01083 | CDS | open | 246451-247149 | _na 232_aa | hmuY | HmuY protein |
| 851 | VVIQ01000002.1 | GCA009728485_01084 | CDS | open | 247428-248300 | _na 290_aa | Transporter | |
| 852 | VVIQ01000002.1 | GCA009728485_01085 | CDS | open | 248293-249168 | _na 291_aa | Transmembrane protein | |
| 853 | VVIQ01000002.1 | GCA009728485_01086 | CDS | open | 249194-249781 | _na 195_aa | PepSY domain-containing protein | |
| 854 | VVIQ01000002.1 | GCA009728485_01087 | CDS | open | 250041-250493 | _na 150_aa | Lipoprotein | |
| 855 | VVIQ01000002.1 | GCA009728485_01088 | CDS | open | 250712-251131 | _na 139_aa | Mobilization protein | |
| 856 | VVIQ01000002.1 | GCA009728485_01089 | CDS | open | 251324-251779 | _na 151_aa | DUF3408 domain-containing protein | |
| 857 | VVIQ01000002.1 | GCA009728485_01090 | CDS | open | 251821-252135 | _na 104_aa | DNA binding domain%2C excisionase family | |
| 858 | VVIQ01000002.1 | GCA009728485_01091 | CDS | open | 252156-252425 | _na 89_aa | Helix-turn-helix domain-containing protein | |
| 859 | VVIQ01000002.1 | GCA009728485_01092 | CDS | open | 253089-253574 | _na 161_aa | DUF1896 domain-containing protein | |
| 860 | VVIQ01000002.1 | GCA009728485_01093 | CDS | open | 253630-254913 | _na 427_aa | Recombinase | |
| 861 | VVIQ01000002.1 | GCA009728485_01094 | CDS | open | 254926-256179 | _na 417_aa | Tyr recombinase domain-containing protein | |
| 862 | VVIQ01000002.1 | GCA009728485_01095 | CDS | open | 256437-257588 | _na 383_aa | Helicase ATP-binding domain-containing protein | |
| 863 | VVIQ01000002.1 | GCA009728485_01096 | CDS | open | 257669-259015 | _na 448_aa | Cytosine-specific methyltransferase | |
| 864 | VVIQ01000002.1 | GCA009728485_01097 | CDS | open | 259028-259759 | _na 243_aa | NgoBV family restriction endonuclease | |
| 865 | VVIQ01000002.1 | GCA009728485_01098 | CDS | open | 259912-260463 | _na 183_aa | HU domain-containing protein | |
| 866 | VVIQ01000002.1 | GCA009728485_01099 | CDS | open | 260606-260989 | _na 127_aa | hypothetical protein | |
| 867 | VVIQ01000002.1 | GCA009728485_01100 | CDS | open | 261079-261351 | _na 90_aa | hypothetical protein | |
| 868 | VVIQ01000002.1 | GCA009728485_01101 | CDS | open | 261300-263153 | _na 617_aa | DNA topoisomerase | |
| 869 | VVIQ01000002.1 | GCA009728485_01102 | CDS | open | 263175-264572 | _na 465_aa | DUF3945 domain-containing protein | |
| 870 | VVIQ01000002.1 | GCA009728485_01103 | CDS | open | 265140-265337 | _na 65_aa | hypothetical protein | |
| 871 | VVIQ01000002.1 | GCA009728485_01104 | CDS | open | 265511-267208 | _na 565_aa | ABC transporter ATP-binding protein | |
| 872 | VVIQ01000002.1 | GCA009728485_01105 | CDS | open | 267211-268956 | _na 581_aa | mdlB | ABC transporter |
| 873 | VVIQ01000002.1 | GCA009728485_01106 | CDS | open | 269192-271531 | _na 779_aa | TonB-dependent receptor plug domain protein | |
| 874 | VVIQ01000002.1 | GCA009728485_01107 | CDS | open | 271550-272731 | _na 393_aa | Lipoprotein | |
| 875 | VVIQ01000002.1 | GCA009728485_01108 | CDS | open | 272857-273837 | _na 326_aa | araC | HTH araC/xylS-type domain-containing protein |
| 876 | VVIQ01000002.1 | GCA009728485_01109 | CDS | open | 273921-274247 | _na 108_aa | rteC | RteC protein |
| 877 | VVIQ01000002.1 | GCA009728485_01110 | CDS | open | 274502-276505 | _na 667_aa | virD4 | YWFCY domain-containing protein |
| 878 | VVIQ01000002.1 | GCA009728485_01111 | CDS | open | 276590-277870 | _na 426_aa | Relaxase/mobilization nuclease domain protein | |
| 879 | VVIQ01000002.1 | GCA009728485_01112 | CDS | open | 277867-278280 | _na 137_aa | Bacterial mobilisation domain-containing protein | |
| 880 | VVIQ01000002.1 | GCA009728485_01113 | CDS | open | 278873-279676 | _na 267_aa | CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein | |
| 881 | VVIQ01000002.1 | GCA009728485_01114 | CDS | open | 279663-280190 | _na 175_aa | traC | Conjugal transfer protein TraC |
| 882 | VVIQ01000002.1 | GCA009728485_01115 | CDS | open | 280187-280957 | _na 256_aa | Conjugal transfer protein | |
| 883 | VVIQ01000002.1 | GCA009728485_01116 | CDS | open | 281115-281390 | _na 91_aa | DUF4134 domain-containing protein | |
| 884 | VVIQ01000002.1 | GCA009728485_01117 | CDS | open | 281394-281729 | _na 111_aa | traF | Conjugative transposon protein TraF |
| 885 | VVIQ01000002.1 | GCA009728485_01118 | CDS | open | 281846-283870 | _na 674_aa | phospholipase D | |
| 886 | VVIQ01000002.1 | GCA009728485_01119 | CDS | open | 284407-284880 | _na 157_aa | Viral histone-like protein | |
| 887 | VVIQ01000002.1 | GCA009728485_01120 | CDS | open | 285004-285213 | _na 69_aa | hypothetical protein | |
| 888 | VVIQ01000002.1 | GCA009728485_01121 | CDS | open | 285223-285993 | _na 256_aa | traM | conjugative transposon protein TraM |
| 889 | VVIQ01000002.1 | GCA009728485_01122 | CDS | open | 286042-286992 | _na 316_aa | traN | conjugative transposon protein TraN |
| 890 | VVIQ01000002.1 | GCA009728485_01123 | CDS | open | 286986-287579 | _na 197_aa | traO | Conjugative transposon protein TraO |
| 891 | VVIQ01000002.1 | GCA009728485_01124 | CDS | open | 287592-288050 | _na 152_aa | traQ | Conjugative transposon protein TraQ |
| 892 | VVIQ01000002.1 | GCA009728485_01125 | CDS | open | 288062-288445 | _na 127_aa | lysozyme | |
| 893 | VVIQ01000002.1 | GCA009728485_01126 | CDS | open | 288660-289262 | _na 200_aa | DJ-1/PfpI domain-containing protein | |
| 894 | VVIQ01000002.1 | GCA009728485_01127 | CDS | open | 289351-289818 | _na 155_aa | HU domain-containing protein | |
| 895 | VVIQ01000002.1 | GCA009728485_01128 | CDS | open | 290136-290243 | _na 35_aa | hypothetical protein | |
| 896 | VVIQ01000002.1 | GCA009728485_01129 | CDS | open | 290271-291545 | _na 424_aa | PcfJ-like protein | |
| 897 | VVIQ01000002.1 | GCA009728485_01130 | CDS | open | 291550-291969 | _na 139_aa | PcfK-like protein | |
| 898 | VVIQ01000002.1 | GCA009728485_01131 | CDS | open | 291975-292406 | _na 143_aa | Molybdenum ABC transporter ATP-binding protein | |
| 899 | VVIQ01000002.1 | GCA009728485_01132 | CDS | open | 292759-293106 | _na 115_aa | AI-2E family transporter | |
| 900 | VVIQ01000002.1 | GCA009728485_01133 | CDS | open | 293244-293711 | _na 155_aa | DUF1896 domain-containing protein | |
| 901 | VVIQ01000002.1 | GCA009728485_01134 | CDS | open | 293737-294969 | _na 410_aa | Tyr recombinase domain-containing protein | |
| 902 | VVIQ01000002.1 | GCA009728485_01136 | CDS | open | 295654-296469 | _na 271_aa | tatD | Hydrolase%2C TatD family |
| 903 | VVIQ01000002.1 | GCA009728485_01137 | CDS | open | 296483-297457 | _na 324_aa | Polyprenyl synthetase | |
| 904 | VVIQ01000002.1 | GCA009728485_01138 | CDS | open | 297554-298351 | _na 265_aa | TonB-dependent receptor | |
| 905 | VVIQ01000002.1 | GCA009728485_01139 | CDS | open | 298506-299450 | _na 314_aa | porQ | type IX secretion system protein PorQ |
| 906 | VVIQ01000002.1 | GCA009728485_01140 | CDS | open | 299866-300558 | _na 230_aa | cmk | (d)CMP kinase |
| 907 | VVIQ01000002.1 | GCA009728485_01141 | CDS | open | 300751-301524 | _na 257_aa | Polysaccharide biosynthesis/export protein | |
| 908 | VVIQ01000002.1 | GCA009728485_01142 | CDS | open | 301692-303539 | _na 615_aa | glmS | glutamine--fructose-6-phosphate transaminase (isomerizing) |
| 909 | VVIQ01000002.1 | GCA009728485_01143 | CDS | open | 303679-305580 | _na 633_aa | Class II glutamine amidotransferase | |
| 910 | VVIQ01000002.1 | GCA009728485_01144 | CDS | open | 305722-306798 | _na 358_aa | carA | carbamoyl phosphate synthase small subunit |
| 911 | VVIQ01000002.1 | GCA009728485_01145 | CDS | open | 306798-310022 | _na 1074_aa | carB | carbamoyl-phosphate synthase large subunit |
| 912 | VVIQ01000002.1 | GCA009728485_01146 | CDS | open | 310034-310618 | _na 194_aa | Lipoprotein | |
| 913 | VVIQ01000002.1 | GCA009728485_01147 | CDS | open | 310878-311483 | _na 201_aa | Lipoprotein | |
| 914 | VVIQ01000002.1 | GCA009728485_01148 | CDS | open | 311765-313849 | _na 694_aa | DUF3857 domain-containing protein | |
| 915 | VVIQ01000002.1 | GCA009728485_01149 | CDS | open | 313953-315857 | _na 634_aa | Transglutaminase-like domain-containing protein | |
| 916 | VVIQ01000002.1 | GCA009728485_01150 | CDS | open | 315991-317529 | _na 512_aa | Sulfatase N-terminal domain-containing protein | |
| 917 | VVIQ01000002.1 | GCA009728485_01151 | CDS | open | 317624-319357 | _na 577_aa | Arylsulfatase | |
| 918 | VVIQ01000002.1 | GCA009728485_01152 | CDS | open | 319857-323258 | _na 1133_aa | sleL | Glycosyl hydrolase%2C family 18 / polysaccharide deacetylase / glycosyltransferase%2C group 2 family multi-domain protein |
| 919 | VVIQ01000002.1 | GCA009728485_01153 | CDS | open | 325043-325339 | _na 98_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 920 | VVIQ01000002.1 | GCA009728485_01154 | CDS | open | 325391-326323 | _na 310_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 921 | VVIQ01000002.1 | GCA009728485_01155 | CDS | open | 326335-330462 | _na 1375_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 922 | VVIQ01000002.1 | GCA009728485_01156 | CDS | open | 331183-332484 | _na 433_aa | IgA Peptidase M64 | |
| 923 | VVIQ01000002.1 | GCA009728485_01157 | CDS | open | 332849-334891 | _na 680_aa | GDSL-like lipase/acylhydrolase family / PF03629 domain multi-domain protein | |
| 924 | VVIQ01000002.1 | GCA009728485_01158 | CDS | open | 335224-336768 | _na 514_aa | Arylsulfatase | |
| 925 | VVIQ01000002.1 | GCA009728485_01159 | CDS | open | 337321-338382 | _na 353_aa | BACON domain-containing protein | |
| 926 | VVIQ01000002.1 | GCA009728485_01160 | CDS | open | 338391-339668 | _na 425_aa | DUF4987 domain-containing protein | |
| 927 | VVIQ01000002.1 | GCA009728485_01161 | CDS | open | 339914-340801 | _na 295_aa | Substrate import-associated zinc metallohydrolase lipoprotein | |
| 928 | VVIQ01000002.1 | GCA009728485_01162 | CDS | open | 340816-342387 | _na 523_aa | SusD-like N-terminal domain-containing protein | |
| 929 | VVIQ01000002.1 | GCA009728485_01163 | CDS | open | 342399-345713 | _na 1104_aa | TonB-linked outer membrane protein%2C SusC/RagA family | |
| 930 | VVIQ01000002.1 | GCA009728485_01164 | CDS | open | 346125-346550 | _na 141_aa | DUF6078 domain-containing protein | |
| 931 | VVIQ01000002.1 | GCA009728485_01166 | CDS | open | 347705-348316 | _na 203_aa | master DNA invertase Mpi family serine-type recombinase | |
| 932 | VVIQ01000002.1 | GCA009728485_01167 | CDS | open | 348335-348733 | _na 132_aa | hypothetical protein | |
| 933 | VVIQ01000002.1 | GCA009728485_01168 | CDS | open | 349470-350474 | _na 334_aa | HTH crp-type domain-containing protein | |
| 934 | VVIQ01000002.1 | GCA009728485_01169 | CDS | open | 350452-351291 | _na 279_aa | Nucleotidyltransferase | |
| 935 | VVIQ01000002.1 | GCA009728485_01170 | CDS | open | 351288-351914 | _na 208_aa | PPM-type phosphatase domain-containing protein | |
| 936 | VVIQ01000002.1 | GCA009728485_01171 | CDS | open | 351919-352032 | _na 37_aa | hypothetical protein | |
| 937 | VVIQ01000002.1 | GCA009728485_01172 | CDS | open | 351977-352813 | _na 278_aa | DNA methylase | |
| 938 | VVIQ01000002.1 | GCA009728485_01173 | CDS | open | 353036-353863 | _na 275_aa | hypothetical protein | |
| 939 | VVIQ01000002.1 | GCA009728485_01174 | CDS | open | 354275-354820 | _na 181_aa | traN | conjugative transposon protein TraN |
| 940 | VVIQ01000002.1 | GCA009728485_01175 | CDS | open | 354872-355219 | _na 115_aa | Mobilization protein | |
| 941 | VVIQ01000002.1 | GCA009728485_01176 | CDS | open | 355224-355397 | _na 57_aa | Partial mobilization protein | |
| 942 | VVIQ01000002.1 | GCA009728485_01177 | CDS | open | 355665-356213 | _na 182_aa | CHC2 zinc finger domain-containing protein | |
| 943 | VVIQ01000002.1 | GCA009728485_01178 | CDS | open | 356396-357445 | _na 349_aa | Mobilization protein | |
| 944 | VVIQ01000002.1 | GCA009728485_01179 | CDS | open | 357442-357753 | _na 103_aa | DUF3853 domain-containing protein | |
| 945 | VVIQ01000002.1 | GCA009728485_01180 | CDS | open | 358110-358313 | _na 67_aa | HTH cro/C1-type domain-containing protein | |
| 946 | VVIQ01000002.1 | GCA009728485_01181 | CDS | open | 358408-361728 | _na 1106_aa | Helicase C-terminal domain protein | |
| 947 | VVIQ01000002.1 | GCA009728485_01182 | CDS | open | 361744-365091 | _na 1115_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 948 | VVIQ01000002.1 | GCA009728485_01183 | CDS | open | 365119-365337 | _na 72_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 949 | VVIQ01000002.1 | GCA009728485_01184 | CDS | open | 365523-365774 | _na 83_aa | hypothetical protein | |
| 950 | VVIQ01000002.1 | GCA009728485_01185 | CDS | open | 365967-366377 | _na 136_aa | ASCH domain-containing protein | |
| 951 | VVIQ01000002.1 | GCA009728485_01186 | CDS | open | 366426-367835 | _na 469_aa | DUF2130 domain-containing protein | |
| 952 | VVIQ01000002.1 | GCA009728485_01187 | CDS | open | 368163-371789 | _na 1208_aa | type I site-specific deoxyribonuclease | |
| 953 | VVIQ01000002.1 | GCA009728485_01188 | CDS | open | 372069-373322 | _na 417_aa | Type I restriction modification DNA specificity domain-containing protein | |
| 954 | VVIQ01000002.1 | GCA009728485_01189 | CDS | open | 373328-375373 | _na 681_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 955 | VVIQ01000002.1 | GCA009728485_01190 | CDS | open | 375410-376423 | _na 337_aa | WYL domain-containing protein | |
| 956 | VVIQ01000002.1 | GCA009728485_01191 | CDS | open | 376811-378079 | _na 422_aa | nqrF | NADH:ubiquinone reductase (Na(+)-transporting) subunit F |
| 957 | VVIQ01000002.1 | GCA009728485_01192 | CDS | open | 378087-378713 | _na 208_aa | nqrE | NADH:ubiquinone reductase (Na(+)-transporting) subunit E |
| 958 | VVIQ01000002.1 | GCA009728485_01193 | CDS | open | 378716-379345 | _na 209_aa | nqrD | NADH:ubiquinone reductase (Na(+)-transporting) subunit D |
| 959 | VVIQ01000002.1 | GCA009728485_01194 | CDS | open | 379373-380086 | _na 237_aa | nqrC | NADH:ubiquinone reductase (Na(+)-transporting) subunit C |
| 960 | VVIQ01000002.1 | GCA009728485_01195 | CDS | open | 380104-381255 | _na 383_aa | nqrB | NADH:ubiquinone reductase (Na(+)-transporting) subunit B |
| 961 | VVIQ01000002.1 | GCA009728485_01196 | CDS | open | 381512-382861 | _na 449_aa | Na(+)-translocating NADH-quinone reductase subunit A | |
| 962 | VVIQ01000002.1 | GCA009728485_01197 | CDS | open | 382998-387470 | _na 1490_aa | PF04357 family protein | |
| 963 | VVIQ01000002.1 | GCA009728485_01198 | CDS | open | 387581-389365 | _na 594_aa | rpsA | 30S ribosomal protein S1 |
| 964 | VVIQ01000002.1 | GCA009728485_01199 | CDS | open | 389649-391001 | _na 450_aa | aF0785 | TIGR00341 family protein |
| 965 | VVIQ01000002.1 | GCA009728485_01200 | CDS | open | 390988-391218 | _na 76_aa | hypothetical protein | |
| 966 | VVIQ01000002.1 | GCA009728485_01201 | CDS | open | 391341-391460 | _na 39_aa | ytxH | YtxH domain-containing protein |
| 967 | VVIQ01000002.1 | GCA009728485_01202 | CDS | open | 391519-391647 | _na 42_aa | hypothetical protein | |
| 968 | VVIQ01000002.1 | GCA009728485_01203 | CDS | open | 392343-392576 | _na 77_aa | DUF2188 domain-containing protein | |
| 969 | VVIQ01000002.1 | GCA009728485_01204 | CDS | open | 392659-393720 | _na 353_aa | Relaxase/mobilization nuclease domain-containing protein | |
| 970 | VVIQ01000002.1 | GCA009728485_01205 | CDS | open | 393704-394135 | _na 143_aa | Mobilization protein | |
| 971 | VVIQ01000002.1 | GCA009728485_01206 | CDS | open | 394517-394951 | _na 144_aa | DUF3408 domain-containing protein | |
| 972 | VVIQ01000002.1 | GCA009728485_00843 | gene | open | 932-1744 | |||
| 973 | VVIQ01000002.1 | GCA009728485_00844 | gene | open | 1914-2027 | |||
| 974 | VVIQ01000002.1 | GCA009728485_00845 | gene | open | 2526-3143 | |||
| 975 | VVIQ01000002.1 | GCA009728485_00846 | gene | open | 3991-4281 | |||
| 976 | VVIQ01000002.1 | GCA009728485_00847 | gene | open | 4286-5392 | recF | ||
| 977 | VVIQ01000002.1 | GCA009728485_00848 | gene | open | 5578-6252 | |||
| 978 | VVIQ01000002.1 | GCA009728485_00849 | gene | open | 6262-6738 | ribH | ||
| 979 | VVIQ01000002.1 | GCA009728485_00850 | gene | open | 6972-9203 | |||
| 980 | VVIQ01000002.1 | GCA009728485_00851 | gene | open | 9569-11206 | hcp | ||
| 981 | VVIQ01000002.1 | GCA009728485_00852 | gene | open | 11599-12057 | araC | ||
| 982 | VVIQ01000002.1 | GCA009728485_00853 | gene | open | 12084-14189 | |||
| 983 | VVIQ01000002.1 | GCA009728485_00854 | gene | open | 14536-15627 | gmd | ||
| 984 | VVIQ01000002.1 | GCA009728485_00855 | gene | open | 15645-16847 | wcaG | ||
| 985 | VVIQ01000002.1 | GCA009728485_00856 | gene | open | 16869-18983 | |||
| 986 | VVIQ01000002.1 | GCA009728485_00857 | gene | open | 19154-19924 | |||
| 987 | VVIQ01000002.1 | GCA009728485_00858 | gene | open | 19958-20155 | |||
| 988 | VVIQ01000002.1 | GCA009728485_00859 | gene | open | 20178-20573 | |||
| 989 | VVIQ01000002.1 | GCA009728485_00860 | gene | open | 20797-21450 | |||
| 990 | VVIQ01000002.1 | GCA009728485_00864 | gene | open | 22691-23731 | |||
| 991 | VVIQ01000002.1 | GCA009728485_00865 | gene | open | 23986-24549 | |||
| 992 | VVIQ01000002.1 | GCA009728485_00866 | gene | open | 25188-26132 | |||
| 993 | VVIQ01000002.1 | GCA009728485_00867 | gene | open | 26143-28995 | |||
| 994 | VVIQ01000002.1 | GCA009728485_00868 | gene | open | 29008-30729 | |||
| 995 | VVIQ01000002.1 | GCA009728485_00869 | gene | open | 30757-32379 | susD | ||
| 996 | VVIQ01000002.1 | GCA009728485_00870 | gene | open | 32394-35393 | |||
| 997 | VVIQ01000002.1 | GCA009728485_00871 | gene | open | 35904-37523 | |||
| 998 | VVIQ01000002.1 | GCA009728485_00872 | gene | open | 38217-40358 | nrdD | ||
| 999 | VVIQ01000002.1 | GCA009728485_00873 | gene | open | 40304-40771 | nrdG | ||
| 1000 | VVIQ01000002.1 | GCA009728485_00874 | gene | open | 40920-41453 |

