HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Schaalia cardiffensis (GCA_016405145.1)

Select a Genome:
BAKTA Annotations for GCA_016405145.1
Genome Selected: Schaalia cardiffensis
ContigsBases CDSrRNA tmRNAtRNA
34 2240847 1854 6 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3838 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 3838 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 JAEKIA010000003.1 GCA016405145_01045 CDS open 50366-51127 _na     253_aa Sortase
1002 JAEKIA010000003.1 GCA016405145_01046 CDS open 51151-51303 _na     50_aa DUF4175 domain-containing protein
1003 JAEKIA010000003.1 GCA016405145_01047 CDS open 51466-53475 _na     669_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
1004 JAEKIA010000003.1 GCA016405145_01048 CDS open 53448-55172 _na     574_aa non-specific serine/threonine protein kinase
1005 JAEKIA010000003.1 GCA016405145_01049 CDS open 55169-56623 _na     484_aa Penicillin binding protein transpeptidase domain protein
1006 JAEKIA010000003.1 GCA016405145_01050 CDS open 56620-58017 _na     465_aa ftsW Cell division protein FtsW
1007 JAEKIA010000003.1 GCA016405145_01051 CDS open 58017-59333 _na     438_aa Protein serine/threonine phosphatase
1008 JAEKIA010000003.1 GCA016405145_01052 CDS open 59335-59826 _na     163_aa FHA domain-containing protein
1009 JAEKIA010000003.1 GCA016405145_01053 CDS open 59823-60527 _na     234_aa FHA domain-containing protein
1010 JAEKIA010000003.1 GCA016405145_01054 CDS open 60781-61743 _na     320_aa nrdF class 1b ribonucleoside-diphosphate reductase subunit beta
1011 JAEKIA010000003.1 GCA016405145_01055 CDS open 61740-61988 _na     82_aa hypothetical protein
1012 JAEKIA010000003.1 GCA016405145_01056 CDS open 62143-63456 _na     437_aa Prolyl aminopeptidase
1013 JAEKIA010000003.1 GCA016405145_01057 CDS open 63634-63960 _na     108_aa brnE Branched chain amino acid exporter BrnE
1014 JAEKIA010000003.1 GCA016405145_01058 CDS open 63957-65072 _na     371_aa brnF Branched chain amino acid exporter BrnF
1015 JAEKIA010000003.1 GCA016405145_01059 CDS open 65350-66225 _na     291_aa ribonuclease H
1016 JAEKIA010000003.1 GCA016405145_01060 CDS open 66222-66458 _na     78_aa YdeI/OmpD-associated family protein
1017 JAEKIA010000003.1 GCA016405145_01061 CDS open 66600-67940 _na     446_aa Fido domain-containing protein
1018 JAEKIA010000003.1 GCA016405145_01062 CDS open 68009-70405 _na     798_aa Oligopeptidase B
1019 JAEKIA010000003.1 GCA016405145_01063 CDS open 70761-71831 _na     356_aa Phospholipase
1020 JAEKIA010000003.1 GCA016405145_01064 CDS open 72259-73989 _na     576_aa Isopentenyl-diphosphate delta-isomerase
1021 JAEKIA010000003.1 GCA016405145_01065 CDS open 74117-74848 _na     243_aa DUF4190 domain-containing protein
1022 JAEKIA010000003.1 GCA016405145_01066 CDS open 75422-78970 _na     1182_aa L-glutamate gamma-semialdehyde dehydrogenase
1023 JAEKIA010000003.1 GCA016405145_01067 CDS open 79170-80675 _na     501_aa putP sodium/proline symporter PutP
1024 JAEKIA010000003.1 GCA016405145_01068 CDS open 81125-83281 _na     718_aa nrdE class 1b ribonucleoside-diphosphate reductase subunit alpha
1025 JAEKIA010000003.1 GCA016405145_01069 CDS open 83251-83667 _na     138_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
1026 JAEKIA010000003.1 GCA016405145_01070 CDS open 84040-84303 _na     87_aa nrdH Glutaredoxin-like protein NrdH
1027 JAEKIA010000003.1 GCA016405145_01071 CDS open 85060-86901 _na     613_aa L-serine ammonia-lyase
1028 JAEKIA010000003.1 GCA016405145_01072 CDS open 87024-87776 _na     250_aa mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
1029 JAEKIA010000003.1 GCA016405145_01073 CDS open 87861-88349 _na     162_aa protein-tyrosine-phosphatase
1030 JAEKIA010000003.1 GCA016405145_01074 CDS open 88452-89810 _na     452_aa MFS family major facilitator transporter
1031 JAEKIA010000003.1 GCA016405145_01075 CDS open 89998-91383 _na     461_aa Major facilitator family transporter
1032 JAEKIA010000003.1 GCA016405145_01076 CDS open 91755-92537 _na     260_aa Phosphoribulokinase/uridine kinase
1033 JAEKIA010000003.1 GCA016405145_01077 CDS open 92548-93099 _na     183_aa Purine phosphoribosyltransferase
1034 JAEKIA010000003.1 GCA016405145_01078 CDS open 93165-94316 _na     383_aa ATP-dependent 6-phosphofructokinase
1035 JAEKIA010000003.1 GCA016405145_01079 CDS open 94342-94557 _na     71_aa hypothetical protein
1036 JAEKIA010000003.1 GCA016405145_01080 CDS open 94482-95198 _na     238_aa nitroreductase family protein
1037 JAEKIA010000003.1 GCA016405145_01081 CDS open 95340-96371 _na     343_aa hypothetical protein
1038 JAEKIA010000003.1 GCA016405145_01082 CDS open 96344-97129 _na     261_aa hypothetical protein
1039 JAEKIA010000003.1 GCA016405145_01083 CDS open 97163-97684 _na     173_aa SprT-like domain-containing protein
1040 JAEKIA010000003.1 GCA016405145_01084 CDS open 97681-103614 _na     1977_aa hrpA ATP-dependent RNA helicase HrpA
1041 JAEKIA010000003.1 GCA016405145_01085 CDS open 104098-104529 _na     143_aa hypothetical protein
1042 JAEKIA010000003.1 GCA016405145_01086 CDS open 104529-105470 _na     313_aa site-specific DNA-methyltransferase (adenine-specific)
1043 JAEKIA010000003.1 GCA016405145_01087 CDS open 105538-107229 _na     563_aa gmrSD DUF262 domain-containing protein
1044 JAEKIA010000003.1 GCA016405145_01088 CDS open 107253-108839 _na     528_aa spoIVCA Resolvase/invertase-type recombinase catalytic domain-containing protein
1045 JAEKIA010000003.1 GCA016405145_01089 CDS open 108840-109754 _na     304_aa hypothetical protein
1046 JAEKIA010000003.1 GCA016405145_01090 CDS open 110491-110850 _na     119_aa hypothetical protein
1047 JAEKIA010000003.1 GCA016405145_01091 CDS open 110865-111521 _na     218_aa site-specific integrase
1048 JAEKIA010000003.1 GCA016405145_01092 CDS open 111548-112591 _na     347_aa Class I SAM-dependent DNA methyltransferase
1049 JAEKIA010000003.1 GCA016405145_01093 CDS open 112588-113586 _na     332_aa Bro-N domain-containing protein
1050 JAEKIA010000003.1 GCA016405145_01094 CDS open 113583-116066 _na     827_aa pglZ BREX-1 system phosphatase PglZ type A
1051 JAEKIA010000003.1 GCA016405145_01095 CDS open 116075-116452 _na     125_aa brxL anti-phage BREX system Lon protease BrxL
1052 JAEKIA010000003.1 GCA016405145_01096 CDS open 116424-118244 _na     606_aa brxL BREX system Lon protease-like protein BrxL
1053 JAEKIA010000003.1 GCA016405145_01097 CDS open 118775-119833 _na     352_aa pfkB PfkB protein
1054 JAEKIA010000003.1 GCA016405145_01098 CDS open 119880-121364 _na     494_aa Transcriptional regulator
1055 JAEKIA010000003.1 GCA016405145_01099 CDS open 121621-122397 _na     258_aa AB hydrolase-1 domain-containing protein
1056 JAEKIA010000003.1 GCA016405145_01100 CDS open 122656-122952 _na     98_aa Acetyl-coenzyme A synthetase
1057 JAEKIA010000003.1 GCA016405145_01101 CDS open 123113-124171 _na     352_aa DUF125 domain-containing protein
1058 JAEKIA010000003.1 GCA016405145_01102 CDS open 124208-124993 _na     261_aa trimeric intracellular cation channel family protein
1059 JAEKIA010000003.1 GCA016405145_01103 CDS open 125054-125788 _na     244_aa Abasic site processing protein
1060 JAEKIA010000003.1 GCA016405145_01104 CDS open 125830-127338 _na     502_aa APC family amino acid-polyamine-organocation transporter
1061 JAEKIA010000003.1 GCA016405145_01105 CDS open 127669-128442 _na     257_aa Extracellular deoxyribonuclease
1062 JAEKIA010000003.1 GCA016405145_01106 CDS open 128526-129179 _na     217_aa DNA-binding response regulator
1063 JAEKIA010000003.1 GCA016405145_01107 CDS open 129176-130357 _na     393_aa Sensor histidine kinase
1064 JAEKIA010000003.1 GCA016405145_01108 CDS open 130461-131351 _na     296_aa ABC-2 type transporter transmembrane domain-containing protein
1065 JAEKIA010000003.1 GCA016405145_01109 CDS open 131432-132349 _na     305_aa ABC superfamily ATP binding cassette transporter ABC protein
1066 JAEKIA010000003.1 GCA016405145_01110 CDS open 132563-134491 _na     642_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
1067 JAEKIA010000003.1 GCA016405145_01111 CDS open 134488-135456 _na     322_aa ABC transmembrane type-1 domain-containing protein
1068 JAEKIA010000003.1 GCA016405145_01112 CDS open 135449-136375 _na     308_aa ABC transmembrane type-1 domain-containing protein
1069 JAEKIA010000003.1 GCA016405145_01113 CDS open 136650-138257 _na     535_aa Oligopeptide ABC superfamily ATP binding cassette transporter peptide-binding protein
1070 JAEKIA010000003.1 GCA016405145_01114 CDS open 138975-140066 _na     363_aa Fructokinase
1071 JAEKIA010000003.1 GCA016405145_01115 CDS open 140198-141430 _na     410_aa DUF559 domain-containing protein
1072 JAEKIA010000003.1 GCA016405145_01116 CDS open 141492-142412 _na     306_aa Glycine betaine/L-proline ABC superfamily ATP binding cassette transporter%2C substrate-binding protein
1073 JAEKIA010000003.1 GCA016405145_01117 CDS open 142430-143401 _na     323_aa Glycine betaine/L-proline ABC superfamily ATP binding cassette transporter%2C permease protein
1074 JAEKIA010000003.1 GCA016405145_01118 CDS open 143398-144084 _na     228_aa Glycine betaine/choline ABC superfamily ATP binding cassette transporter%2C membrane protein
1075 JAEKIA010000003.1 GCA016405145_01119 CDS open 144081-144956 _na     291_aa Glycine betaine/L-proline ABC superfamily ATP binding cassette transporter%2C ABC protein
1076 JAEKIA010000003.1 GCA016405145_01120 CDS open 145341-146708 _na     455_aa Uracil-xanthine permease
1077 JAEKIA010000003.1 GCA016405145_01121 CDS open 147312-148088 _na     258_aa Glutamine amidotransferase
1078 JAEKIA010000003.1 GCA016405145_01125 CDS open 150491-150862 _na     123_aa hypothetical protein
1079 JAEKIA010000003.1 GCA016405145_01126 CDS open 151431-152681 _na     416_aa hypothetical protein
1080 JAEKIA010000003.1 GCA016405145_01127 CDS open 152718-153026 _na     102_aa Thiamine-binding protein domain-containing protein
1081 JAEKIA010000003.1 GCA016405145_01128 CDS open 153606-154133 _na     175_aa crcB CrcB family protein
1082 JAEKIA010000003.1 GCA016405145_01129 CDS open 154130-154732 _na     200_aa crcB CrcB family protein
1083 JAEKIA010000003.1 GCA016405145_01130 CDS open 154947-155939 _na     330_aa Methionine ABC superfamily ATP binding cassette transporter%2C ABC protein
1084 JAEKIA010000003.1 GCA016405145_01131 CDS open 155936-156676 _na     246_aa Methionine ABC superfamily ATP binding cassette transporter%2C membrane protein
1085 JAEKIA010000003.1 GCA016405145_01132 CDS open 156868-157707 _na     279_aa Lipoprotein
1086 JAEKIA010000003.1 GCA016405145_01133 CDS open 158106-159386 _na     426_aa sulfurtransferase
1087 JAEKIA010000003.1 GCA016405145_01134 CDS open 159827-160276 _na     149_aa GNAT family acetyltransferase
1088 JAEKIA010000003.1 GCA016405145_01135 CDS open 160594-161232 _na     212_aa upp uracil phosphoribosyltransferase
1089 JAEKIA010000003.1 GCA016405145_01136 CDS open 161405-162463 _na     352_aa tadA tRNA adenosine(34) deaminase TadA
1090 JAEKIA010000003.1 GCA016405145_01137 CDS open 162566-163078 _na     170_aa Molybdopterin biosynthesis Mog protein
1091 JAEKIA010000003.1 GCA016405145_01138 CDS open 163323-163805 _na     160_aa moaC cyclic pyranopterin monophosphate synthase MoaC
1092 JAEKIA010000003.1 GCA016405145_01139 CDS open 164022-165416 _na     464_aa glp gephyrin-like molybdotransferase Glp
1093 JAEKIA010000003.1 GCA016405145_01140 CDS open 165467-166255 _na     262_aa thiF Thiazole biosynthesis adenylyltransferase ThiF
1094 JAEKIA010000003.1 GCA016405145_01141 CDS open 166252-166674 _na     140_aa Molybdenum cofactor biosynthesis protein large subunit
1095 JAEKIA010000003.1 GCA016405145_01142 CDS open 166684-167667 _na     327_aa HTH marR-type domain-containing protein
1096 JAEKIA010000003.1 GCA016405145_01143 CDS open 167870-168652 _na     260_aa narI respiratory nitrate reductase subunit gamma
1097 JAEKIA010000003.1 GCA016405145_01144 CDS open 168658-169338 _na     226_aa narJ nitrate reductase molybdenum cofactor assembly chaperone
1098 JAEKIA010000003.1 GCA016405145_01145 CDS open 169335-170870 _na     511_aa narH nitrate reductase subunit beta
1099 JAEKIA010000003.1 GCA016405145_01146 CDS open 170870-174631 _na     1253_aa nitrate reductase subunit alpha
1100 JAEKIA010000003.1 GCA016405145_01147 CDS open 174704-176047 _na     447_aa Nitrate/nitrite transporter
1101 JAEKIA010000003.1 GCA016405145_01148 CDS open 176255-177316 _na     353_aa moaA GTP 3'%2C8-cyclase MoaA
1102 JAEKIA010000003.1 GCA016405145_01149 CDS open 177375-178145 _na     256_aa MobA-like NTP transferase domain-containing protein
1103 JAEKIA010000003.1 GCA016405145_01150 CDS open 178244-179488 _na     414_aa narK Nitrite extrusion protein NarK
1104 JAEKIA010000003.1 GCA016405145_01151 CDS open 179839-180468 _na     209_aa Biotin transporter
1105 JAEKIA010000003.1 GCA016405145_01152 CDS open 180655-181308 _na     217_aa holo-ACP synthase
1106 JAEKIA010000003.1 GCA016405145_01153 CDS open 181305-190481 _na     3058_aa Fatty-acid synthase I
1107 JAEKIA010000003.1 GCA016405145_01154 CDS open 190534-192276 _na     580_aa Propionyl-CoA carboxylase
1108 JAEKIA010000003.1 GCA016405145_01155 CDS open 192273-194204 _na     643_aa biotin carboxylase
1109 JAEKIA010000003.1 GCA016405145_01156 CDS open 194201-194956 _na     251_aa Biotin--[acetyl-CoA-carboxylase] ligase
1110 JAEKIA010000003.1 GCA016405145_01157 CDS open 195265-196137 _na     290_aa Restriction endonuclease type II DpnII-like domain-containing protein
1111 JAEKIA010000003.1 GCA016405145_01158 CDS open 196152-197213 _na     353_aa site-specific DNA-methyltransferase (adenine-specific)
1112 JAEKIA010000003.1 GCA016405145_01159 CDS open 197327-198118 _na     263_aa tetR TetR family transcriptional regulator
1113 JAEKIA010000003.1 GCA016405145_01160 CDS open 198125-198637 _na     170_aa MoaB/Mog domain-containing protein
1114 JAEKIA010000003.1 GCA016405145_01161 CDS open 198921-199724 _na     267_aa modA molybdate ABC transporter substrate-binding protein
1115 JAEKIA010000003.1 GCA016405145_01162 CDS open 199721-201799 _na     692_aa modB molybdate ABC transporter permease subunit
1116 JAEKIA010000003.1 GCA016405145_01163 CDS open 202018-202893 _na     291_aa HTH tetR-type domain-containing protein
1117 JAEKIA010000003.1 GCA016405145_01164 CDS open 203062-207696 _na     1544_aa Activator of 2-hydroxyglutaryl-CoA dehydratase (HSP70-class ATPase domain)
1118 JAEKIA010000003.1 GCA016405145_00998 gene open 474-650
1119 JAEKIA010000003.1 GCA016405145_00999 gene open 786-1202
1120 JAEKIA010000003.1 GCA016405145_01000 gene open 1440-1724
1121 JAEKIA010000003.1 GCA016405145_01001 gene open 2146-2658
1122 JAEKIA010000003.1 GCA016405145_01002 gene open 2604-3029
1123 JAEKIA010000003.1 GCA016405145_01003 gene open 3183-4868
1124 JAEKIA010000003.1 GCA016405145_01004 gene open 5580-6230
1125 JAEKIA010000003.1 GCA016405145_01005 gene open 6750-7091
1126 JAEKIA010000003.1 GCA016405145_01006 gene open 7336-7638
1127 JAEKIA010000003.1 GCA016405145_01007 gene open 7611-8789
1128 JAEKIA010000003.1 GCA016405145_01008 gene open 9104-9826
1129 JAEKIA010000003.1 GCA016405145_01009 gene open 9823-10284 ychJ
1130 JAEKIA010000003.1 GCA016405145_01010 gene open 10688-11722 trxB
1131 JAEKIA010000003.1 GCA016405145_01011 gene open 11798-13201
1132 JAEKIA010000003.1 GCA016405145_01012 gene open 13194-14945 mviN
1133 JAEKIA010000003.1 GCA016405145_01013 gene open 14945-17317
1134 JAEKIA010000003.1 GCA016405145_01014 gene open 17318-17854
1135 JAEKIA010000003.1 GCA016405145_01015 gene open 18283-19887
1136 JAEKIA010000003.1 GCA016405145_01016 gene open 20376-21839 gndA
1137 JAEKIA010000003.1 GCA016405145_01017 gene open 22128-24599
1138 JAEKIA010000003.1 GCA016405145_01018 gene open 24969-25289
1139 JAEKIA010000003.1 GCA016405145_01019 gene open 25502-25723
1140 JAEKIA010000003.1 GCA016405145_01020 gene open 26022-27068
1141 JAEKIA010000003.1 GCA016405145_01021 gene open 27536-27994 rplI
1142 JAEKIA010000003.1 GCA016405145_01022 gene open 28013-28255 rpsR
1143 JAEKIA010000003.1 GCA016405145_01023 gene open 28343-28879
1144 JAEKIA010000003.1 GCA016405145_01024 gene open 28923-29273 rpsF
1145 JAEKIA010000003.1 GCA016405145_01025 gene open 29578-29847
1146 JAEKIA010000003.1 GCA016405145_01026 gene open 29751-31187
1147 JAEKIA010000003.1 GCA016405145_01027 gene open 31559-32914 dnaB
1148 JAEKIA010000003.1 GCA016405145_01028 gene open 33413-33631
1149 JAEKIA010000003.1 GCA016405145_01029 gene open 34185-34418
1150 JAEKIA010000003.1 GCA016405145_01030 gene open 34497-34676
1151 JAEKIA010000003.1 GCA016405145_01032 gene open 35268-36362 ecfT
1152 JAEKIA010000003.1 GCA016405145_01033 gene open 36359-38869 ccmA
1153 JAEKIA010000003.1 GCA016405145_01034 gene open 39066-40520
1154 JAEKIA010000003.1 GCA016405145_01035 gene open 40522-42594
1155 JAEKIA010000003.1 GCA016405145_01036 gene open 42591-43061
1156 JAEKIA010000003.1 GCA016405145_01037 gene open 43127-43768
1157 JAEKIA010000003.1 GCA016405145_01038 gene open 43864-44649
1158 JAEKIA010000003.1 GCA016405145_01039 gene open 44941-45795
1159 JAEKIA010000003.1 GCA016405145_01040 gene open 45896-46417
1160 JAEKIA010000003.1 GCA016405145_01041 gene open 46567-47172
1161 JAEKIA010000003.1 GCA016405145_01042 gene open 47413-48282
1162 JAEKIA010000003.1 GCA016405145_01043 gene open 48941-49204 crgA
1163 JAEKIA010000003.1 GCA016405145_01044 gene open 49312-50364
1164 JAEKIA010000003.1 GCA016405145_01045 gene open 50366-51127
1165 JAEKIA010000003.1 GCA016405145_01046 gene open 51151-51303
1166 JAEKIA010000003.1 GCA016405145_01047 gene open 51466-53475 pknB
1167 JAEKIA010000003.1 GCA016405145_01048 gene open 53448-55172
1168 JAEKIA010000003.1 GCA016405145_01049 gene open 55169-56623
1169 JAEKIA010000003.1 GCA016405145_01050 gene open 56620-58017 ftsW
1170 JAEKIA010000003.1 GCA016405145_01051 gene open 58017-59333
1171 JAEKIA010000003.1 GCA016405145_01052 gene open 59335-59826
1172 JAEKIA010000003.1 GCA016405145_01053 gene open 59823-60527
1173 JAEKIA010000003.1 GCA016405145_01054 gene open 60781-61743 nrdF
1174 JAEKIA010000003.1 GCA016405145_01055 gene open 61740-61988
1175 JAEKIA010000003.1 GCA016405145_01056 gene open 62143-63456
1176 JAEKIA010000003.1 GCA016405145_01057 gene open 63634-63960 brnE
1177 JAEKIA010000003.1 GCA016405145_01058 gene open 63957-65072 brnF
1178 JAEKIA010000003.1 GCA016405145_01059 gene open 65350-66225
1179 JAEKIA010000003.1 GCA016405145_01060 gene open 66222-66458
1180 JAEKIA010000003.1 GCA016405145_01061 gene open 66600-67940
1181 JAEKIA010000003.1 GCA016405145_01062 gene open 68009-70405
1182 JAEKIA010000003.1 GCA016405145_01063 gene open 70761-71831
1183 JAEKIA010000003.1 GCA016405145_01064 gene open 72259-73989
1184 JAEKIA010000003.1 GCA016405145_01065 gene open 74117-74848
1185 JAEKIA010000003.1 GCA016405145_01066 gene open 75422-78970
1186 JAEKIA010000003.1 GCA016405145_01067 gene open 79170-80675 putP
1187 JAEKIA010000003.1 GCA016405145_01068 gene open 81125-83281 nrdE
1188 JAEKIA010000003.1 GCA016405145_01069 gene open 83251-83667 nrdI
1189 JAEKIA010000003.1 GCA016405145_01070 gene open 84040-84303 nrdH
1190 JAEKIA010000003.1 GCA016405145_01071 gene open 85060-86901
1191 JAEKIA010000003.1 GCA016405145_01072 gene open 87024-87776 mtnN
1192 JAEKIA010000003.1 GCA016405145_01073 gene open 87861-88349
1193 JAEKIA010000003.1 GCA016405145_01074 gene open 88452-89810
1194 JAEKIA010000003.1 GCA016405145_01075 gene open 89998-91383
1195 JAEKIA010000003.1 GCA016405145_01076 gene open 91755-92537
1196 JAEKIA010000003.1 GCA016405145_01077 gene open 92548-93099
1197 JAEKIA010000003.1 GCA016405145_01078 gene open 93165-94316
1198 JAEKIA010000003.1 GCA016405145_01079 gene open 94342-94557
1199 JAEKIA010000003.1 GCA016405145_01080 gene open 94482-95198
1200 JAEKIA010000003.1 GCA016405145_01081 gene open 95340-96371
1201 JAEKIA010000003.1 GCA016405145_01082 gene open 96344-97129
1202 JAEKIA010000003.1 GCA016405145_01083 gene open 97163-97684
1203 JAEKIA010000003.1 GCA016405145_01084 gene open 97681-103614 hrpA
1204 JAEKIA010000003.1 GCA016405145_01085 gene open 104098-104529
1205 JAEKIA010000003.1 GCA016405145_01086 gene open 104529-105470
1206 JAEKIA010000003.1 GCA016405145_01087 gene open 105538-107229 gmrSD
1207 JAEKIA010000003.1 GCA016405145_01088 gene open 107253-108839 spoIVCA
1208 JAEKIA010000003.1 GCA016405145_01089 gene open 108840-109754
1209 JAEKIA010000003.1 GCA016405145_01090 gene open 110491-110850
1210 JAEKIA010000003.1 GCA016405145_01091 gene open 110865-111521
1211 JAEKIA010000003.1 GCA016405145_01092 gene open 111548-112591
1212 JAEKIA010000003.1 GCA016405145_01093 gene open 112588-113586
1213 JAEKIA010000003.1 GCA016405145_01094 gene open 113583-116066 pglZ
1214 JAEKIA010000003.1 GCA016405145_01095 gene open 116075-116452 brxL
1215 JAEKIA010000003.1 GCA016405145_01096 gene open 116424-118244 brxL
1216 JAEKIA010000003.1 GCA016405145_01097 gene open 118775-119833 pfkB
1217 JAEKIA010000003.1 GCA016405145_01098 gene open 119880-121364
1218 JAEKIA010000003.1 GCA016405145_01099 gene open 121621-122397
1219 JAEKIA010000003.1 GCA016405145_01100 gene open 122656-122952
1220 JAEKIA010000003.1 GCA016405145_01101 gene open 123113-124171
1221 JAEKIA010000003.1 GCA016405145_01102 gene open 124208-124993
1222 JAEKIA010000003.1 GCA016405145_01103 gene open 125054-125788
1223 JAEKIA010000003.1 GCA016405145_01104 gene open 125830-127338
1224 JAEKIA010000003.1 GCA016405145_01105 gene open 127669-128442
1225 JAEKIA010000003.1 GCA016405145_01106 gene open 128526-129179
1226 JAEKIA010000003.1 GCA016405145_01107 gene open 129176-130357
1227 JAEKIA010000003.1 GCA016405145_01108 gene open 130461-131351
1228 JAEKIA010000003.1 GCA016405145_01109 gene open 131432-132349
1229 JAEKIA010000003.1 GCA016405145_01110 gene open 132563-134491
1230 JAEKIA010000003.1 GCA016405145_01111 gene open 134488-135456
1231 JAEKIA010000003.1 GCA016405145_01112 gene open 135449-136375
1232 JAEKIA010000003.1 GCA016405145_01113 gene open 136650-138257
1233 JAEKIA010000003.1 GCA016405145_01114 gene open 138975-140066
1234 JAEKIA010000003.1 GCA016405145_01115 gene open 140198-141430
1235 JAEKIA010000003.1 GCA016405145_01116 gene open 141492-142412
1236 JAEKIA010000003.1 GCA016405145_01117 gene open 142430-143401
1237 JAEKIA010000003.1 GCA016405145_01118 gene open 143398-144084
1238 JAEKIA010000003.1 GCA016405145_01119 gene open 144081-144956
1239 JAEKIA010000003.1 GCA016405145_01120 gene open 145341-146708
1240 JAEKIA010000003.1 GCA016405145_01121 gene open 147312-148088
1241 JAEKIA010000003.1 GCA016405145_01125 gene open 150491-150862
1242 JAEKIA010000003.1 GCA016405145_01126 gene open 151431-152681
1243 JAEKIA010000003.1 GCA016405145_01127 gene open 152718-153026
1244 JAEKIA010000003.1 GCA016405145_01128 gene open 153606-154133 crcB
1245 JAEKIA010000003.1 GCA016405145_01129 gene open 154130-154732 crcB
1246 JAEKIA010000003.1 GCA016405145_01130 gene open 154947-155939
1247 JAEKIA010000003.1 GCA016405145_01131 gene open 155936-156676
1248 JAEKIA010000003.1 GCA016405145_01132 gene open 156868-157707
1249 JAEKIA010000003.1 GCA016405145_01133 gene open 158106-159386
1250 JAEKIA010000003.1 GCA016405145_01134 gene open 159827-160276
1251 JAEKIA010000003.1 GCA016405145_01135 gene open 160594-161232 upp
1252 JAEKIA010000003.1 GCA016405145_01136 gene open 161405-162463 tadA
1253 JAEKIA010000003.1 GCA016405145_01137 gene open 162566-163078
1254 JAEKIA010000003.1 GCA016405145_01138 gene open 163323-163805 moaC
1255 JAEKIA010000003.1 GCA016405145_01139 gene open 164022-165416 glp
1256 JAEKIA010000003.1 GCA016405145_01140 gene open 165467-166255 thiF
1257 JAEKIA010000003.1 GCA016405145_01141 gene open 166252-166674
1258 JAEKIA010000003.1 GCA016405145_01142 gene open 166684-167667
1259 JAEKIA010000003.1 GCA016405145_01143 gene open 167870-168652 narI
1260 JAEKIA010000003.1 GCA016405145_01144 gene open 168658-169338 narJ
1261 JAEKIA010000003.1 GCA016405145_01145 gene open 169335-170870 narH
1262 JAEKIA010000003.1 GCA016405145_01146 gene open 170870-174631
1263 JAEKIA010000003.1 GCA016405145_01147 gene open 174704-176047
1264 JAEKIA010000003.1 GCA016405145_01148 gene open 176255-177316 moaA
1265 JAEKIA010000003.1 GCA016405145_01149 gene open 177375-178145
1266 JAEKIA010000003.1 GCA016405145_01150 gene open 178244-179488 narK
1267 JAEKIA010000003.1 GCA016405145_01151 gene open 179839-180468
1268 JAEKIA010000003.1 GCA016405145_01152 gene open 180655-181308
1269 JAEKIA010000003.1 GCA016405145_01153 gene open 181305-190481
1270 JAEKIA010000003.1 GCA016405145_01154 gene open 190534-192276
1271 JAEKIA010000003.1 GCA016405145_01155 gene open 192273-194204
1272 JAEKIA010000003.1 GCA016405145_01156 gene open 194201-194956
1273 JAEKIA010000003.1 GCA016405145_01157 gene open 195265-196137
1274 JAEKIA010000003.1 GCA016405145_01158 gene open 196152-197213
1275 JAEKIA010000003.1 GCA016405145_01159 gene open 197327-198118 tetR
1276 JAEKIA010000003.1 GCA016405145_01160 gene open 198125-198637
1277 JAEKIA010000003.1 GCA016405145_01161 gene open 198921-199724 modA
1278 JAEKIA010000003.1 GCA016405145_01162 gene open 199721-201799 modB
1279 JAEKIA010000003.1 GCA016405145_01163 gene open 202018-202893
1280 JAEKIA010000003.1 GCA016405145_01164 gene open 203062-207696
1281 JAEKIA010000003.1 GCA016405145_01031 gene open 35111-35197 trnL
1282 JAEKIA010000003.1 GCA016405145_01122 gene open 148871-148955 trnS
1283 JAEKIA010000003.1 GCA016405145_01124 gene open 149650-149722 trnR
1284 JAEKIA010000003.1 GCA016405145_01165 gene open 207893-207982 trnS
1285 JAEKIA010000003.1 GCA016405145_01031 tRNA open 35111-35197 trnL tRNA-Leu(cag)
1286 JAEKIA010000003.1 GCA016405145_01122 tRNA open 148871-148955 trnS tRNA-Ser(gga)
1287 JAEKIA010000003.1 GCA016405145_01124 tRNA open 149650-149722 trnR tRNA-Arg(acg)
1288 JAEKIA010000003.1 GCA016405145_01165 tRNA open 207893-207982 trnS tRNA-Ser(cga)
1289 JAEKIA010000004.1 repeat_region open 156-1227 CRISPR array with 18 repeats of length 28%2C consensus sequence GTGCTCCCCGCGTGAGCGGGGATGAGCC and spacer length 33
1290 JAEKIA010000004.1 GCA016405145_01171 CDS open 1584-2267 _na     227_aa hypothetical protein
1291 JAEKIA010000004.1 GCA016405145_01172 CDS open 2716-3678 _na     320_aa SPFH domain/Band 7 family protein
1292 JAEKIA010000004.1 GCA016405145_01173 CDS open 3748-3972 _na     74_aa hicB Toxin-antitoxin system HicB family antitoxin
1293 JAEKIA010000004.1 GCA016405145_01174 CDS open 4236-5498 _na     420_aa ATP-binding protein
1294 JAEKIA010000004.1 GCA016405145_01175 CDS open 5976-7256 _na     426_aa adenylosuccinate synthase
1295 JAEKIA010000004.1 GCA016405145_01176 CDS open 7657-7950 _na     97_aa hypothetical protein
1296 JAEKIA010000004.1 GCA016405145_01177 CDS open 8667-10208 _na     513_aa fxsA FxsA cytoplasmic membrane protein
1297 JAEKIA010000004.1 GCA016405145_01178 CDS open 10512-11168 _na     218_aa THAP4-like heme-binding beta-barrel domain-containing protein
1298 JAEKIA010000004.1 GCA016405145_01179 CDS open 11165-12520 _na     451_aa ygfZ Folate-binding protein YgfZ
1299 JAEKIA010000004.1 GCA016405145_01180 CDS open 12520-12945 _na     141_aa dtd D-aminoacyl-tRNA deacylase
1300 JAEKIA010000004.1 GCA016405145_01181 CDS open 12861-13193 _na     110_aa hypothetical protein
1301 JAEKIA010000004.1 GCA016405145_01182 CDS open 13232-19048 _na     1938_aa Fibronectin type-III domain-containing protein
1302 JAEKIA010000004.1 GCA016405145_01183 CDS open 19133-20098 _na     321_aa MoxR-like ATPase
1303 JAEKIA010000004.1 GCA016405145_01184 CDS open 20104-21351 _na     415_aa DUF58 domain-containing protein
1304 JAEKIA010000004.1 GCA016405145_01185 CDS open 21348-23978 _na     876_aa Transglutaminase-like domain-containing protein
1305 JAEKIA010000004.1 GCA016405145_01186 CDS open 23975-25576 _na     533_aa non-specific serine/threonine protein kinase
1306 JAEKIA010000004.1 GCA016405145_01187 CDS open 25820-27253 _na     477_aa Thermitase
1307 JAEKIA010000004.1 GCA016405145_01188 CDS open 27250-28710 _na     486_aa eccB type VII secretion protein EccB
1308 JAEKIA010000004.1 GCA016405145_01189 CDS open 28710-30020 _na     436_aa eccD type VII secretion integral membrane protein EccD
1309 JAEKIA010000004.1 GCA016405145_01190 CDS open 30960-31271 _na     103_aa ESAT-6-like protein
1310 JAEKIA010000004.1 GCA016405145_01191 CDS open 31303-31587 _na     94_aa ESAT-6-like protein
1311 JAEKIA010000004.1 GCA016405145_01192 CDS open 31961-33352 _na     463_aa FHA domain-containing protein
1312 JAEKIA010000004.1 GCA016405145_01193 CDS open 33349-34689 _na     446_aa eccD Type VII secretion integral membrane protein EccD
1313 JAEKIA010000004.1 GCA016405145_01194 CDS open 34956-38990 _na     1344_aa Cell division protein FtsK/SpoIIIE
1314 JAEKIA010000004.1 GCA016405145_01195 CDS open 39089-39652 _na     187_aa Lipoprotein
1315 JAEKIA010000004.1 GCA016405145_01196 CDS open 39733-40590 _na     285_aa Protein phosphatase 2C family protein
1316 JAEKIA010000004.1 GCA016405145_01197 CDS open 40606-42009 _na     467_aa FHA domain-containing protein
1317 JAEKIA010000004.1 GCA016405145_01198 CDS open 42127-43554 _na     475_aa PPE domain-containing protein
1318 JAEKIA010000004.1 GCA016405145_01199 CDS open 43598-44098 _na     166_aa hypothetical protein
1319 JAEKIA010000004.1 GCA016405145_01200 CDS open 44201-45415 _na     404_aa S8/S53 family peptidase
1320 JAEKIA010000004.1 GCA016405145_01201 CDS open 45665-46867 _na     400_aa S8/S53 family peptidase
1321 JAEKIA010000004.1 GCA016405145_01202 CDS open 47207-49906 _na     899_aa yukE putative protein YukE
1322 JAEKIA010000004.1 GCA016405145_01203 CDS open 49914-50315 _na     133_aa hypothetical protein
1323 JAEKIA010000004.1 GCA016405145_01204 CDS open 50369-52807 _na     812_aa von Willebrand factor%2C type A
1324 JAEKIA010000004.1 GCA016405145_01205 CDS open 52804-53994 _na     396_aa PASTA domain-containing protein
1325 JAEKIA010000004.1 GCA016405145_01206 CDS open 54400-55224 _na     274_aa DUF4037 domain-containing protein
1326 JAEKIA010000004.1 GCA016405145_01207 CDS open 55465-57936 _na     823_aa clpC ATP-dependent Clp protease ATP-binding subunit ClpC
1327 JAEKIA010000004.1 GCA016405145_01208 CDS open 58043-58834 _na     263_aa Two component system response regulator
1328 JAEKIA010000004.1 GCA016405145_01209 CDS open 58831-60420 _na     529_aa hypothetical protein
1329 JAEKIA010000004.1 GCA016405145_01210 CDS open 60414-62117 _na     567_aa Signal transduction histidine kinase subgroup 3 dimerisation and phosphoacceptor domain-containing protein
1330 JAEKIA010000004.1 GCA016405145_01211 CDS open 62326-63507 _na     393_aa DUF4428 domain-containing protein
1331 JAEKIA010000004.1 GCA016405145_01212 CDS open 63605-64459 _na     284_aa TPM domain-containing protein
1332 JAEKIA010000004.1 GCA016405145_01213 CDS open 64473-65666 _na     397_aa TFIIB-type zinc ribbon-containing protein
1333 JAEKIA010000004.1 GCA016405145_01214 CDS open 65866-67524 _na     552_aa SPFH domain-containing protein
1334 JAEKIA010000004.1 GCA016405145_01215 CDS open 67550-67732 _na     60_aa hypothetical protein
1335 JAEKIA010000004.1 GCA016405145_01216 CDS open 68288-70996 _na     902_aa ppdK pyruvate%2C phosphate dikinase
1336 JAEKIA010000004.1 GCA016405145_01217 CDS open 71519-73177 _na     552_aa L-lactate permease
1337 JAEKIA010000004.1 GCA016405145_01218 CDS open 73454-73960 _na     168_aa DUF4418 domain-containing protein
1338 JAEKIA010000004.1 GCA016405145_01219 CDS open 74002-74859 _na     285_aa DUF6273 domain-containing protein
1339 JAEKIA010000004.1 GCA016405145_01220 CDS open 74856-76049 _na     397_aa ABC3 transporter permease C-terminal domain-containing protein
1340 JAEKIA010000004.1 GCA016405145_01221 CDS open 76099-77295 _na     398_aa ABC superfamily ATP binding cassette transporter%2C membrane protein
1341 JAEKIA010000004.1 GCA016405145_01222 CDS open 77297-78097 _na     266_aa Lipoprotein releasing ABC superfamily ATP binding cassette transporter%2C ABC protein
1342 JAEKIA010000004.1 GCA016405145_01223 CDS open 78478-80088 _na     536_aa ofeT OfeT family oxidase-dependent iron (Fe2+) transporter
1343 JAEKIA010000004.1 GCA016405145_01224 CDS open 80130-80759 _na     209_aa Amino acid ABC transporter substrate-binding protein
1344 JAEKIA010000004.1 GCA016405145_01225 CDS open 81037-82299 _na     420_aa Membrane iron-sulfur containing protein FtrD-like domain-containing protein
1345 JAEKIA010000004.1 GCA016405145_01226 CDS open 82346-83617 _na     423_aa ABC superfamily ATP binding cassette transporter%2C membrane protein
1346 JAEKIA010000004.1 GCA016405145_01227 CDS open 83635-84855 _na     406_aa ABC superfamily ATP binding cassette transporter%2C membrane protein
1347 JAEKIA010000004.1 GCA016405145_01228 CDS open 84866-85609 _na     247_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
1348 JAEKIA010000004.1 GCA016405145_01229 CDS open 85606-86148 _na     180_aa FMN-binding protein
1349 JAEKIA010000004.1 GCA016405145_01230 CDS open 86148-87383 _na     411_aa FAD:protein FMN transferase
1350 JAEKIA010000004.1 GCA016405145_01231 CDS open 87491-89095 _na     534_aa DASS family divalent anion:sodium (Na+) symporter
1351 JAEKIA010000004.1 GCA016405145_01232 CDS open 89279-89458 _na     59_aa hypothetical protein
1352 JAEKIA010000004.1 GCA016405145_01233 CDS open 89501-90256 _na     251_aa ABC transporter permease
1353 JAEKIA010000004.1 GCA016405145_01234 CDS open 90262-91110 _na     282_aa mutG MutG family lantibiotic protection ABC superfamily ATP binding cassette transporter permease
1354 JAEKIA010000004.1 GCA016405145_01235 CDS open 91107-92057 _na     316_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
1355 JAEKIA010000004.1 GCA016405145_01236 CDS open 92403-95600 _na     1065_aa D-lactate dehydrogenase
1356 JAEKIA010000004.1 GCA016405145_01237 CDS open 95721-96929 _na     402_aa Cell division topological specificity factor
1357 JAEKIA010000004.1 GCA016405145_01238 CDS open 97215-98339 _na     374_aa Hydrolase
1358 JAEKIA010000004.1 GCA016405145_01239 CDS open 99020-99772 _na     250_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
1359 JAEKIA010000004.1 GCA016405145_01240 CDS open 99774-100646 _na     290_aa ABC transporter domain-containing protein
1360 JAEKIA010000004.1 GCA016405145_01241 CDS open 100646-101032 _na     128_aa gntR GntR family transcriptional regulator
1361 JAEKIA010000004.1 GCA016405145_01242 CDS open 101073-101603 _na     176_aa hypothetical protein
1362 JAEKIA010000004.1 GCA016405145_01243 CDS open 102005-103153 _na     382_aa homoserine O-acetyltransferase
1363 JAEKIA010000004.1 GCA016405145_01244 CDS open 103298-104632 _na     444_aa O-acetylhomoserine sulfhydrylase
1364 JAEKIA010000004.1 GCA016405145_01245 CDS open 104912-106282 _na     456_aa NLP/P60 family protein
1365 JAEKIA010000004.1 GCA016405145_01246 CDS open 106723-107217 _na     164_aa ppa Inorganic pyrophosphatase
1366 JAEKIA010000004.1 GCA016405145_01247 CDS open 107322-108698 _na     458_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
1367 JAEKIA010000004.1 GCA016405145_01248 CDS open 108788-109624 _na     278_aa hypothetical protein
1368 JAEKIA010000004.1 GCA016405145_01249 CDS open 109617-110801 _na     394_aa tRNA(Ile)-lysidine synthase
1369 JAEKIA010000004.1 GCA016405145_01250 CDS open 111048-111587 _na     179_aa hpt hypoxanthine phosphoribosyltransferase
1370 JAEKIA010000004.1 GCA016405145_01251 CDS open 111599-113611 _na     670_aa ftsH ATP-dependent zinc metalloprotease FtsH
1371 JAEKIA010000004.1 GCA016405145_01252 CDS open 113611-114180 _na     189_aa folE GTP cyclohydrolase I FolE
1372 JAEKIA010000004.1 GCA016405145_01253 CDS open 114246-115010 _na     254_aa folP dihydropteroate synthase
1373 JAEKIA010000004.1 GCA016405145_01254 CDS open 115007-117358 _na     783_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
1374 JAEKIA010000004.1 GCA016405145_01255 CDS open 117355-117840 _na     161_aa DUF3180 domain-containing protein
1375 JAEKIA010000004.1 GCA016405145_01256 CDS open 118044-118730 _na     228_aa hypothetical protein
1376 JAEKIA010000004.1 GCA016405145_01257 CDS open 119100-120170 _na     356_aa disA DNA integrity scanning diadenylate cyclase DisA
1377 JAEKIA010000004.1 GCA016405145_01258 CDS open 120206-121576 _na     456_aa radA DNA repair protein RadA
1378 JAEKIA010000004.1 GCA016405145_01259 CDS open 121744-122427 _na     227_aa Trk family potassium (K+) transporter%2C NAD+ binding protein
1379 JAEKIA010000004.1 GCA016405145_01260 CDS open 122455-123978 _na     507_aa trkB Trk family potassium uptake protein TrkB
1380 JAEKIA010000004.1 GCA016405145_01261 CDS open 124178-124396 _na     72_aa DNA binding domain protein
1381 JAEKIA010000004.1 GCA016405145_01262 CDS open 124492-124590 _na     32_aa 30S ribosomal protein bS22
1382 JAEKIA010000004.1 GCA016405145_01263 CDS open 124784-125452 _na     222_aa Phosphoglycerate mutase
1383 JAEKIA010000004.1 GCA016405145_01264 CDS open 125556-126002 _na     148_aa Cardiolipin synthase N-terminal domain-containing protein
1384 JAEKIA010000004.1 GCA016405145_01265 CDS open 126194-127087 _na     297_aa 1%2C4-dihydroxy-2-naphthoate polyprenyltransferase
1385 JAEKIA010000004.1 GCA016405145_01266 CDS open 127110-128435 _na     441_aa O-succinylbenzoic acid--CoA ligase
1386 JAEKIA010000004.1 GCA016405145_01267 CDS open 128832-129812 _na     326_aa 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
1387 JAEKIA010000004.1 GCA016405145_01268 CDS open 130170-131117 _na     315_aa hypothetical protein
1388 JAEKIA010000004.1 GCA016405145_01269 CDS open 131377-132450 _na     357_aa o-succinylbenzoate synthase
1389 JAEKIA010000004.1 GCA016405145_01270 CDS open 132447-134153 _na     568_aa menD 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase
1390 JAEKIA010000004.1 GCA016405145_01271 CDS open 134304-136118 _na     604_aa PDZ domain-containing protein
1391 JAEKIA010000004.1 GCA016405145_01272 CDS open 136447-137844 _na     465_aa isochorismate synthase
1392 JAEKIA010000004.1 GCA016405145_01273 CDS open 137936-138655 _na     239_aa Demethylmenaquinone methyltransferase
1393 JAEKIA010000004.1 GCA016405145_01274 CDS open 138907-140187 _na     426_aa Electron transfer oxidoreductase
1394 JAEKIA010000004.1 GCA016405145_01275 CDS open 140228-140587 _na     119_aa NADH-quinone oxidoreductase subunit A
1395 JAEKIA010000004.1 GCA016405145_01276 CDS open 140608-141162 _na     184_aa nuoB NADH-quinone oxidoreductase subunit B
1396 JAEKIA010000004.1 GCA016405145_01277 CDS open 141159-141869 _na     236_aa NADH-quinone oxidoreductase subunit C
1397 JAEKIA010000004.1 GCA016405145_01278 CDS open 141866-143218 _na     450_aa NADH-quinone oxidoreductase subunit D
1398 JAEKIA010000004.1 GCA016405145_01279 CDS open 143215-143907 _na     230_aa nuoE NADH-quinone oxidoreductase subunit NuoE
1399 JAEKIA010000004.1 GCA016405145_01280 CDS open 143904-145205 _na     433_aa nuoF NADH-quinone oxidoreductase subunit NuoF
1400 JAEKIA010000004.1 GCA016405145_01281 CDS open 145202-147766 _na     854_aa NADH-quinone oxidoreductase subunit G
1401 JAEKIA010000004.1 GCA016405145_01282 CDS open 147763-149073 _na     436_aa nuoH NADH-quinone oxidoreductase subunit NuoH
1402 JAEKIA010000004.1 GCA016405145_01283 CDS open 149066-149725 _na     219_aa nuoI NADH-quinone oxidoreductase subunit NuoI
1403 JAEKIA010000004.1 GCA016405145_01284 CDS open 149722-150693 _na     323_aa NADH-quinone oxidoreductase subunit J
1404 JAEKIA010000004.1 GCA016405145_01285 CDS open 150690-150989 _na     99_aa nuoK NADH-quinone oxidoreductase subunit NuoK
1405 JAEKIA010000004.1 GCA016405145_01286 CDS open 151004-152974 _na     656_aa nuoL NADH-quinone oxidoreductase subunit L
1406 JAEKIA010000004.1 GCA016405145_01287 CDS open 152989-154545 _na     518_aa NADH-quinone oxidoreductase subunit M
1407 JAEKIA010000004.1 GCA016405145_01288 CDS open 154542-156110 _na     522_aa nuoN NADH-quinone oxidoreductase subunit NuoN
1408 JAEKIA010000004.1 GCA016405145_01289 CDS open 156107-157120 _na     337_aa Trans-hexaprenyltranstransferase
1409 JAEKIA010000004.1 GCA016405145_01290 CDS open 157564-159060 _na     498_aa ferredoxin--NADP(+) reductase
1410 JAEKIA010000004.1 GCA016405145_01291 CDS open 159079-160107 _na     342_aa htpX zinc metalloprotease HtpX
1411 JAEKIA010000004.1 GCA016405145_01292 CDS open 160308-160811 _na     167_aa yajQ YajQ family cyclic di-GMP-binding protein
1412 JAEKIA010000004.1 GCA016405145_01296 CDS open 161344-161514 _na     56_aa rpmG 50S ribosomal protein L33
1413 JAEKIA010000004.1 GCA016405145_01297 CDS open 161749-162519 _na     256_aa gntR GntR family transcriptional regulator
1414 JAEKIA010000004.1 GCA016405145_01298 CDS open 162582-164138 _na     518_aa ABC superfamily ATP binding cassette transporter%2C binding protein
1415 JAEKIA010000004.1 GCA016405145_01299 CDS open 164249-165202 _na     317_aa ABC superfamily ATP binding cassette transporter%2C membrane protein
1416 JAEKIA010000004.1 GCA016405145_01300 CDS open 165202-167244 _na     680_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
1417 JAEKIA010000004.1 GCA016405145_01301 CDS open 167244-168062 _na     272_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
1418 JAEKIA010000004.1 GCA016405145_01302 CDS open 168062-168976 _na     304_aa N-acetylneuraminate lyase
1419 JAEKIA010000004.1 GCA016405145_01303 CDS open 169044-170003 _na     319_aa Glucokinase
1420 JAEKIA010000004.1 GCA016405145_01304 CDS open 170078-170755 _na     225_aa Putative N-acetylmannosamine-6-phosphate 2-epimerase
1421 JAEKIA010000004.1 GCA016405145_01305 CDS open 170796-172487 _na     563_aa Putative heroin esterase%2C chain A
1422 JAEKIA010000004.1 GCA016405145_01306 CDS open 172585-173358 _na     257_aa nagB glucosamine-6-phosphate deaminase
1423 JAEKIA010000004.1 GCA016405145_01307 CDS open 173657-174712 _na     351_aa galE UDP-glucose 4-epimerase GalE
1424 JAEKIA010000004.1 GCA016405145_01308 CDS open 174737-175867 _na     376_aa UDP-N-acetylmuramate dehydrogenase
1425 JAEKIA010000004.1 GCA016405145_01309 CDS open 175904-177028 _na     374_aa adenosine deaminase
1426 JAEKIA010000004.1 GCA016405145_01310 CDS open 177028-177858 _na     276_aa Monoglyceride lipase
1427 JAEKIA010000004.1 GCA016405145_01311 CDS open 178190-179710 _na     506_aa Aminotransferase
1428 JAEKIA010000004.1 GCA016405145_01313 CDS open 180106-180399 _na     97_aa secE preprotein translocase subunit SecE
1429 JAEKIA010000004.1 GCA016405145_01314 CDS open 180493-181236 _na     247_aa nusG transcription termination/antitermination protein NusG
1430 JAEKIA010000004.1 GCA016405145_01315 CDS open 181387-181818 _na     143_aa rplK 50S ribosomal protein L11
1431 JAEKIA010000004.1 GCA016405145_01316 CDS open 181891-182595 _na     234_aa rplA 50S ribosomal protein L1
1432 JAEKIA010000004.1 GCA016405145_01317 CDS open 183248-183421 _na     57_aa hypothetical protein
1433 JAEKIA010000004.1 GCA016405145_01318 CDS open 183515-184036 _na     173_aa rplJ 50S ribosomal protein L10
1434 JAEKIA010000004.1 GCA016405145_01319 CDS open 184139-184522 _na     127_aa rplL 50S ribosomal protein L7/L12
1435 JAEKIA010000004.1 GCA016405145_01171 gene open 1584-2267
1436 JAEKIA010000004.1 GCA016405145_01172 gene open 2716-3678
1437 JAEKIA010000004.1 GCA016405145_01173 gene open 3748-3972 hicB
1438 JAEKIA010000004.1 GCA016405145_01174 gene open 4236-5498
1439 JAEKIA010000004.1 GCA016405145_01175 gene open 5976-7256
1440 JAEKIA010000004.1 GCA016405145_01176 gene open 7657-7950
1441 JAEKIA010000004.1 GCA016405145_01177 gene open 8667-10208 fxsA
1442 JAEKIA010000004.1 GCA016405145_01178 gene open 10512-11168
1443 JAEKIA010000004.1 GCA016405145_01179 gene open 11165-12520 ygfZ
1444 JAEKIA010000004.1 GCA016405145_01180 gene open 12520-12945 dtd
1445 JAEKIA010000004.1 GCA016405145_01181 gene open 12861-13193
1446 JAEKIA010000004.1 GCA016405145_01182 gene open 13232-19048
1447 JAEKIA010000004.1 GCA016405145_01183 gene open 19133-20098
1448 JAEKIA010000004.1 GCA016405145_01184 gene open 20104-21351
1449 JAEKIA010000004.1 GCA016405145_01185 gene open 21348-23978
1450 JAEKIA010000004.1 GCA016405145_01186 gene open 23975-25576
1451 JAEKIA010000004.1 GCA016405145_01187 gene open 25820-27253
1452 JAEKIA010000004.1 GCA016405145_01188 gene open 27250-28710 eccB
1453 JAEKIA010000004.1 GCA016405145_01189 gene open 28710-30020 eccD
1454 JAEKIA010000004.1 GCA016405145_01190 gene open 30960-31271
1455 JAEKIA010000004.1 GCA016405145_01191 gene open 31303-31587
1456 JAEKIA010000004.1 GCA016405145_01192 gene open 31961-33352
1457 JAEKIA010000004.1 GCA016405145_01193 gene open 33349-34689 eccD
1458 JAEKIA010000004.1 GCA016405145_01194 gene open 34956-38990
1459 JAEKIA010000004.1 GCA016405145_01195 gene open 39089-39652
1460 JAEKIA010000004.1 GCA016405145_01196 gene open 39733-40590
1461 JAEKIA010000004.1 GCA016405145_01197 gene open 40606-42009
1462 JAEKIA010000004.1 GCA016405145_01198 gene open 42127-43554
1463 JAEKIA010000004.1 GCA016405145_01199 gene open 43598-44098
1464 JAEKIA010000004.1 GCA016405145_01200 gene open 44201-45415
1465 JAEKIA010000004.1 GCA016405145_01201 gene open 45665-46867
1466 JAEKIA010000004.1 GCA016405145_01202 gene open 47207-49906 yukE
1467 JAEKIA010000004.1 GCA016405145_01203 gene open 49914-50315
1468 JAEKIA010000004.1 GCA016405145_01204 gene open 50369-52807
1469 JAEKIA010000004.1 GCA016405145_01205 gene open 52804-53994
1470 JAEKIA010000004.1 GCA016405145_01206 gene open 54400-55224
1471 JAEKIA010000004.1 GCA016405145_01207 gene open 55465-57936 clpC
1472 JAEKIA010000004.1 GCA016405145_01208 gene open 58043-58834
1473 JAEKIA010000004.1 GCA016405145_01209 gene open 58831-60420
1474 JAEKIA010000004.1 GCA016405145_01210 gene open 60414-62117
1475 JAEKIA010000004.1 GCA016405145_01211 gene open 62326-63507
1476 JAEKIA010000004.1 GCA016405145_01212 gene open 63605-64459
1477 JAEKIA010000004.1 GCA016405145_01213 gene open 64473-65666
1478 JAEKIA010000004.1 GCA016405145_01214 gene open 65866-67524
1479 JAEKIA010000004.1 GCA016405145_01215 gene open 67550-67732
1480 JAEKIA010000004.1 GCA016405145_01216 gene open 68288-70996 ppdK
1481 JAEKIA010000004.1 GCA016405145_01217 gene open 71519-73177
1482 JAEKIA010000004.1 GCA016405145_01218 gene open 73454-73960
1483 JAEKIA010000004.1 GCA016405145_01219 gene open 74002-74859
1484 JAEKIA010000004.1 GCA016405145_01220 gene open 74856-76049
1485 JAEKIA010000004.1 GCA016405145_01221 gene open 76099-77295
1486 JAEKIA010000004.1 GCA016405145_01222 gene open 77297-78097
1487 JAEKIA010000004.1 GCA016405145_01223 gene open 78478-80088 ofeT
1488 JAEKIA010000004.1 GCA016405145_01224 gene open 80130-80759
1489 JAEKIA010000004.1 GCA016405145_01225 gene open 81037-82299
1490 JAEKIA010000004.1 GCA016405145_01226 gene open 82346-83617
1491 JAEKIA010000004.1 GCA016405145_01227 gene open 83635-84855
1492 JAEKIA010000004.1 GCA016405145_01228 gene open 84866-85609
1493 JAEKIA010000004.1 GCA016405145_01229 gene open 85606-86148
1494 JAEKIA010000004.1 GCA016405145_01230 gene open 86148-87383
1495 JAEKIA010000004.1 GCA016405145_01231 gene open 87491-89095
1496 JAEKIA010000004.1 GCA016405145_01232 gene open 89279-89458
1497 JAEKIA010000004.1 GCA016405145_01233 gene open 89501-90256
1498 JAEKIA010000004.1 GCA016405145_01234 gene open 90262-91110 mutG
1499 JAEKIA010000004.1 GCA016405145_01235 gene open 91107-92057
1500 JAEKIA010000004.1 GCA016405145_01236 gene open 92403-95600