HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Staphylococcus capitis (GCA_015645265.1)

Select a Genome:
BAKTA Annotations for GCA_015645265.1
Genome Selected: Staphylococcus capitis
ContigsBases CDSrRNA tmRNAtRNA
28 2518283 2384 10 1 63
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4989 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:9]    |    Number of Records Found: 4989 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4001 JADOYK010000006.1 GCA015645265_01952 gene open 27559-28284 gatD
4002 JADOYK010000006.1 GCA015645265_01953 gene open 28285-29598 murT
4003 JADOYK010000006.1 GCA015645265_01954 gene open 29826-30326 ftnA
4004 JADOYK010000006.1 GCA015645265_01955 gene open 30636-31190 dnaQ
4005 JADOYK010000006.1 GCA015645265_01956 gene open 31226-32296 dinB
4006 JADOYK010000006.1 GCA015645265_01957 gene open 32455-32997
4007 JADOYK010000006.1 GCA015645265_01958 gene open 33149-34516 rlmD
4008 JADOYK010000006.1 GCA015645265_01959 gene open 34604-35554 dagK
4009 JADOYK010000006.1 GCA015645265_01960 gene open 35795-37222 gatB
4010 JADOYK010000006.1 GCA015645265_01961 gene open 37235-38692 gatA
4011 JADOYK010000006.1 GCA015645265_01962 gene open 38694-38996 gatC
4012 JADOYK010000006.1 GCA015645265_01963 gene open 39376-40911 putP
4013 JADOYK010000006.1 GCA015645265_01964 gene open 40985-42193 camS
4014 JADOYK010000006.1 GCA015645265_01965 gene open 42206-44209 ligA
4015 JADOYK010000006.1 GCA015645265_01966 gene open 44217-46412 pcrA
4016 JADOYK010000006.1 GCA015645265_01967 gene open 46412-47101
4017 JADOYK010000006.1 GCA015645265_01968 gene open 47407-47709 yerC
4018 JADOYK010000006.1 GCA015645265_01969 gene open 47833-49128 purB
4019 JADOYK010000006.1 GCA015645265_01970 gene open 49410-49589
4020 JADOYK010000006.1 GCA015645265_01971 gene open 49573-50199 yebE
4021 JADOYK010000006.1 GCA015645265_01972 gene open 50285-51106 nadE
4022 JADOYK010000006.1 GCA015645265_01973 gene open 51099-52568
4023 JADOYK010000006.1 GCA015645265_01974 gene open 52776-53843
4024 JADOYK010000006.1 GCA015645265_01975 gene open 53861-54664
4025 JADOYK010000006.1 GCA015645265_01976 gene open 54773-55858
4026 JADOYK010000006.1 GCA015645265_01977 gene open 56057-56611
4027 JADOYK010000006.1 GCA015645265_01978 gene open 56666-57592
4028 JADOYK010000006.1 GCA015645265_01979 gene open 57787-59166
4029 JADOYK010000006.1 GCA015645265_01980 gene open 59295-60323
4030 JADOYK010000006.1 GCA015645265_01981 gene open 60507-61796 arsB
4031 JADOYK010000006.1 GCA015645265_01982 gene open 61914-62312
4032 JADOYK010000006.1 GCA015645265_01983 gene open 62386-62556
4033 JADOYK010000006.1 GCA015645265_01984 gene open 62967-64007
4034 JADOYK010000006.1 GCA015645265_01985 gene open 64106-64942
4035 JADOYK010000006.1 GCA015645265_01986 gene open 64939-65496
4036 JADOYK010000006.1 GCA015645265_01987 gene open 65547-66041
4037 JADOYK010000006.1 GCA015645265_01988 gene open 66199-66762
4038 JADOYK010000006.1 GCA015645265_01989 gene open 66795-67526 pmtD
4039 JADOYK010000006.1 GCA015645265_01990 gene open 67526-68398 pmtC
4040 JADOYK010000006.1 GCA015645265_01991 gene open 68418-69077 pmtB
4041 JADOYK010000006.1 GCA015645265_01992 gene open 69074-69973 pmtA
4042 JADOYK010000006.1 GCA015645265_01993 gene open 69973-70350 pmtR
4043 JADOYK010000006.1 GCA015645265_01994 gene open 70528-70698
4044 JADOYK010000006.1 GCA015645265_01995 gene open 70932-71027
4045 JADOYK010000006.1 GCA015645265_01996 gene open 71221-72510
4046 JADOYK010000006.1 GCA015645265_01997 gene open 72558-78461
4047 JADOYK010000006.1 GCA015645265_01998 gene open 78656-79975
4048 JADOYK010000006.1 GCA015645265_01999 gene open 80229-81848 groL
4049 JADOYK010000006.1 GCA015645265_02000 gene open 81918-82202 groES
4050 JADOYK010000006.1 GCA015645265_02001 gene open 82380-83123 mroQ
4051 JADOYK010000006.1 GCA015645265_02002 gene open 83181-85079
4052 JADOYK010000006.1 GCA015645265_02003 gene open 85270-85896
4053 JADOYK010000006.1 GCA015645265_02004 gene open 85998-86783
4054 JADOYK010000006.1 GCA015645265_02007 gene open 87545-88111
4055 JADOYK010000006.1 GCA015645265_02008 gene open 88108-88254
4056 JADOYK010000006.1 GCA015645265_02009 gene open 88278-89567 agrC
4057 JADOYK010000006.1 GCA015645265_02010 gene open 89583-90299 agrA
4058 JADOYK010000006.1 GCA015645265_02011 gene open 90364-91323
4059 JADOYK010000006.1 GCA015645265_02012 gene open 91330-92805
4060 JADOYK010000006.1 GCA015645265_02013 gene open 93040-93990
4061 JADOYK010000006.1 GCA015645265_02014 gene open 94135-95385
4062 JADOYK010000006.1 GCA015645265_02015 gene open 95563-95787
4063 JADOYK010000006.1 GCA015645265_02016 gene open 95806-96900
4064 JADOYK010000006.1 GCA015645265_02017 gene open 96982-97269
4065 JADOYK010000006.1 GCA015645265_02018 gene open 97358-97999
4066 JADOYK010000006.1 GCA015645265_02019 gene open 98356-100293 abc-f
4067 JADOYK010000006.1 GCA015645265_02020 gene open 100635-102251 mutS
4068 JADOYK010000006.1 GCA015645265_02021 gene open 102357-103400 tsaD
4069 JADOYK010000006.1 GCA015645265_02022 gene open 103382-103843 rimI
4070 JADOYK010000006.1 GCA015645265_02023 gene open 103816-104478 tsaB
4071 JADOYK010000006.1 GCA015645265_02024 gene open 104459-104923 tsaE
4072 JADOYK010000006.1 GCA015645265_02026 gene open 105364-107052 ilvD
4073 JADOYK010000006.1 GCA015645265_02027 gene open 107069-108868 ilvB
4074 JADOYK010000006.1 GCA015645265_02028 gene open 108868-109101
4075 JADOYK010000006.1 GCA015645265_02029 gene open 109230-110234 ilvC
4076 JADOYK010000006.1 GCA015645265_02030 gene open 110251-111786
4077 JADOYK010000006.1 GCA015645265_02031 gene open 111783-112826 leuB
4078 JADOYK010000006.1 GCA015645265_02032 gene open 112844-114214 leuC
4079 JADOYK010000006.1 GCA015645265_02033 gene open 114215-114784
4080 JADOYK010000006.1 GCA015645265_02034 gene open 114799-116067 ilvA
4081 JADOYK010000007.1 rep_origin open 51036-51770
4082 JADOYK010000007.1 regulatory_region open 7215-7627 T-box leader
4083 JADOYK010000007.1 regulatory_region open 63940-64153 T-box leader
4084 JADOYK010000007.1 regulatory_region open 67004-67104 SAM riboswitch aptamer (S box leader)
4085 JADOYK010000007.1 GCA015645265_02036 CDS open 111-788 _na     225_aa DUF7411 domain-containing protein
4086 JADOYK010000007.1 GCA015645265_02037 CDS open 792-1952 _na     386_aa Selenocysteine lyase
4087 JADOYK010000007.1 GCA015645265_02038 CDS open 2043-2441 _na     132_aa Helix-turn-helix domain-containing protein
4088 JADOYK010000007.1 GCA015645265_02039 CDS open 2575-3390 _na     271_aa Lysozyme
4089 JADOYK010000007.1 GCA015645265_02040 CDS open 3471-3662 _na     63_aa hypothetical protein
4090 JADOYK010000007.1 GCA015645265_02041 CDS open 3795-4892 _na     365_aa ychF redox-regulated ATPase YchF
4091 JADOYK010000007.1 GCA015645265_02042 CDS open 4904-5107 _na     67_aa Cytosolic protein
4092 JADOYK010000007.1 GCA015645265_02043 CDS open 5128-6009 _na     293_aa mscS Mechanosensitive ion channel family protein
4093 JADOYK010000007.1 GCA015645265_02044 CDS open 6114-6944 _na     276_aa Transcription terminator
4094 JADOYK010000007.1 GCA015645265_02045 CDS open 7694-8797 _na     367_aa Cystathionine gamma-synthase and O-acetylhomoserine thiolyase
4095 JADOYK010000007.1 GCA015645265_02046 CDS open 8794-9969 _na     391_aa metC cystathionine beta-lyase MetC
4096 JADOYK010000007.1 GCA015645265_02047 CDS open 9923-11761 _na     612_aa metF bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase
4097 JADOYK010000007.1 GCA015645265_02048 CDS open 11758-14004 _na     748_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
4098 JADOYK010000007.1 GCA015645265_02049 CDS open 14026-14769 _na     247_aa Cyclase family protein
4099 JADOYK010000007.1 GCA015645265_02050 CDS open 15161-15808 _na     215_aa Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B
4100 JADOYK010000007.1 GCA015645265_02051 CDS open 15813-16508 _na     231_aa Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A
4101 JADOYK010000007.1 GCA015645265_02052 CDS open 16512-17699 _na     395_aa putative acetyl-CoA acyltransferase
4102 JADOYK010000007.1 GCA015645265_02053 CDS open 18103-18489 _na     128_aa Putative lyase
4103 JADOYK010000007.1 GCA015645265_02054 CDS open 18671-18922 _na     83_aa HTH cro/C1-type domain-containing protein
4104 JADOYK010000007.1 GCA015645265_02055 CDS open 19035-19238 _na     67_aa yozE YozE SAM-like domain-containing protein
4105 JADOYK010000007.1 GCA015645265_02056 CDS open 19520-20407 _na     295_aa lysR LysR family transcriptional regulator
4106 JADOYK010000007.1 GCA015645265_02057 CDS open 20513-22150 _na     545_aa malolactic enzyme
4107 JADOYK010000007.1 GCA015645265_02058 CDS open 22184-23533 _na     449_aa Citrate/malate-proton symporter
4108 JADOYK010000007.1 GCA015645265_02059 CDS open 23616-24776 _na     386_aa Esterase
4109 JADOYK010000007.1 GCA015645265_02060 CDS open 25160-26518 _na     452_aa Transporter
4110 JADOYK010000007.1 GCA015645265_02061 CDS open 26596-27171 _na     191_aa lepB signal peptidase I
4111 JADOYK010000007.1 GCA015645265_02062 CDS open 27197-27358 _na     53_aa vraH VraH family protein
4112 JADOYK010000007.1 GCA015645265_02063 CDS open 27384-28040 _na     218_aa Proteophosphoglycan 5
4113 JADOYK010000007.1 GCA015645265_02064 CDS open 28055-28435 _na     126_aa Lipoprotein
4114 JADOYK010000007.1 GCA015645265_02065 CDS open 29120-29521 _na     133_aa putative protein conserved in bacteria
4115 JADOYK010000007.1 GCA015645265_02066 CDS open 29535-29933 _na     132_aa yxeA YxeA family protein
4116 JADOYK010000007.1 GCA015645265_02067 CDS open 30096-30854 _na     252_aa vraD VraD protein
4117 JADOYK010000007.1 GCA015645265_02068 CDS open 30844-32724 _na     626_aa ABC transporter permease
4118 JADOYK010000007.1 GCA015645265_02069 CDS open 32769-32963 _na     64_aa vraH Peptide resistance ABC transporter activity modulator VraH
4119 JADOYK010000007.1 GCA015645265_02070 CDS open 33051-35369 _na     772_aa lip YSIRK-targeted triacylglycerol lipase
4120 JADOYK010000007.1 GCA015645265_02071 CDS open 35608-35823 _na     71_aa hypothetical protein
4121 JADOYK010000007.1 GCA015645265_02072 CDS open 36154-36612 _na     152_aa hypothetical protein
4122 JADOYK010000007.1 GCA015645265_02073 CDS open 36733-37092 _na     119_aa Lipoprotein
4123 JADOYK010000007.1 GCA015645265_02074 CDS open 37824-39026 _na     400_aa ABC transporter permease
4124 JADOYK010000007.1 GCA015645265_02075 CDS open 39019-39705 _na     228_aa lolD ABC transporter ATP-binding protein
4125 JADOYK010000007.1 GCA015645265_02076 CDS open 39702-40817 _na     371_aa RND transporter
4126 JADOYK010000007.1 GCA015645265_02077 CDS open 41061-41711 _na     216_aa YIP1 family protein
4127 JADOYK010000007.1 GCA015645265_02078 CDS open 42006-42203 _na     65_aa hypothetical protein
4128 JADOYK010000007.1 GCA015645265_02079 CDS open 42309-42863 _na     184_aa acrR AcrR family transcriptional regulator
4129 JADOYK010000007.1 GCA015645265_02080 CDS open 42829-43224 _na     131_aa Permease
4130 JADOYK010000007.1 GCA015645265_02081 CDS open 43244-43603 _na     119_aa Permease
4131 JADOYK010000007.1 GCA015645265_02082 CDS open 43864-44499 _na     211_aa HAD family hydrolase
4132 JADOYK010000007.1 GCA015645265_02083 CDS open 44566-45276 _na     236_aa Carbonyl reductase
4133 JADOYK010000007.1 GCA015645265_02084 CDS open 45339-46178 _na     279_aa noc nucleoid occlusion protein
4134 JADOYK010000007.1 GCA015645265_02085 CDS open 46226-46945 _na     239_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
4135 JADOYK010000007.1 GCA015645265_02086 CDS open 46945-48822 _na     625_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
4136 JADOYK010000007.1 GCA015645265_02087 CDS open 48905-50284 _na     459_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
4137 JADOYK010000007.1 GCA015645265_02088 CDS open 50442-50789 _na     115_aa rnpA ribonuclease P protein component
4138 JADOYK010000007.1 GCA015645265_02089 CDS open 50898-51035 _na     45_aa rpmH 50S ribosomal protein L34
4139 JADOYK010000007.1 GCA015645265_02090 CDS open 51771-53126 _na     451_aa dnaA chromosomal replication initiator protein DnaA
4140 JADOYK010000007.1 GCA015645265_02091 CDS open 53436-54569 _na     377_aa dnaN DNA polymerase III subunit beta
4141 JADOYK010000007.1 GCA015645265_02092 CDS open 54953-55189 _na     78_aa yaaA S4 domain-containing protein YaaA
4142 JADOYK010000007.1 GCA015645265_02093 CDS open 55186-56301 _na     371_aa recF DNA replication/repair protein RecF
4143 JADOYK010000007.1 GCA015645265_02094 CDS open 56312-58243 _na     643_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
4144 JADOYK010000007.1 GCA015645265_02095 CDS open 58280-60952 _na     890_aa gyrA DNA gyrase subunit A
4145 JADOYK010000007.1 GCA015645265_02096 CDS open 61130-61942 _na     270_aa nnr2 ADP-dependent (S)-NAD(P)H-hydrate dehydratase
4146 JADOYK010000007.1 GCA015645265_02097 CDS open 62358-63863 _na     501_aa hutH histidine ammonia-lyase
4147 JADOYK010000007.1 GCA015645265_02098 CDS open 64237-65523 _na     428_aa serS serine--tRNA ligase
4148 JADOYK010000007.1 GCA015645265_02099 CDS open 65860-66552 _na     230_aa azlC AzlC family ABC transporter permease
4149 JADOYK010000007.1 GCA015645265_02100 CDS open 66549-66878 _na     109_aa Branched-chain amino acid transport family protein
4150 JADOYK010000007.1 GCA015645265_02101 CDS open 67170-68138 _na     322_aa Homoserine-o-acetyltransferase
4151 JADOYK010000007.1 GCA015645265_02102 CDS open 68437-69348 _na     303_aa DUF2232 domain-containing protein
4152 JADOYK010000007.1 GCA015645265_02103 CDS open 69378-71345 _na     655_aa gdpP Cyclic-di-AMP phosphodiesterase
4153 JADOYK010000007.1 GCA015645265_02104 CDS open 71342-71788 _na     148_aa rplI 50S ribosomal protein L9
4154 JADOYK010000007.1 GCA015645265_02105 CDS open 71837-73237 _na     466_aa dnaB replicative DNA helicase
4155 JADOYK010000007.1 GCA015645265_02106 CDS open 73516-74799 _na     427_aa purA adenylosuccinate synthase
4156 JADOYK010000007.1 GCA015645265_02109 CDS open 75737-76438 _na     233_aa yycF response regulator YycF
4157 JADOYK010000007.1 GCA015645265_02110 CDS open 76451-78283 _na     610_aa walK cell wall metabolism sensor histidine kinase WalK
4158 JADOYK010000007.1 GCA015645265_02111 CDS open 78276-79613 _na     445_aa yycH Regulatory protein YycH domain-containing protein
4159 JADOYK010000007.1 GCA015645265_02112 CDS open 79614-80402 _na     262_aa Regulatory protein YycH-like domain-containing protein
4160 JADOYK010000007.1 GCA015645265_02113 CDS open 80914-81705 _na     263_aa MBL fold metallo-hydrolase
4161 JADOYK010000007.1 GCA015645265_02114 CDS open 82115-82594 _na     159_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
4162 JADOYK010000007.1 GCA015645265_02115 CDS open 82840-83145 _na     101_aa hypothetical protein
4163 JADOYK010000007.1 GCA015645265_02116 CDS open 83344-84207 _na     287_aa GIY-YIG domain-containing protein
4164 JADOYK010000007.1 GCA015645265_02117 CDS open 84315-85790 _na     491_aa DUF6038 domain-containing protein
4165 JADOYK010000007.1 GCA015645265_02118 CDS open 86016-87116 _na     366_aa DNA-directed DNA polymerase family A palm domain-containing protein
4166 JADOYK010000007.1 GCA015645265_02119 CDS open 87109-87480 _na     123_aa Intein C-terminal splicing domain-containing protein
4167 JADOYK010000007.1 GCA015645265_02120 CDS open 87477-89120 _na     547_aa SF3 helicase domain-containing protein
4168 JADOYK010000007.1 GCA015645265_02121 CDS open 89074-89190 _na     38_aa hypothetical protein
4169 JADOYK010000007.1 GCA015645265_02122 CDS open 89346-91022 _na     558_aa ccrC cassette chromosome recombinase CcrC
4170 JADOYK010000007.1 GCA015645265_02123 CDS open 91128-91466 _na     112_aa Phage protein
4171 JADOYK010000007.1 GCA015645265_02124 CDS open 91562-91873 _na     103_aa Pyridoxal phosphate-dependent enzyme
4172 JADOYK010000007.1 GCA015645265_02125 CDS open 91889-92395 _na     168_aa DUF1643 domain-containing protein
4173 JADOYK010000007.1 GCA015645265_02036 gene open 111-788
4174 JADOYK010000007.1 GCA015645265_02037 gene open 792-1952
4175 JADOYK010000007.1 GCA015645265_02038 gene open 2043-2441
4176 JADOYK010000007.1 GCA015645265_02039 gene open 2575-3390
4177 JADOYK010000007.1 GCA015645265_02040 gene open 3471-3662
4178 JADOYK010000007.1 GCA015645265_02041 gene open 3795-4892 ychF
4179 JADOYK010000007.1 GCA015645265_02042 gene open 4904-5107
4180 JADOYK010000007.1 GCA015645265_02043 gene open 5128-6009 mscS
4181 JADOYK010000007.1 GCA015645265_02044 gene open 6114-6944
4182 JADOYK010000007.1 GCA015645265_02045 gene open 7694-8797
4183 JADOYK010000007.1 GCA015645265_02046 gene open 8794-9969 metC
4184 JADOYK010000007.1 GCA015645265_02047 gene open 9923-11761 metF
4185 JADOYK010000007.1 GCA015645265_02048 gene open 11758-14004 metE
4186 JADOYK010000007.1 GCA015645265_02049 gene open 14026-14769
4187 JADOYK010000007.1 GCA015645265_02050 gene open 15161-15808
4188 JADOYK010000007.1 GCA015645265_02051 gene open 15813-16508
4189 JADOYK010000007.1 GCA015645265_02052 gene open 16512-17699
4190 JADOYK010000007.1 GCA015645265_02053 gene open 18103-18489
4191 JADOYK010000007.1 GCA015645265_02054 gene open 18671-18922
4192 JADOYK010000007.1 GCA015645265_02055 gene open 19035-19238 yozE
4193 JADOYK010000007.1 GCA015645265_02056 gene open 19520-20407 lysR
4194 JADOYK010000007.1 GCA015645265_02057 gene open 20513-22150
4195 JADOYK010000007.1 GCA015645265_02058 gene open 22184-23533
4196 JADOYK010000007.1 GCA015645265_02059 gene open 23616-24776
4197 JADOYK010000007.1 GCA015645265_02060 gene open 25160-26518
4198 JADOYK010000007.1 GCA015645265_02061 gene open 26596-27171 lepB
4199 JADOYK010000007.1 GCA015645265_02062 gene open 27197-27358 vraH
4200 JADOYK010000007.1 GCA015645265_02063 gene open 27384-28040
4201 JADOYK010000007.1 GCA015645265_02064 gene open 28055-28435
4202 JADOYK010000007.1 GCA015645265_02065 gene open 29120-29521
4203 JADOYK010000007.1 GCA015645265_02066 gene open 29535-29933 yxeA
4204 JADOYK010000007.1 GCA015645265_02067 gene open 30096-30854 vraD
4205 JADOYK010000007.1 GCA015645265_02068 gene open 30844-32724
4206 JADOYK010000007.1 GCA015645265_02069 gene open 32769-32963 vraH
4207 JADOYK010000007.1 GCA015645265_02070 gene open 33051-35369 lip
4208 JADOYK010000007.1 GCA015645265_02071 gene open 35608-35823
4209 JADOYK010000007.1 GCA015645265_02072 gene open 36154-36612
4210 JADOYK010000007.1 GCA015645265_02073 gene open 36733-37092
4211 JADOYK010000007.1 GCA015645265_02074 gene open 37824-39026
4212 JADOYK010000007.1 GCA015645265_02075 gene open 39019-39705 lolD
4213 JADOYK010000007.1 GCA015645265_02076 gene open 39702-40817
4214 JADOYK010000007.1 GCA015645265_02077 gene open 41061-41711
4215 JADOYK010000007.1 GCA015645265_02078 gene open 42006-42203
4216 JADOYK010000007.1 GCA015645265_02079 gene open 42309-42863 acrR
4217 JADOYK010000007.1 GCA015645265_02080 gene open 42829-43224
4218 JADOYK010000007.1 GCA015645265_02081 gene open 43244-43603
4219 JADOYK010000007.1 GCA015645265_02082 gene open 43864-44499
4220 JADOYK010000007.1 GCA015645265_02083 gene open 44566-45276
4221 JADOYK010000007.1 GCA015645265_02084 gene open 45339-46178 noc
4222 JADOYK010000007.1 GCA015645265_02085 gene open 46226-46945 rsmG
4223 JADOYK010000007.1 GCA015645265_02086 gene open 46945-48822 mnmG
4224 JADOYK010000007.1 GCA015645265_02087 gene open 48905-50284 mnmE
4225 JADOYK010000007.1 GCA015645265_02088 gene open 50442-50789 rnpA
4226 JADOYK010000007.1 GCA015645265_02089 gene open 50898-51035 rpmH
4227 JADOYK010000007.1 GCA015645265_02090 gene open 51771-53126 dnaA
4228 JADOYK010000007.1 GCA015645265_02091 gene open 53436-54569 dnaN
4229 JADOYK010000007.1 GCA015645265_02092 gene open 54953-55189 yaaA
4230 JADOYK010000007.1 GCA015645265_02093 gene open 55186-56301 recF
4231 JADOYK010000007.1 GCA015645265_02094 gene open 56312-58243 gyrB
4232 JADOYK010000007.1 GCA015645265_02095 gene open 58280-60952 gyrA
4233 JADOYK010000007.1 GCA015645265_02096 gene open 61130-61942 nnr2
4234 JADOYK010000007.1 GCA015645265_02097 gene open 62358-63863 hutH
4235 JADOYK010000007.1 GCA015645265_02098 gene open 64237-65523 serS
4236 JADOYK010000007.1 GCA015645265_02099 gene open 65860-66552 azlC
4237 JADOYK010000007.1 GCA015645265_02100 gene open 66549-66878
4238 JADOYK010000007.1 GCA015645265_02101 gene open 67170-68138
4239 JADOYK010000007.1 GCA015645265_02102 gene open 68437-69348
4240 JADOYK010000007.1 GCA015645265_02103 gene open 69378-71345 gdpP
4241 JADOYK010000007.1 GCA015645265_02104 gene open 71342-71788 rplI
4242 JADOYK010000007.1 GCA015645265_02105 gene open 71837-73237 dnaB
4243 JADOYK010000007.1 GCA015645265_02106 gene open 73516-74799 purA
4244 JADOYK010000007.1 GCA015645265_02109 gene open 75737-76438 yycF
4245 JADOYK010000007.1 GCA015645265_02110 gene open 76451-78283 walK
4246 JADOYK010000007.1 GCA015645265_02111 gene open 78276-79613 yycH
4247 JADOYK010000007.1 GCA015645265_02112 gene open 79614-80402
4248 JADOYK010000007.1 GCA015645265_02113 gene open 80914-81705
4249 JADOYK010000007.1 GCA015645265_02114 gene open 82115-82594 rlmH
4250 JADOYK010000007.1 GCA015645265_02115 gene open 82840-83145
4251 JADOYK010000007.1 GCA015645265_02116 gene open 83344-84207
4252 JADOYK010000007.1 GCA015645265_02117 gene open 84315-85790
4253 JADOYK010000007.1 GCA015645265_02118 gene open 86016-87116
4254 JADOYK010000007.1 GCA015645265_02119 gene open 87109-87480
4255 JADOYK010000007.1 GCA015645265_02120 gene open 87477-89120
4256 JADOYK010000007.1 GCA015645265_02121 gene open 89074-89190
4257 JADOYK010000007.1 GCA015645265_02122 gene open 89346-91022 ccrC
4258 JADOYK010000007.1 GCA015645265_02123 gene open 91128-91466
4259 JADOYK010000007.1 GCA015645265_02124 gene open 91562-91873
4260 JADOYK010000007.1 GCA015645265_02125 gene open 91889-92395
4261 JADOYK010000007.1 GCA015645265_02107 gene open 75071-75145 trnE
4262 JADOYK010000007.1 GCA015645265_02108 gene open 75151-75223 trnD
4263 JADOYK010000007.1 GCA015645265_02107 tRNA open 75071-75145 trnE tRNA-Glu(ttc)
4264 JADOYK010000007.1 GCA015645265_02108 tRNA open 75151-75223 trnD tRNA-Asp(gtc)
4265 JADOYK010000008.1 repeat_region open 50437-50631 CRISPR array with 3 repeats of length 39%2C consensus sequence GAGTTCTCGTCCCCTCTTCTACGGGGTAGTTATCGAAT and spacer length 34
4266 JADOYK010000008.1 repeat_region open 59415-60175 CRISPR array with 11 repeats of length 35%2C consensus sequence TTCTCGTCCCCTGTTATTCGGGGTAGTTATCGATC and spacer length 36
4267 JADOYK010000008.1 GCA015645265_02126 CDS open 119-637 _na     172_aa ribD RibD C-terminal domain
4268 JADOYK010000008.1 GCA015645265_02127 CDS open 897-1886 _na     329_aa sph sphingomyelin phosphodiesterase
4269 JADOYK010000008.1 GCA015645265_02128 CDS open 2031-3350 _na     439_aa gtfB accessory Sec system glycosylation chaperone GtfB
4270 JADOYK010000008.1 GCA015645265_02129 CDS open 3343-4845 _na     500_aa gtfA accessory Sec system glycosyltransferase GtfA
4271 JADOYK010000008.1 GCA015645265_02130 CDS open 4925-8329 _na     1134_aa Bone sialoprotein-binding protein
4272 JADOYK010000008.1 GCA015645265_02131 CDS open 8830-9864 _na     344_aa mcrC 5-methylcytosine-specific restriction endonuclease system specificity protein McrC
4273 JADOYK010000008.1 GCA015645265_02132 CDS open 9864-11561 _na     565_aa AAA family ATPase
4274 JADOYK010000008.1 GCA015645265_02133 CDS open 11958-15110 _na     1050_aa ATPase
4275 JADOYK010000008.1 GCA015645265_02134 CDS open 15331-16662 _na     443_aa mcrC 5-methylcytosine restriction system specificity protein McrC
4276 JADOYK010000008.1 GCA015645265_02135 CDS open 16649-18655 _na     668_aa mrcB MrcB family domain-containing protein
4277 JADOYK010000008.1 GCA015645265_02136 CDS open 18911-19150 _na     79_aa hypothetical protein
4278 JADOYK010000008.1 GCA015645265_02137 CDS open 19780-22899 _na     1039_aa Type I restriction enzyme endonuclease subunit
4279 JADOYK010000008.1 GCA015645265_02138 CDS open 22883-24163 _na     426_aa restriction endonuclease subunit S
4280 JADOYK010000008.1 GCA015645265_02139 CDS open 24153-25667 _na     504_aa hsdM site-specific DNA-methyltransferase (adenine-specific)
4281 JADOYK010000008.1 GCA015645265_02140 CDS open 25726-26511 _na     261_aa abiH AbiH family protein
4282 JADOYK010000008.1 GCA015645265_02141 CDS open 26583-27068 _na     161_aa hypothetical protein
4283 JADOYK010000008.1 GCA015645265_02142 CDS open 27353-27898 _na     181_aa DUF1541 domain-containing protein
4284 JADOYK010000008.1 GCA015645265_02143 CDS open 27916-29976 _na     686_aa copB putative copper-transporting P-type ATPase B
4285 JADOYK010000008.1 GCA015645265_02144 CDS open 30245-30562 _na     105_aa arsR Arsenical resistance operon repressor
4286 JADOYK010000008.1 GCA015645265_02145 CDS open 30562-31851 _na     429_aa arsB arsenite efflux transporter membrane subunit ArsB
4287 JADOYK010000008.1 GCA015645265_02146 CDS open 31869-32270 _na     133_aa arsC thioredoxin-dependent arsenate reductase
4288 JADOYK010000008.1 GCA015645265_02147 CDS open 32290-32631 _na     113_aa arsR Cadmium resistant accessory protein
4289 JADOYK010000008.1 GCA015645265_02148 CDS open 32650-33267 _na     205_aa Cadmium resistance protein
4290 JADOYK010000008.1 GCA015645265_02149 CDS open 33805-34170 _na     121_aa doxX DoxX family protein
4291 JADOYK010000008.1 GCA015645265_02150 CDS open 34179-35183 _na     334_aa curA NADP-dependent oxidoreductase
4292 JADOYK010000008.1 GCA015645265_02151 CDS open 35187-35852 _na     221_aa wcaG putative sugar epimerase YhfK
4293 JADOYK010000008.1 GCA015645265_02152 CDS open 35874-36557 _na     227_aa yajL ThiJ/PfpI family protein
4294 JADOYK010000008.1 GCA015645265_02153 CDS open 36635-36982 _na     115_aa soxR HTH merR-type domain-containing protein
4295 JADOYK010000008.1 GCA015645265_02154 CDS open 37478-37642 _na     54_aa Acetyltransferase
4296 JADOYK010000008.1 GCA015645265_02155 CDS open 37831-38820 _na     329_aa ATP-binding protein
4297 JADOYK010000008.1 GCA015645265_02156 CDS open 39003-39152 _na     49_aa hypothetical protein
4298 JADOYK010000008.1 GCA015645265_02157 CDS open 39152-40942 _na     596_aa cch1 cassette chromosome replicative helicase
4299 JADOYK010000008.1 GCA015645265_02158 CDS open 41007-41264 _na     85_aa Phage protein
4300 JADOYK010000008.1 GCA015645265_02159 CDS open 41442-42791 _na     449_aa ccrA cassette chromosome recombinase CcrA
4301 JADOYK010000008.1 GCA015645265_02160 CDS open 42812-44440 _na     542_aa ccrB cassette chromosome recombinase CcrB
4302 JADOYK010000008.1 GCA015645265_02162 CDS open 44906-45256 _na     116_aa DUF950 domain-containing protein
4303 JADOYK010000008.1 GCA015645265_02163 CDS open 45243-45341 _na     32_aa hypothetical protein
4304 JADOYK010000008.1 GCA015645265_02164 CDS open 45343-45654 _na     103_aa Pyridoxal phosphate-dependent enzyme
4305 JADOYK010000008.1 GCA015645265_02165 CDS open 45670-46179 _na     169_aa Transposase
4306 JADOYK010000008.1 GCA015645265_02166 CDS open 46193-46414 _na     73_aa Transcriptional regulator
4307 JADOYK010000008.1 GCA015645265_02167 CDS open 46784-47443 _na     219_aa Membrane protein
4308 JADOYK010000008.1 GCA015645265_02168 CDS open 47453-48100 _na     215_aa tetR TetR family transcriptional regulator
4309 JADOYK010000008.1 GCA015645265_02169 CDS open 48105-48740 _na     211_aa Membrane protein
4310 JADOYK010000008.1 GCA015645265_02170 CDS open 50755-51489 _na     244_aa cas6 CRISPR-associated endoribonuclease Cas6
4311 JADOYK010000008.1 GCA015645265_02171 CDS open 51486-52754 _na     422_aa csm6 type III-A CRISPR-associated CARF protein Csm6
4312 JADOYK010000008.1 GCA015645265_02172 CDS open 52754-53776 _na     340_aa csm5 type III-A CRISPR-associated RAMP protein Csm5
4313 JADOYK010000008.1 GCA015645265_02173 CDS open 53779-54687 _na     302_aa csm4 type III-A CRISPR-associated RAMP protein Csm4
4314 JADOYK010000008.1 GCA015645265_02174 CDS open 54698-55342 _na     214_aa csm3 type III-A CRISPR-associated RAMP protein Csm3
4315 JADOYK010000008.1 GCA015645265_02175 CDS open 55344-55769 _na     141_aa CRISPR system Cms protein Csm2
4316 JADOYK010000008.1 GCA015645265_02176 CDS open 55772-58045 _na     757_aa cas10 type III-A CRISPR-associated protein Cas10/Csm1
4317 JADOYK010000008.1 GCA015645265_02177 CDS open 58059-58364 _na     101_aa cas2 CRISPR-associated endonuclease Cas2
4318 JADOYK010000008.1 GCA015645265_02178 CDS open 58364-59269 _na     301_aa cas1 type II CRISPR-associated endonuclease Cas1
4319 JADOYK010000008.1 GCA015645265_02179 CDS open 60629-60889 _na     86_aa DUF3387 domain-containing protein
4320 JADOYK010000008.1 GCA015645265_02180 CDS open 60886-61017 _na     43_aa hypothetical protein
4321 JADOYK010000008.1 GCA015645265_02181 CDS open 61181-61402 _na     73_aa hypothetical protein
4322 JADOYK010000008.1 GCA015645265_02182 CDS open 61417-61920 _na     167_aa Ribosomal RNA large subunit methyltransferase e
4323 JADOYK010000008.1 GCA015645265_02183 CDS open 61935-62246 _na     103_aa Pyridoxal phosphate-dependent enzyme
4324 JADOYK010000008.1 GCA015645265_02184 CDS open 62248-62337 _na     29_aa Phage protein
4325 JADOYK010000008.1 GCA015645265_02185 CDS open 62340-62678 _na     112_aa Phage protein
4326 JADOYK010000008.1 GCA015645265_02186 CDS open 62767-64446 _na     559_aa ccrC cassette chromosome recombinase CcrC
4327 JADOYK010000008.1 GCA015645265_02187 CDS open 64671-66287 _na     538_aa DNA primase
4328 JADOYK010000008.1 GCA015645265_02188 CDS open 66287-66655 _na     122_aa Intein C-terminal splicing domain-containing protein
4329 JADOYK010000008.1 GCA015645265_02189 CDS open 66648-67757 _na     369_aa DNA-directed DNA polymerase family A palm domain-containing protein
4330 JADOYK010000008.1 GCA015645265_02190 CDS open 67952-69940 _na     662_aa hypothetical protein
4331 JADOYK010000008.1 GCA015645265_02191 CDS open 70102-71031 _na     309_aa yobV HTH domain-containing protein
4332 JADOYK010000008.1 GCA015645265_02192 CDS open 71112-71540 _na     142_aa phnB PhnB-like domain-containing protein
4333 JADOYK010000008.1 GCA015645265_02193 CDS open 72131-72274 _na     47_aa tnp IS6 family IS431mec transposase
4334 JADOYK010000008.1 GCA015645265_02194 CDS open 72522-74528 _na     668_aa mecA PBP2a family beta-lactam-resistant peptidoglycan transpeptidase MecA
4335 JADOYK010000008.1 GCA015645265_02195 CDS open 74574-75002 _na     142_aa maoC Acyl dehydratase
4336 JADOYK010000008.1 GCA015645265_02196 CDS open 75099-75842 _na     247_aa ugpQ Glycerophosphoryl diester phosphodiesterase
4337 JADOYK010000008.1 GCA015645265_02197 CDS open 76759-76926 _na     55_aa pksG hydroxymethylglutaryl-CoA synthase
4338 JADOYK010000008.1 GCA015645265_02126 gene open 119-637 ribD
4339 JADOYK010000008.1 GCA015645265_02127 gene open 897-1886 sph
4340 JADOYK010000008.1 GCA015645265_02128 gene open 2031-3350 gtfB
4341 JADOYK010000008.1 GCA015645265_02129 gene open 3343-4845 gtfA
4342 JADOYK010000008.1 GCA015645265_02130 gene open 4925-8329
4343 JADOYK010000008.1 GCA015645265_02131 gene open 8830-9864 mcrC
4344 JADOYK010000008.1 GCA015645265_02132 gene open 9864-11561
4345 JADOYK010000008.1 GCA015645265_02133 gene open 11958-15110
4346 JADOYK010000008.1 GCA015645265_02134 gene open 15331-16662 mcrC
4347 JADOYK010000008.1 GCA015645265_02135 gene open 16649-18655 mrcB
4348 JADOYK010000008.1 GCA015645265_02136 gene open 18911-19150
4349 JADOYK010000008.1 GCA015645265_02137 gene open 19780-22899
4350 JADOYK010000008.1 GCA015645265_02138 gene open 22883-24163
4351 JADOYK010000008.1 GCA015645265_02139 gene open 24153-25667 hsdM
4352 JADOYK010000008.1 GCA015645265_02140 gene open 25726-26511 abiH
4353 JADOYK010000008.1 GCA015645265_02141 gene open 26583-27068
4354 JADOYK010000008.1 GCA015645265_02142 gene open 27353-27898
4355 JADOYK010000008.1 GCA015645265_02143 gene open 27916-29976 copB
4356 JADOYK010000008.1 GCA015645265_02144 gene open 30245-30562 arsR
4357 JADOYK010000008.1 GCA015645265_02145 gene open 30562-31851 arsB
4358 JADOYK010000008.1 GCA015645265_02146 gene open 31869-32270 arsC
4359 JADOYK010000008.1 GCA015645265_02147 gene open 32290-32631 arsR
4360 JADOYK010000008.1 GCA015645265_02148 gene open 32650-33267
4361 JADOYK010000008.1 GCA015645265_02149 gene open 33805-34170 doxX
4362 JADOYK010000008.1 GCA015645265_02150 gene open 34179-35183 curA
4363 JADOYK010000008.1 GCA015645265_02151 gene open 35187-35852 wcaG
4364 JADOYK010000008.1 GCA015645265_02152 gene open 35874-36557 yajL
4365 JADOYK010000008.1 GCA015645265_02153 gene open 36635-36982 soxR
4366 JADOYK010000008.1 GCA015645265_02154 gene open 37478-37642
4367 JADOYK010000008.1 GCA015645265_02155 gene open 37831-38820
4368 JADOYK010000008.1 GCA015645265_02156 gene open 39003-39152
4369 JADOYK010000008.1 GCA015645265_02157 gene open 39152-40942 cch1
4370 JADOYK010000008.1 GCA015645265_02158 gene open 41007-41264
4371 JADOYK010000008.1 GCA015645265_02159 gene open 41442-42791 ccrA
4372 JADOYK010000008.1 GCA015645265_02160 gene open 42812-44440 ccrB
4373 JADOYK010000008.1 GCA015645265_02162 gene open 44906-45256
4374 JADOYK010000008.1 GCA015645265_02163 gene open 45243-45341
4375 JADOYK010000008.1 GCA015645265_02164 gene open 45343-45654
4376 JADOYK010000008.1 GCA015645265_02165 gene open 45670-46179
4377 JADOYK010000008.1 GCA015645265_02166 gene open 46193-46414
4378 JADOYK010000008.1 GCA015645265_02167 gene open 46784-47443
4379 JADOYK010000008.1 GCA015645265_02168 gene open 47453-48100 tetR
4380 JADOYK010000008.1 GCA015645265_02169 gene open 48105-48740
4381 JADOYK010000008.1 GCA015645265_02170 gene open 50755-51489 cas6
4382 JADOYK010000008.1 GCA015645265_02171 gene open 51486-52754 csm6
4383 JADOYK010000008.1 GCA015645265_02172 gene open 52754-53776 csm5
4384 JADOYK010000008.1 GCA015645265_02173 gene open 53779-54687 csm4
4385 JADOYK010000008.1 GCA015645265_02174 gene open 54698-55342 csm3
4386 JADOYK010000008.1 GCA015645265_02175 gene open 55344-55769
4387 JADOYK010000008.1 GCA015645265_02176 gene open 55772-58045 cas10
4388 JADOYK010000008.1 GCA015645265_02177 gene open 58059-58364 cas2
4389 JADOYK010000008.1 GCA015645265_02178 gene open 58364-59269 cas1
4390 JADOYK010000008.1 GCA015645265_02179 gene open 60629-60889
4391 JADOYK010000008.1 GCA015645265_02180 gene open 60886-61017
4392 JADOYK010000008.1 GCA015645265_02181 gene open 61181-61402
4393 JADOYK010000008.1 GCA015645265_02182 gene open 61417-61920
4394 JADOYK010000008.1 GCA015645265_02183 gene open 61935-62246
4395 JADOYK010000008.1 GCA015645265_02184 gene open 62248-62337
4396 JADOYK010000008.1 GCA015645265_02185 gene open 62340-62678
4397 JADOYK010000008.1 GCA015645265_02186 gene open 62767-64446 ccrC
4398 JADOYK010000008.1 GCA015645265_02187 gene open 64671-66287
4399 JADOYK010000008.1 GCA015645265_02188 gene open 66287-66655
4400 JADOYK010000008.1 GCA015645265_02189 gene open 66648-67757
4401 JADOYK010000008.1 GCA015645265_02190 gene open 67952-69940
4402 JADOYK010000008.1 GCA015645265_02191 gene open 70102-71031 yobV
4403 JADOYK010000008.1 GCA015645265_02192 gene open 71112-71540 phnB
4404 JADOYK010000008.1 GCA015645265_02193 gene open 72131-72274 tnp
4405 JADOYK010000008.1 GCA015645265_02194 gene open 72522-74528 mecA
4406 JADOYK010000008.1 GCA015645265_02195 gene open 74574-75002 maoC
4407 JADOYK010000008.1 GCA015645265_02196 gene open 75099-75842 ugpQ
4408 JADOYK010000008.1 GCA015645265_02197 gene open 76759-76926 pksG
4409 JADOYK010000009.1 GCA015645265_02213 gene open 8912-9014 sRNA71
4410 JADOYK010000009.1 GCA015645265_02271 gene open 67188-67457 Bacteria_large_SRP
4411 JADOYK010000009.1 GCA015645265_02272 gene open 67306-67405 Bacteria_small_SRP
4412 JADOYK010000009.1 GCA015645265_02213 ncRNA open 8912-9014 Staphylococcus sRNA71 small RNA
4413 JADOYK010000009.1 GCA015645265_02271 ncRNA open 67188-67457 Bacterial large signal recognition particle RNA
4414 JADOYK010000009.1 GCA015645265_02272 ncRNA open 67306-67405 Bacterial small signal recognition particle RNA
4415 JADOYK010000009.1 regulatory_region open 20438-20540 Purine riboswitch aptamer
4416 JADOYK010000009.1 GCA015645265_02198 CDS open 131-514 _na     127_aa mutT Putative mutator protein mutT
4417 JADOYK010000009.1 GCA015645265_02199 CDS open 514-1404 _na     296_aa DMT family transporter
4418 JADOYK010000009.1 GCA015645265_02200 CDS open 1407-1817 _na     136_aa NTP pyrophosphohydrolases containing a Zn-finger%2C probably nucleic-acid-binding
4419 JADOYK010000009.1 GCA015645265_02201 CDS open 1821-2567 _na     248_aa HAD-superfamily hydrolase
4420 JADOYK010000009.1 GCA015645265_02202 CDS open 2980-3276 _na     98_aa rpsF 30S ribosomal protein S6
4421 JADOYK010000009.1 GCA015645265_02203 CDS open 3298-3807 _na     169_aa ssb Single-stranded DNA-binding protein 1
4422 JADOYK010000009.1 GCA015645265_02204 CDS open 3854-4096 _na     80_aa rpsR 30S ribosomal protein S18
4423 JADOYK010000009.1 GCA015645265_02205 CDS open 4425-4679 _na     84_aa hypothetical protein
4424 JADOYK010000009.1 GCA015645265_02206 CDS open 4807-5379 _na     190_aa DUF5067 domain-containing protein
4425 JADOYK010000009.1 GCA015645265_02207 CDS open 5463-5816 _na     117_aa DUF4870 domain-containing protein
4426 JADOYK010000009.1 GCA015645265_02208 CDS open 5887-6144 _na     85_aa HTH cro/C1-type domain-containing protein
4427 JADOYK010000009.1 GCA015645265_02209 CDS open 6301-7050 _na     249_aa 2-pyrone-4%2C6-dicarboxylic acid hydrolase
4428 JADOYK010000009.1 GCA015645265_02210 CDS open 7054-7314 _na     86_aa DUF3955 domain-containing protein
4429 JADOYK010000009.1 GCA015645265_02211 CDS open 7616-7870 _na     84_aa Transglycosylase
4430 JADOYK010000009.1 GCA015645265_02212 CDS open 8033-8887 _na     284_aa Patatin-like phospholipase family protein
4431 JADOYK010000009.1 GCA015645265_02214 CDS open 9228-9860 _na     210_aa lysE Amino acid transporter LysE
4432 JADOYK010000009.1 GCA015645265_02215 CDS open 9888-10466 _na     192_aa phosphoglycerate mutase (2%2C3-diphosphoglycerate-dependent)
4433 JADOYK010000009.1 GCA015645265_02216 CDS open 10574-10951 _na     125_aa Phage holin family protein
4434 JADOYK010000009.1 GCA015645265_02217 CDS open 11110-11736 _na     208_aa NDxxF motif lipoprotein
4435 JADOYK010000009.1 GCA015645265_02218 CDS open 12057-13580 _na     507_aa ahpF alkyl hydroperoxide reductase subunit F
4436 JADOYK010000009.1 GCA015645265_02219 CDS open 13595-14164 _na     189_aa ahpC alkyl hydroperoxide reductase subunit C
4437 JADOYK010000009.1 GCA015645265_02220 CDS open 14611-15390 _na     259_aa 2-oxo-hepta-3-ene-1%2C7-dioate hydratase
4438 JADOYK010000009.1 GCA015645265_02221 CDS open 15520-16305 _na     261_aa NADPH-dependent oxidoreductase
4439 JADOYK010000009.1 GCA015645265_02222 CDS open 16364-17752 _na     462_aa tcyP L-cystine uptake protein TcyP
4440 JADOYK010000009.1 GCA015645265_02223 CDS open 18014-18868 _na     284_aa DNA-binding protein
4441 JADOYK010000009.1 GCA015645265_02224 CDS open 18985-19653 _na     222_aa N-acetyltransferase domain-containing protein
4442 JADOYK010000009.1 GCA015645265_02225 CDS open 19814-20221 _na     135_aa General stress protein
4443 JADOYK010000009.1 GCA015645265_02226 CDS open 20829-21407 _na     192_aa xpt xanthine phosphoribosyltransferase
4444 JADOYK010000009.1 GCA015645265_02227 CDS open 21407-22675 _na     422_aa uraA Xanthine permease
4445 JADOYK010000009.1 GCA015645265_02228 CDS open 22714-24180 _na     488_aa guaB IMP dehydrogenase
4446 JADOYK010000009.1 GCA015645265_02229 CDS open 24359-25900 _na     513_aa guaA glutamine-hydrolyzing GMP synthase
4447 JADOYK010000009.1 GCA015645265_02230 CDS open 26064-26252 _na     62_aa DUF3397 domain-containing protein
4448 JADOYK010000009.1 GCA015645265_02231 CDS open 26339-26956 _na     205_aa hypothetical protein
4449 JADOYK010000009.1 GCA015645265_02232 CDS open 27218-27400 _na     60_aa hypothetical protein
4450 JADOYK010000009.1 GCA015645265_02233 CDS open 28155-28394 _na     79_aa Ferredoxin
4451 JADOYK010000009.1 GCA015645265_02234 CDS open 28400-30112 _na     570_aa hypothetical protein
4452 JADOYK010000009.1 GCA015645265_02235 CDS open 30116-31363 _na     415_aa ATP-grasp domain-containing protein
4453 JADOYK010000009.1 GCA015645265_02236 CDS open 31360-32571 _na     403_aa ATP-grasp domain-containing protein
4454 JADOYK010000009.1 GCA015645265_02237 CDS open 32588-33763 _na     391_aa lmrP Integral membrane protein LmrP
4455 JADOYK010000009.1 GCA015645265_02238 CDS open 33938-34027 _na     29_aa hypothetical protein
4456 JADOYK010000009.1 GCA015645265_02239 CDS open 34174-34557 _na     127_aa Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily
4457 JADOYK010000009.1 GCA015645265_02240 CDS open 34729-35931 _na     400_aa Cobalamin synthesis protein
4458 JADOYK010000009.1 GCA015645265_02241 CDS open 36087-36965 _na     292_aa Serine protease
4459 JADOYK010000009.1 GCA015645265_02242 CDS open 37005-37268 _na     87_aa hypothetical protein
4460 JADOYK010000009.1 GCA015645265_02245 CDS open 38374-39873 _na     499_aa NADH dehydrogenase subunit 5
4461 JADOYK010000009.1 GCA015645265_02246 CDS open 39891-42461 _na     856_aa dabA putative inorganic carbon transporter subunit DabA
4462 JADOYK010000009.1 GCA015645265_02247 CDS open 42568-42936 _na     122_aa mpsC Na+-translocating membrane putative-generating system MpsC domain-containing protein
4463 JADOYK010000009.1 GCA015645265_02248 CDS open 42978-43226 _na     82_aa hypothetical protein
4464 JADOYK010000009.1 GCA015645265_02249 CDS open 43438-44121 _na     227_aa N-acetyltransferase
4465 JADOYK010000009.1 GCA015645265_02250 CDS open 44191-44868 _na     225_aa PAP2 family phosphatase/haloperoxidase
4466 JADOYK010000009.1 GCA015645265_02251 CDS open 44893-45744 _na     283_aa Putative esterase of the alpha-beta hydrolase superfamily
4467 JADOYK010000009.1 GCA015645265_02252 CDS open 45878-46612 _na     244_aa Carboxylesterase
4468 JADOYK010000009.1 GCA015645265_02253 CDS open 46646-46894 _na     82_aa Phage protein
4469 JADOYK010000009.1 GCA015645265_02254 CDS open 47025-48353 _na     442_aa Transporter
4470 JADOYK010000009.1 GCA015645265_02255 CDS open 48403-48951 _na     182_aa Phage protein
4471 JADOYK010000009.1 GCA015645265_02256 CDS open 49030-49569 _na     179_aa Pentapeptide repeat-containing protein
4472 JADOYK010000009.1 GCA015645265_02257 CDS open 49905-50813 _na     302_aa Cysteine synthase
4473 JADOYK010000009.1 GCA015645265_02258 CDS open 50806-51951 _na     381_aa metC bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase
4474 JADOYK010000009.1 GCA015645265_02259 CDS open 52050-52814 _na     254_aa Alpha/beta fold hydrolase
4475 JADOYK010000009.1 GCA015645265_02260 CDS open 53500-54510 _na     336_aa SAG1386/EF1546 family surface-associated protein
4476 JADOYK010000009.1 GCA015645265_02261 CDS open 54585-56087 _na     500_aa Poly (Glycerol-phosphate) alpha-glucosyltransferase
4477 JADOYK010000009.1 GCA015645265_02262 CDS open 56270-56623 _na     117_aa hypothetical protein
4478 JADOYK010000009.1 GCA015645265_02263 CDS open 56723-57118 _na     131_aa NUDIX domain-containing protein
4479 JADOYK010000009.1 GCA015645265_02264 CDS open 57128-57592 _na     154_aa Acetyltransferase
4480 JADOYK010000009.1 GCA015645265_02265 CDS open 57649-58440 _na     263_aa YibE/F-like protein
4481 JADOYK010000009.1 GCA015645265_02266 CDS open 58437-59549 _na     370_aa YibE/F-like protein
4482 JADOYK010000009.1 GCA015645265_02267 CDS open 59700-60581 _na     293_aa gltC glutamate biosynthesis transcriptional regulator GltC
4483 JADOYK010000009.1 GCA015645265_02268 CDS open 60782-65278 _na     1498_aa gltB glutamate synthase large subunit
4484 JADOYK010000009.1 GCA015645265_02269 CDS open 65296-66759 _na     487_aa Glutamate synthase subunit beta
4485 JADOYK010000009.1 GCA015645265_02273 CDS open 67825-68355 _na     176_aa N-acetyltransferase
4486 JADOYK010000009.1 GCA015645265_02274 CDS open 68424-70130 _na     568_aa dnaX DNA polymerase III subunit gamma/tau
4487 JADOYK010000009.1 GCA015645265_02275 CDS open 70219-70536 _na     105_aa ybaB YbaB/EbfC family nucleoid-associated protein
4488 JADOYK010000009.1 GCA015645265_02276 CDS open 70543-71139 _na     198_aa recR recombination mediator RecR
4489 JADOYK010000009.1 GCA015645265_02198 gene open 131-514 mutT
4490 JADOYK010000009.1 GCA015645265_02199 gene open 514-1404
4491 JADOYK010000009.1 GCA015645265_02200 gene open 1407-1817
4492 JADOYK010000009.1 GCA015645265_02201 gene open 1821-2567
4493 JADOYK010000009.1 GCA015645265_02202 gene open 2980-3276 rpsF
4494 JADOYK010000009.1 GCA015645265_02203 gene open 3298-3807 ssb
4495 JADOYK010000009.1 GCA015645265_02204 gene open 3854-4096 rpsR
4496 JADOYK010000009.1 GCA015645265_02205 gene open 4425-4679
4497 JADOYK010000009.1 GCA015645265_02206 gene open 4807-5379
4498 JADOYK010000009.1 GCA015645265_02207 gene open 5463-5816
4499 JADOYK010000009.1 GCA015645265_02208 gene open 5887-6144
4500 JADOYK010000009.1 GCA015645265_02209 gene open 6301-7050