HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Micrococcus luteus (GCA_014138885.1)

Select a Genome:
BAKTA Annotations for GCA_014138885.1
Genome Selected: Micrococcus luteus
ContigsBases CDSrRNA tmRNAtRNA
2 2552467 2317 6 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4758 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:10]    |    Number of Records Found: 4758 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer
Range
(bp)
Show Sequences
(length) NA / AA
BAKTA
Gene
BAKTA
GeneProduct
4501 JACJIK010000001.1 GCA014138885_00338 tRNA open 387366-387436 trnC tRNA-Cys(gca)
4502 JACJIK010000001.1 GCA014138885_00339 tRNA open 387495-387566 trnV tRNA-Val(gac)
4503 JACJIK010000001.1 GCA014138885_00340 tRNA open 387595-387671 trnG tRNA-Gly(gcc)
4504 JACJIK010000001.1 GCA014138885_00388 tRNA open 440321-440396 trnA tRNA-Ala(ggc)
4505 JACJIK010000001.1 GCA014138885_00390 tRNA open 441785-441860 trnA tRNA-Ala(ggc)
4506 JACJIK010000001.1 GCA014138885_00424 tRNA open 480216-480289 trnP tRNA-Pro(tgg)
4507 JACJIK010000001.1 GCA014138885_00426 tRNA open 481343-481413 trnG tRNA-Gly(tcc)
4508 JACJIK010000001.1 GCA014138885_00438 tRNA open 494937-495010 trnR tRNA-Arg(tct)
4509 JACJIK010000001.1 GCA014138885_00444 tRNA open 502190-502265 trnH tRNA-His(gtg)
4510 JACJIK010000001.1 GCA014138885_00475 tRNA open 528400-528473 trnV tRNA-Val(tac)
4511 JACJIK010000001.1 GCA014138885_00537 tRNA open 594672-594744 trnE tRNA-Glu(ctc)
4512 JACJIK010000001.1 GCA014138885_00538 tRNA open 594873-594945 trnE tRNA-Glu(ctc)
4513 JACJIK010000001.1 GCA014138885_00539 tRNA open 595001-595072 trnQ tRNA-Gln(ctg)
4514 JACJIK010000001.1 GCA014138885_00556 tRNA open 616189-616261 trnK tRNA-Lys(ctt)
4515 JACJIK010000001.1 GCA014138885_00558 tRNA open 616904-616984 trnL tRNA-Leu(tag)
4516 JACJIK010000001.1 GCA014138885_00608 tRNA open 671263-671335 trnR tRNA-Arg(ccg)
4517 JACJIK010000001.1 GCA014138885_00730 tRNA open 803544-803617 trnI tRNA-Ile2(cat)
4518 JACJIK010000001.1 GCA014138885_00818 tRNA open 886194-886265 trnN tRNA-Asn(gtt)
4519 JACJIK010000001.1 GCA014138885_00899 tRNA open 976431-976502 trnQ tRNA-Gln(ttg)
4520 JACJIK010000001.1 GCA014138885_00939 tRNA open 1018890-1018966 trnL tRNA-Leu(taa)
4521 JACJIK010000001.1 GCA014138885_01019 tRNA open 1112845-1112918 trnR tRNA-Arg(cct)
4522 JACJIK010000001.1 GCA014138885_01037 tRNA open 1129184-1129257 trnV tRNA-Val(cac)
4523 JACJIK010000001.1 GCA014138885_01039 tRNA open 1131185-1131261 trnT tRNA-Thr(tgt)
4524 JACJIK010000001.1 GCA014138885_01051 tRNA open 1144158-1144234 trnP tRNA-Pro(cgg)
4525 JACJIK010000001.1 GCA014138885_01075 tRNA open 1171746-1171819 trnT tRNA-Thr(cgt)
4526 JACJIK010000001.1 GCA014138885_01078 tRNA open 1173538-1173625 trnS tRNA-Ser(tga)
4527 JACJIK010000001.1 GCA014138885_01083 tRNA open 1182211-1182299 trnS tRNA-Ser(gct)
4528 JACJIK010000001.1 GCA014138885_01092 tRNA open 1193784-1193857 trnR tRNA-Arg(acg)
4529 JACJIK010000001.1 GCA014138885_01097 tRNA open 1197095-1197185 trnS tRNA-Ser(cga)
4530 JACJIK010000001.1 GCA014138885_01153 tRNA open 1260382-1260467 trnS tRNA-Ser(gga)
4531 JACJIK010000001.1 GCA014138885_01242 tRNA open 1357551-1357626 trnF tRNA-Phe(gaa)
4532 JACJIK010000001.1 GCA014138885_01243 tRNA open 1357699-1357772 trnD tRNA-Asp(gtc)
4533 JACJIK010000001.1 GCA014138885_01244 tRNA open 1357889-1357961 trnE tRNA-Glu(ttc)
4534 JACJIK010000001.1 GCA014138885_01271 tRNA open 1379712-1379784 trnK tRNA-Lys(ttt)
4535 JACJIK010000001.1 GCA014138885_01354 tRNA open 1467662-1467745 trnL tRNA-Leu(cag)
4536 JACJIK010000001.1 GCA014138885_01370 tRNA open 1484901-1484973 trnA tRNA-Ala(tgc)
4537 JACJIK010000001.1 GCA014138885_01372 tRNA open 1485205-1485278 trnI tRNA-Ile(gat)
4538 JACJIK010000001.1 GCA014138885_01712 tRNA open 1840592-1840664 trnA tRNA-Ala(cgc)
4539 JACJIK010000001.1 GCA014138885_01797 tRNA open 1934529-1934602 trnG tRNA-Gly(ccc)
4540 JACJIK010000001.1 GCA014138885_01915 tRNA open 2065295-2065376 trnY tRNA-Tyr(gta)
4541 JACJIK010000001.1 GCA014138885_01924 tRNA open 2076586-2076657 trnT tRNA-Thr(ggt)
4542 JACJIK010000001.1 GCA014138885_01925 tRNA open 2076718-2076791 trnM tRNA-Met(cat)
4543 JACJIK010000001.1 GCA014138885_01947 tRNA open 2094387-2094459 trnW tRNA-Trp(cca)
4544 JACJIK010000001.1 GCA014138885_02171 tRNA open 2329796-2329869 trnfM tRNA-fMet(cat)
4545 JACJIK010000001.1 GCA014138885_02261 tRNA open 2435197-2435273 trnP tRNA-Pro(ggg)
4546 JACJIK010000002.1 repeat_region open 10657-10939 CRISPR array with 5 repeats of length 29%2C consensus sequence GGGCTCATCCCTGCGTGCGCGGGGCCTCC and spacer length 32
4547 JACJIK010000002.1 GCA014138885_02269 CDS open 542-1222 _na     226_aa hypothetical protein
4548 JACJIK010000002.1 GCA014138885_02270 CDS open 1479-1925 _na     148_aa hypothetical protein
4549 JACJIK010000002.1 GCA014138885_02271 CDS open 2194-2892 _na     232_aa Aldose epimerase
4550 JACJIK010000002.1 GCA014138885_02272 CDS open 3161-3883 _na     240_aa DUF4129 domain-containing protein
4551 JACJIK010000002.1 GCA014138885_02273 CDS open 3996-4505 _na     169_aa Lipoprotein
4552 JACJIK010000002.1 GCA014138885_02274 CDS open 4631-5638 _na     335_aa tnp IS481 family transposase
4553 JACJIK010000002.1 GCA014138885_02275 CDS open 5702-6016 _na     104_aa hypothetical protein
4554 JACJIK010000002.1 GCA014138885_02276 CDS open 6172-6462 _na     96_aa hypothetical protein
4555 JACJIK010000002.1 GCA014138885_02277 CDS open 6654-6884 _na     76_aa hypothetical protein
4556 JACJIK010000002.1 GCA014138885_02278 CDS open 7038-7688 _na     216_aa hypothetical protein
4557 JACJIK010000002.1 GCA014138885_02279 CDS open 7939-8604 _na     221_aa SAM-dependent methyltransferase
4558 JACJIK010000002.1 GCA014138885_02280 CDS open 8817-9146 _na     109_aa DUF3846 domain-containing protein
4559 JACJIK010000002.1 GCA014138885_02281 CDS open 9307-9576 _na     89_aa hypothetical protein
4560 JACJIK010000002.1 GCA014138885_02282 CDS open 9656-9925 _na     89_aa MoaD/ThiS family protein
4561 JACJIK010000002.1 GCA014138885_02283 CDS open 9955-10506 _na     183_aa mmpS MmpS family membrane protein
4562 JACJIK010000002.1 GCA014138885_02284 CDS open 12674-13411 _na     245_aa HNH endonuclease family protein
4563 JACJIK010000002.1 GCA014138885_02285 CDS open 13408-13857 _na     149_aa Helix-turn-helix protein
4564 JACJIK010000002.1 GCA014138885_02286 CDS open 13861-14160 _na     99_aa hypothetical protein
4565 JACJIK010000002.1 GCA014138885_02287 CDS open 14472-14648 _na     58_aa HNH endonuclease
4566 JACJIK010000002.1 GCA014138885_02288 CDS open 14801-15061 _na     86_aa hypothetical protein
4567 JACJIK010000002.1 GCA014138885_02289 CDS open 15175-16182 _na     335_aa tnp IS481 family transposase
4568 JACJIK010000002.1 GCA014138885_02290 CDS open 17058-17375 _na     105_aa Transposase-like protein
4569 JACJIK010000002.1 GCA014138885_02291 CDS open 17378-18079 _na     233_aa IS3 family transposase
4570 JACJIK010000002.1 GCA014138885_02292 CDS open 18045-19487 _na     480_aa tnp IS30 family ISMlu7 transposase
4571 JACJIK010000002.1 GCA014138885_02293 CDS open 19753-21102 _na     449_aa tnp IS256 family ISMlu11 transposase
4572 JACJIK010000002.1 GCA014138885_02294 CDS open 21283-22353 _na     356_aa IS110 family transposase
4573 JACJIK010000002.1 GCA014138885_02295 CDS open 22870-23094 _na     74_aa arsR ArsR family transcriptional regulator
4574 JACJIK010000002.1 GCA014138885_02296 CDS open 23094-24026 _na     310_aa czcD Cation transporter
4575 JACJIK010000002.1 GCA014138885_02297 CDS open 24480-25829 _na     449_aa tnp IS256 family ISMlu11 transposase
4576 JACJIK010000002.1 GCA014138885_02298 CDS open 26050-26715 _na     221_aa Type III restriction-modification system EcoPI enzyme Mod
4577 JACJIK010000002.1 GCA014138885_02299 CDS open 26879-29032 _na     717_aa Adenine specific DNA methylase Mod
4578 JACJIK010000002.1 GCA014138885_02300 CDS open 29038-31623 _na     861_aa Helicase/UvrB N-terminal domain-containing protein
4579 JACJIK010000002.1 GCA014138885_02301 CDS open 31662-31793 _na     43_aa hypothetical protein
4580 JACJIK010000002.1 GCA014138885_02302 CDS open 32665-34419 _na     584_aa hypothetical protein
4581 JACJIK010000002.1 GCA014138885_02303 CDS open 34596-35837 _na     413_aa DUF222 domain-containing protein
4582 JACJIK010000002.1 GCA014138885_02304 CDS open 36543-37112 _na     189_aa DNA-invertase hin
4583 JACJIK010000002.1 GCA014138885_02305 CDS open 37392-38858 _na     488_aa Transporter%2C major facilitator family protein
4584 JACJIK010000002.1 GCA014138885_02306 CDS open 38876-39445 _na     189_aa tetR Transcriptional regulator%2C TetR family
4585 JACJIK010000002.1 GCA014138885_02307 CDS open 39651-40331 _na     226_aa Manganese transport regulator
4586 JACJIK010000002.1 GCA014138885_02308 CDS open 40348-41622 _na     424_aa Nramp family divalent metal transporter
4587 JACJIK010000002.1 GCA014138885_02309 CDS open 41813-42409 _na     198_aa Tat pathway signal sequence domain protein
4588 JACJIK010000002.1 GCA014138885_02310 CDS open 42547-42819 _na     90_aa hypothetical protein
4589 JACJIK010000002.1 GCA014138885_02311 CDS open 42816-43532 _na     238_aa DUF4145 domain-containing protein
4590 JACJIK010000002.1 GCA014138885_02312 CDS open 43543-44010 _na     155_aa DNA-binding protein
4591 JACJIK010000002.1 GCA014138885_02313 CDS open 44001-44780 _na     259_aa Helix-turn-helix protein
4592 JACJIK010000002.1 GCA014138885_02314 CDS open 44773-46542 _na     589_aa hypothetical protein
4593 JACJIK010000002.1 GCA014138885_02315 CDS open 46697-47311 _na     204_aa Integral membrane protein
4594 JACJIK010000002.1 GCA014138885_02316 CDS open 47355-47942 _na     195_aa hypothetical protein
4595 JACJIK010000002.1 GCA014138885_02317 CDS open 47932-48702 _na     256_aa Glutaredoxin domain-containing protein
4596 JACJIK010000002.1 GCA014138885_02318 CDS open 48797-49351 _na     184_aa Ankyrin repeat domain-containing protein
4597 JACJIK010000002.1 GCA014138885_02319 CDS open 49356-49991 _na     211_aa Prepilin type IV endopeptidase peptidase domain-containing protein
4598 JACJIK010000002.1 GCA014138885_02320 CDS open 49972-53427 _na     1151_aa Bacterial transcriptional activator domain-containing protein
4599 JACJIK010000002.1 GCA014138885_02321 CDS open 53522-54784 _na     420_aa Replication protein
4600 JACJIK010000002.1 GCA014138885_02322 CDS open 54987-55223 _na     78_aa hypothetical protein
4601 JACJIK010000002.1 GCA014138885_02323 CDS open 55314-56129 _na     271_aa ATP/GTP-binding protein
4602 JACJIK010000002.1 GCA014138885_02324 CDS open 56255-56989 _na     244_aa Nuclear transport factor 2 family protein
4603 JACJIK010000002.1 GCA014138885_02325 CDS open 57005-57421 _na     138_aa Putative Flp pilus-assembly TadG-like N-terminal domain-containing protein
4604 JACJIK010000002.1 GCA014138885_02326 CDS open 57424-57873 _na     149_aa Pilus assembly protein
4605 JACJIK010000002.1 GCA014138885_02327 CDS open 57870-58280 _na     136_aa Pilus assembly protein
4606 JACJIK010000002.1 GCA014138885_02328 CDS open 58324-58506 _na     60_aa Flp family type IVb pilin
4607 JACJIK010000002.1 GCA014138885_02329 CDS open 58606-59478 _na     290_aa gspF Type II secretion system protein GspF domain-containing protein
4608 JACJIK010000002.1 GCA014138885_02330 CDS open 59475-60341 _na     288_aa gspF Type II secretion system protein GspF domain-containing protein
4609 JACJIK010000002.1 GCA014138885_02331 CDS open 60338-61921 _na     527_aa ATPase%2C T2SS/T4P/T4SS family
4610 JACJIK010000002.1 GCA014138885_02332 CDS open 61918-62742 _na     274_aa bcsQ Cellulose biosynthesis protein BcsQ
4611 JACJIK010000002.1 GCA014138885_02333 CDS open 62739-63443 _na     234_aa SAF domain-containing protein
4612 JACJIK010000002.1 GCA014138885_02334 CDS open 63588-63884 _na     98_aa HTH arsR-type domain-containing protein
4613 JACJIK010000002.1 GCA014138885_02335 CDS open 64069-64992 _na     307_aa parA Plasmid partitioning protein ParA
4614 JACJIK010000002.1 GCA014138885_02336 CDS open 64994-65620 _na     208_aa copG CopG family transcriptional regulator
4615 JACJIK010000002.1 GCA014138885_02337 CDS open 65672-66577 _na     301_aa repA Plasmid encoded RepA protein
4616 JACJIK010000002.1 GCA014138885_02338 CDS open 66976-67782 _na     268_aa Sigma-70 family RNA polymerase sigma factor
4617 JACJIK010000002.1 GCA014138885_02339 CDS open 68045-68272 _na     75_aa HNH endonuclease
4618 JACJIK010000002.1 GCA014138885_02340 CDS open 68269-69363 _na     364_aa Conjugal transfer protein
4619 JACJIK010000002.1 GCA014138885_02341 CDS open 69390-69659 _na     89_aa TrbC/VirB2 family protein
4620 JACJIK010000002.1 GCA014138885_02342 CDS open 69677-70192 _na     171_aa hypothetical protein
4621 JACJIK010000002.1 GCA014138885_02343 CDS open 70189-72744 _na     851_aa ATP-binding cassette domain-containing protein
4622 JACJIK010000002.1 GCA014138885_02344 CDS open 72741-74687 _na     648_aa TrbL/VirB6 plasmid conjugal transfer protein
4623 JACJIK010000002.1 GCA014138885_02345 CDS open 74684-76450 _na     588_aa NlpC/P60 domain-containing protein
4624 JACJIK010000002.1 GCA014138885_02346 CDS open 76447-77232 _na     261_aa Mce-associated membrane protein
4625 JACJIK010000002.1 GCA014138885_02347 CDS open 77464-78237 _na     257_aa Pimeloyl-ACP methyl ester carboxylesterase
4626 JACJIK010000002.1 GCA014138885_02348 CDS open 78580-79140 _na     186_aa hypothetical protein
4627 JACJIK010000002.1 GCA014138885_02349 CDS open 79451-80722 _na     423_aa IS110 family transposase
4628 JACJIK010000002.1 GCA014138885_02350 CDS open 80975-82228 _na     417_aa tnp IS256 family ISMlu1 transposase
4629 JACJIK010000002.1 GCA014138885_02351 CDS open 82617-83096 _na     159_aa Kinase
4630 JACJIK010000002.1 GCA014138885_02352 CDS open 83547-85760 _na     737_aa ftsK FtsK domain-containing protein
4631 JACJIK010000002.1 GCA014138885_02353 CDS open 85762-86067 _na     101_aa LPXTG-motif cell wall-anchored protein
4632 JACJIK010000002.1 GCA014138885_02354 CDS open 86171-87514 _na     447_aa PI3K/PI4K catalytic domain-containing protein
4633 JACJIK010000002.1 GCA014138885_02355 CDS open 87548-87943 _na     131_aa hypothetical protein
4634 JACJIK010000002.1 GCA014138885_02356 CDS open 88147-88377 _na     76_aa hypothetical protein
4635 JACJIK010000002.1 GCA014138885_02357 CDS open 89039-89470 _na     143_aa hypothetical protein
4636 JACJIK010000002.1 GCA014138885_02358 CDS open 90293-90817 _na     174_aa IS5 family transposase
4637 JACJIK010000002.1 GCA014138885_02359 CDS open 90783-91172 _na     129_aa IS5 family transposase
4638 JACJIK010000002.1 GCA014138885_02360 CDS open 92496-93845 _na     449_aa repA replication protein RepA
4639 JACJIK010000002.1 GCA014138885_02361 CDS open 93838-94617 _na     259_aa Helix-turn-helix protein
4640 JACJIK010000002.1 GCA014138885_02362 CDS open 94777-95094 _na     105_aa hypothetical protein
4641 JACJIK010000002.1 GCA014138885_02363 CDS open 95416-97026 _na     536_aa toll/interleukin-1 receptor domain-containing protein
4642 JACJIK010000002.1 GCA014138885_02364 CDS open 97248-98114 _na     288_aa helix-turn-helix domain-containing protein
4643 JACJIK010000002.1 GCA014138885_02365 CDS open 98111-98803 _na     230_aa DUF3800 domain-containing protein
4644 JACJIK010000002.1 GCA014138885_02366 CDS open 98897-100087 _na     396_aa hypothetical protein
4645 JACJIK010000002.1 GCA014138885_02367 CDS open 100084-100173 _na     29_aa hypothetical protein
4646 JACJIK010000002.1 GCA014138885_02368 CDS open 100221-100559 _na     112_aa Lsr2 family protein
4647 JACJIK010000002.1 GCA014138885_02369 CDS open 102757-103923 _na     388_aa cytochrome P450
4648 JACJIK010000002.1 GCA014138885_02370 CDS open 103920-105071 _na     383_aa glycine amidinotransferase
4649 JACJIK010000002.1 GCA014138885_02371 CDS open 105136-106458 _na     440_aa hypothetical protein
4650 JACJIK010000002.1 GCA014138885_02372 CDS open 108162-108401 _na     79_aa hypothetical protein
4651 JACJIK010000002.1 GCA014138885_02373 CDS open 109162-110169 _na     335_aa tnp IS481 family transposase
4652 JACJIK010000002.1 GCA014138885_02374 CDS open 110520-111605 _na     361_aa hypothetical protein
4653 JACJIK010000002.1 GCA014138885_02269 gene open 542-1222
4654 JACJIK010000002.1 GCA014138885_02270 gene open 1479-1925
4655 JACJIK010000002.1 GCA014138885_02271 gene open 2194-2892
4656 JACJIK010000002.1 GCA014138885_02272 gene open 3161-3883
4657 JACJIK010000002.1 GCA014138885_02273 gene open 3996-4505
4658 JACJIK010000002.1 GCA014138885_02274 gene open 4631-5638 tnp
4659 JACJIK010000002.1 GCA014138885_02275 gene open 5702-6016
4660 JACJIK010000002.1 GCA014138885_02276 gene open 6172-6462
4661 JACJIK010000002.1 GCA014138885_02277 gene open 6654-6884
4662 JACJIK010000002.1 GCA014138885_02278 gene open 7038-7688
4663 JACJIK010000002.1 GCA014138885_02279 gene open 7939-8604
4664 JACJIK010000002.1 GCA014138885_02280 gene open 8817-9146
4665 JACJIK010000002.1 GCA014138885_02281 gene open 9307-9576
4666 JACJIK010000002.1 GCA014138885_02282 gene open 9656-9925
4667 JACJIK010000002.1 GCA014138885_02283 gene open 9955-10506 mmpS
4668 JACJIK010000002.1 GCA014138885_02284 gene open 12674-13411
4669 JACJIK010000002.1 GCA014138885_02285 gene open 13408-13857
4670 JACJIK010000002.1 GCA014138885_02286 gene open 13861-14160
4671 JACJIK010000002.1 GCA014138885_02287 gene open 14472-14648
4672 JACJIK010000002.1 GCA014138885_02288 gene open 14801-15061
4673 JACJIK010000002.1 GCA014138885_02289 gene open 15175-16182 tnp
4674 JACJIK010000002.1 GCA014138885_02290 gene open 17058-17375
4675 JACJIK010000002.1 GCA014138885_02291 gene open 17378-18079
4676 JACJIK010000002.1 GCA014138885_02292 gene open 18045-19487 tnp
4677 JACJIK010000002.1 GCA014138885_02293 gene open 19753-21102 tnp
4678 JACJIK010000002.1 GCA014138885_02294 gene open 21283-22353
4679 JACJIK010000002.1 GCA014138885_02295 gene open 22870-23094 arsR
4680 JACJIK010000002.1 GCA014138885_02296 gene open 23094-24026 czcD
4681 JACJIK010000002.1 GCA014138885_02297 gene open 24480-25829 tnp
4682 JACJIK010000002.1 GCA014138885_02298 gene open 26050-26715
4683 JACJIK010000002.1 GCA014138885_02299 gene open 26879-29032
4684 JACJIK010000002.1 GCA014138885_02300 gene open 29038-31623
4685 JACJIK010000002.1 GCA014138885_02301 gene open 31662-31793
4686 JACJIK010000002.1 GCA014138885_02302 gene open 32665-34419
4687 JACJIK010000002.1 GCA014138885_02303 gene open 34596-35837
4688 JACJIK010000002.1 GCA014138885_02304 gene open 36543-37112
4689 JACJIK010000002.1 GCA014138885_02305 gene open 37392-38858
4690 JACJIK010000002.1 GCA014138885_02306 gene open 38876-39445 tetR
4691 JACJIK010000002.1 GCA014138885_02307 gene open 39651-40331
4692 JACJIK010000002.1 GCA014138885_02308 gene open 40348-41622
4693 JACJIK010000002.1 GCA014138885_02309 gene open 41813-42409
4694 JACJIK010000002.1 GCA014138885_02310 gene open 42547-42819
4695 JACJIK010000002.1 GCA014138885_02311 gene open 42816-43532
4696 JACJIK010000002.1 GCA014138885_02312 gene open 43543-44010
4697 JACJIK010000002.1 GCA014138885_02313 gene open 44001-44780
4698 JACJIK010000002.1 GCA014138885_02314 gene open 44773-46542
4699 JACJIK010000002.1 GCA014138885_02315 gene open 46697-47311
4700 JACJIK010000002.1 GCA014138885_02316 gene open 47355-47942
4701 JACJIK010000002.1 GCA014138885_02317 gene open 47932-48702
4702 JACJIK010000002.1 GCA014138885_02318 gene open 48797-49351
4703 JACJIK010000002.1 GCA014138885_02319 gene open 49356-49991
4704 JACJIK010000002.1 GCA014138885_02320 gene open 49972-53427
4705 JACJIK010000002.1 GCA014138885_02321 gene open 53522-54784
4706 JACJIK010000002.1 GCA014138885_02322 gene open 54987-55223
4707 JACJIK010000002.1 GCA014138885_02323 gene open 55314-56129
4708 JACJIK010000002.1 GCA014138885_02324 gene open 56255-56989
4709 JACJIK010000002.1 GCA014138885_02325 gene open 57005-57421
4710 JACJIK010000002.1 GCA014138885_02326 gene open 57424-57873
4711 JACJIK010000002.1 GCA014138885_02327 gene open 57870-58280
4712 JACJIK010000002.1 GCA014138885_02328 gene open 58324-58506
4713 JACJIK010000002.1 GCA014138885_02329 gene open 58606-59478 gspF
4714 JACJIK010000002.1 GCA014138885_02330 gene open 59475-60341 gspF
4715 JACJIK010000002.1 GCA014138885_02331 gene open 60338-61921
4716 JACJIK010000002.1 GCA014138885_02332 gene open 61918-62742 bcsQ
4717 JACJIK010000002.1 GCA014138885_02333 gene open 62739-63443
4718 JACJIK010000002.1 GCA014138885_02334 gene open 63588-63884
4719 JACJIK010000002.1 GCA014138885_02335 gene open 64069-64992 parA
4720 JACJIK010000002.1 GCA014138885_02336 gene open 64994-65620 copG
4721 JACJIK010000002.1 GCA014138885_02337 gene open 65672-66577 repA
4722 JACJIK010000002.1 GCA014138885_02338 gene open 66976-67782
4723 JACJIK010000002.1 GCA014138885_02339 gene open 68045-68272
4724 JACJIK010000002.1 GCA014138885_02340 gene open 68269-69363
4725 JACJIK010000002.1 GCA014138885_02341 gene open 69390-69659
4726 JACJIK010000002.1 GCA014138885_02342 gene open 69677-70192
4727 JACJIK010000002.1 GCA014138885_02343 gene open 70189-72744
4728 JACJIK010000002.1 GCA014138885_02344 gene open 72741-74687
4729 JACJIK010000002.1 GCA014138885_02345 gene open 74684-76450
4730 JACJIK010000002.1 GCA014138885_02346 gene open 76447-77232
4731 JACJIK010000002.1 GCA014138885_02347 gene open 77464-78237
4732 JACJIK010000002.1 GCA014138885_02348 gene open 78580-79140
4733 JACJIK010000002.1 GCA014138885_02349 gene open 79451-80722
4734 JACJIK010000002.1 GCA014138885_02350 gene open 80975-82228 tnp
4735 JACJIK010000002.1 GCA014138885_02351 gene open 82617-83096
4736 JACJIK010000002.1 GCA014138885_02352 gene open 83547-85760 ftsK
4737 JACJIK010000002.1 GCA014138885_02353 gene open 85762-86067
4738 JACJIK010000002.1 GCA014138885_02354 gene open 86171-87514
4739 JACJIK010000002.1 GCA014138885_02355 gene open 87548-87943
4740 JACJIK010000002.1 GCA014138885_02356 gene open 88147-88377
4741 JACJIK010000002.1 GCA014138885_02357 gene open 89039-89470
4742 JACJIK010000002.1 GCA014138885_02358 gene open 90293-90817
4743 JACJIK010000002.1 GCA014138885_02359 gene open 90783-91172
4744 JACJIK010000002.1 GCA014138885_02360 gene open 92496-93845 repA
4745 JACJIK010000002.1 GCA014138885_02361 gene open 93838-94617
4746 JACJIK010000002.1 GCA014138885_02362 gene open 94777-95094
4747 JACJIK010000002.1 GCA014138885_02363 gene open 95416-97026
4748 JACJIK010000002.1 GCA014138885_02364 gene open 97248-98114
4749 JACJIK010000002.1 GCA014138885_02365 gene open 98111-98803
4750 JACJIK010000002.1 GCA014138885_02366 gene open 98897-100087
4751 JACJIK010000002.1 GCA014138885_02367 gene open 100084-100173
4752 JACJIK010000002.1 GCA014138885_02368 gene open 100221-100559
4753 JACJIK010000002.1 GCA014138885_02369 gene open 102757-103923
4754 JACJIK010000002.1 GCA014138885_02370 gene open 103920-105071
4755 JACJIK010000002.1 GCA014138885_02371 gene open 105136-106458
4756 JACJIK010000002.1 GCA014138885_02372 gene open 108162-108401
4757 JACJIK010000002.1 GCA014138885_02373 gene open 109162-110169 tnp
4758 JACJIK010000002.1 GCA014138885_02374 gene open 110520-111605