HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Schaalia cardiffensis (GCA_016405145.1)

Select a Genome:
BAKTA Annotations for GCA_016405145.1
Genome Selected: Schaalia cardiffensis
ContigsBases CDSrRNA tmRNAtRNA
34 2240847 1854 6 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3838 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 3838 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 JAEKIA010000016.1 GCA016405145_00631 CDS open 18654-21482 _na     942_aa DUF1156 domain-containing protein
3502 JAEKIA010000016.1 GCA016405145_00632 CDS open 21486-24869 _na     1127_aa DUF499 domain-containing protein
3503 JAEKIA010000016.1 GCA016405145_00633 CDS open 24873-26390 _na     505_aa ATP-binding protein
3504 JAEKIA010000016.1 GCA016405145_00634 CDS open 26383-27363 _na     326_aa PD-(D/E)XK motif protein
3505 JAEKIA010000016.1 GCA016405145_00635 CDS open 27360-30356 _na     998_aa Z1 domain-containing protein
3506 JAEKIA010000016.1 GCA016405145_00636 CDS open 30346-30777 _na     143_aa very short patch repair endonuclease
3507 JAEKIA010000016.1 GCA016405145_00637 CDS open 31346-31729 _na     127_aa hypothetical protein
3508 JAEKIA010000016.1 GCA016405145_00638 CDS open 31745-31957 _na     70_aa hypothetical protein
3509 JAEKIA010000016.1 GCA016405145_00639 CDS open 32516-34270 _na     584_aa leuA 2-isopropylmalate synthase
3510 JAEKIA010000016.1 GCA016405145_00640 CDS open 34522-35259 _na     245_aa recO DNA repair protein RecO
3511 JAEKIA010000016.1 GCA016405145_00641 CDS open 35259-36080 _na     273_aa isoprenyl transferase
3512 JAEKIA010000016.1 GCA016405145_00642 CDS open 36321-36635 _na     104_aa Methyl accepting chemotaxis protein
3513 JAEKIA010000016.1 GCA016405145_00643 CDS open 36632-37618 _na     328_aa WXG100 family type VII secretion target
3514 JAEKIA010000016.1 GCA016405145_00644 CDS open 37630-38229 _na     199_aa Photosystem I reaction center subunit X
3515 JAEKIA010000016.1 GCA016405145_00645 CDS open 38254-38580 _na     108_aa DUF4176 domain-containing protein
3516 JAEKIA010000016.1 GCA016405145_00646 CDS open 38797-39315 _na     172_aa dedA Membrane protein DedA with SNARE-associated domain
3517 JAEKIA010000016.1 GCA016405145_00647 CDS open 39312-39755 _na     147_aa Ferric uptake regulation protein
3518 JAEKIA010000016.1 GCA016405145_00648 CDS open 39752-40693 _na     313_aa Zinc/manganese ABC superfamily ATP binding cassette transporter permease
3519 JAEKIA010000016.1 GCA016405145_00617 gene open 158-316
3520 JAEKIA010000016.1 GCA016405145_00618 gene open 364-2043 argS
3521 JAEKIA010000016.1 GCA016405145_00619 gene open 2046-3473 lysA
3522 JAEKIA010000016.1 GCA016405145_00620 gene open 3842-4654
3523 JAEKIA010000016.1 GCA016405145_00621 gene open 5178-7901 hrpB
3524 JAEKIA010000016.1 GCA016405145_00622 gene open 8154-8900
3525 JAEKIA010000016.1 GCA016405145_00623 gene open 8897-9652
3526 JAEKIA010000016.1 GCA016405145_00624 gene open 9649-10242 tetR
3527 JAEKIA010000016.1 GCA016405145_00625 gene open 10548-11597
3528 JAEKIA010000016.1 GCA016405145_00626 gene open 11594-12043 ybeY
3529 JAEKIA010000016.1 GCA016405145_00627 gene open 12040-13359
3530 JAEKIA010000016.1 GCA016405145_00628 gene open 13364-14653 era
3531 JAEKIA010000016.1 GCA016405145_00629 gene open 16518-17363
3532 JAEKIA010000016.1 GCA016405145_00630 gene open 17377-18477
3533 JAEKIA010000016.1 GCA016405145_00631 gene open 18654-21482
3534 JAEKIA010000016.1 GCA016405145_00632 gene open 21486-24869
3535 JAEKIA010000016.1 GCA016405145_00633 gene open 24873-26390
3536 JAEKIA010000016.1 GCA016405145_00634 gene open 26383-27363
3537 JAEKIA010000016.1 GCA016405145_00635 gene open 27360-30356
3538 JAEKIA010000016.1 GCA016405145_00636 gene open 30346-30777
3539 JAEKIA010000016.1 GCA016405145_00637 gene open 31346-31729
3540 JAEKIA010000016.1 GCA016405145_00638 gene open 31745-31957
3541 JAEKIA010000016.1 GCA016405145_00639 gene open 32516-34270 leuA
3542 JAEKIA010000016.1 GCA016405145_00640 gene open 34522-35259 recO
3543 JAEKIA010000016.1 GCA016405145_00641 gene open 35259-36080
3544 JAEKIA010000016.1 GCA016405145_00642 gene open 36321-36635
3545 JAEKIA010000016.1 GCA016405145_00643 gene open 36632-37618
3546 JAEKIA010000016.1 GCA016405145_00644 gene open 37630-38229
3547 JAEKIA010000016.1 GCA016405145_00645 gene open 38254-38580
3548 JAEKIA010000016.1 GCA016405145_00646 gene open 38797-39315 dedA
3549 JAEKIA010000016.1 GCA016405145_00647 gene open 39312-39755
3550 JAEKIA010000016.1 GCA016405145_00648 gene open 39752-40693
3551 JAEKIA010000017.1 GCA016405145_00649 CDS open 585-1187 _na     200_aa satD SatD family protein
3552 JAEKIA010000017.1 GCA016405145_00650 CDS open 1184-1606 _na     140_aa DUF2975 domain-containing protein
3553 JAEKIA010000017.1 GCA016405145_00651 CDS open 1670-2947 _na     425_aa AAA family ATPase
3554 JAEKIA010000017.1 GCA016405145_00652 CDS open 3128-4084 _na     318_aa Inosine-uridine preferring nucleoside hydrolase
3555 JAEKIA010000017.1 GCA016405145_00653 CDS open 4237-4788 _na     183_aa site-specific DNA-methyltransferase (adenine-specific)
3556 JAEKIA010000017.1 GCA016405145_00654 CDS open 4833-5702 _na     289_aa hypothetical protein
3557 JAEKIA010000017.1 GCA016405145_00655 CDS open 6599-7063 _na     154_aa hypothetical protein
3558 JAEKIA010000017.1 GCA016405145_00656 CDS open 7136-7348 _na     70_aa hypothetical protein
3559 JAEKIA010000017.1 GCA016405145_00657 CDS open 7487-8341 _na     284_aa DUF4062 domain-containing protein
3560 JAEKIA010000017.1 GCA016405145_00658 CDS open 8625-8876 _na     83_aa hypothetical protein
3561 JAEKIA010000017.1 GCA016405145_00659 CDS open 8873-9166 _na     97_aa hypothetical protein
3562 JAEKIA010000017.1 GCA016405145_00660 CDS open 9230-9502 _na     90_aa Integrase core domain-containing protein
3563 JAEKIA010000017.1 GCA016405145_00661 CDS open 9784-11532 _na     582_aa anchored repeat ABC transporter%2C substrate-binding protein
3564 JAEKIA010000017.1 GCA016405145_00662 CDS open 11567-12559 _na     330_aa Surface-anchored protein
3565 JAEKIA010000017.1 GCA016405145_00663 CDS open 12556-13602 _na     348_aa anchored repeat-type ABC transporter ATP-binding subunit
3566 JAEKIA010000017.1 GCA016405145_00664 CDS open 13599-14456 _na     285_aa anchored repeat-type ABC transporter permease subunit
3567 JAEKIA010000017.1 GCA016405145_00665 CDS open 14761-16167 _na     468_aa fumC class II fumarate hydratase
3568 JAEKIA010000017.1 GCA016405145_00666 CDS open 16268-17656 _na     462_aa Major facilitator superfamily (MFS) profile domain-containing protein
3569 JAEKIA010000017.1 GCA016405145_00667 CDS open 17778-18332 _na     184_aa MmcQ/YjbR family DNA-binding protein
3570 JAEKIA010000017.1 GCA016405145_00668 CDS open 18341-18871 _na     176_aa dihydrofolate reductase
3571 JAEKIA010000017.1 GCA016405145_00669 CDS open 18868-19665 _na     265_aa thymidylate synthase
3572 JAEKIA010000017.1 GCA016405145_00670 CDS open 19803-20558 _na     251_aa VPDSG-CTERM exosortase interaction domain protein
3573 JAEKIA010000017.1 GCA016405145_00671 CDS open 20560-21006 _na     148_aa osmC OsmC family protein
3574 JAEKIA010000017.1 GCA016405145_00672 CDS open 21232-21705 _na     157_aa DUF2505 domain-containing protein
3575 JAEKIA010000017.1 GCA016405145_00673 CDS open 21794-23254 _na     486_aa histidine kinase
3576 JAEKIA010000017.1 GCA016405145_00674 CDS open 23474-23722 _na     82_aa whiB Transcriptional regulator WhiB
3577 JAEKIA010000017.1 GCA016405145_00675 CDS open 23857-27360 _na     1167_aa FtsK/SpoIIIE family protein
3578 JAEKIA010000017.1 GCA016405145_00676 CDS open 27600-29960 _na     786_aa ligA NAD-dependent DNA ligase LigA
3579 JAEKIA010000017.1 GCA016405145_00677 CDS open 30064-31413 _na     449_aa Cardiolipin synthetase
3580 JAEKIA010000017.1 GCA016405145_00678 CDS open 31431-31727 _na     98_aa gatC Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
3581 JAEKIA010000017.1 GCA016405145_00679 CDS open 31727-33232 _na     501_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
3582 JAEKIA010000017.1 GCA016405145_00680 CDS open 33232-34728 _na     498_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
3583 JAEKIA010000017.1 GCA016405145_00681 CDS open 35126-36577 _na     483_aa NADP-dependent malate dehydrogenase (Oxaloacetate-decarboxylating)
3584 JAEKIA010000017.1 GCA016405145_00649 gene open 585-1187 satD
3585 JAEKIA010000017.1 GCA016405145_00650 gene open 1184-1606
3586 JAEKIA010000017.1 GCA016405145_00651 gene open 1670-2947
3587 JAEKIA010000017.1 GCA016405145_00652 gene open 3128-4084
3588 JAEKIA010000017.1 GCA016405145_00653 gene open 4237-4788
3589 JAEKIA010000017.1 GCA016405145_00654 gene open 4833-5702
3590 JAEKIA010000017.1 GCA016405145_00655 gene open 6599-7063
3591 JAEKIA010000017.1 GCA016405145_00656 gene open 7136-7348
3592 JAEKIA010000017.1 GCA016405145_00657 gene open 7487-8341
3593 JAEKIA010000017.1 GCA016405145_00658 gene open 8625-8876
3594 JAEKIA010000017.1 GCA016405145_00659 gene open 8873-9166
3595 JAEKIA010000017.1 GCA016405145_00660 gene open 9230-9502
3596 JAEKIA010000017.1 GCA016405145_00661 gene open 9784-11532
3597 JAEKIA010000017.1 GCA016405145_00662 gene open 11567-12559
3598 JAEKIA010000017.1 GCA016405145_00663 gene open 12556-13602
3599 JAEKIA010000017.1 GCA016405145_00664 gene open 13599-14456
3600 JAEKIA010000017.1 GCA016405145_00665 gene open 14761-16167 fumC
3601 JAEKIA010000017.1 GCA016405145_00666 gene open 16268-17656
3602 JAEKIA010000017.1 GCA016405145_00667 gene open 17778-18332
3603 JAEKIA010000017.1 GCA016405145_00668 gene open 18341-18871
3604 JAEKIA010000017.1 GCA016405145_00669 gene open 18868-19665
3605 JAEKIA010000017.1 GCA016405145_00670 gene open 19803-20558
3606 JAEKIA010000017.1 GCA016405145_00671 gene open 20560-21006 osmC
3607 JAEKIA010000017.1 GCA016405145_00672 gene open 21232-21705
3608 JAEKIA010000017.1 GCA016405145_00673 gene open 21794-23254
3609 JAEKIA010000017.1 GCA016405145_00674 gene open 23474-23722 whiB
3610 JAEKIA010000017.1 GCA016405145_00675 gene open 23857-27360
3611 JAEKIA010000017.1 GCA016405145_00676 gene open 27600-29960 ligA
3612 JAEKIA010000017.1 GCA016405145_00677 gene open 30064-31413
3613 JAEKIA010000017.1 GCA016405145_00678 gene open 31431-31727 gatC
3614 JAEKIA010000017.1 GCA016405145_00679 gene open 31727-33232 gatA
3615 JAEKIA010000017.1 GCA016405145_00680 gene open 33232-34728 gatB
3616 JAEKIA010000017.1 GCA016405145_00681 gene open 35126-36577
3617 JAEKIA010000018.1 GCA016405145_00682 CDS open 975-1160 _na     61_aa Transposase
3618 JAEKIA010000018.1 GCA016405145_00683 CDS open 1319-3001 _na     560_aa CoA-disulfide reductase
3619 JAEKIA010000018.1 GCA016405145_00684 CDS open 3094-3384 _na     96_aa csoR Copper-sensing transcriptional repressor CsoR
3620 JAEKIA010000018.1 GCA016405145_00685 CDS open 3518-4960 _na     480_aa AGCS family alanine or glycine:sodium (Na+) or proton (H+) symporter
3621 JAEKIA010000018.1 GCA016405145_00686 CDS open 5284-8700 _na     1138_aa Surface-anchored protein
3622 JAEKIA010000018.1 GCA016405145_00687 CDS open 8796-9155 _na     119_aa DUF86 domain-containing protein
3623 JAEKIA010000018.1 GCA016405145_00688 CDS open 9152-9472 _na     106_aa Polymerase nucleotidyl transferase domain-containing protein
3624 JAEKIA010000018.1 GCA016405145_00689 CDS open 9700-11304 _na     534_aa Alcohol dehydrogenase-like N-terminal domain-containing protein
3625 JAEKIA010000018.1 GCA016405145_00690 CDS open 11465-12484 _na     339_aa Sorbitol-6-phosphate dehydrogenase
3626 JAEKIA010000018.1 GCA016405145_00691 CDS open 12531-13832 _na     433_aa PHP domain protein
3627 JAEKIA010000018.1 GCA016405145_00692 CDS open 14055-16505 _na     816_aa dihydrolipoyllysine-residue succinyltransferase
3628 JAEKIA010000018.1 GCA016405145_00693 CDS open 16540-17907 _na     455_aa lpdA dihydrolipoyl dehydrogenase
3629 JAEKIA010000018.1 GCA016405145_00694 CDS open 17935-19269 _na     444_aa Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex
3630 JAEKIA010000018.1 GCA016405145_00695 CDS open 19280-20026 _na     248_aa deoR DeoR family transcriptional regulator
3631 JAEKIA010000018.1 GCA016405145_00696 CDS open 20318-20749 _na     143_aa L-fucose mutarotase
3632 JAEKIA010000018.1 GCA016405145_00697 CDS open 20799-21794 _na     331_aa lacI LacI family transcriptional regulator
3633 JAEKIA010000018.1 GCA016405145_00698 CDS open 21769-23316 _na     515_aa Rhamnulokinase
3634 JAEKIA010000018.1 GCA016405145_00699 CDS open 23408-25168 _na     586_aa L-fucose isomerase
3635 JAEKIA010000018.1 GCA016405145_00700 CDS open 25280-26317 _na     345_aa Ribose ABC superfamily ATP binding cassette transporter%2C binding protein
3636 JAEKIA010000018.1 GCA016405145_00701 CDS open 26427-27443 _na     338_aa rbsC Ribose transport system permease rbsC
3637 JAEKIA010000018.1 GCA016405145_00702 CDS open 27440-28960 _na     506_aa sugar ABC transporter ATP-binding protein
3638 JAEKIA010000018.1 GCA016405145_00703 CDS open 29688-29906 _na     72_aa hypothetical protein
3639 JAEKIA010000018.1 GCA016405145_00682 gene open 975-1160
3640 JAEKIA010000018.1 GCA016405145_00683 gene open 1319-3001
3641 JAEKIA010000018.1 GCA016405145_00684 gene open 3094-3384 csoR
3642 JAEKIA010000018.1 GCA016405145_00685 gene open 3518-4960
3643 JAEKIA010000018.1 GCA016405145_00686 gene open 5284-8700
3644 JAEKIA010000018.1 GCA016405145_00687 gene open 8796-9155
3645 JAEKIA010000018.1 GCA016405145_00688 gene open 9152-9472
3646 JAEKIA010000018.1 GCA016405145_00689 gene open 9700-11304
3647 JAEKIA010000018.1 GCA016405145_00690 gene open 11465-12484
3648 JAEKIA010000018.1 GCA016405145_00691 gene open 12531-13832
3649 JAEKIA010000018.1 GCA016405145_00692 gene open 14055-16505
3650 JAEKIA010000018.1 GCA016405145_00693 gene open 16540-17907 lpdA
3651 JAEKIA010000018.1 GCA016405145_00694 gene open 17935-19269
3652 JAEKIA010000018.1 GCA016405145_00695 gene open 19280-20026 deoR
3653 JAEKIA010000018.1 GCA016405145_00696 gene open 20318-20749
3654 JAEKIA010000018.1 GCA016405145_00697 gene open 20799-21794 lacI
3655 JAEKIA010000018.1 GCA016405145_00698 gene open 21769-23316
3656 JAEKIA010000018.1 GCA016405145_00699 gene open 23408-25168
3657 JAEKIA010000018.1 GCA016405145_00700 gene open 25280-26317
3658 JAEKIA010000018.1 GCA016405145_00701 gene open 26427-27443 rbsC
3659 JAEKIA010000018.1 GCA016405145_00702 gene open 27440-28960
3660 JAEKIA010000018.1 GCA016405145_00703 gene open 29688-29906
3661 JAEKIA010000019.1 GCA016405145_00704 CDS open 345-1460 _na     371_aa IS1249 family transposase
3662 JAEKIA010000019.1 GCA016405145_00705 CDS open 1803-2048 _na     81_aa hypothetical protein
3663 JAEKIA010000019.1 GCA016405145_00706 CDS open 2465-3061 _na     198_aa recR recombination mediator RecR
3664 JAEKIA010000019.1 GCA016405145_00707 CDS open 3065-6667 _na     1200_aa DNA polymerase III subunit gamma and tau
3665 JAEKIA010000019.1 GCA016405145_00708 CDS open 7143-7943 _na     266_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
3666 JAEKIA010000019.1 GCA016405145_00709 CDS open 7943-8704 _na     253_aa ABC transporter permease
3667 JAEKIA010000019.1 GCA016405145_00710 CDS open 9283-10275 _na     330_aa ABC superfamily ATP binding cassette transporter
3668 JAEKIA010000019.1 GCA016405145_00711 CDS open 10482-11951 _na     489_aa aspartate kinase
3669 JAEKIA010000019.1 GCA016405145_00712 CDS open 12149-13198 _na     349_aa aspartate-semialdehyde dehydrogenase
3670 JAEKIA010000019.1 GCA016405145_00713 CDS open 13223-14515 _na     430_aa Iron (Fe3+) ABC superfamily ATP binding cassette transporter%2C ABC protein
3671 JAEKIA010000019.1 GCA016405145_00714 CDS open 14508-14756 _na     82_aa hypothetical protein
3672 JAEKIA010000019.1 GCA016405145_00715 CDS open 14753-15685 _na     310_aa hypothetical protein
3673 JAEKIA010000019.1 GCA016405145_00716 CDS open 15630-16499 _na     289_aa extracellular solute-binding protein
3674 JAEKIA010000019.1 GCA016405145_00717 CDS open 16569-17009 _na     146_aa hypothetical protein
3675 JAEKIA010000019.1 GCA016405145_00718 CDS open 17161-18558 _na     465_aa MFS transporter
3676 JAEKIA010000019.1 GCA016405145_00719 CDS open 18700-19413 _na     237_aa phoB Phosphate regulon transcriptional regulator PhoB
3677 JAEKIA010000019.1 GCA016405145_00720 CDS open 19410-19844 _na     144_aa kdpD sensor histidine kinase KdpD
3678 JAEKIA010000019.1 GCA016405145_00721 CDS open 19935-20195 _na     86_aa hypothetical protein
3679 JAEKIA010000019.1 GCA016405145_00722 CDS open 20353-20715 _na     120_aa trxA thioredoxin
3680 JAEKIA010000019.1 GCA016405145_00723 CDS open 21112-21804 _na     230_aa tetR TetR family transcriptional regulator
3681 JAEKIA010000019.1 GCA016405145_00724 CDS open 21998-22435 _na     145_aa 8-oxo-dGTP diphosphatase
3682 JAEKIA010000019.1 GCA016405145_00704 gene open 345-1460
3683 JAEKIA010000019.1 GCA016405145_00705 gene open 1803-2048
3684 JAEKIA010000019.1 GCA016405145_00706 gene open 2465-3061 recR
3685 JAEKIA010000019.1 GCA016405145_00707 gene open 3065-6667
3686 JAEKIA010000019.1 GCA016405145_00708 gene open 7143-7943
3687 JAEKIA010000019.1 GCA016405145_00709 gene open 7943-8704
3688 JAEKIA010000019.1 GCA016405145_00710 gene open 9283-10275
3689 JAEKIA010000019.1 GCA016405145_00711 gene open 10482-11951
3690 JAEKIA010000019.1 GCA016405145_00712 gene open 12149-13198
3691 JAEKIA010000019.1 GCA016405145_00713 gene open 13223-14515
3692 JAEKIA010000019.1 GCA016405145_00714 gene open 14508-14756
3693 JAEKIA010000019.1 GCA016405145_00715 gene open 14753-15685
3694 JAEKIA010000019.1 GCA016405145_00716 gene open 15630-16499
3695 JAEKIA010000019.1 GCA016405145_00717 gene open 16569-17009
3696 JAEKIA010000019.1 GCA016405145_00718 gene open 17161-18558
3697 JAEKIA010000019.1 GCA016405145_00719 gene open 18700-19413 phoB
3698 JAEKIA010000019.1 GCA016405145_00720 gene open 19410-19844 kdpD
3699 JAEKIA010000019.1 GCA016405145_00721 gene open 19935-20195
3700 JAEKIA010000019.1 GCA016405145_00722 gene open 20353-20715 trxA
3701 JAEKIA010000019.1 GCA016405145_00723 gene open 21112-21804 tetR
3702 JAEKIA010000019.1 GCA016405145_00724 gene open 21998-22435
3703 JAEKIA010000019.1 GCA016405145_00725 gene open 22906-22976 trnG
3704 JAEKIA010000019.1 GCA016405145_00725 tRNA open 22906-22976 trnG tRNA-Gly(ccc)
3705 JAEKIA010000020.1 GCA016405145_00938 gene open 1-86 rrf
3706 JAEKIA010000020.1 GCA016405145_00938 rRNA open 1-86 rrf 5S ribosomal RNA
3707 JAEKIA010000020.1 GCA016405145_00939 CDS open 869-1558 _na     229_aa PRTRC system protein E
3708 JAEKIA010000020.1 GCA016405145_00940 CDS open 2346-3533 _na     395_aa ABC superfamily ATP binding cassette transporter%2C binding protein
3709 JAEKIA010000020.1 GCA016405145_00941 CDS open 3530-4315 _na     261_aa Manganese/zinc/iron ABC superfamily ATP binding cassette transporter%2C ABC protein
3710 JAEKIA010000020.1 GCA016405145_00942 CDS open 4315-5271 _na     318_aa ABC superfamily ATP binding cassette transporter
3711 JAEKIA010000020.1 GCA016405145_00943 CDS open 5268-6134 _na     288_aa Metal cation ABC superfamily ATP binding cassette transporter%2C membrane protein
3712 JAEKIA010000020.1 GCA016405145_00944 CDS open 6172-7032 _na     286_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
3713 JAEKIA010000020.1 GCA016405145_00945 CDS open 7178-7753 _na     191_aa nicotinamidase
3714 JAEKIA010000020.1 GCA016405145_00946 CDS open 7864-9705 _na     613_aa metG Methionine--tRNA ligase
3715 JAEKIA010000020.1 GCA016405145_00947 CDS open 9797-11230 _na     477_aa L%2CD-TPase catalytic domain-containing protein
3716 JAEKIA010000020.1 GCA016405145_00948 CDS open 11316-11786 _na     156_aa hypothetical protein
3717 JAEKIA010000020.1 GCA016405145_00949 CDS open 11859-12374 _na     171_aa hypothetical protein
3718 JAEKIA010000020.1 GCA016405145_00950 CDS open 12340-13533 _na     397_aa pspC PspC domain-containing protein
3719 JAEKIA010000020.1 GCA016405145_00951 CDS open 13737-15092 _na     451_aa Sensor histidine kinase
3720 JAEKIA010000020.1 GCA016405145_00952 CDS open 15089-15739 _na     216_aa Two component system response regulator
3721 JAEKIA010000020.1 GCA016405145_00953 CDS open 15794-17341 _na     515_aa UPF0371 protein HMPREF9004_1956
3722 JAEKIA010000020.1 GCA016405145_00954 CDS open 17542-20352 _na     936_aa pcrA DNA helicase PcrA
3723 JAEKIA010000020.1 GCA016405145_00939 gene open 869-1558
3724 JAEKIA010000020.1 GCA016405145_00940 gene open 2346-3533
3725 JAEKIA010000020.1 GCA016405145_00941 gene open 3530-4315
3726 JAEKIA010000020.1 GCA016405145_00942 gene open 4315-5271
3727 JAEKIA010000020.1 GCA016405145_00943 gene open 5268-6134
3728 JAEKIA010000020.1 GCA016405145_00944 gene open 6172-7032 rsmI
3729 JAEKIA010000020.1 GCA016405145_00945 gene open 7178-7753
3730 JAEKIA010000020.1 GCA016405145_00946 gene open 7864-9705 metG
3731 JAEKIA010000020.1 GCA016405145_00947 gene open 9797-11230
3732 JAEKIA010000020.1 GCA016405145_00948 gene open 11316-11786
3733 JAEKIA010000020.1 GCA016405145_00949 gene open 11859-12374
3734 JAEKIA010000020.1 GCA016405145_00950 gene open 12340-13533 pspC
3735 JAEKIA010000020.1 GCA016405145_00951 gene open 13737-15092
3736 JAEKIA010000020.1 GCA016405145_00952 gene open 15089-15739
3737 JAEKIA010000020.1 GCA016405145_00953 gene open 15794-17341
3738 JAEKIA010000020.1 GCA016405145_00954 gene open 17542-20352 pcrA
3739 JAEKIA010000021.1 GCA016405145_00955 CDS open 246-1205 _na     319_aa hypothetical protein
3740 JAEKIA010000021.1 GCA016405145_00956 CDS open 1257-1829 _na     190_aa padR PadR family transcriptional regulator
3741 JAEKIA010000021.1 GCA016405145_00957 CDS open 2252-2761 _na     169_aa Heat shock protein 15
3742 JAEKIA010000021.1 GCA016405145_00958 CDS open 2788-3735 _na     315_aa hypothetical protein
3743 JAEKIA010000021.1 GCA016405145_00959 CDS open 4052-5620 _na     522_aa RCK C-terminal domain-containing protein
3744 JAEKIA010000021.1 GCA016405145_00960 CDS open 6057-6596 _na     179_aa Mutt/nudix family protein
3745 JAEKIA010000021.1 GCA016405145_00961 CDS open 6914-8221 _na     435_aa M18 family aminopeptidase
3746 JAEKIA010000021.1 GCA016405145_00962 CDS open 8309-10042 _na     577_aa ABC superfamily ATP binding cassette transporter ABC protein
3747 JAEKIA010000021.1 GCA016405145_00963 CDS open 10039-11805 _na     588_aa ABC superfamily ATP binding cassette transporter ABC protein
3748 JAEKIA010000021.1 GCA016405145_00964 CDS open 11829-12869 _na     346_aa ABC superfamily ATP binding cassette transporter%2C binding protein
3749 JAEKIA010000021.1 GCA016405145_00965 CDS open 12882-13661 _na     259_aa Ferrichrome ABC superfamily ATP binding cassette transporter%2C ABC protein
3750 JAEKIA010000021.1 GCA016405145_00966 CDS open 13658-14770 _na     370_aa Hemin ABC superfamily ATP binding cassette transporter%2C membrane protein
3751 JAEKIA010000021.1 GCA016405145_00967 CDS open 14763-16877 _na     704_aa sagD SagD family bacteriocin biosynthesis docking scaffold protein
3752 JAEKIA010000021.1 GCA016405145_00968 CDS open 16882-17013 _na     43_aa hypothetical protein
3753 JAEKIA010000021.1 GCA016405145_00969 CDS open 17354-17803 _na     149_aa GNAT family acetyltransferase
3754 JAEKIA010000021.1 GCA016405145_00970 CDS open 17975-19147 _na     390_aa rumB 23S rRNA (Uracil-5-)-methyltransferase RumB
3755 JAEKIA010000021.1 GCA016405145_00955 gene open 246-1205
3756 JAEKIA010000021.1 GCA016405145_00956 gene open 1257-1829 padR
3757 JAEKIA010000021.1 GCA016405145_00957 gene open 2252-2761
3758 JAEKIA010000021.1 GCA016405145_00958 gene open 2788-3735
3759 JAEKIA010000021.1 GCA016405145_00959 gene open 4052-5620
3760 JAEKIA010000021.1 GCA016405145_00960 gene open 6057-6596
3761 JAEKIA010000021.1 GCA016405145_00961 gene open 6914-8221
3762 JAEKIA010000021.1 GCA016405145_00962 gene open 8309-10042
3763 JAEKIA010000021.1 GCA016405145_00963 gene open 10039-11805
3764 JAEKIA010000021.1 GCA016405145_00964 gene open 11829-12869
3765 JAEKIA010000021.1 GCA016405145_00965 gene open 12882-13661
3766 JAEKIA010000021.1 GCA016405145_00966 gene open 13658-14770
3767 JAEKIA010000021.1 GCA016405145_00967 gene open 14763-16877 sagD
3768 JAEKIA010000021.1 GCA016405145_00968 gene open 16882-17013
3769 JAEKIA010000021.1 GCA016405145_00969 gene open 17354-17803
3770 JAEKIA010000021.1 GCA016405145_00970 gene open 17975-19147 rumB
3771 JAEKIA010000022.1 repeat_region open 447-644 CRISPR array with 3 repeats of length 38%2C consensus sequence GTCAGAAAGCACCTCGCACCATAAGGTGCATTAAGACG and spacer length 34
3772 JAEKIA010000022.1 repeat_region open 722-1585 CRISPR array with 12 repeats of length 37%2C consensus sequence GTCAGAAAGCACCTCGCACCATAAGGTGCATTAAGAC and spacer length 35
3773 JAEKIA010000022.1 GCA016405145_00971 CDS open 1722-2219 _na     165_aa Methylated-DNA--protein-cysteine methyltransferase
3774 JAEKIA010000022.1 GCA016405145_00972 CDS open 2247-3725 _na     492_aa der ribosome biogenesis GTPase Der
3775 JAEKIA010000022.1 GCA016405145_00973 CDS open 3799-5382 _na     527_aa UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
3776 JAEKIA010000022.1 GCA016405145_00974 CDS open 5465-8020 _na     851_aa pepN aminopeptidase N
3777 JAEKIA010000022.1 GCA016405145_00975 CDS open 8022-8879 _na     285_aa Membrane associated protein
3778 JAEKIA010000022.1 GCA016405145_00976 CDS open 8881-9213 _na     110_aa Small basic protein
3779 JAEKIA010000022.1 GCA016405145_00977 CDS open 9401-9595 _na     64_aa hypothetical protein
3780 JAEKIA010000022.1 GCA016405145_00971 gene open 1722-2219
3781 JAEKIA010000022.1 GCA016405145_00972 gene open 2247-3725 der
3782 JAEKIA010000022.1 GCA016405145_00973 gene open 3799-5382
3783 JAEKIA010000022.1 GCA016405145_00974 gene open 5465-8020 pepN
3784 JAEKIA010000022.1 GCA016405145_00975 gene open 8022-8879
3785 JAEKIA010000022.1 GCA016405145_00976 gene open 8881-9213
3786 JAEKIA010000022.1 GCA016405145_00977 gene open 9401-9595
3787 JAEKIA010000023.1 GCA016405145_00978 CDS open 126-281 _na     51_aa hypothetical protein
3788 JAEKIA010000023.1 GCA016405145_00979 CDS open 312-1325 _na     337_aa lacI LacI family DNA-binding transcriptional regulator
3789 JAEKIA010000023.1 GCA016405145_00980 CDS open 1503-2753 _na     416_aa maltose ABC transporter substrate-binding protein
3790 JAEKIA010000023.1 GCA016405145_00981 CDS open 2938-4539 _na     533_aa ABC transporter permease subunit
3791 JAEKIA010000023.1 GCA016405145_00982 CDS open 4539-5441 _na     300_aa sugar ABC transporter permease
3792 JAEKIA010000023.1 GCA016405145_00983 CDS open 5546-7966 _na     806_aa TIM-barrel domain-containing protein
3793 JAEKIA010000023.1 GCA016405145_00978 gene open 126-281
3794 JAEKIA010000023.1 GCA016405145_00979 gene open 312-1325 lacI
3795 JAEKIA010000023.1 GCA016405145_00980 gene open 1503-2753
3796 JAEKIA010000023.1 GCA016405145_00981 gene open 2938-4539
3797 JAEKIA010000023.1 GCA016405145_00982 gene open 4539-5441
3798 JAEKIA010000023.1 GCA016405145_00983 gene open 5546-7966
3799 JAEKIA010000024.1 GCA016405145_00984 CDS open 689-1588 _na     299_aa HTH cro/C1-type domain-containing protein
3800 JAEKIA010000024.1 GCA016405145_00985 CDS open 1949-2077 _na     42_aa araC AraC family transcriptional activator
3801 JAEKIA010000024.1 GCA016405145_00986 CDS open 2442-2705 _na     87_aa hypothetical protein
3802 JAEKIA010000024.1 GCA016405145_00987 CDS open 2848-7548 _na     1566_aa NACHT domain-containing protein
3803 JAEKIA010000024.1 GCA016405145_00984 gene open 689-1588
3804 JAEKIA010000024.1 GCA016405145_00985 gene open 1949-2077 araC
3805 JAEKIA010000024.1 GCA016405145_00986 gene open 2442-2705
3806 JAEKIA010000024.1 GCA016405145_00987 gene open 2848-7548
3807 JAEKIA010000025.1 GCA016405145_00988 gene open 42-158 rrf
3808 JAEKIA010000025.1 GCA016405145_00989 gene open 296-3435 rrl
3809 JAEKIA010000025.1 GCA016405145_00990 gene open 3783-5334 rrs
3810 JAEKIA010000025.1 GCA016405145_00988 rRNA open 42-158 rrf 5S ribosomal RNA
3811 JAEKIA010000025.1 GCA016405145_00989 rRNA open 296-3435 rrl 23S ribosomal RNA
3812 JAEKIA010000025.1 GCA016405145_00990 rRNA open 3783-5334 rrs 16S ribosomal RNA
3813 JAEKIA010000026.1 GCA016405145_00991 CDS open 391-2937 _na     848_aa YhgE/Pip domain protein
3814 JAEKIA010000026.1 GCA016405145_00992 CDS open 3044-3754 _na     236_aa HTH tetR-type domain-containing protein
3815 JAEKIA010000026.1 GCA016405145_00991 gene open 391-2937
3816 JAEKIA010000026.1 GCA016405145_00992 gene open 3044-3754
3817 JAEKIA010000027.1 repeat_region open 220-3368 CRISPR array with 52 repeats of length 28%2C consensus sequence GGCTCATCCCCGCTCACGCGGGGAGCAC and spacer length 33
3818 JAEKIA010000028.1 GCA016405145_00993 CDS open 68-841 _na     257_aa hypothetical protein
3819 JAEKIA010000028.1 GCA016405145_00994 CDS open 1064-2455 _na     463_aa glycine--tRNA ligase
3820 JAEKIA010000028.1 GCA016405145_00993 gene open 68-841
3821 JAEKIA010000028.1 GCA016405145_00994 gene open 1064-2455
3822 JAEKIA010000029.1 GCA016405145_00995 CDS open 202-972 _na     256_aa sugar-binding domain-containing protein
3823 JAEKIA010000029.1 GCA016405145_00996 CDS open 996-1478 _na     160_aa type I 3-dehydroquinate dehydratase
3824 JAEKIA010000029.1 GCA016405145_00997 CDS open 1782-2066 _na     94_aa hypothetical protein
3825 JAEKIA010000029.1 GCA016405145_00995 gene open 202-972
3826 JAEKIA010000029.1 GCA016405145_00996 gene open 996-1478
3827 JAEKIA010000029.1 GCA016405145_00997 gene open 1782-2066
3828 JAEKIA010000030.1 GCA016405145_01166 CDS open 1-840 _na     279_aa Metal ABC superfamily ATP binding cassette transporter%2C binding protein
3829 JAEKIA010000030.1 GCA016405145_01166 gene open 1-840
3830 JAEKIA010000031.1 GCA016405145_01167 CDS open 24-1232 _na     402_aa IS110 family transposase
3831 JAEKIA010000031.1 GCA016405145_01167 gene open 24-1232
3832 JAEKIA010000032.1 GCA016405145_01168 CDS open 115-1236 _na     373_aa IS1249 family transposase
3833 JAEKIA010000032.1 GCA016405145_01168 gene open 115-1236
3834 JAEKIA010000033.1 regulatory_region open 133-264 ALIL pseudoknot
3835 JAEKIA010000033.1 GCA016405145_01169 CDS open 238-915 _na     225_aa Integrase catalytic domain-containing protein
3836 JAEKIA010000033.1 GCA016405145_01169 gene open 238-915
3837 JAEKIA010000034.1 GCA016405145_01170 gene open 1-86 rrf
3838 JAEKIA010000034.1 GCA016405145_01170 rRNA open 1-86 rrf 5S ribosomal RNA