BAKTAGenome Explorer: Pseudomonas otitidis (GCA_014161995.1)
Select a Genome:
|
BAKTA Annotations for GCA_014161995.1
|
Search & Sort all 11548 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | AP022213.1 | GCA014161995_05070 | gene | open | 5441000-5441351 | ssrA | ||
| 2 | AP022213.1 | GCA014161995_05070 | tmRNA | open | 5441000-5441351 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | AP022213.1 | rep_origin | open | 6193229-6193744 | ||||
| 4 | AP022213.1 | GCA014161995_00100 | gene | open | 97755-97872 | Pseudomon-1 | ||
| 5 | AP022213.1 | GCA014161995_00255 | gene | open | 253342-253520 | 6S | ||
| 6 | AP022213.1 | GCA014161995_00282 | gene | open | 280738-280917 | P1 | ||
| 7 | AP022213.1 | GCA014161995_00452 | gene | open | 461987-462135 | proV | ||
| 8 | AP022213.1 | GCA014161995_00559 | gene | open | 587851-587971 | rsmY | ||
| 9 | AP022213.1 | GCA014161995_00588 | gene | open | 617427-617514 | C4 | ||
| 10 | AP022213.1 | GCA014161995_00648 | gene | open | 681264-682799 | rrs | ||
| 11 | AP022213.1 | GCA014161995_00651 | gene | open | 683296-686187 | rrl | ||
| 12 | AP022213.1 | GCA014161995_00652 | gene | open | 686310-686425 | rrf | ||
| 13 | AP022213.1 | GCA014161995_00665 | gene | open | 693025-693228 | P27 | ||
| 14 | AP022213.1 | GCA014161995_00668 | gene | open | 694184-694249 | P26 | ||
| 15 | AP022213.1 | GCA014161995_00719 | gene | open | 746300-746583 | 5_ureB_sRNA | ||
| 16 | AP022213.1 | GCA014161995_00796 | gene | open | 834251-834370 | P15 | ||
| 17 | AP022213.1 | GCA014161995_00946 | gene | open | 994326-994582 | P24 | ||
| 18 | AP022213.1 | GCA014161995_00978 | gene | open | 1025595-1025668 | P9 | ||
| 19 | AP022213.1 | GCA014161995_01035 | gene | open | 1094098-1094219 | yrlA | ||
| 20 | AP022213.1 | GCA014161995_01037 | gene | open | 1094250-1094357 | yrlA | ||
| 21 | AP022213.1 | GCA014161995_01049 | gene | open | 1106312-1106434 | rsmW | ||
| 22 | AP022213.1 | GCA014161995_01262 | gene | open | 1319162-1319519 | RNaseP_bact_a | ||
| 23 | AP022213.1 | GCA014161995_01383 | gene | open | 1451407-1451493 | C4 | ||
| 24 | AP022213.1 | GCA014161995_01384 | gene | open | 1451584-1451636 | c4-a1b1 | ||
| 25 | AP022213.1 | GCA014161995_01427 | gene | open | 1495625-1495708 | C4 | ||
| 26 | AP022213.1 | GCA014161995_01428 | gene | open | 1495797-1495849 | c4-a1b1 | ||
| 27 | AP022213.1 | GCA014161995_01573 | gene | open | 1645909-1646126 | phrS | ||
| 28 | AP022213.1 | GCA014161995_01577 | gene | open | 1648372-1648506 | P18 | ||
| 29 | AP022213.1 | GCA014161995_01664 | gene | open | 1731677-1731757 | sRNA-Xcc1 | ||
| 30 | AP022213.1 | GCA014161995_02225 | gene | open | 2328080-2328132 | c4-a1b1 | ||
| 31 | AP022213.1 | GCA014161995_02226 | gene | open | 2328226-2328312 | C4 | ||
| 32 | AP022213.1 | GCA014161995_02229 | gene | open | 2329329-2329415 | C4 | ||
| 33 | AP022213.1 | GCA014161995_02230 | gene | open | 2329505-2329557 | c4-a1b1 | ||
| 34 | AP022213.1 | GCA014161995_02401 | gene | open | 2532629-2532858 | srbA | ||
| 35 | AP022213.1 | GCA014161995_02436 | gene | open | 2565395-2565477 | C4 | ||
| 36 | AP022213.1 | GCA014161995_02722 | gene | open | 2909581-2909633 | c4-a1b1 | ||
| 37 | AP022213.1 | GCA014161995_02860 | gene | open | 3052565-3052617 | c4-a1b1 | ||
| 38 | AP022213.1 | GCA014161995_03101 | gene | open | 3327505-3327578 | Hammerhead_II | ||
| 39 | AP022213.1 | GCA014161995_03406 | gene | open | 3650470-3650522 | c4-a1b1 | ||
| 40 | AP022213.1 | GCA014161995_03407 | gene | open | 3650612-3650696 | C4 | ||
| 41 | AP022213.1 | GCA014161995_03480 | gene | open | 3730670-3730755 | C4 | ||
| 42 | AP022213.1 | GCA014161995_03481 | gene | open | 3730780-3730857 | isrK | ||
| 43 | AP022213.1 | GCA014161995_03651 | gene | open | 3928986-3929082 | Bacteria_small_SRP | ||
| 44 | AP022213.1 | GCA014161995_03707 | gene | open | 3989565-3989680 | rrf | ||
| 45 | AP022213.1 | GCA014161995_03708 | gene | open | 3989803-3992694 | rrl | ||
| 46 | AP022213.1 | GCA014161995_03711 | gene | open | 3993191-3994726 | rrs | ||
| 47 | AP022213.1 | GCA014161995_03824 | gene | open | 4119916-4120062 | P14 | ||
| 48 | AP022213.1 | GCA014161995_03873 | gene | open | 4174298-4174350 | c4-a1b1 | ||
| 49 | AP022213.1 | GCA014161995_03874 | gene | open | 4174440-4174523 | C4 | ||
| 50 | AP022213.1 | GCA014161995_04138 | gene | open | 4460098-4460293 | rgsA | ||
| 51 | AP022213.1 | GCA014161995_04488 | gene | open | 4820901-4821031 | PrrB_RsmZ | ||
| 52 | AP022213.1 | GCA014161995_04523 | gene | open | 4857207-4857293 | t44 | ||
| 53 | AP022213.1 | GCA014161995_04803 | gene | open | 5165291-5165343 | c4-a1b1 | ||
| 54 | AP022213.1 | GCA014161995_04804 | gene | open | 5165421-5165504 | C4 | ||
| 55 | AP022213.1 | GCA014161995_04977 | gene | open | 5342803-5342918 | rrf | ||
| 56 | AP022213.1 | GCA014161995_04978 | gene | open | 5343041-5345932 | rrl | ||
| 57 | AP022213.1 | GCA014161995_04981 | gene | open | 5346429-5347964 | rrs | ||
| 58 | AP022213.1 | GCA014161995_04997 | gene | open | 5363226-5363375 | prrF | ||
| 59 | AP022213.1 | GCA014161995_05013 | gene | open | 5378409-5378469 | P36 | ||
| 60 | AP022213.1 | GCA014161995_05014 | gene | open | 5378565-5378966 | crcZ | ||
| 61 | AP022213.1 | GCA014161995_05053 | gene | open | 5420988-5421064 | P31 | ||
| 62 | AP022213.1 | GCA014161995_05199 | gene | open | 5562000-5562052 | c4-a1b1 | ||
| 63 | AP022213.1 | GCA014161995_05200 | gene | open | 5562143-5562228 | C4 | ||
| 64 | AP022213.1 | GCA014161995_05339 | gene | open | 5741658-5741741 | sRNA-Xcc1 | ||
| 65 | AP022213.1 | GCA014161995_05377 | gene | open | 5781296-5781589 | asponA | ||
| 66 | AP022213.1 | GCA014161995_05444 | gene | open | 5857746-5858003 | nrsZ | ||
| 67 | AP022213.1 | GCA014161995_05625 | gene | open | 6046092-6046207 | rrf | ||
| 68 | AP022213.1 | GCA014161995_05626 | gene | open | 6046330-6049221 | rrl | ||
| 69 | AP022213.1 | GCA014161995_05629 | gene | open | 6049718-6051253 | rrs | ||
| 70 | AP022213.1 | GCA014161995_05679 | gene | open | 6113264-6113354 | sRNA-Xcc1 | ||
| 71 | AP022213.1 | GCA014161995_00100 | ncRNA | open | 97755-97872 | Pseudomon-1/ErsA RNA | ||
| 72 | AP022213.1 | GCA014161995_00255 | ncRNA | open | 253342-253520 | 6S / SsrS RNA | ||
| 73 | AP022213.1 | GCA014161995_00282 | ncRNA | open | 280738-280917 | Pseudomonas sRNA P1 | ||
| 74 | AP022213.1 | GCA014161995_00452 | ncRNA | open | 461987-462135 | proV | proV RNA | |
| 75 | AP022213.1 | GCA014161995_00559 | ncRNA | open | 587851-587971 | rsmY | RsmY RNA family | |
| 76 | AP022213.1 | GCA014161995_00588 | ncRNA | open | 617427-617514 | C4 antisense RNA | ||
| 77 | AP022213.1 | GCA014161995_00665 | ncRNA | open | 693025-693228 | Pseudomonas sRNA P27 | ||
| 78 | AP022213.1 | GCA014161995_00668 | ncRNA | open | 694184-694249 | Pseudomonas sRNA P26 | ||
| 79 | AP022213.1 | GCA014161995_00719 | ncRNA | open | 746300-746583 | 5' ureB small RNA | ||
| 80 | AP022213.1 | GCA014161995_00796 | ncRNA | open | 834251-834370 | Pseudomonas sRNA P15 | ||
| 81 | AP022213.1 | GCA014161995_00946 | ncRNA | open | 994326-994582 | Pseudomonas sRNA P24 | ||
| 82 | AP022213.1 | GCA014161995_00978 | ncRNA | open | 1025595-1025668 | Pseudomonas sRNA P9 | ||
| 83 | AP022213.1 | GCA014161995_01035 | ncRNA | open | 1094098-1094219 | yrlA | Y RNA-like | |
| 84 | AP022213.1 | GCA014161995_01037 | ncRNA | open | 1094250-1094357 | yrlA | Y RNA-like | |
| 85 | AP022213.1 | GCA014161995_01049 | ncRNA | open | 1106312-1106434 | rsmW | RsmW RNA family | |
| 86 | AP022213.1 | GCA014161995_01262 | ncRNA | open | 1319162-1319519 | Bacterial RNase P class A | ||
| 87 | AP022213.1 | GCA014161995_01383 | ncRNA | open | 1451407-1451493 | C4 antisense RNA | ||
| 88 | AP022213.1 | GCA014161995_01384 | ncRNA | open | 1451584-1451636 | a1%2C b1 targets of C4 antisense RNA | ||
| 89 | AP022213.1 | GCA014161995_01427 | ncRNA | open | 1495625-1495708 | C4 antisense RNA | ||
| 90 | AP022213.1 | GCA014161995_01428 | ncRNA | open | 1495797-1495849 | a1%2C b1 targets of C4 antisense RNA | ||
| 91 | AP022213.1 | GCA014161995_01573 | ncRNA | open | 1645909-1646126 | phrS | PhrS | |
| 92 | AP022213.1 | GCA014161995_01577 | ncRNA | open | 1648372-1648506 | Pseudomonas sRNA P18 | ||
| 93 | AP022213.1 | GCA014161995_01664 | ncRNA | open | 1731677-1731757 | sRNA-Xcc1 | ||
| 94 | AP022213.1 | GCA014161995_02225 | ncRNA | open | 2328080-2328132 | a1%2C b1 targets of C4 antisense RNA | ||
| 95 | AP022213.1 | GCA014161995_02226 | ncRNA | open | 2328226-2328312 | C4 antisense RNA | ||
| 96 | AP022213.1 | GCA014161995_02229 | ncRNA | open | 2329329-2329415 | C4 antisense RNA | ||
| 97 | AP022213.1 | GCA014161995_02230 | ncRNA | open | 2329505-2329557 | a1%2C b1 targets of C4 antisense RNA | ||
| 98 | AP022213.1 | GCA014161995_02401 | ncRNA | open | 2532629-2532858 | srbA | sRNA regulator of biofilms A | |
| 99 | AP022213.1 | GCA014161995_02436 | ncRNA | open | 2565395-2565477 | C4 antisense RNA | ||
| 100 | AP022213.1 | GCA014161995_02722 | ncRNA | open | 2909581-2909633 | a1%2C b1 targets of C4 antisense RNA | ||
| 101 | AP022213.1 | GCA014161995_02860 | ncRNA | open | 3052565-3052617 | a1%2C b1 targets of C4 antisense RNA | ||
| 102 | AP022213.1 | GCA014161995_03101 | ncRNA | open | 3327505-3327578 | Hammerhead ribozyme (type II) | ||
| 103 | AP022213.1 | GCA014161995_03406 | ncRNA | open | 3650470-3650522 | a1%2C b1 targets of C4 antisense RNA | ||
| 104 | AP022213.1 | GCA014161995_03407 | ncRNA | open | 3650612-3650696 | C4 antisense RNA | ||
| 105 | AP022213.1 | GCA014161995_03480 | ncRNA | open | 3730670-3730755 | C4 antisense RNA | ||
| 106 | AP022213.1 | GCA014161995_03481 | ncRNA | open | 3730780-3730857 | isrK | isrK Hfq binding RNA | |
| 107 | AP022213.1 | GCA014161995_03651 | ncRNA | open | 3928986-3929082 | Bacterial small signal recognition particle RNA | ||
| 108 | AP022213.1 | GCA014161995_03824 | ncRNA | open | 4119916-4120062 | Pseudomonas sRNA P14 | ||
| 109 | AP022213.1 | GCA014161995_03873 | ncRNA | open | 4174298-4174350 | a1%2C b1 targets of C4 antisense RNA | ||
| 110 | AP022213.1 | GCA014161995_03874 | ncRNA | open | 4174440-4174523 | C4 antisense RNA | ||
| 111 | AP022213.1 | GCA014161995_04138 | ncRNA | open | 4460098-4460293 | rgsA | RgsA sRNA | |
| 112 | AP022213.1 | GCA014161995_04488 | ncRNA | open | 4820901-4821031 | PrrB/RsmZ RNA family | ||
| 113 | AP022213.1 | GCA014161995_04523 | ncRNA | open | 4857207-4857293 | t44 RNA | ||
| 114 | AP022213.1 | GCA014161995_04803 | ncRNA | open | 5165291-5165343 | a1%2C b1 targets of C4 antisense RNA | ||
| 115 | AP022213.1 | GCA014161995_04804 | ncRNA | open | 5165421-5165504 | C4 antisense RNA | ||
| 116 | AP022213.1 | GCA014161995_04997 | ncRNA | open | 5363226-5363375 | prrF | PrrF RNA | |
| 117 | AP022213.1 | GCA014161995_05013 | ncRNA | open | 5378409-5378469 | Pseudomonas sRNA P36 | ||
| 118 | AP022213.1 | GCA014161995_05014 | ncRNA | open | 5378565-5378966 | crcZ | Pseudomonas sRNA CrcZ | |
| 119 | AP022213.1 | GCA014161995_05053 | ncRNA | open | 5420988-5421064 | Pseudomonas sRNA P31 | ||
| 120 | AP022213.1 | GCA014161995_05199 | ncRNA | open | 5562000-5562052 | a1%2C b1 targets of C4 antisense RNA | ||
| 121 | AP022213.1 | GCA014161995_05200 | ncRNA | open | 5562143-5562228 | C4 antisense RNA | ||
| 122 | AP022213.1 | GCA014161995_05339 | ncRNA | open | 5741658-5741741 | sRNA-Xcc1 | ||
| 123 | AP022213.1 | GCA014161995_05377 | ncRNA | open | 5781296-5781589 | anti ponA RNA | ||
| 124 | AP022213.1 | GCA014161995_05444 | ncRNA | open | 5857746-5858003 | nrsZ | Nitrogen regulated small RNA | |
| 125 | AP022213.1 | GCA014161995_05679 | ncRNA | open | 6113264-6113354 | sRNA-Xcc1 | ||
| 126 | AP022213.1 | regulatory_region | open | 112156-112250 | ivy-DE RNA | |||
| 127 | AP022213.1 | regulatory_region | open | 239627-239725 | Pseudomon-Rho RNA | |||
| 128 | AP022213.1 | regulatory_region | open | 420189-420282 | SAH (S-adenosyl-L-homocysteine) riboswitch aptamer | |||
| 129 | AP022213.1 | regulatory_region | open | 702775-702905 | Pseudomonas rpsL leader | |||
| 130 | AP022213.1 | regulatory_region | open | 718154-718252 | Alpha operon ribosome binding site | |||
| 131 | AP022213.1 | regulatory_region | open | 802194-802252 | Selenocysteine insertion sequence 3 | |||
| 132 | AP022213.1 | regulatory_region | open | 827319-827522 | Cobalamin riboswitch aptamer | |||
| 133 | AP022213.1 | regulatory_region | open | 844311-844504 | Cobalamin riboswitch aptamer | |||
| 134 | AP022213.1 | regulatory_region | open | 856267-856423 | FMN riboswitch aptamer (RFN element) | |||
| 135 | AP022213.1 | regulatory_region | open | 1357445-1357560 | Pseudomon-groES RNA | |||
| 136 | AP022213.1 | regulatory_region | open | 1813102-1813233 | rmf RNA | |||
| 137 | AP022213.1 | regulatory_region | open | 1864275-1864355 | gyrA RNA | |||
| 138 | AP022213.1 | regulatory_region | open | 1910262-1910331 | Repression of heat shock gene expression (ROSE) element | |||
| 139 | AP022213.1 | regulatory_region | open | 2208521-2208737 | sucA-II RNA | |||
| 140 | AP022213.1 | regulatory_region | open | 2214463-2214531 | sucC RNA | |||
| 141 | AP022213.1 | regulatory_region | open | 2266016-2266219 | Cobalamin riboswitch aptamer | |||
| 142 | AP022213.1 | regulatory_region | open | 2404641-2404685 | Guanidine-II riboswitch aptamer (mini-ykkC) | |||
| 143 | AP022213.1 | regulatory_region | open | 2409067-2409166 | Guanidine-I riboswitch aptamer | |||
| 144 | AP022213.1 | regulatory_region | open | 2441321-2441372 | terC RNA | |||
| 145 | AP022213.1 | regulatory_region | open | 3129261-3129456 | Cobalamin riboswitch aptamer | |||
| 146 | AP022213.1 | regulatory_region | open | 3350785-3350889 | TwoAYGGAY RNA | |||
| 147 | AP022213.1 | regulatory_region | open | 4473968-4474238 | rne-II RNA | |||
| 148 | AP022213.1 | regulatory_region | open | 4499679-4499892 | Cobalamin riboswitch aptamer | |||
| 149 | AP022213.1 | regulatory_region | open | 4741722-4741774 | terC RNA | |||
| 150 | AP022213.1 | regulatory_region | open | 4816330-4816445 | ALIL pseudoknot | |||
| 151 | AP022213.1 | regulatory_region | open | 5255035-5255134 | Manganese Mn2+ riboswitch aptamer (yybP-ykoY) | |||
| 152 | AP022213.1 | regulatory_region | open | 5402623-5402743 | Ribosomal S15 leader | |||
| 153 | AP022213.1 | regulatory_region | open | 5647969-5648075 | TPP riboswitch aptamer (THI element) | |||
| 154 | AP022213.1 | regulatory_region | open | 5846969-5847059 | Glycine riboswitch aptamer | |||
| 155 | AP022213.1 | regulatory_region | open | 5847060-5847159 | Glycine riboswitch aptamer | |||
| 156 | AP022213.1 | regulatory_region | open | 5921399-5921454 | COG3860 RNA | |||
| 157 | AP022213.1 | GCA014161995_00648 | rRNA | open | 681264-682799 | rrs | 16S ribosomal RNA | |
| 158 | AP022213.1 | GCA014161995_00651 | rRNA | open | 683296-686187 | rrl | 23S ribosomal RNA | |
| 159 | AP022213.1 | GCA014161995_00652 | rRNA | open | 686310-686425 | rrf | 5S ribosomal RNA | |
| 160 | AP022213.1 | GCA014161995_03707 | rRNA | open | 3989565-3989680 | rrf | 5S ribosomal RNA | |
| 161 | AP022213.1 | GCA014161995_03708 | rRNA | open | 3989803-3992694 | rrl | 23S ribosomal RNA | |
| 162 | AP022213.1 | GCA014161995_03711 | rRNA | open | 3993191-3994726 | rrs | 16S ribosomal RNA | |
| 163 | AP022213.1 | GCA014161995_04977 | rRNA | open | 5342803-5342918 | rrf | 5S ribosomal RNA | |
| 164 | AP022213.1 | GCA014161995_04978 | rRNA | open | 5343041-5345932 | rrl | 23S ribosomal RNA | |
| 165 | AP022213.1 | GCA014161995_04981 | rRNA | open | 5346429-5347964 | rrs | 16S ribosomal RNA | |
| 166 | AP022213.1 | GCA014161995_05625 | rRNA | open | 6046092-6046207 | rrf | 5S ribosomal RNA | |
| 167 | AP022213.1 | GCA014161995_05626 | rRNA | open | 6046330-6049221 | rrl | 23S ribosomal RNA | |
| 168 | AP022213.1 | GCA014161995_05629 | rRNA | open | 6049718-6051253 | rrs | 16S ribosomal RNA | |
| 169 | AP022213.1 | repeat_region | open | 985612-986076 | CRISPR array with 8 repeats of length 29%2C consensus sequence GTGTTCCCCACGGGGGTGGGGATGAACCG and spacer length 32 | |||
| 170 | AP022213.1 | repeat_region | open | 3731736-3732385 | CRISPR array with 11 repeats of length 29%2C consensus sequence CGGTTCATCCCCACACCCGTGGGGAACAC and spacer length 32 | |||
| 171 | AP022213.1 | GCA014161995_00001 | CDS | open | 95-1561 | _na 488_aa | dnaA | chromosomal replication initiator protein DnaA |
| 172 | AP022213.1 | GCA014161995_00002 | CDS | open | 1600-2703 | _na 367_aa | dnaN | DNA polymerase III subunit beta |
| 173 | AP022213.1 | GCA014161995_00003 | CDS | open | 2712-3821 | _na 369_aa | recF | DNA replication/repair protein RecF |
| 174 | AP022213.1 | GCA014161995_00004 | CDS | open | 3818-6238 | _na 806_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 175 | AP022213.1 | GCA014161995_00005 | CDS | open | 6320-6520 | _na 66_aa | hypothetical protein | |
| 176 | AP022213.1 | GCA014161995_00006 | CDS | open | 6652-7425 | _na 257_aa | 1-acyl-sn-glycerol-3-phosphate acyltransferase | |
| 177 | AP022213.1 | GCA014161995_00007 | CDS | open | 7441-7971 | _na 176_aa | gmhB | D-glycero-beta-D-manno-heptose 1%2C7-bisphosphate 7-phosphatase |
| 178 | AP022213.1 | GCA014161995_00008 | CDS | open | 8024-10078 | _na 684_aa | Glycine--tRNA ligase beta subunit | |
| 179 | AP022213.1 | GCA014161995_00009 | CDS | open | 10075-11022 | _na 315_aa | glyQ | glycine--tRNA ligase subunit alpha |
| 180 | AP022213.1 | GCA014161995_00010 | CDS | open | 11104-11655 | _na 183_aa | DNA-3-methyladenine glycosylase I | |
| 181 | AP022213.1 | GCA014161995_00011 | CDS | open | 11723-12610 | _na 295_aa | lysophospholipid acyltransferase | |
| 182 | AP022213.1 | GCA014161995_00012 | CDS | open | 12706-12972 | _na 88_aa | pilZ | PilZ domain-containing protein |
| 183 | AP022213.1 | GCA014161995_00013 | CDS | open | 12992-13420 | _na 142_aa | hypothetical protein | |
| 184 | AP022213.1 | GCA014161995_00014 | CDS | open | 13422-13742 | _na 106_aa | TPR repeat-containing protein | |
| 185 | AP022213.1 | GCA014161995_00015 | CDS | open | 13810-15333 | _na 507_aa | Trk system potassium uptake protein | |
| 186 | AP022213.1 | GCA014161995_00016 | CDS | open | 15454-16827 | _na 457_aa | trkA | Trk system potassium transporter TrkA |
| 187 | AP022213.1 | GCA014161995_00017 | CDS | open | 16839-18152 | _na 437_aa | rsmB | 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB |
| 188 | AP022213.1 | GCA014161995_00018 | CDS | open | 18149-19093 | _na 314_aa | fmt | methionyl-tRNA formyltransferase |
| 189 | AP022213.1 | GCA014161995_00019 | CDS | open | 19154-19660 | _na 168_aa | Peptide deformylase | |
| 190 | AP022213.1 | GCA014161995_00020 | CDS | open | 19802-20827 | _na 341_aa | lysM | LysM domain-containing protein |
| 191 | AP022213.1 | GCA014161995_00021 | CDS | open | 20912-22012 | _na 366_aa | dprA | DNA-processing protein DprA |
| 192 | AP022213.1 | GCA014161995_00022 | CDS | open | 22053-22610 | _na 185_aa | Threonylcarbamoyl-AMP synthase | |
| 193 | AP022213.1 | GCA014161995_00023 | CDS | open | 22669-23646 | _na 325_aa | Quinone oxidoreductase | |
| 194 | AP022213.1 | GCA014161995_00024 | CDS | open | 23804-24721 | _na 305_aa | hemF | oxygen-dependent coproporphyrinogen oxidase |
| 195 | AP022213.1 | GCA014161995_00025 | CDS | open | 24879-25703 | _na 274_aa | aroE | shikimate dehydrogenase |
| 196 | AP022213.1 | GCA014161995_00026 | CDS | open | 25727-27325 | _na 532_aa | Sulfate transporter | |
| 197 | AP022213.1 | GCA014161995_00027 | CDS | open | 27410-28336 | _na 308_aa | Choline ABC transporter substrate-binding protein | |
| 198 | AP022213.1 | GCA014161995_00028 | CDS | open | 28347-29855 | _na 502_aa | betC | choline-sulfatase |
| 199 | AP022213.1 | GCA014161995_00029 | CDS | open | 29968-30918 | _na 316_aa | choline sulfate utilization transcriptional regulator | |
| 200 | AP022213.1 | GCA014161995_00030 | CDS | open | 31063-32049 | _na 328_aa | Phospholipase C | |
| 201 | AP022213.1 | GCA014161995_00031 | CDS | open | 32030-33304 | _na 424_aa | peptidylprolyl isomerase | |
| 202 | AP022213.1 | GCA014161995_00032 | CDS | open | 33301-33897 | _na 198_aa | plcR | Phospholipase C accessory protein PlcR |
| 203 | AP022213.1 | GCA014161995_00033 | CDS | open | 33952-34320 | _na 122_aa | Aromatic ring-cleaving dioxygenase | |
| 204 | AP022213.1 | GCA014161995_00034 | CDS | open | 34317-35753 | _na 478_aa | Amine oxidase [flavin-containing] A | |
| 205 | AP022213.1 | GCA014161995_00035 | CDS | open | 35825-36499 | _na 224_aa | HTH gntR-type domain-containing protein | |
| 206 | AP022213.1 | GCA014161995_00036 | CDS | open | 36601-37467 | _na 288_aa | carboxylate/amino acid/amine transporter | |
| 207 | AP022213.1 | GCA014161995_00037 | CDS | open | 37519-38397 | _na 292_aa | Methionine aminopeptidase | |
| 208 | AP022213.1 | GCA014161995_00038 | CDS | open | 38617-39426 | _na 269_aa | trpA | tryptophan synthase subunit alpha |
| 209 | AP022213.1 | GCA014161995_00039 | CDS | open | 39426-40649 | _na 407_aa | trpB | tryptophan synthase subunit beta |
| 210 | AP022213.1 | GCA014161995_00040 | CDS | open | 40767-41438 | _na 223_aa | DUF3592 domain-containing protein | |
| 211 | AP022213.1 | GCA014161995_00041 | CDS | open | 41440-42327 | _na 295_aa | trpI | HTH-type transcriptional regulator TrpI |
| 212 | AP022213.1 | GCA014161995_00042 | CDS | open | 42422-42925 | _na 167_aa | DUF3060 domain-containing protein | |
| 213 | AP022213.1 | GCA014161995_00043 | CDS | open | 42930-43259 | _na 109_aa | Transmembrane protein | |
| 214 | AP022213.1 | GCA014161995_00044 | CDS | open | 43395-43610 | _na 71_aa | dodecin | |
| 215 | AP022213.1 | GCA014161995_00045 | CDS | open | 43750-43974 | _na 74_aa | DUF1161 domain-containing protein | |
| 216 | AP022213.1 | GCA014161995_00046 | CDS | open | 44210-45208 | _na 332_aa | Luciferase-like domain-containing protein | |
| 217 | AP022213.1 | GCA014161995_00047 | CDS | open | 45211-45630 | _na 139_aa | Lipoprotein | |
| 218 | AP022213.1 | GCA014161995_00048 | CDS | open | 45693-46109 | _na 138_aa | Lipoprotein | |
| 219 | AP022213.1 | GCA014161995_00049 | CDS | open | 46158-47255 | _na 365_aa | Putative zinc protease protein | |
| 220 | AP022213.1 | GCA014161995_00050 | CDS | open | 47287-47520 | _na 77_aa | DUF1161 domain-containing protein | |
| 221 | AP022213.1 | GCA014161995_00051 | CDS | open | 47523-48167 | _na 214_aa | Phosphoglycolate phosphatase | |
| 222 | AP022213.1 | GCA014161995_00052 | CDS | open | 48196-48741 | _na 181_aa | Carbonic anhydrase%2C family 3 | |
| 223 | AP022213.1 | GCA014161995_00053 | CDS | open | 48906-49100 | _na 64_aa | sutA | Transcriptional regulator SutA RNAP-binding domain-containing protein |
| 224 | AP022213.1 | GCA014161995_00054 | CDS | open | 49116-51227 | _na 703_aa | prlC | oligopeptidase A |
| 225 | AP022213.1 | GCA014161995_00055 | CDS | open | 51224-51490 | _na 88_aa | yheV | YheV family putative zinc ribbon protein |
| 226 | AP022213.1 | GCA014161995_00056 | CDS | open | 51513-52295 | _na 260_aa | DUF1835 domain-containing protein | |
| 227 | AP022213.1 | GCA014161995_00057 | CDS | open | 52340-52981 | _na 213_aa | vat | Vat family streptogramin A O-acetyltransferase |
| 228 | AP022213.1 | GCA014161995_00058 | CDS | open | 53112-53939 | _na 275_aa | hypothetical protein | |
| 229 | AP022213.1 | GCA014161995_00059 | CDS | open | 53936-54448 | _na 170_aa | Lipoprotein | |
| 230 | AP022213.1 | GCA014161995_00060 | CDS | open | 54531-55589 | _na 352_aa | Radical SAM domain protein | |
| 231 | AP022213.1 | GCA014161995_00061 | CDS | open | 55737-56441 | _na 234_aa | Carbonic anhydrase | |
| 232 | AP022213.1 | GCA014161995_00062 | CDS | open | 56733-57464 | _na 243_aa | Carbonic anhydrase | |
| 233 | AP022213.1 | GCA014161995_00063 | CDS | open | 57531-59060 | _na 509_aa | Sulfate transporter family protein in cluster with carbonic anhydrase | |
| 234 | AP022213.1 | GCA014161995_00064 | CDS | open | 59064-59723 | _na 219_aa | Transcriptional regulator | |
| 235 | AP022213.1 | GCA014161995_00065 | CDS | open | 60094-61221 | _na 375_aa | coxB | cytochrome c oxidase subunit II |
| 236 | AP022213.1 | GCA014161995_00066 | CDS | open | 61223-62827 | _na 534_aa | ctaD | cytochrome c oxidase subunit I |
| 237 | AP022213.1 | GCA014161995_00067 | CDS | open | 62829-63374 | _na 181_aa | cytochrome c oxidase assembly protein | |
| 238 | AP022213.1 | GCA014161995_00068 | CDS | open | 63397-64284 | _na 295_aa | cytochrome-c oxidase | |
| 239 | AP022213.1 | GCA014161995_00069 | CDS | open | 64299-64502 | _na 67_aa | Permeases of the major facilitator superfamily | |
| 240 | AP022213.1 | GCA014161995_00070 | CDS | open | 64534-65304 | _na 256_aa | SURF1-like protein | |
| 241 | AP022213.1 | GCA014161995_00071 | CDS | open | 65279-65857 | _na 192_aa | Transmembrane protein | |
| 242 | AP022213.1 | GCA014161995_00072 | CDS | open | 65879-66922 | _na 347_aa | Heme A synthase%2C cytochrome oxidase biogenesis protein Cox15-CtaA | |
| 243 | AP022213.1 | GCA014161995_00073 | CDS | open | 66946-67851 | _na 301_aa | cyoE | heme o synthase |
| 244 | AP022213.1 | GCA014161995_00074 | CDS | open | 67999-68634 | _na 211_aa | Cytochrome c oxidase assembly protein | |
| 245 | AP022213.1 | GCA014161995_00075 | CDS | open | 68719-69231 | _na 170_aa | Sigma factor%2C ECF subfamily | |
| 246 | AP022213.1 | GCA014161995_00076 | CDS | open | 69191-70288 | _na 365_aa | Iron siderophore sensor protein | |
| 247 | AP022213.1 | GCA014161995_00077 | CDS | open | 70436-73096 | _na 886_aa | hasR | Heme uptake outer membrane receptor HasR |
| 248 | AP022213.1 | GCA014161995_00078 | CDS | open | 73174-73776 | _na 200_aa | hasA | Hemophore HasA |
| 249 | AP022213.1 | GCA014161995_00079 | CDS | open | 73933-75693 | _na 586_aa | hasD | Transporter HasD |
| 250 | AP022213.1 | GCA014161995_00080 | CDS | open | 75707-77029 | _na 440_aa | Membrane fusion protein (MFP) family protein | |
| 251 | AP022213.1 | GCA014161995_00081 | CDS | open | 77029-78372 | _na 447_aa | Peptidase | |
| 252 | AP022213.1 | GCA014161995_00082 | CDS | open | 78511-78939 | _na 142_aa | DUF4180 domain-containing protein | |
| 253 | AP022213.1 | GCA014161995_00083 | CDS | open | 79091-79684 | _na 197_aa | Heme oxygenase | |
| 254 | AP022213.1 | GCA014161995_00084 | CDS | open | 79677-80075 | _na 132_aa | Inner membrane protein | |
| 255 | AP022213.1 | GCA014161995_00085 | CDS | open | 80538-81308 | _na 256_aa | Methionine ABC transporter substrate-binding protein | |
| 256 | AP022213.1 | GCA014161995_00086 | CDS | open | 81364-82029 | _na 221_aa | D-methionine ABC transporter membrane protein | |
| 257 | AP022213.1 | GCA014161995_00087 | CDS | open | 82029-83036 | _na 335_aa | metN | Methionine import ATP-binding protein MetN 2 |
| 258 | AP022213.1 | GCA014161995_00088 | CDS | open | 83215-84027 | _na 270_aa | PA5502 family lipoprotein | |
| 259 | AP022213.1 | GCA014161995_00089 | CDS | open | 84262-85911 | _na 549_aa | Choline dehydrogenase | |
| 260 | AP022213.1 | GCA014161995_00090 | CDS | open | 85908-86693 | _na 261_aa | znuB | zinc ABC transporter permease subunit ZnuB |
| 261 | AP022213.1 | GCA014161995_00091 | CDS | open | 86686-87492 | _na 268_aa | znuC | zinc ABC transporter ATP-binding protein ZnuC |
| 262 | AP022213.1 | GCA014161995_00092 | CDS | open | 87489-87989 | _na 166_aa | Zinc uptake regulation protein ZUR | |
| 263 | AP022213.1 | GCA014161995_00093 | CDS | open | 88051-88965 | _na 304_aa | znuA | High-affinity zinc uptake system protein ZnuA |
| 264 | AP022213.1 | GCA014161995_00094 | CDS | open | 89124-91259 | _na 711_aa | adenosylcobalamin-dependent ribonucleoside-diphosphate reductase | |
| 265 | AP022213.1 | GCA014161995_00095 | CDS | open | 91272-91958 | _na 228_aa | Ribonucleotide reductase of class II (Coenzyme B12-dependent)%2C alpha subunit | |
| 266 | AP022213.1 | GCA014161995_00096 | CDS | open | 92454-93533 | _na 359_aa | DUF4419 domain-containing protein | |
| 267 | AP022213.1 | GCA014161995_00097 | CDS | open | 93530-94480 | _na 316_aa | homoserine kinase | |
| 268 | AP022213.1 | GCA014161995_00098 | CDS | open | 94513-94797 | _na 94_aa | DUF2782 domain-containing protein | |
| 269 | AP022213.1 | GCA014161995_00099 | CDS | open | 94875-97625 | _na 916_aa | polA | DNA polymerase I |
| 270 | AP022213.1 | GCA014161995_00101 | CDS | open | 97874-98530 | _na 218_aa | yihA | ribosome biogenesis GTP-binding protein YihA/YsxC |
| 271 | AP022213.1 | GCA014161995_00102 | CDS | open | 98708-98998 | _na 96_aa | Cytochrome c5 | |
| 272 | AP022213.1 | GCA014161995_00103 | CDS | open | 99053-99658 | _na 201_aa | C-type cytochrome | |
| 273 | AP022213.1 | GCA014161995_00104 | CDS | open | 99810-100442 | _na 210_aa | Thiol:disulfide interchange protein | |
| 274 | AP022213.1 | GCA014161995_00105 | CDS | open | 100462-101337 | _na 291_aa | Endonuclease/exonuclease/phosphatase family protein | |
| 275 | AP022213.1 | GCA014161995_00106 | CDS | open | 101334-103376 | _na 680_aa | diguanylate cyclase | |
| 276 | AP022213.1 | GCA014161995_00107 | CDS | open | 103384-104802 | _na 472_aa | Cryptochrome DASH | |
| 277 | AP022213.1 | GCA014161995_00108 | CDS | open | 104997-105617 | _na 206_aa | Outer membrane protein V | |
| 278 | AP022213.1 | GCA014161995_00109 | CDS | open | 105690-106283 | _na 197_aa | UPF0056 membrane protein | |
| 279 | AP022213.1 | GCA014161995_00110 | CDS | open | 106280-107065 | _na 261_aa | N-acetylmuramoyl-L-alanine amidase | |
| 280 | AP022213.1 | GCA014161995_00111 | CDS | open | 107075-108850 | _na 591_aa | histidine kinase | |
| 281 | AP022213.1 | GCA014161995_00112 | CDS | open | 108859-110208 | _na 449_aa | algB | sigma-54-dependent response regulator transcription factor AlgB |
| 282 | AP022213.1 | GCA014161995_00113 | CDS | open | 110494-110928 | _na 144_aa | DUF2383 domain-containing protein | |
| 283 | AP022213.1 | GCA014161995_00114 | CDS | open | 110969-111232 | _na 87_aa | hypothetical protein | |
| 284 | AP022213.1 | GCA014161995_00115 | CDS | open | 111250-111456 | _na 68_aa | hypothetical protein | |
| 285 | AP022213.1 | GCA014161995_00116 | CDS | open | 111485-111646 | _na 53_aa | UPF0391 membrane protein PCA10_00860 | |
| 286 | AP022213.1 | GCA014161995_00117 | CDS | open | 111656-112120 | _na 154_aa | Inhibitor of vertebrate lysozyme (Ivy) | |
| 287 | AP022213.1 | GCA014161995_00118 | CDS | open | 112299-112895 | _na 198_aa | wrbA | NAD(P)H:quinone oxidoreductase |
| 288 | AP022213.1 | GCA014161995_00119 | CDS | open | 113042-114268 | _na 408_aa | Nucleoside transporter/FeoB GTPase Gate domain-containing protein | |
| 289 | AP022213.1 | GCA014161995_00120 | CDS | open | 114551-115582 | _na 343_aa | DUF2914 domain-containing protein | |
| 290 | AP022213.1 | GCA014161995_00121 | CDS | open | 115661-117034 | _na 457_aa | Metalloprotease%2C insulinase family | |
| 291 | AP022213.1 | GCA014161995_00122 | CDS | open | 117104-118687 | _na 527_aa | Aerotaxis sensor receptor protein | |
| 292 | AP022213.1 | GCA014161995_00123 | CDS | open | 118684-120915 | _na 743_aa | dosC | Diguanylate cyclase DosC |
| 293 | AP022213.1 | GCA014161995_00124 | CDS | open | 121068-121382 | _na 104_aa | hypothetical protein | |
| 294 | AP022213.1 | GCA014161995_00125 | CDS | open | 121562-122473 | _na 303_aa | Na(+) dependent transporter%2CSodium Bile acid symporter family | |
| 295 | AP022213.1 | GCA014161995_00126 | CDS | open | 122461-123408 | _na 315_aa | UDP-glucose 4-epimerase | |
| 296 | AP022213.1 | GCA014161995_00127 | CDS | open | 123420-124457 | _na 345_aa | araC | Transcriptional regulator%2C AraC family |
| 297 | AP022213.1 | GCA014161995_00128 | CDS | open | 124500-126197 | _na 565_aa | phoU | PhoU domain-containing protein |
| 298 | AP022213.1 | GCA014161995_00129 | CDS | open | 126511-129759 | _na 1082_aa | recC | exodeoxyribonuclease V subunit gamma |
| 299 | AP022213.1 | GCA014161995_00130 | CDS | open | 129756-133295 | _na 1179_aa | recB | exodeoxyribonuclease V subunit beta |
| 300 | AP022213.1 | GCA014161995_00131 | CDS | open | 133292-135133 | _na 613_aa | recD | exodeoxyribonuclease V subunit alpha |
| 301 | AP022213.1 | GCA014161995_00132 | CDS | open | 135267-136607 | _na 446_aa | Transporter | |
| 302 | AP022213.1 | GCA014161995_00133 | CDS | open | 136720-138024 | _na 434_aa | phoR | phosphate regulon sensor histidine kinase PhoR |
| 303 | AP022213.1 | GCA014161995_00134 | CDS | open | 138052-138741 | _na 229_aa | phoB | phosphate regulon transcriptional regulator PhoB |
| 304 | AP022213.1 | GCA014161995_00135 | CDS | open | 138852-139742 | _na 296_aa | ubiA | 4-hydroxybenzoate octaprenyltransferase |
| 305 | AP022213.1 | GCA014161995_00136 | CDS | open | 139771-140325 | _na 184_aa | putative chorismate pyruvate-lyase | |
| 306 | AP022213.1 | GCA014161995_00137 | CDS | open | 140487-140654 | _na 55_aa | Rubredoxin | |
| 307 | AP022213.1 | GCA014161995_00138 | CDS | open | 140824-140991 | _na 55_aa | rubA2 | Rubredoxin-2 |
| 308 | AP022213.1 | GCA014161995_00139 | CDS | open | 141058-142206 | _na 382_aa | Rubredoxin-NAD(+) reductase | |
| 309 | AP022213.1 | GCA014161995_00140 | CDS | open | 142395-142667 | _na 90_aa | hupA | DNA-binding protein HU-beta |
| 310 | AP022213.1 | GCA014161995_00141 | CDS | open | 142795-143187 | _na 130_aa | Helicase | |
| 311 | AP022213.1 | GCA014161995_00142 | CDS | open | 143282-144013 | _na 243_aa | DUF2059 domain-containing protein | |
| 312 | AP022213.1 | GCA014161995_00143 | CDS | open | 144075-145475 | _na 466_aa | HDOD domain-containing protein | |
| 313 | AP022213.1 | GCA014161995_00144 | CDS | open | 145566-147641 | _na 691_aa | recG | ATP-dependent DNA helicase RecG |
| 314 | AP022213.1 | GCA014161995_00145 | CDS | open | 147638-148576 | _na 312_aa | lysR | LysR family transcriptional regulator OxyR |
| 315 | AP022213.1 | GCA014161995_00146 | CDS | open | 148664-149410 | _na 248_aa | tonB | TonB C-terminal domain-containing protein |
| 316 | AP022213.1 | GCA014161995_00147 | CDS | open | 149411-149833 | _na 140_aa | exbD | TonB system transport protein ExbD |
| 317 | AP022213.1 | GCA014161995_00148 | CDS | open | 149837-150982 | _na 381_aa | exbB | tonB-system energizer ExbB |
| 318 | AP022213.1 | GCA014161995_00149 | CDS | open | 151179-152036 | _na 285_aa | Nucleoside-diphosphate-sugar epimerase | |
| 319 | AP022213.1 | GCA014161995_00150 | CDS | open | 152038-152838 | _na 266_aa | rhaR | L-rhamnose operon transcriptional activator RhaR |
| 320 | AP022213.1 | GCA014161995_00151 | CDS | open | 152923-153543 | _na 206_aa | Threonine efflux protein | |
| 321 | AP022213.1 | GCA014161995_00152 | CDS | open | 153557-154294 | _na 245_aa | Lipoprotein | |
| 322 | AP022213.1 | GCA014161995_00153 | CDS | open | 154356-154736 | _na 126_aa | ridA | Endoribonuclease |
| 323 | AP022213.1 | GCA014161995_00154 | CDS | open | 154857-156965 | _na 702_aa | spoT | bifunctional GTP diphosphokinase/guanosine-3'%2C5'-bis pyrophosphate 3'-pyrophosphohydrolase |
| 324 | AP022213.1 | GCA014161995_00155 | CDS | open | 157027-157290 | _na 87_aa | rpoZ | DNA-directed RNA polymerase subunit omega |
| 325 | AP022213.1 | GCA014161995_00156 | CDS | open | 157423-158043 | _na 206_aa | gmk | guanylate kinase |
| 326 | AP022213.1 | GCA014161995_00157 | CDS | open | 158055-158918 | _na 287_aa | yicC | YicC family protein |
| 327 | AP022213.1 | GCA014161995_00158 | CDS | open | 158933-159769 | _na 278_aa | rph | ribonuclease PH |
| 328 | AP022213.1 | GCA014161995_00159 | CDS | open | 159799-160164 | _na 121_aa | Orotate phosphoribosyltransferase | |
| 329 | AP022213.1 | GCA014161995_00160 | CDS | open | 160219-160998 | _na 259_aa | crc | catabolite repression control protein Crc |
| 330 | AP022213.1 | GCA014161995_00161 | CDS | open | 161083-161724 | _na 213_aa | pyrE | Orotate phosphoribosyltransferase |
| 331 | AP022213.1 | GCA014161995_00162 | CDS | open | 161751-162335 | _na 194_aa | DUF4124 domain-containing protein | |
| 332 | AP022213.1 | GCA014161995_00163 | CDS | open | 162337-162783 | _na 148_aa | Thioesterase domain-containing protein | |
| 333 | AP022213.1 | GCA014161995_00164 | CDS | open | 162893-163798 | _na 301_aa | argB | Acetylglutamate kinase |
| 334 | AP022213.1 | GCA014161995_00165 | CDS | open | 163814-166438 | _na 874_aa | phosphomannomutase | |
| 335 | AP022213.1 | GCA014161995_00166 | CDS | open | 166480-166935 | _na 151_aa | dut | dUTP diphosphatase |
| 336 | AP022213.1 | GCA014161995_00167 | CDS | open | 166942-168150 | _na 402_aa | coaBC | bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC |
| 337 | AP022213.1 | GCA014161995_00168 | CDS | open | 168292-168966 | _na 224_aa | radC | DNA repair protein RadC |
| 338 | AP022213.1 | GCA014161995_00169 | CDS | open | 168963-169523 | _na 186_aa | DUF2867 domain-containing protein | |
| 339 | AP022213.1 | GCA014161995_00170 | CDS | open | 169520-171097 | _na 525_aa | Dipeptide-binding ABC transporter%2C periplasmic substrate-binding component | |
| 340 | AP022213.1 | GCA014161995_00171 | CDS | open | 171438-171674 | _na 78_aa | rpmB | 50S ribosomal protein L28 |
| 341 | AP022213.1 | GCA014161995_00172 | CDS | open | 171685-171840 | _na 51_aa | rpmG | 50S ribosomal protein L33 |
| 342 | AP022213.1 | GCA014161995_00173 | CDS | open | 171973-172335 | _na 120_aa | (S)-ureidoglycine aminohydrolase cupin domain-containing protein | |
| 343 | AP022213.1 | GCA014161995_00174 | CDS | open | 172650-174143 | _na 497_aa | Aldehyde dehydrogenase | |
| 344 | AP022213.1 | GCA014161995_00175 | CDS | open | 174322-175479 | _na 385_aa | Major facilitator family transporter | |
| 345 | AP022213.1 | GCA014161995_00176 | CDS | open | 175483-176814 | _na 443_aa | Gamma-glutamyl-putrescine oxidase | |
| 346 | AP022213.1 | GCA014161995_00177 | CDS | open | 176929-177417 | _na 162_aa | dadR | transcriptional regulator DadR |
| 347 | AP022213.1 | GCA014161995_00178 | CDS | open | 177574-178872 | _na 432_aa | dadA | D-amino acid dehydrogenase |
| 348 | AP022213.1 | GCA014161995_00179 | CDS | open | 178847-179200 | _na 117_aa | Translation initiation inhibitor | |
| 349 | AP022213.1 | GCA014161995_00180 | CDS | open | 179261-180328 | _na 355_aa | alr | alanine racemase |
| 350 | AP022213.1 | GCA014161995_00181 | CDS | open | 180513-181061 | _na 182_aa | puuR | HTH-type transcriptional regulator PuuR |
| 351 | AP022213.1 | GCA014161995_00182 | CDS | open | 181189-181611 | _na 140_aa | Cytochrome C5 | |
| 352 | AP022213.1 | GCA014161995_00183 | CDS | open | 181722-182294 | _na 190_aa | xanthine phosphoribosyltransferase | |
| 353 | AP022213.1 | GCA014161995_00184 | CDS | open | 182410-184422 | _na 670_aa | rep | DNA helicase Rep |
| 354 | AP022213.1 | GCA014161995_00185 | CDS | open | 184704-186377 | _na 557_aa | GGDEF domain/EAL domain protein | |
| 355 | AP022213.1 | GCA014161995_00186 | CDS | open | 186381-187772 | _na 463_aa | norM | NorM family multidrug efflux MATE transporter |
| 356 | AP022213.1 | GCA014161995_00187 | CDS | open | 187910-188827 | _na 305_aa | Glycine cleavage system transcriptional activator | |
| 357 | AP022213.1 | GCA014161995_00188 | CDS | open | 188989-190965 | _na 658_aa | Methyl-accepting chemotaxis protein | |
| 358 | AP022213.1 | GCA014161995_00189 | CDS | open | 191006-192982 | _na 658_aa | betT | High-affinity choline uptake protein BetT |
| 359 | AP022213.1 | GCA014161995_00190 | CDS | open | 193089-194582 | _na 497_aa | yifB | YifB family Mg chelatase-like AAA ATPase |
| 360 | AP022213.1 | GCA014161995_00191 | CDS | open | 194620-194883 | _na 87_aa | ubiK | Ubiquinone biosynthesis accessory factor UbiK |
| 361 | AP022213.1 | GCA014161995_00192 | CDS | open | 195294-195632 | _na 112_aa | glnK | P-II family nitrogen regulator |
| 362 | AP022213.1 | GCA014161995_00193 | CDS | open | 195667-196986 | _na 439_aa | Ammonium transporter | |
| 363 | AP022213.1 | GCA014161995_00194 | CDS | open | 197104-197529 | _na 141_aa | yjbQ | YjbQ family protein |
| 364 | AP022213.1 | GCA014161995_00195 | CDS | open | 197605-197925 | _na 106_aa | sutA | transcriptional regulator SutA |
| 365 | AP022213.1 | GCA014161995_00196 | CDS | open | 197983-198687 | _na 234_aa | Putative FMN hydrolase | |
| 366 | AP022213.1 | GCA014161995_00197 | CDS | open | 198684-199586 | _na 300_aa | xerC | tyrosine recombinase XerC |
| 367 | AP022213.1 | GCA014161995_00198 | CDS | open | 199609-200310 | _na 233_aa | DUF484 domain-containing protein | |
| 368 | AP022213.1 | GCA014161995_00199 | CDS | open | 200324-201154 | _na 276_aa | dapF | diaminopimelate epimerase |
| 369 | AP022213.1 | GCA014161995_00200 | CDS | open | 201159-202406 | _na 415_aa | lysA | diaminopimelate decarboxylase |
| 370 | AP022213.1 | GCA014161995_00201 | CDS | open | 202416-202541 | _na 41_aa | lptM | LPS translocon maturation chaperone LptM |
| 371 | AP022213.1 | GCA014161995_00202 | CDS | open | 202692-203729 | _na 345_aa | araC | Transcriptional regulator%2C AraC family |
| 372 | AP022213.1 | GCA014161995_00203 | CDS | open | 203769-204101 | _na 110_aa | cyaY | iron donor protein CyaY |
| 373 | AP022213.1 | GCA014161995_00204 | CDS | open | 204433-204840 | _na 135_aa | rnk | nucleoside diphosphate kinase regulator |
| 374 | AP022213.1 | GCA014161995_00205 | CDS | open | 204859-207705 | _na 948_aa | class I adenylate cyclase | |
| 375 | AP022213.1 | GCA014161995_00206 | CDS | open | 207791-208045 | _na 84_aa | DNA-binding protein inhibitor Id-2-related protein | |
| 376 | AP022213.1 | GCA014161995_00207 | CDS | open | 208113-208883 | _na 256_aa | Solute-binding protein family 3/N-terminal domain-containing protein | |
| 377 | AP022213.1 | GCA014161995_00208 | CDS | open | 208952-209227 | _na 91_aa | Phage protein | |
| 378 | AP022213.1 | GCA014161995_00209 | CDS | open | 209372-210037 | _na 221_aa | Glutathione S-transferase N-terminal domain protein | |
| 379 | AP022213.1 | GCA014161995_00210 | CDS | open | 210097-211491 | _na 464_aa | argH | argininosuccinate lyase |
| 380 | AP022213.1 | GCA014161995_00211 | CDS | open | 211717-212796 | _na 359_aa | Autolysin sensor kinase | |
| 381 | AP022213.1 | GCA014161995_00212 | CDS | open | 212793-213539 | _na 248_aa | algR | Two component response regulator AlgR |
| 382 | AP022213.1 | GCA014161995_00213 | CDS | open | 213631-214569 | _na 312_aa | hemC | hydroxymethylbilane synthase |
| 383 | AP022213.1 | GCA014161995_00214 | CDS | open | 214566-215336 | _na 256_aa | uroporphyrinogen-III synthase | |
| 384 | AP022213.1 | GCA014161995_00215 | CDS | open | 215353-216525 | _na 390_aa | Uroporphyrinogen-III synthase | |
| 385 | AP022213.1 | GCA014161995_00216 | CDS | open | 216522-217754 | _na 410_aa | HemY-like protein | |
| 386 | AP022213.1 | GCA014161995_00217 | CDS | open | 217742-218827 | _na 361_aa | Glucose/Sorbosone dehydrogenase domain-containing protein | |
| 387 | AP022213.1 | GCA014161995_00218 | CDS | open | 218932-219423 | _na 163_aa | Disulfide bond formation protein B | |
| 388 | AP022213.1 | GCA014161995_00219 | CDS | open | 219665-220129 | _na 154_aa | rsd | sigma D regulator |
| 389 | AP022213.1 | GCA014161995_00220 | CDS | open | 220130-220771 | _na 213_aa | Peptidyl-prolyl cis-trans isomerase | |
| 390 | AP022213.1 | GCA014161995_00221 | CDS | open | 220900-221820 | _na 306_aa | Transcriptional regulator | |
| 391 | AP022213.1 | GCA014161995_00222 | CDS | open | 221817-222275 | _na 152_aa | TIGR02444 family protein | |
| 392 | AP022213.1 | GCA014161995_00223 | CDS | open | 222299-224242 | _na 647_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 393 | AP022213.1 | GCA014161995_00224 | CDS | open | 224242-224781 | _na 179_aa | Small-conductance mechanosensitive channel | |
| 394 | AP022213.1 | GCA014161995_00225 | CDS | open | 224862-225494 | _na 210_aa | rhtB | homoserine/homoserine lactone efflux protein |
| 395 | AP022213.1 | GCA014161995_00226 | CDS | open | 225583-225921 | _na 112_aa | sseB | SseB protein C-terminal domain-containing protein |
| 396 | AP022213.1 | GCA014161995_00227 | CDS | open | 225966-226709 | _na 247_aa | lpoB | Penicillin-binding protein activator LpoB |
| 397 | AP022213.1 | GCA014161995_00228 | CDS | open | 226713-227306 | _na 197_aa | lpoB | penicillin-binding protein activator LpoB |
| 398 | AP022213.1 | GCA014161995_00229 | CDS | open | 227338-227694 | _na 118_aa | DUF1425 domain-containing protein | |
| 399 | AP022213.1 | GCA014161995_00230 | CDS | open | 227703-229100 | _na 465_aa | Lipoprotein | |
| 400 | AP022213.1 | GCA014161995_00231 | CDS | open | 229359-229811 | _na 150_aa | YaiI/YqxD family protein | |
| 401 | AP022213.1 | GCA014161995_00232 | CDS | open | 229812-230282 | _na 156_aa | thioesterase family protein | |
| 402 | AP022213.1 | GCA014161995_00233 | CDS | open | 230429-231088 | _na 219_aa | elbB | isoprenoid biosynthesis glyoxalase ElbB |
| 403 | AP022213.1 | GCA014161995_00234 | CDS | open | 231102-231935 | _na 277_aa | Dienelactone hydrolase domain-containing protein | |
| 404 | AP022213.1 | GCA014161995_00235 | CDS | open | 232052-233284 | _na 410_aa | Fatty acid hydroxylase domain-containing protein | |
| 405 | AP022213.1 | GCA014161995_00236 | CDS | open | 233286-233882 | _na 198_aa | VTT domain-containing protein | |
| 406 | AP022213.1 | GCA014161995_00237 | CDS | open | 234080-235132 | _na 350_aa | hemB | porphobilinogen synthase |
| 407 | AP022213.1 | GCA014161995_00238 | CDS | open | 235152-237356 | _na 734_aa | ppk1 | polyphosphate kinase 1 |
| 408 | AP022213.1 | GCA014161995_00239 | CDS | open | 237417-238922 | _na 501_aa | ppx | exopolyphosphatase |
| 409 | AP022213.1 | GCA014161995_00240 | CDS | open | 239210-239536 | _na 108_aa | trxA | thioredoxin TrxA |
| 410 | AP022213.1 | GCA014161995_00241 | CDS | open | 239777-241039 | _na 420_aa | rho | transcription termination factor Rho |
| 411 | AP022213.1 | GCA014161995_00242 | CDS | open | 241169-242635 | _na 488_aa | ubiD | 4-hydroxy-3-polyprenylbenzoate decarboxylase |
| 412 | AP022213.1 | GCA014161995_00243 | CDS | open | 242700-243653 | _na 317_aa | 2-polyprenylphenol hydroxylase and related flavodoxin oxidoreductase | |
| 413 | AP022213.1 | GCA014161995_00244 | CDS | open | 243681-244577 | _na 298_aa | Transcriptional regulator | |
| 414 | AP022213.1 | GCA014161995_00245 | CDS | open | 244789-245910 | _na 373_aa | potA | Spermidine/putrescine import ATP-binding protein PotA |
| 415 | AP022213.1 | GCA014161995_00246 | CDS | open | 245923-246831 | _na 302_aa | potB | Spermidine Putrescine ABC transporter permease component PotB |
| 416 | AP022213.1 | GCA014161995_00247 | CDS | open | 246828-247637 | _na 269_aa | potC | Spermidine/putrescine transport system permease protein PotC |
| 417 | AP022213.1 | GCA014161995_00248 | CDS | open | 247658-248692 | _na 344_aa | potD | ABC transporter%2C periplasmic spermidine putrescine-binding protein PotD |
| 418 | AP022213.1 | GCA014161995_00249 | CDS | open | 248825-250285 | _na 486_aa | Amidase | |
| 419 | AP022213.1 | GCA014161995_00250 | CDS | open | 250319-251296 | _na 325_aa | Quinone oxidoreductase | |
| 420 | AP022213.1 | GCA014161995_00251 | CDS | open | 251478-251894 | _na 138_aa | fliL | Flagellar protein FliL |
| 421 | AP022213.1 | GCA014161995_00252 | CDS | open | 251907-252356 | _na 149_aa | RNA-binding protein | |
| 422 | AP022213.1 | GCA014161995_00253 | CDS | open | 252566-252709 | _na 47_aa | hypothetical protein | |
| 423 | AP022213.1 | GCA014161995_00254 | CDS | open | 252735-253334 | _na 199_aa | 5-formyltetrahydrofolate cyclo-ligase | |
| 424 | AP022213.1 | GCA014161995_00256 | CDS | open | 253555-253869 | _na 104_aa | zapA | Cell division protein ZapA |
| 425 | AP022213.1 | GCA014161995_00257 | CDS | open | 253866-254075 | _na 69_aa | TIGR02449 family protein | |
| 426 | AP022213.1 | GCA014161995_00258 | CDS | open | 254234-254788 | _na 184_aa | UPF0149 protein SZ55_0930 | |
| 427 | AP022213.1 | GCA014161995_00259 | CDS | open | 254835-256169 | _na 444_aa | pepP | Xaa-Pro aminopeptidase |
| 428 | AP022213.1 | GCA014161995_00260 | CDS | open | 256171-257355 | _na 394_aa | ubiH | 2-octaprenyl-6-methoxyphenyl hydroxylase |
| 429 | AP022213.1 | GCA014161995_00261 | CDS | open | 257363-257845 | _na 160_aa | Tetrameric acyl-CoA thioesterase | |
| 430 | AP022213.1 | GCA014161995_00262 | CDS | open | 257855-259072 | _na 405_aa | 2-octaprenyl-3-methyl-6-methoxy-1%2C4-benzoquinol hydroxylase | |
| 431 | AP022213.1 | GCA014161995_00263 | CDS | open | 259183-260184 | _na 333_aa | Ferric iron ABC transporter%2C iron-binding protein | |
| 432 | AP022213.1 | GCA014161995_00264 | CDS | open | 260175-261854 | _na 559_aa | Ferric iron ABC transporter%2C permease protein | |
| 433 | AP022213.1 | GCA014161995_00265 | CDS | open | 262039-263121 | _na 360_aa | gcvT | glycine cleavage system aminomethyltransferase GcvT |
| 434 | AP022213.1 | GCA014161995_00266 | CDS | open | 263167-263550 | _na 127_aa | gcvH | glycine cleavage system protein GcvH |
| 435 | AP022213.1 | GCA014161995_00267 | CDS | open | 263677-263904 | _na 75_aa | DUF378 domain-containing protein | |
| 436 | AP022213.1 | GCA014161995_00268 | CDS | open | 263990-264292 | _na 100_aa | Ribonucleotide reductase%2C alpha subunit | |
| 437 | AP022213.1 | GCA014161995_00269 | CDS | open | 264384-266693 | _na 769_aa | Doubled CXXCH domain-containing protein | |
| 438 | AP022213.1 | GCA014161995_00270 | CDS | open | 266757-267692 | _na 311_aa | Glycine cleavage system transcriptional activator | |
| 439 | AP022213.1 | GCA014161995_00271 | CDS | open | 267847-269451 | _na 534_aa | 5-guanidino-2-oxopentanoate decarboxylase | |
| 440 | AP022213.1 | GCA014161995_00272 | CDS | open | 269465-271042 | _na 525_aa | Metal-dependent amidase/aminoacylase/carboxypeptidase | |
| 441 | AP022213.1 | GCA014161995_00273 | CDS | open | 271057-271848 | _na 263_aa | hisP | Histidine ABC transporter%2C ATP-binding protein HisP |
| 442 | AP022213.1 | GCA014161995_00274 | CDS | open | 271887-272651 | _na 254_aa | Lysine-arginine-ornithine-binding periplasmic protein | |
| 443 | AP022213.1 | GCA014161995_00275 | CDS | open | 272648-273361 | _na 237_aa | hisQ | Histidine ABC transporter%2C permease protein HisQ |
| 444 | AP022213.1 | GCA014161995_00276 | CDS | open | 273370-274059 | _na 229_aa | ABC transporter%2C permease protein | |
| 445 | AP022213.1 | GCA014161995_00277 | CDS | open | 274064-275272 | _na 402_aa | Aminotransferase | |
| 446 | AP022213.1 | GCA014161995_00278 | CDS | open | 275357-277114 | _na 585_aa | Amidohydrolase | |
| 447 | AP022213.1 | GCA014161995_00279 | CDS | open | 277107-278015 | _na 302_aa | Putative metal chaperone | |
| 448 | AP022213.1 | GCA014161995_00280 | CDS | open | 278021-279079 | _na 352_aa | potF | Putrescine ABC transporter putrescine-binding protein PotF |
| 449 | AP022213.1 | GCA014161995_00281 | CDS | open | 279265-280644 | _na 459_aa | Glutamine synthetase | |
| 450 | AP022213.1 | GCA014161995_00283 | CDS | open | 280921-281673 | _na 250_aa | Glutamine amidotransferase | |
| 451 | AP022213.1 | GCA014161995_00284 | CDS | open | 281716-283074 | _na 452_aa | GS catalytic domain-containing protein | |
| 452 | AP022213.1 | GCA014161995_00285 | CDS | open | 283139-284509 | _na 456_aa | spuC | Putrescine--pyruvate aminotransferase |
| 453 | AP022213.1 | GCA014161995_00286 | CDS | open | 284667-285767 | _na 366_aa | spuD | Polyamine ABC transporter substrate-binding protein SpuD |
| 454 | AP022213.1 | GCA014161995_00287 | CDS | open | 285827-286921 | _na 364_aa | spuE | Spermidine-binding periplasmic protein SpuE |
| 455 | AP022213.1 | GCA014161995_00288 | CDS | open | 286990-288081 | _na 363_aa | potF | Putrescine ABC transporter putrescine-binding protein PotF |
| 456 | AP022213.1 | GCA014161995_00289 | CDS | open | 288230-289372 | _na 380_aa | potA | Spermidine/putrescine import ATP-binding protein PotA |
| 457 | AP022213.1 | GCA014161995_00290 | CDS | open | 289369-290277 | _na 302_aa | spuG | Polyamine ABC transporter permease protein SpuG |
| 458 | AP022213.1 | GCA014161995_00291 | CDS | open | 290274-291158 | _na 294_aa | potI | Putrescine transport system permease protein PotI |
| 459 | AP022213.1 | GCA014161995_00292 | CDS | open | 291340-293724 | _na 794_aa | Penicillin acylase II | |
| 460 | AP022213.1 | GCA014161995_00293 | CDS | open | 293832-294875 | _na 347_aa | araC | Transcriptional regulator%2C AraC family |
| 461 | AP022213.1 | GCA014161995_00294 | CDS | open | 294965-295777 | _na 270_aa | Solute-binding protein family 3/N-terminal domain-containing protein | |
| 462 | AP022213.1 | GCA014161995_00295 | CDS | open | 295747-296325 | _na 192_aa | Thioredoxin domain-containing protein | |
| 463 | AP022213.1 | GCA014161995_00296 | CDS | open | 296337-297386 | _na 349_aa | Lysophospholipase | |
| 464 | AP022213.1 | GCA014161995_00297 | CDS | open | 297403-298155 | _na 250_aa | DUF2059 domain-containing protein | |
| 465 | AP022213.1 | GCA014161995_00298 | CDS | open | 298462-299085 | _na 207_aa | 2OG-Fe(II) oxygenase | |
| 466 | AP022213.1 | GCA014161995_00299 | CDS | open | 299098-299655 | _na 185_aa | DUF6160 domain-containing protein | |
| 467 | AP022213.1 | GCA014161995_00300 | CDS | open | 299837-300337 | _na 166_aa | Purine nucleoside phosphorylase | |
| 468 | AP022213.1 | GCA014161995_00301 | CDS | open | 300329-300949 | _na 206_aa | Solute-binding protein family 3/N-terminal domain-containing protein | |
| 469 | AP022213.1 | GCA014161995_00302 | CDS | open | 301079-301513 | _na 144_aa | DUF4399 domain-containing protein | |
| 470 | AP022213.1 | GCA014161995_00303 | CDS | open | 301869-303098 | _na 409_aa | serA | phosphoglycerate dehydrogenase |
| 471 | AP022213.1 | GCA014161995_00304 | CDS | open | 303278-304669 | _na 463_aa | FAD-binding oxidoreductase | |
| 472 | AP022213.1 | GCA014161995_00305 | CDS | open | 304730-305395 | _na 221_aa | fumarylacetoacetate hydrolase family protein | |
| 473 | AP022213.1 | GCA014161995_00306 | CDS | open | 305466-306380 | _na 304_aa | SdiA-regulated domain-containing protein | |
| 474 | AP022213.1 | GCA014161995_00307 | CDS | open | 306486-306833 | _na 115_aa | Bacterial OB-fold domain-containing protein | |
| 475 | AP022213.1 | GCA014161995_00308 | CDS | open | 307050-307934 | _na 294_aa | hypothetical protein | |
| 476 | AP022213.1 | GCA014161995_00309 | CDS | open | 307937-308488 | _na 183_aa | Putative ATP/GTP-binding protein | |
| 477 | AP022213.1 | GCA014161995_00310 | CDS | open | 308503-308895 | _na 130_aa | Roadblock/LAMTOR2 domain-containing protein | |
| 478 | AP022213.1 | GCA014161995_00311 | CDS | open | 308918-309277 | _na 119_aa | Roadblock/LAMTOR2 domain-containing protein | |
| 479 | AP022213.1 | GCA014161995_00312 | CDS | open | 309369-310403 | _na 344_aa | Acetylpolyamine amidohydrolase | |
| 480 | AP022213.1 | GCA014161995_00313 | CDS | open | 310422-311801 | _na 459_aa | Putrescine importer | |
| 481 | AP022213.1 | GCA014161995_00314 | CDS | open | 312066-313109 | _na 347_aa | spuE | Polyamine ABC transporter substrate-binding protein SpuE |
| 482 | AP022213.1 | GCA014161995_00315 | CDS | open | 313126-313914 | _na 262_aa | potC | Spermidine/putrescine transport system permease protein PotC |
| 483 | AP022213.1 | GCA014161995_00316 | CDS | open | 313911-314822 | _na 303_aa | ABC transporter permease | |
| 484 | AP022213.1 | GCA014161995_00317 | CDS | open | 314819-315838 | _na 339_aa | potA | Spermidine/putrescine import ATP-binding protein PotA |
| 485 | AP022213.1 | GCA014161995_00318 | CDS | open | 316116-317126 | _na 336_aa | Helix-turn-helix domain-containing protein | |
| 486 | AP022213.1 | GCA014161995_00319 | CDS | open | 317258-318181 | _na 307_aa | SdiA-regulated domain-containing protein | |
| 487 | AP022213.1 | GCA014161995_00320 | CDS | open | 318219-319460 | _na 413_aa | TPR repeat | |
| 488 | AP022213.1 | GCA014161995_00321 | CDS | open | 319608-320279 | _na 223_aa | rpiA | ribose-5-phosphate isomerase RpiA |
| 489 | AP022213.1 | GCA014161995_00322 | CDS | open | 320421-321935 | _na 504_aa | ilvA | threonine ammonia-lyase%2C biosynthetic |
| 490 | AP022213.1 | GCA014161995_00323 | CDS | open | 321986-322429 | _na 147_aa | Integral membrane protein | |
| 491 | AP022213.1 | GCA014161995_00324 | CDS | open | 322431-323714 | _na 427_aa | NAD-dependent epimerase/dehydratase domain-containing protein | |
| 492 | AP022213.1 | GCA014161995_00325 | CDS | open | 323711-324178 | _na 155_aa | Membrane protein | |
| 493 | AP022213.1 | GCA014161995_00326 | CDS | open | 324206-324859 | _na 217_aa | Phosphoserine phosphatase | |
| 494 | AP022213.1 | GCA014161995_00327 | CDS | open | 325004-325483 | _na 159_aa | rppH | RNA pyrophosphohydrolase |
| 495 | AP022213.1 | GCA014161995_00328 | CDS | open | 325506-327785 | _na 759_aa | ptsP | phosphoenolpyruvate--protein phosphotransferase |
| 496 | AP022213.1 | GCA014161995_00329 | CDS | open | 327862-328884 | _na 340_aa | diguanylate cyclase | |
| 497 | AP022213.1 | GCA014161995_00330 | CDS | open | 328881-329636 | _na 251_aa | NRDE family protein | |
| 498 | AP022213.1 | GCA014161995_00331 | CDS | open | 329799-330581 | _na 260_aa | putative membrane transporter protein | |
| 499 | AP022213.1 | GCA014161995_00332 | CDS | open | 330591-331394 | _na 267_aa | lgt | prolipoprotein diacylglyceryl transferase |
| 500 | AP022213.1 | GCA014161995_00333 | CDS | open | 331391-332185 | _na 264_aa | thyA | thymidylate synthase |

