HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Staphylococcus capitis (GCA_015645205.1)

Select a Genome:
BAKTA Annotations for GCA_015645205.1
Genome Selected: Staphylococcus capitis
ContigsBases CDSrRNA tmRNAtRNA
33 2558708 2444 10 1 63
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5110 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:9]    |    Number of Records Found: 5110 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4001 JADOYF010000006.1 GCA015645205_02003 CDS open 21229-21453 _na     74_aa UPF0033 domain-containing protein
4002 JADOYF010000006.1 GCA015645205_02004 CDS open 21631-22881 _na     416_aa Ammonium transporter
4003 JADOYF010000006.1 GCA015645205_02005 CDS open 23026-23976 _na     316_aa Sucrose operon repressor
4004 JADOYF010000006.1 GCA015645205_02006 CDS open 24211-25686 _na     491_aa Sucrose-6-phosphate hydrolase
4005 JADOYF010000006.1 GCA015645205_02007 CDS open 25693-26652 _na     319_aa Fructokinase
4006 JADOYF010000006.1 GCA015645205_02008 CDS open 26717-27433 _na     238_aa agrA quorum-sensing response regulator AgrA
4007 JADOYF010000006.1 GCA015645205_02009 CDS open 27449-28738 _na     429_aa agrC quorum-sensing sensor histidine kinase AgrC
4008 JADOYF010000006.1 GCA015645205_02010 CDS open 28762-28908 _na     48_aa Cyclic lactone autoinducer peptide
4009 JADOYF010000006.1 GCA015645205_02011 CDS open 28905-29471 _na     188_aa Accessory gene regulator protein B
4010 JADOYF010000006.1 GCA015645205_02014 CDS open 30233-31018 _na     261_aa Carbon-nitrogen family hydrolase
4011 JADOYF010000006.1 GCA015645205_02015 CDS open 31120-31746 _na     208_aa Nitroreductase family protein
4012 JADOYF010000006.1 GCA015645205_02016 CDS open 31937-33835 _na     632_aa Serine-aspartate repeat family protein
4013 JADOYF010000006.1 GCA015645205_02017 CDS open 33893-34636 _na     247_aa mroQ intramembrane glutamic endopeptidase MroQ
4014 JADOYF010000006.1 GCA015645205_02018 CDS open 34814-35098 _na     94_aa groES co-chaperone GroES
4015 JADOYF010000006.1 GCA015645205_02019 CDS open 35168-36787 _na     539_aa groL chaperonin GroEL
4016 JADOYF010000006.1 GCA015645205_02020 CDS open 37041-38360 _na     439_aa Cell wall surface anchor family protein
4017 JADOYF010000006.1 GCA015645205_02021 CDS open 38555-44458 _na     1967_aa LPXTG cell wall anchor domain-containing protein
4018 JADOYF010000006.1 GCA015645205_02022 CDS open 44506-45795 _na     429_aa Aspartate aminotransferase
4019 JADOYF010000006.1 GCA015645205_02023 CDS open 45989-46084 _na     31_aa Trp-rich small protein
4020 JADOYF010000006.1 GCA015645205_02024 CDS open 46318-46488 _na     56_aa SE1626 family protein
4021 JADOYF010000006.1 GCA015645205_02025 CDS open 46666-47043 _na     125_aa pmtR PSM export ABC transporter transcriptional regulator PmtR
4022 JADOYF010000006.1 GCA015645205_02026 CDS open 47043-47942 _na     299_aa pmtA phenol-soluble modulin export ABC transporter ATP-binding protein PmtA
4023 JADOYF010000006.1 GCA015645205_02027 CDS open 47939-48598 _na     219_aa pmtB phenol-soluble modulin export ABC transporter permease subunit PmtB
4024 JADOYF010000006.1 GCA015645205_02028 CDS open 48618-49490 _na     290_aa pmtC phenol-soluble modulin export ABC transporter ATP-binding protein PmtC
4025 JADOYF010000006.1 GCA015645205_02029 CDS open 49490-50221 _na     243_aa pmtD phenol-soluble modulin export ABC transporter permease subunit PmtD
4026 JADOYF010000006.1 GCA015645205_02030 CDS open 50254-50817 _na     187_aa Thioredoxin family protein
4027 JADOYF010000006.1 GCA015645205_02031 CDS open 50975-51469 _na     164_aa Lipoprotein
4028 JADOYF010000006.1 GCA015645205_02032 CDS open 51520-52077 _na     185_aa DUF1700 domain-containing protein
4029 JADOYF010000006.1 GCA015645205_02033 CDS open 52074-52910 _na     278_aa DUF4097 domain-containing protein
4030 JADOYF010000006.1 GCA015645205_02034 CDS open 53009-54049 _na     346_aa Acyl-CoA--6-aminopenicillanic acid acyltransferase
4031 JADOYF010000006.1 GCA015645205_02035 CDS open 54460-54630 _na     56_aa Exported protein
4032 JADOYF010000006.1 GCA015645205_02036 CDS open 54704-55102 _na     132_aa YolD-like family protein
4033 JADOYF010000006.1 GCA015645205_02037 CDS open 55220-56509 _na     429_aa arsB arsenite efflux transporter membrane subunit ArsB
4034 JADOYF010000006.1 GCA015645205_02038 CDS open 56693-57721 _na     342_aa 6-phosphogluconolactonase
4035 JADOYF010000006.1 GCA015645205_02039 CDS open 57850-59229 _na     459_aa Aldehyde dehydrogenase
4036 JADOYF010000006.1 GCA015645205_02040 CDS open 59424-60350 _na     308_aa manganese-dependent inorganic pyrophosphatase
4037 JADOYF010000006.1 GCA015645205_02041 CDS open 60405-60959 _na     184_aa Isochorismatase
4038 JADOYF010000006.1 GCA015645205_02042 CDS open 61158-62243 _na     361_aa Pectate lyase
4039 JADOYF010000006.1 GCA015645205_02043 CDS open 62352-63155 _na     267_aa prephenate dehydratase
4040 JADOYF010000006.1 GCA015645205_02044 CDS open 63173-64240 _na     355_aa Nitric oxide synthase oxygenase
4041 JADOYF010000006.1 GCA015645205_02045 CDS open 64448-65917 _na     489_aa nicotinate phosphoribosyltransferase
4042 JADOYF010000006.1 GCA015645205_02046 CDS open 65910-66731 _na     273_aa nadE ammonia-dependent NAD(+) synthetase
4043 JADOYF010000006.1 GCA015645205_02047 CDS open 66817-67443 _na     208_aa yebE UPF0316 protein SE_1595
4044 JADOYF010000006.1 GCA015645205_02048 CDS open 67427-67606 _na     59_aa NETI motif-containing protein
4045 JADOYF010000006.1 GCA015645205_02049 CDS open 67888-69183 _na     431_aa purB adenylosuccinate lyase
4046 JADOYF010000006.1 GCA015645205_02050 CDS open 69307-69609 _na     100_aa yerC His repressor
4047 JADOYF010000006.1 GCA015645205_02051 CDS open 69915-70604 _na     229_aa heptaprenylglyceryl phosphate synthase
4048 JADOYF010000006.1 GCA015645205_02052 CDS open 70604-72799 _na     731_aa pcrA DNA helicase PcrA
4049 JADOYF010000006.1 GCA015645205_02053 CDS open 72807-74810 _na     667_aa ligA NAD-dependent DNA ligase LigA
4050 JADOYF010000006.1 GCA015645205_02054 CDS open 74823-76031 _na     402_aa camS CamS family sex pheromone protein
4051 JADOYF010000006.1 GCA015645205_02055 CDS open 76105-77640 _na     511_aa putP sodium/proline symporter PutP
4052 JADOYF010000006.1 GCA015645205_02056 CDS open 78020-78322 _na     100_aa gatC Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
4053 JADOYF010000006.1 GCA015645205_02057 CDS open 78324-79781 _na     485_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
4054 JADOYF010000006.1 GCA015645205_02058 CDS open 79794-81221 _na     475_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
4055 JADOYF010000006.1 GCA015645205_02059 CDS open 81462-82412 _na     316_aa dagK diacylglycerol kinase
4056 JADOYF010000006.1 GCA015645205_02060 CDS open 82500-83867 _na     455_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
4057 JADOYF010000006.1 GCA015645205_02061 CDS open 84019-84561 _na     180_aa DUF3267 domain-containing protein
4058 JADOYF010000006.1 GCA015645205_02062 CDS open 84720-85790 _na     356_aa dinB DNA polymerase IV
4059 JADOYF010000006.1 GCA015645205_02063 CDS open 85826-86380 _na     184_aa dnaQ DNA polymerase III subunit alpha PolC-type
4060 JADOYF010000006.1 GCA015645205_02064 CDS open 86690-87190 _na     166_aa ftnA H-type ferritin FtnA
4061 JADOYF010000006.1 GCA015645205_02065 CDS open 87418-88731 _na     437_aa murT Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT
4062 JADOYF010000006.1 GCA015645205_02066 CDS open 88732-89457 _na     241_aa gatD Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD
4063 JADOYF010000006.1 GCA015645205_02067 CDS open 89686-90228 _na     180_aa isaB immunodominant staphylococcal antigen IsaB family protein
4064 JADOYF010000006.1 GCA015645205_02068 CDS open 90306-91295 _na     329_aa Aromatic acid exporter family protein
4065 JADOYF010000006.1 GCA015645205_02069 CDS open 91469-92224 _na     251_aa map type I methionyl aminopeptidase
4066 JADOYF010000006.1 GCA015645205_02070 CDS open 92369-92755 _na     128_aa Staphylococcal protein
4067 JADOYF010000006.1 GCA015645205_02071 CDS open 92770-93471 _na     233_aa liaF Cell wall-active antibiotics response LiaF-like C-terminal domain-containing protein
4068 JADOYF010000006.1 GCA015645205_02072 CDS open 93468-94514 _na     348_aa vraS Sensor protein VraS
4069 JADOYF010000006.1 GCA015645205_02073 CDS open 94504-95133 _na     209_aa vraR two-component system response regulator VraR
4070 JADOYF010000006.1 GCA015645205_02074 CDS open 95198-96451 _na     417_aa Transporter
4071 JADOYF010000006.1 GCA015645205_02075 CDS open 96788-97072 _na     94_aa ytxH YtxH domain-containing protein
4072 JADOYF010000006.1 GCA015645205_02076 CDS open 97079-97543 _na     154_aa ptpA Low molecular weight protein-tyrosine-phosphatase PtpA
4073 JADOYF010000006.1 GCA015645205_02077 CDS open 97684-97890 _na     68_aa UPF0435 protein HHM13_02320
4074 JADOYF010000006.1 GCA015645205_02078 CDS open 97904-99145 _na     413_aa Aminopeptidase
4075 JADOYF010000006.1 GCA015645205_02079 CDS open 99247-99777 _na     176_aa Acyl-CoA thioesterase
4076 JADOYF010000006.1 GCA015645205_02080 CDS open 99845-100987 _na     380_aa yfkAB radical SAM/CxCxxxxC motif protein YfkAB
4077 JADOYF010000006.1 GCA015645205_02081 CDS open 101140-101301 _na     53_aa Cytosolic protein
4078 JADOYF010000006.1 GCA015645205_02082 CDS open 101495-102013 _na     172_aa yajL putative protein SERP1413
4079 JADOYF010000006.1 GCA015645205_02083 CDS open 102237-103046 _na     269_aa sgtB monofunctional peptidoglycan glycosyltransferase SgtB
4080 JADOYF010000006.1 GCA015645205_02084 CDS open 103217-104035 _na     272_aa recX recombination regulator RecX
4081 JADOYF010000006.1 GCA015645205_02085 CDS open 104013-104327 _na     104_aa DUF1811 domain-containing protein
4082 JADOYF010000006.1 GCA015645205_02086 CDS open 104343-105860 _na     505_aa tagH Teichoic acid translocation ATP-binding protein tagH
4083 JADOYF010000006.1 GCA015645205_02087 CDS open 105869-106762 _na     297_aa tagG Teichoic acid transport protein tagG
4084 JADOYF010000006.1 GCA015645205_02088 CDS open 106855-107832 _na     325_aa Metal-dependent hydrolase
4085 JADOYF010000006.1 GCA015645205_02089 CDS open 107982-109025 _na     347_aa mutY A/G-specific adenine glycosylase
4086 JADOYF010000006.1 GCA015645205_02090 CDS open 109128-109670 _na     180_aa ygaC Nucleoside triphosphate/diphosphate phosphatase
4087 JADOYF010000006.1 GCA015645205_02091 CDS open 109951-111687 _na     578_aa mdlB ABC transporter ATP-binding protein
4088 JADOYF010000006.1 GCA015645205_02092 CDS open 111779-112873 _na     364_aa ygaE Aromatic acid exporter family protein
4089 JADOYF010000006.1 GCA015645205_02093 CDS open 113048-114343 _na     431_aa hemL2 glutamate-1-semialdehyde 2%2C1-aminomutase
4090 JADOYF010000006.1 GCA015645205_02094 CDS open 114412-114879 _na     155_aa bcp thioredoxin-dependent thiol peroxidase
4091 JADOYF010000006.1 GCA015645205_02095 CDS open 114885-115835 _na     316_aa D-3-phosphoglycerate dehydrogenase
4092 JADOYF010000006.1 GCA015645205_02096 CDS open 115931-116386 _na     151_aa perR peroxide-responsive transcriptional repressor PerR
4093 JADOYF010000006.1 GCA015645205_01984 gene open 949-2217 ilvA
4094 JADOYF010000006.1 GCA015645205_01985 gene open 2232-2801
4095 JADOYF010000006.1 GCA015645205_01986 gene open 2802-4172 leuC
4096 JADOYF010000006.1 GCA015645205_01987 gene open 4190-5233 leuB
4097 JADOYF010000006.1 GCA015645205_01988 gene open 5230-6765
4098 JADOYF010000006.1 GCA015645205_01989 gene open 6782-7786 ilvC
4099 JADOYF010000006.1 GCA015645205_01990 gene open 7915-8148
4100 JADOYF010000006.1 GCA015645205_01991 gene open 8148-9947 ilvB
4101 JADOYF010000006.1 GCA015645205_01992 gene open 9964-11652 ilvD
4102 JADOYF010000006.1 GCA015645205_01994 gene open 12093-12557 tsaE
4103 JADOYF010000006.1 GCA015645205_01995 gene open 12538-13200 tsaB
4104 JADOYF010000006.1 GCA015645205_01996 gene open 13173-13634 rimI
4105 JADOYF010000006.1 GCA015645205_01997 gene open 13616-14659 tsaD
4106 JADOYF010000006.1 GCA015645205_01998 gene open 14765-16381 mutS
4107 JADOYF010000006.1 GCA015645205_01999 gene open 16723-18660 abc-f
4108 JADOYF010000006.1 GCA015645205_02000 gene open 19017-19658
4109 JADOYF010000006.1 GCA015645205_02001 gene open 19747-20034
4110 JADOYF010000006.1 GCA015645205_02002 gene open 20116-21210
4111 JADOYF010000006.1 GCA015645205_02003 gene open 21229-21453
4112 JADOYF010000006.1 GCA015645205_02004 gene open 21631-22881
4113 JADOYF010000006.1 GCA015645205_02005 gene open 23026-23976
4114 JADOYF010000006.1 GCA015645205_02006 gene open 24211-25686
4115 JADOYF010000006.1 GCA015645205_02007 gene open 25693-26652
4116 JADOYF010000006.1 GCA015645205_02008 gene open 26717-27433 agrA
4117 JADOYF010000006.1 GCA015645205_02009 gene open 27449-28738 agrC
4118 JADOYF010000006.1 GCA015645205_02010 gene open 28762-28908
4119 JADOYF010000006.1 GCA015645205_02011 gene open 28905-29471
4120 JADOYF010000006.1 GCA015645205_02014 gene open 30233-31018
4121 JADOYF010000006.1 GCA015645205_02015 gene open 31120-31746
4122 JADOYF010000006.1 GCA015645205_02016 gene open 31937-33835
4123 JADOYF010000006.1 GCA015645205_02017 gene open 33893-34636 mroQ
4124 JADOYF010000006.1 GCA015645205_02018 gene open 34814-35098 groES
4125 JADOYF010000006.1 GCA015645205_02019 gene open 35168-36787 groL
4126 JADOYF010000006.1 GCA015645205_02020 gene open 37041-38360
4127 JADOYF010000006.1 GCA015645205_02021 gene open 38555-44458
4128 JADOYF010000006.1 GCA015645205_02022 gene open 44506-45795
4129 JADOYF010000006.1 GCA015645205_02023 gene open 45989-46084
4130 JADOYF010000006.1 GCA015645205_02024 gene open 46318-46488
4131 JADOYF010000006.1 GCA015645205_02025 gene open 46666-47043 pmtR
4132 JADOYF010000006.1 GCA015645205_02026 gene open 47043-47942 pmtA
4133 JADOYF010000006.1 GCA015645205_02027 gene open 47939-48598 pmtB
4134 JADOYF010000006.1 GCA015645205_02028 gene open 48618-49490 pmtC
4135 JADOYF010000006.1 GCA015645205_02029 gene open 49490-50221 pmtD
4136 JADOYF010000006.1 GCA015645205_02030 gene open 50254-50817
4137 JADOYF010000006.1 GCA015645205_02031 gene open 50975-51469
4138 JADOYF010000006.1 GCA015645205_02032 gene open 51520-52077
4139 JADOYF010000006.1 GCA015645205_02033 gene open 52074-52910
4140 JADOYF010000006.1 GCA015645205_02034 gene open 53009-54049
4141 JADOYF010000006.1 GCA015645205_02035 gene open 54460-54630
4142 JADOYF010000006.1 GCA015645205_02036 gene open 54704-55102
4143 JADOYF010000006.1 GCA015645205_02037 gene open 55220-56509 arsB
4144 JADOYF010000006.1 GCA015645205_02038 gene open 56693-57721
4145 JADOYF010000006.1 GCA015645205_02039 gene open 57850-59229
4146 JADOYF010000006.1 GCA015645205_02040 gene open 59424-60350
4147 JADOYF010000006.1 GCA015645205_02041 gene open 60405-60959
4148 JADOYF010000006.1 GCA015645205_02042 gene open 61158-62243
4149 JADOYF010000006.1 GCA015645205_02043 gene open 62352-63155
4150 JADOYF010000006.1 GCA015645205_02044 gene open 63173-64240
4151 JADOYF010000006.1 GCA015645205_02045 gene open 64448-65917
4152 JADOYF010000006.1 GCA015645205_02046 gene open 65910-66731 nadE
4153 JADOYF010000006.1 GCA015645205_02047 gene open 66817-67443 yebE
4154 JADOYF010000006.1 GCA015645205_02048 gene open 67427-67606
4155 JADOYF010000006.1 GCA015645205_02049 gene open 67888-69183 purB
4156 JADOYF010000006.1 GCA015645205_02050 gene open 69307-69609 yerC
4157 JADOYF010000006.1 GCA015645205_02051 gene open 69915-70604
4158 JADOYF010000006.1 GCA015645205_02052 gene open 70604-72799 pcrA
4159 JADOYF010000006.1 GCA015645205_02053 gene open 72807-74810 ligA
4160 JADOYF010000006.1 GCA015645205_02054 gene open 74823-76031 camS
4161 JADOYF010000006.1 GCA015645205_02055 gene open 76105-77640 putP
4162 JADOYF010000006.1 GCA015645205_02056 gene open 78020-78322 gatC
4163 JADOYF010000006.1 GCA015645205_02057 gene open 78324-79781 gatA
4164 JADOYF010000006.1 GCA015645205_02058 gene open 79794-81221 gatB
4165 JADOYF010000006.1 GCA015645205_02059 gene open 81462-82412 dagK
4166 JADOYF010000006.1 GCA015645205_02060 gene open 82500-83867 rlmD
4167 JADOYF010000006.1 GCA015645205_02061 gene open 84019-84561
4168 JADOYF010000006.1 GCA015645205_02062 gene open 84720-85790 dinB
4169 JADOYF010000006.1 GCA015645205_02063 gene open 85826-86380 dnaQ
4170 JADOYF010000006.1 GCA015645205_02064 gene open 86690-87190 ftnA
4171 JADOYF010000006.1 GCA015645205_02065 gene open 87418-88731 murT
4172 JADOYF010000006.1 GCA015645205_02066 gene open 88732-89457 gatD
4173 JADOYF010000006.1 GCA015645205_02067 gene open 89686-90228 isaB
4174 JADOYF010000006.1 GCA015645205_02068 gene open 90306-91295
4175 JADOYF010000006.1 GCA015645205_02069 gene open 91469-92224 map
4176 JADOYF010000006.1 GCA015645205_02070 gene open 92369-92755
4177 JADOYF010000006.1 GCA015645205_02071 gene open 92770-93471 liaF
4178 JADOYF010000006.1 GCA015645205_02072 gene open 93468-94514 vraS
4179 JADOYF010000006.1 GCA015645205_02073 gene open 94504-95133 vraR
4180 JADOYF010000006.1 GCA015645205_02074 gene open 95198-96451
4181 JADOYF010000006.1 GCA015645205_02075 gene open 96788-97072 ytxH
4182 JADOYF010000006.1 GCA015645205_02076 gene open 97079-97543 ptpA
4183 JADOYF010000006.1 GCA015645205_02077 gene open 97684-97890
4184 JADOYF010000006.1 GCA015645205_02078 gene open 97904-99145
4185 JADOYF010000006.1 GCA015645205_02079 gene open 99247-99777
4186 JADOYF010000006.1 GCA015645205_02080 gene open 99845-100987 yfkAB
4187 JADOYF010000006.1 GCA015645205_02081 gene open 101140-101301
4188 JADOYF010000006.1 GCA015645205_02082 gene open 101495-102013 yajL
4189 JADOYF010000006.1 GCA015645205_02083 gene open 102237-103046 sgtB
4190 JADOYF010000006.1 GCA015645205_02084 gene open 103217-104035 recX
4191 JADOYF010000006.1 GCA015645205_02085 gene open 104013-104327
4192 JADOYF010000006.1 GCA015645205_02086 gene open 104343-105860 tagH
4193 JADOYF010000006.1 GCA015645205_02087 gene open 105869-106762 tagG
4194 JADOYF010000006.1 GCA015645205_02088 gene open 106855-107832
4195 JADOYF010000006.1 GCA015645205_02089 gene open 107982-109025 mutY
4196 JADOYF010000006.1 GCA015645205_02090 gene open 109128-109670 ygaC
4197 JADOYF010000006.1 GCA015645205_02091 gene open 109951-111687 mdlB
4198 JADOYF010000006.1 GCA015645205_02092 gene open 111779-112873 ygaE
4199 JADOYF010000006.1 GCA015645205_02093 gene open 113048-114343 hemL2
4200 JADOYF010000006.1 GCA015645205_02094 gene open 114412-114879 bcp
4201 JADOYF010000006.1 GCA015645205_02095 gene open 114885-115835
4202 JADOYF010000006.1 GCA015645205_02096 gene open 115931-116386 perR
4203 JADOYF010000007.1 rep_origin open 40822-41556
4204 JADOYF010000007.1 regulatory_region open 25488-25588 SAM riboswitch aptamer (S box leader)
4205 JADOYF010000007.1 regulatory_region open 28439-28652 T-box leader
4206 JADOYF010000007.1 regulatory_region open 84965-85377 T-box leader
4207 JADOYF010000007.1 GCA015645205_02097 CDS open 197-703 _na     168_aa DUF1643 domain-containing protein
4208 JADOYF010000007.1 GCA015645205_02098 CDS open 719-1030 _na     103_aa Pyridoxal phosphate-dependent enzyme
4209 JADOYF010000007.1 GCA015645205_02099 CDS open 1126-1464 _na     112_aa Phage protein
4210 JADOYF010000007.1 GCA015645205_02100 CDS open 1570-3246 _na     558_aa ccrC cassette chromosome recombinase CcrC
4211 JADOYF010000007.1 GCA015645205_02101 CDS open 3402-3518 _na     38_aa hypothetical protein
4212 JADOYF010000007.1 GCA015645205_02102 CDS open 3472-5115 _na     547_aa SF3 helicase domain-containing protein
4213 JADOYF010000007.1 GCA015645205_02103 CDS open 5112-5483 _na     123_aa Intein C-terminal splicing domain-containing protein
4214 JADOYF010000007.1 GCA015645205_02104 CDS open 5476-6576 _na     366_aa DNA-directed DNA polymerase family A palm domain-containing protein
4215 JADOYF010000007.1 GCA015645205_02105 CDS open 6802-8277 _na     491_aa DUF6038 domain-containing protein
4216 JADOYF010000007.1 GCA015645205_02106 CDS open 8385-9248 _na     287_aa GIY-YIG domain-containing protein
4217 JADOYF010000007.1 GCA015645205_02107 CDS open 9447-9752 _na     101_aa hypothetical protein
4218 JADOYF010000007.1 GCA015645205_02108 CDS open 9998-10477 _na     159_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
4219 JADOYF010000007.1 GCA015645205_02109 CDS open 10887-11678 _na     263_aa MBL fold metallo-hydrolase
4220 JADOYF010000007.1 GCA015645205_02110 CDS open 12190-12978 _na     262_aa Regulatory protein YycH-like domain-containing protein
4221 JADOYF010000007.1 GCA015645205_02111 CDS open 12979-14316 _na     445_aa yycH Regulatory protein YycH domain-containing protein
4222 JADOYF010000007.1 GCA015645205_02112 CDS open 14309-16141 _na     610_aa walK cell wall metabolism sensor histidine kinase WalK
4223 JADOYF010000007.1 GCA015645205_02113 CDS open 16154-16855 _na     233_aa yycF response regulator YycF
4224 JADOYF010000007.1 GCA015645205_02116 CDS open 17793-19076 _na     427_aa purA adenylosuccinate synthase
4225 JADOYF010000007.1 GCA015645205_02117 CDS open 19355-20755 _na     466_aa dnaB replicative DNA helicase
4226 JADOYF010000007.1 GCA015645205_02118 CDS open 20804-21250 _na     148_aa rplI 50S ribosomal protein L9
4227 JADOYF010000007.1 GCA015645205_02119 CDS open 21247-23214 _na     655_aa gdpP Cyclic-di-AMP phosphodiesterase
4228 JADOYF010000007.1 GCA015645205_02120 CDS open 23244-24155 _na     303_aa DUF2232 domain-containing protein
4229 JADOYF010000007.1 GCA015645205_02121 CDS open 24454-25422 _na     322_aa Homoserine-o-acetyltransferase
4230 JADOYF010000007.1 GCA015645205_02122 CDS open 25714-26043 _na     109_aa Branched-chain amino acid transport family protein
4231 JADOYF010000007.1 GCA015645205_02123 CDS open 26040-26732 _na     230_aa azlC AzlC family ABC transporter permease
4232 JADOYF010000007.1 GCA015645205_02124 CDS open 27069-28355 _na     428_aa serS serine--tRNA ligase
4233 JADOYF010000007.1 GCA015645205_02125 CDS open 28729-30234 _na     501_aa hutH histidine ammonia-lyase
4234 JADOYF010000007.1 GCA015645205_02126 CDS open 30650-31462 _na     270_aa nnr2 ADP-dependent (S)-NAD(P)H-hydrate dehydratase
4235 JADOYF010000007.1 GCA015645205_02127 CDS open 31640-34312 _na     890_aa gyrA DNA gyrase subunit A
4236 JADOYF010000007.1 GCA015645205_02128 CDS open 34349-36280 _na     643_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
4237 JADOYF010000007.1 GCA015645205_02129 CDS open 36291-37406 _na     371_aa recF DNA replication/repair protein RecF
4238 JADOYF010000007.1 GCA015645205_02130 CDS open 37403-37639 _na     78_aa yaaA S4 domain-containing protein YaaA
4239 JADOYF010000007.1 GCA015645205_02131 CDS open 38023-39156 _na     377_aa dnaN DNA polymerase III subunit beta
4240 JADOYF010000007.1 GCA015645205_02132 CDS open 39466-40821 _na     451_aa dnaA chromosomal replication initiator protein DnaA
4241 JADOYF010000007.1 GCA015645205_02133 CDS open 41557-41694 _na     45_aa rpmH 50S ribosomal protein L34
4242 JADOYF010000007.1 GCA015645205_02134 CDS open 41803-42150 _na     115_aa rnpA ribonuclease P protein component
4243 JADOYF010000007.1 GCA015645205_02135 CDS open 42308-43687 _na     459_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
4244 JADOYF010000007.1 GCA015645205_02136 CDS open 43770-45647 _na     625_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
4245 JADOYF010000007.1 GCA015645205_02137 CDS open 45647-46366 _na     239_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
4246 JADOYF010000007.1 GCA015645205_02138 CDS open 46414-47253 _na     279_aa noc nucleoid occlusion protein
4247 JADOYF010000007.1 GCA015645205_02139 CDS open 47316-48026 _na     236_aa Carbonyl reductase
4248 JADOYF010000007.1 GCA015645205_02140 CDS open 48093-48728 _na     211_aa HAD family hydrolase
4249 JADOYF010000007.1 GCA015645205_02141 CDS open 48989-49348 _na     119_aa Permease
4250 JADOYF010000007.1 GCA015645205_02142 CDS open 49368-49763 _na     131_aa Permease
4251 JADOYF010000007.1 GCA015645205_02143 CDS open 49729-50283 _na     184_aa acrR AcrR family transcriptional regulator
4252 JADOYF010000007.1 GCA015645205_02144 CDS open 50389-50586 _na     65_aa hypothetical protein
4253 JADOYF010000007.1 GCA015645205_02145 CDS open 50881-51531 _na     216_aa YIP1 family protein
4254 JADOYF010000007.1 GCA015645205_02146 CDS open 51775-52890 _na     371_aa RND transporter
4255 JADOYF010000007.1 GCA015645205_02147 CDS open 52887-53573 _na     228_aa lolD ABC transporter ATP-binding protein
4256 JADOYF010000007.1 GCA015645205_02148 CDS open 53566-54768 _na     400_aa ABC transporter permease
4257 JADOYF010000007.1 GCA015645205_02149 CDS open 55500-55859 _na     119_aa Lipoprotein
4258 JADOYF010000007.1 GCA015645205_02150 CDS open 55980-56438 _na     152_aa hypothetical protein
4259 JADOYF010000007.1 GCA015645205_02151 CDS open 56769-56984 _na     71_aa hypothetical protein
4260 JADOYF010000007.1 GCA015645205_02152 CDS open 57223-59541 _na     772_aa lip YSIRK-targeted triacylglycerol lipase
4261 JADOYF010000007.1 GCA015645205_02153 CDS open 59629-59823 _na     64_aa vraH Peptide resistance ABC transporter activity modulator VraH
4262 JADOYF010000007.1 GCA015645205_02154 CDS open 59868-61748 _na     626_aa ABC transporter permease
4263 JADOYF010000007.1 GCA015645205_02155 CDS open 61738-62496 _na     252_aa vraD VraD protein
4264 JADOYF010000007.1 GCA015645205_02156 CDS open 62659-63057 _na     132_aa yxeA YxeA family protein
4265 JADOYF010000007.1 GCA015645205_02157 CDS open 63071-63472 _na     133_aa putative protein conserved in bacteria
4266 JADOYF010000007.1 GCA015645205_02158 CDS open 64157-64537 _na     126_aa Lipoprotein
4267 JADOYF010000007.1 GCA015645205_02159 CDS open 64552-65208 _na     218_aa Proteophosphoglycan 5
4268 JADOYF010000007.1 GCA015645205_02160 CDS open 65234-65395 _na     53_aa vraH VraH family protein
4269 JADOYF010000007.1 GCA015645205_02161 CDS open 65421-65996 _na     191_aa lepB signal peptidase I
4270 JADOYF010000007.1 GCA015645205_02162 CDS open 66074-67432 _na     452_aa Transporter
4271 JADOYF010000007.1 GCA015645205_02163 CDS open 67816-68976 _na     386_aa Esterase
4272 JADOYF010000007.1 GCA015645205_02164 CDS open 69059-70408 _na     449_aa Citrate/malate-proton symporter
4273 JADOYF010000007.1 GCA015645205_02165 CDS open 70442-72079 _na     545_aa malolactic enzyme
4274 JADOYF010000007.1 GCA015645205_02166 CDS open 72185-73072 _na     295_aa lysR LysR family transcriptional regulator
4275 JADOYF010000007.1 GCA015645205_02167 CDS open 73354-73557 _na     67_aa yozE YozE SAM-like domain-containing protein
4276 JADOYF010000007.1 GCA015645205_02168 CDS open 73670-73921 _na     83_aa HTH cro/C1-type domain-containing protein
4277 JADOYF010000007.1 GCA015645205_02169 CDS open 74103-74489 _na     128_aa Putative lyase
4278 JADOYF010000007.1 GCA015645205_02170 CDS open 74893-76080 _na     395_aa putative acetyl-CoA acyltransferase
4279 JADOYF010000007.1 GCA015645205_02171 CDS open 76084-76779 _na     231_aa Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A
4280 JADOYF010000007.1 GCA015645205_02172 CDS open 76784-77431 _na     215_aa Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B
4281 JADOYF010000007.1 GCA015645205_02173 CDS open 77823-78566 _na     247_aa Cyclase family protein
4282 JADOYF010000007.1 GCA015645205_02174 CDS open 78588-80834 _na     748_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
4283 JADOYF010000007.1 GCA015645205_02175 CDS open 80831-82669 _na     612_aa metF bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase
4284 JADOYF010000007.1 GCA015645205_02176 CDS open 82623-83798 _na     391_aa metC cystathionine beta-lyase MetC
4285 JADOYF010000007.1 GCA015645205_02177 CDS open 83795-84898 _na     367_aa Cystathionine gamma-synthase and O-acetylhomoserine thiolyase
4286 JADOYF010000007.1 GCA015645205_02178 CDS open 85648-86478 _na     276_aa Transcription terminator
4287 JADOYF010000007.1 GCA015645205_02179 CDS open 86583-87464 _na     293_aa mscS Mechanosensitive ion channel family protein
4288 JADOYF010000007.1 GCA015645205_02180 CDS open 87485-87688 _na     67_aa Cytosolic protein
4289 JADOYF010000007.1 GCA015645205_02181 CDS open 87700-88797 _na     365_aa ychF redox-regulated ATPase YchF
4290 JADOYF010000007.1 GCA015645205_02182 CDS open 88930-89121 _na     63_aa hypothetical protein
4291 JADOYF010000007.1 GCA015645205_02183 CDS open 89202-90017 _na     271_aa Lysozyme
4292 JADOYF010000007.1 GCA015645205_02184 CDS open 90151-90549 _na     132_aa Helix-turn-helix domain-containing protein
4293 JADOYF010000007.1 GCA015645205_02185 CDS open 90640-91800 _na     386_aa Selenocysteine lyase
4294 JADOYF010000007.1 GCA015645205_02186 CDS open 91804-92481 _na     225_aa DUF7411 domain-containing protein
4295 JADOYF010000007.1 GCA015645205_02097 gene open 197-703
4296 JADOYF010000007.1 GCA015645205_02098 gene open 719-1030
4297 JADOYF010000007.1 GCA015645205_02099 gene open 1126-1464
4298 JADOYF010000007.1 GCA015645205_02100 gene open 1570-3246 ccrC
4299 JADOYF010000007.1 GCA015645205_02101 gene open 3402-3518
4300 JADOYF010000007.1 GCA015645205_02102 gene open 3472-5115
4301 JADOYF010000007.1 GCA015645205_02103 gene open 5112-5483
4302 JADOYF010000007.1 GCA015645205_02104 gene open 5476-6576
4303 JADOYF010000007.1 GCA015645205_02105 gene open 6802-8277
4304 JADOYF010000007.1 GCA015645205_02106 gene open 8385-9248
4305 JADOYF010000007.1 GCA015645205_02107 gene open 9447-9752
4306 JADOYF010000007.1 GCA015645205_02108 gene open 9998-10477 rlmH
4307 JADOYF010000007.1 GCA015645205_02109 gene open 10887-11678
4308 JADOYF010000007.1 GCA015645205_02110 gene open 12190-12978
4309 JADOYF010000007.1 GCA015645205_02111 gene open 12979-14316 yycH
4310 JADOYF010000007.1 GCA015645205_02112 gene open 14309-16141 walK
4311 JADOYF010000007.1 GCA015645205_02113 gene open 16154-16855 yycF
4312 JADOYF010000007.1 GCA015645205_02116 gene open 17793-19076 purA
4313 JADOYF010000007.1 GCA015645205_02117 gene open 19355-20755 dnaB
4314 JADOYF010000007.1 GCA015645205_02118 gene open 20804-21250 rplI
4315 JADOYF010000007.1 GCA015645205_02119 gene open 21247-23214 gdpP
4316 JADOYF010000007.1 GCA015645205_02120 gene open 23244-24155
4317 JADOYF010000007.1 GCA015645205_02121 gene open 24454-25422
4318 JADOYF010000007.1 GCA015645205_02122 gene open 25714-26043
4319 JADOYF010000007.1 GCA015645205_02123 gene open 26040-26732 azlC
4320 JADOYF010000007.1 GCA015645205_02124 gene open 27069-28355 serS
4321 JADOYF010000007.1 GCA015645205_02125 gene open 28729-30234 hutH
4322 JADOYF010000007.1 GCA015645205_02126 gene open 30650-31462 nnr2
4323 JADOYF010000007.1 GCA015645205_02127 gene open 31640-34312 gyrA
4324 JADOYF010000007.1 GCA015645205_02128 gene open 34349-36280 gyrB
4325 JADOYF010000007.1 GCA015645205_02129 gene open 36291-37406 recF
4326 JADOYF010000007.1 GCA015645205_02130 gene open 37403-37639 yaaA
4327 JADOYF010000007.1 GCA015645205_02131 gene open 38023-39156 dnaN
4328 JADOYF010000007.1 GCA015645205_02132 gene open 39466-40821 dnaA
4329 JADOYF010000007.1 GCA015645205_02133 gene open 41557-41694 rpmH
4330 JADOYF010000007.1 GCA015645205_02134 gene open 41803-42150 rnpA
4331 JADOYF010000007.1 GCA015645205_02135 gene open 42308-43687 mnmE
4332 JADOYF010000007.1 GCA015645205_02136 gene open 43770-45647 mnmG
4333 JADOYF010000007.1 GCA015645205_02137 gene open 45647-46366 rsmG
4334 JADOYF010000007.1 GCA015645205_02138 gene open 46414-47253 noc
4335 JADOYF010000007.1 GCA015645205_02139 gene open 47316-48026
4336 JADOYF010000007.1 GCA015645205_02140 gene open 48093-48728
4337 JADOYF010000007.1 GCA015645205_02141 gene open 48989-49348
4338 JADOYF010000007.1 GCA015645205_02142 gene open 49368-49763
4339 JADOYF010000007.1 GCA015645205_02143 gene open 49729-50283 acrR
4340 JADOYF010000007.1 GCA015645205_02144 gene open 50389-50586
4341 JADOYF010000007.1 GCA015645205_02145 gene open 50881-51531
4342 JADOYF010000007.1 GCA015645205_02146 gene open 51775-52890
4343 JADOYF010000007.1 GCA015645205_02147 gene open 52887-53573 lolD
4344 JADOYF010000007.1 GCA015645205_02148 gene open 53566-54768
4345 JADOYF010000007.1 GCA015645205_02149 gene open 55500-55859
4346 JADOYF010000007.1 GCA015645205_02150 gene open 55980-56438
4347 JADOYF010000007.1 GCA015645205_02151 gene open 56769-56984
4348 JADOYF010000007.1 GCA015645205_02152 gene open 57223-59541 lip
4349 JADOYF010000007.1 GCA015645205_02153 gene open 59629-59823 vraH
4350 JADOYF010000007.1 GCA015645205_02154 gene open 59868-61748
4351 JADOYF010000007.1 GCA015645205_02155 gene open 61738-62496 vraD
4352 JADOYF010000007.1 GCA015645205_02156 gene open 62659-63057 yxeA
4353 JADOYF010000007.1 GCA015645205_02157 gene open 63071-63472
4354 JADOYF010000007.1 GCA015645205_02158 gene open 64157-64537
4355 JADOYF010000007.1 GCA015645205_02159 gene open 64552-65208
4356 JADOYF010000007.1 GCA015645205_02160 gene open 65234-65395 vraH
4357 JADOYF010000007.1 GCA015645205_02161 gene open 65421-65996 lepB
4358 JADOYF010000007.1 GCA015645205_02162 gene open 66074-67432
4359 JADOYF010000007.1 GCA015645205_02163 gene open 67816-68976
4360 JADOYF010000007.1 GCA015645205_02164 gene open 69059-70408
4361 JADOYF010000007.1 GCA015645205_02165 gene open 70442-72079
4362 JADOYF010000007.1 GCA015645205_02166 gene open 72185-73072 lysR
4363 JADOYF010000007.1 GCA015645205_02167 gene open 73354-73557 yozE
4364 JADOYF010000007.1 GCA015645205_02168 gene open 73670-73921
4365 JADOYF010000007.1 GCA015645205_02169 gene open 74103-74489
4366 JADOYF010000007.1 GCA015645205_02170 gene open 74893-76080
4367 JADOYF010000007.1 GCA015645205_02171 gene open 76084-76779
4368 JADOYF010000007.1 GCA015645205_02172 gene open 76784-77431
4369 JADOYF010000007.1 GCA015645205_02173 gene open 77823-78566
4370 JADOYF010000007.1 GCA015645205_02174 gene open 78588-80834 metE
4371 JADOYF010000007.1 GCA015645205_02175 gene open 80831-82669 metF
4372 JADOYF010000007.1 GCA015645205_02176 gene open 82623-83798 metC
4373 JADOYF010000007.1 GCA015645205_02177 gene open 83795-84898
4374 JADOYF010000007.1 GCA015645205_02178 gene open 85648-86478
4375 JADOYF010000007.1 GCA015645205_02179 gene open 86583-87464 mscS
4376 JADOYF010000007.1 GCA015645205_02180 gene open 87485-87688
4377 JADOYF010000007.1 GCA015645205_02181 gene open 87700-88797 ychF
4378 JADOYF010000007.1 GCA015645205_02182 gene open 88930-89121
4379 JADOYF010000007.1 GCA015645205_02183 gene open 89202-90017
4380 JADOYF010000007.1 GCA015645205_02184 gene open 90151-90549
4381 JADOYF010000007.1 GCA015645205_02185 gene open 90640-91800
4382 JADOYF010000007.1 GCA015645205_02186 gene open 91804-92481
4383 JADOYF010000007.1 GCA015645205_02114 gene open 17369-17441 trnD
4384 JADOYF010000007.1 GCA015645205_02115 gene open 17447-17521 trnE
4385 JADOYF010000007.1 GCA015645205_02114 tRNA open 17369-17441 trnD tRNA-Asp(gtc)
4386 JADOYF010000007.1 GCA015645205_02115 tRNA open 17447-17521 trnE tRNA-Glu(ttc)
4387 JADOYF010000008.1 repeat_region open 59253-59652 CRISPR array with 6 repeats of length 35%2C consensus sequence TTCTCGTCCCCTGTTATTCGGGGTAGTTATCGATC and spacer length 36
4388 JADOYF010000008.1 GCA015645205_02187 CDS open 119-637 _na     172_aa ribD RibD C-terminal domain
4389 JADOYF010000008.1 GCA015645205_02188 CDS open 897-1886 _na     329_aa sph sphingomyelin phosphodiesterase
4390 JADOYF010000008.1 GCA015645205_02189 CDS open 2031-3350 _na     439_aa gtfB accessory Sec system glycosylation chaperone GtfB
4391 JADOYF010000008.1 GCA015645205_02190 CDS open 3343-4845 _na     500_aa gtfA accessory Sec system glycosyltransferase GtfA
4392 JADOYF010000008.1 GCA015645205_02191 CDS open 4925-8239 _na     1104_aa Bone sialoprotein-binding protein
4393 JADOYF010000008.1 GCA015645205_02192 CDS open 8740-9774 _na     344_aa mcrC 5-methylcytosine-specific restriction endonuclease system specificity protein McrC
4394 JADOYF010000008.1 GCA015645205_02193 CDS open 9774-11471 _na     565_aa AAA family ATPase
4395 JADOYF010000008.1 GCA015645205_02194 CDS open 11868-15020 _na     1050_aa ATPase
4396 JADOYF010000008.1 GCA015645205_02195 CDS open 15241-16572 _na     443_aa mcrC 5-methylcytosine restriction system specificity protein McrC
4397 JADOYF010000008.1 GCA015645205_02196 CDS open 16559-18565 _na     668_aa mrcB MrcB family domain-containing protein
4398 JADOYF010000008.1 GCA015645205_02197 CDS open 18821-19060 _na     79_aa hypothetical protein
4399 JADOYF010000008.1 GCA015645205_02198 CDS open 19690-22809 _na     1039_aa Type I restriction enzyme endonuclease subunit
4400 JADOYF010000008.1 GCA015645205_02199 CDS open 22793-24073 _na     426_aa restriction endonuclease subunit S
4401 JADOYF010000008.1 GCA015645205_02200 CDS open 24063-25577 _na     504_aa hsdM site-specific DNA-methyltransferase (adenine-specific)
4402 JADOYF010000008.1 GCA015645205_02201 CDS open 25636-26421 _na     261_aa abiH AbiH family protein
4403 JADOYF010000008.1 GCA015645205_02202 CDS open 26493-26978 _na     161_aa hypothetical protein
4404 JADOYF010000008.1 GCA015645205_02203 CDS open 27263-27808 _na     181_aa DUF1541 domain-containing protein
4405 JADOYF010000008.1 GCA015645205_02204 CDS open 27826-29886 _na     686_aa copB putative copper-transporting P-type ATPase B
4406 JADOYF010000008.1 GCA015645205_02205 CDS open 30155-30472 _na     105_aa arsR Arsenical resistance operon repressor
4407 JADOYF010000008.1 GCA015645205_02206 CDS open 30472-31761 _na     429_aa arsB arsenite efflux transporter membrane subunit ArsB
4408 JADOYF010000008.1 GCA015645205_02207 CDS open 31779-32180 _na     133_aa arsC thioredoxin-dependent arsenate reductase
4409 JADOYF010000008.1 GCA015645205_02208 CDS open 32200-32541 _na     113_aa arsR Cadmium resistant accessory protein
4410 JADOYF010000008.1 GCA015645205_02209 CDS open 32560-33177 _na     205_aa Cadmium resistance protein
4411 JADOYF010000008.1 GCA015645205_02210 CDS open 33715-34080 _na     121_aa doxX DoxX family protein
4412 JADOYF010000008.1 GCA015645205_02211 CDS open 34089-35093 _na     334_aa curA NADP-dependent oxidoreductase
4413 JADOYF010000008.1 GCA015645205_02212 CDS open 35097-35762 _na     221_aa wcaG putative sugar epimerase YhfK
4414 JADOYF010000008.1 GCA015645205_02213 CDS open 35784-36467 _na     227_aa yajL ThiJ/PfpI family protein
4415 JADOYF010000008.1 GCA015645205_02214 CDS open 36545-36892 _na     115_aa soxR HTH merR-type domain-containing protein
4416 JADOYF010000008.1 GCA015645205_02215 CDS open 37388-37552 _na     54_aa Acetyltransferase
4417 JADOYF010000008.1 GCA015645205_02216 CDS open 37741-38730 _na     329_aa ATP-binding protein
4418 JADOYF010000008.1 GCA015645205_02217 CDS open 38913-39062 _na     49_aa hypothetical protein
4419 JADOYF010000008.1 GCA015645205_02218 CDS open 39062-40852 _na     596_aa cch1 cassette chromosome replicative helicase
4420 JADOYF010000008.1 GCA015645205_02219 CDS open 40917-41174 _na     85_aa Phage protein
4421 JADOYF010000008.1 GCA015645205_02220 CDS open 41352-42701 _na     449_aa ccrA cassette chromosome recombinase CcrA
4422 JADOYF010000008.1 GCA015645205_02221 CDS open 42722-44350 _na     542_aa ccrB cassette chromosome recombinase CcrB
4423 JADOYF010000008.1 GCA015645205_02223 CDS open 44816-45166 _na     116_aa DUF950 domain-containing protein
4424 JADOYF010000008.1 GCA015645205_02224 CDS open 45153-45251 _na     32_aa hypothetical protein
4425 JADOYF010000008.1 GCA015645205_02225 CDS open 45253-45564 _na     103_aa Pyridoxal phosphate-dependent enzyme
4426 JADOYF010000008.1 GCA015645205_02226 CDS open 45580-46089 _na     169_aa Transposase
4427 JADOYF010000008.1 GCA015645205_02227 CDS open 46103-46324 _na     73_aa Transcriptional regulator
4428 JADOYF010000008.1 GCA015645205_02228 CDS open 46694-47353 _na     219_aa Membrane protein
4429 JADOYF010000008.1 GCA015645205_02229 CDS open 47363-48010 _na     215_aa tetR TetR family transcriptional regulator
4430 JADOYF010000008.1 GCA015645205_02230 CDS open 48015-48650 _na     211_aa Membrane protein
4431 JADOYF010000008.1 GCA015645205_02231 CDS open 50593-51327 _na     244_aa cas6 CRISPR-associated endoribonuclease Cas6
4432 JADOYF010000008.1 GCA015645205_02232 CDS open 51324-52592 _na     422_aa csm6 type III-A CRISPR-associated CARF protein Csm6
4433 JADOYF010000008.1 GCA015645205_02233 CDS open 52592-53614 _na     340_aa csm5 type III-A CRISPR-associated RAMP protein Csm5
4434 JADOYF010000008.1 GCA015645205_02234 CDS open 53617-54525 _na     302_aa csm4 type III-A CRISPR-associated RAMP protein Csm4
4435 JADOYF010000008.1 GCA015645205_02235 CDS open 54536-55180 _na     214_aa csm3 type III-A CRISPR-associated RAMP protein Csm3
4436 JADOYF010000008.1 GCA015645205_02236 CDS open 55182-55607 _na     141_aa CRISPR system Cms protein Csm2
4437 JADOYF010000008.1 GCA015645205_02237 CDS open 55610-57883 _na     757_aa cas10 type III-A CRISPR-associated protein Cas10/Csm1
4438 JADOYF010000008.1 GCA015645205_02238 CDS open 57897-58202 _na     101_aa cas2 CRISPR-associated endonuclease Cas2
4439 JADOYF010000008.1 GCA015645205_02239 CDS open 58202-59107 _na     301_aa cas1 type II CRISPR-associated endonuclease Cas1
4440 JADOYF010000008.1 GCA015645205_02240 CDS open 60535-60795 _na     86_aa DUF3387 domain-containing protein
4441 JADOYF010000008.1 GCA015645205_02241 CDS open 60792-60923 _na     43_aa hypothetical protein
4442 JADOYF010000008.1 GCA015645205_02242 CDS open 61087-61308 _na     73_aa hypothetical protein
4443 JADOYF010000008.1 GCA015645205_02243 CDS open 61323-61826 _na     167_aa Ribosomal RNA large subunit methyltransferase e
4444 JADOYF010000008.1 GCA015645205_02244 CDS open 61841-62152 _na     103_aa Pyridoxal phosphate-dependent enzyme
4445 JADOYF010000008.1 GCA015645205_02245 CDS open 62154-62243 _na     29_aa Phage protein
4446 JADOYF010000008.1 GCA015645205_02246 CDS open 62246-62584 _na     112_aa Phage protein
4447 JADOYF010000008.1 GCA015645205_02247 CDS open 62673-64352 _na     559_aa ccrC cassette chromosome recombinase CcrC
4448 JADOYF010000008.1 GCA015645205_02248 CDS open 64577-66193 _na     538_aa DNA primase
4449 JADOYF010000008.1 GCA015645205_02249 CDS open 66193-66561 _na     122_aa Intein C-terminal splicing domain-containing protein
4450 JADOYF010000008.1 GCA015645205_02250 CDS open 66554-67663 _na     369_aa DNA-directed DNA polymerase family A palm domain-containing protein
4451 JADOYF010000008.1 GCA015645205_02251 CDS open 67858-69846 _na     662_aa hypothetical protein
4452 JADOYF010000008.1 GCA015645205_02252 CDS open 70008-70937 _na     309_aa yobV HTH domain-containing protein
4453 JADOYF010000008.1 GCA015645205_02253 CDS open 71018-71446 _na     142_aa phnB PhnB-like domain-containing protein
4454 JADOYF010000008.1 GCA015645205_02254 CDS open 72037-72180 _na     47_aa tnp IS6 family IS431mec transposase
4455 JADOYF010000008.1 GCA015645205_02255 CDS open 72428-74434 _na     668_aa mecA PBP2a family beta-lactam-resistant peptidoglycan transpeptidase MecA
4456 JADOYF010000008.1 GCA015645205_02256 CDS open 74480-74908 _na     142_aa maoC Acyl dehydratase
4457 JADOYF010000008.1 GCA015645205_02257 CDS open 75005-75748 _na     247_aa ugpQ Glycerophosphoryl diester phosphodiesterase
4458 JADOYF010000008.1 GCA015645205_02258 CDS open 76665-76832 _na     55_aa pksG hydroxymethylglutaryl-CoA synthase
4459 JADOYF010000008.1 GCA015645205_02187 gene open 119-637 ribD
4460 JADOYF010000008.1 GCA015645205_02188 gene open 897-1886 sph
4461 JADOYF010000008.1 GCA015645205_02189 gene open 2031-3350 gtfB
4462 JADOYF010000008.1 GCA015645205_02190 gene open 3343-4845 gtfA
4463 JADOYF010000008.1 GCA015645205_02191 gene open 4925-8239
4464 JADOYF010000008.1 GCA015645205_02192 gene open 8740-9774 mcrC
4465 JADOYF010000008.1 GCA015645205_02193 gene open 9774-11471
4466 JADOYF010000008.1 GCA015645205_02194 gene open 11868-15020
4467 JADOYF010000008.1 GCA015645205_02195 gene open 15241-16572 mcrC
4468 JADOYF010000008.1 GCA015645205_02196 gene open 16559-18565 mrcB
4469 JADOYF010000008.1 GCA015645205_02197 gene open 18821-19060
4470 JADOYF010000008.1 GCA015645205_02198 gene open 19690-22809
4471 JADOYF010000008.1 GCA015645205_02199 gene open 22793-24073
4472 JADOYF010000008.1 GCA015645205_02200 gene open 24063-25577 hsdM
4473 JADOYF010000008.1 GCA015645205_02201 gene open 25636-26421 abiH
4474 JADOYF010000008.1 GCA015645205_02202 gene open 26493-26978
4475 JADOYF010000008.1 GCA015645205_02203 gene open 27263-27808
4476 JADOYF010000008.1 GCA015645205_02204 gene open 27826-29886 copB
4477 JADOYF010000008.1 GCA015645205_02205 gene open 30155-30472 arsR
4478 JADOYF010000008.1 GCA015645205_02206 gene open 30472-31761 arsB
4479 JADOYF010000008.1 GCA015645205_02207 gene open 31779-32180 arsC
4480 JADOYF010000008.1 GCA015645205_02208 gene open 32200-32541 arsR
4481 JADOYF010000008.1 GCA015645205_02209 gene open 32560-33177
4482 JADOYF010000008.1 GCA015645205_02210 gene open 33715-34080 doxX
4483 JADOYF010000008.1 GCA015645205_02211 gene open 34089-35093 curA
4484 JADOYF010000008.1 GCA015645205_02212 gene open 35097-35762 wcaG
4485 JADOYF010000008.1 GCA015645205_02213 gene open 35784-36467 yajL
4486 JADOYF010000008.1 GCA015645205_02214 gene open 36545-36892 soxR
4487 JADOYF010000008.1 GCA015645205_02215 gene open 37388-37552
4488 JADOYF010000008.1 GCA015645205_02216 gene open 37741-38730
4489 JADOYF010000008.1 GCA015645205_02217 gene open 38913-39062
4490 JADOYF010000008.1 GCA015645205_02218 gene open 39062-40852 cch1
4491 JADOYF010000008.1 GCA015645205_02219 gene open 40917-41174
4492 JADOYF010000008.1 GCA015645205_02220 gene open 41352-42701 ccrA
4493 JADOYF010000008.1 GCA015645205_02221 gene open 42722-44350 ccrB
4494 JADOYF010000008.1 GCA015645205_02223 gene open 44816-45166
4495 JADOYF010000008.1 GCA015645205_02224 gene open 45153-45251
4496 JADOYF010000008.1 GCA015645205_02225 gene open 45253-45564
4497 JADOYF010000008.1 GCA015645205_02226 gene open 45580-46089
4498 JADOYF010000008.1 GCA015645205_02227 gene open 46103-46324
4499 JADOYF010000008.1 GCA015645205_02228 gene open 46694-47353
4500 JADOYF010000008.1 GCA015645205_02229 gene open 47363-48010 tetR