HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Capnocytophaga endodontalis (GCA_016806985.1)

Select a Genome:
BAKTA Annotations for GCA_016806985.1
Genome Selected: Capnocytophaga endodontalis
ContigsBases CDSrRNA tmRNAtRNA
99 3200929 2961 4 1 41
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 6033 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:13]    |    Number of Records Found: 6033 [13 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
6001 JAESPI010000087.1 GCA016806985_02908 gene open 5864-6220
6002 JAESPI010000088.1 GCA016806985_02909 CDS open 117-395 _na     92_aa hypothetical protein
6003 JAESPI010000088.1 GCA016806985_02909 gene open 117-395
6004 JAESPI010000089.1 GCA016806985_02910 CDS open 350-994 _na     214_aa Integrase-like protein
6005 JAESPI010000089.1 GCA016806985_02910 gene open 350-994
6006 JAESPI010000090.1 GCA016806985_02999 CDS open 198-884 _na     228_aa Cytokinin riboside 5'-monophosphate phosphoribohydrolase
6007 JAESPI010000090.1 GCA016806985_03000 CDS open 1341-2504 _na     387_aa VWFA domain-containing protein
6008 JAESPI010000090.1 GCA016806985_03001 CDS open 2504-3247 _na     247_aa Outer membrane protein beta-barrel domain-containing protein
6009 JAESPI010000090.1 GCA016806985_03002 CDS open 3244-3624 _na     126_aa toxin
6010 JAESPI010000090.1 GCA016806985_03003 CDS open 3614-3868 _na     84_aa hypothetical protein
6011 JAESPI010000090.1 GCA016806985_02999 gene open 198-884
6012 JAESPI010000090.1 GCA016806985_03000 gene open 1341-2504
6013 JAESPI010000090.1 GCA016806985_03001 gene open 2504-3247
6014 JAESPI010000090.1 GCA016806985_03002 gene open 3244-3624
6015 JAESPI010000090.1 GCA016806985_03003 gene open 3614-3868
6016 JAESPI010000091.1 repeat_region open 61-496 CRISPR array with 6 repeats of length 46%2C consensus sequence GTTGTTATCAATCACAAAACTACAAAATTTGAAAGCAATTCACAAC and spacer length 29
6017 JAESPI010000091.1 repeat_region open 837-1121 CRISPR array with 4 repeats of length 47%2C consensus sequence GTTGTTATCAATCGCAAAACTACAAAATTTGAAAGCAATTCACAACG and spacer length 29
6018 JAESPI010000091.1 repeat_region open 2578-2804 CRISPR array with 3 repeats of length 47%2C consensus sequence GTTGTTATCAATCACAAAACTACAAAATTTGAAAGCAATTCACAACT and spacer length 28
6019 JAESPI010000091.1 GCA016806985_03004 CDS open 579-815 _na     78_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
6020 JAESPI010000091.1 GCA016806985_03005 CDS open 1461-1898 _na     145_aa Polymerase
6021 JAESPI010000091.1 GCA016806985_03006 CDS open 2050-2541 _na     163_aa Sulfatase
6022 JAESPI010000091.1 GCA016806985_03004 gene open 579-815
6023 JAESPI010000091.1 GCA016806985_03005 gene open 1461-1898
6024 JAESPI010000091.1 GCA016806985_03006 gene open 2050-2541
6025 JAESPI010000092.1 repeat_region open 273-727 CRISPR array with 6 repeats of length 46%2C consensus sequence GTTGTTATCAATCACAAAACTACAAAATTTGAAAGCAATTCACAAC and spacer length 29
6026 JAESPI010000096.1 GCA016806985_03007 CDS open 38-769 _na     243_aa tRNA threonylcarbamoyladenosine dehydratase
6027 JAESPI010000096.1 GCA016806985_03007 gene open 38-769
6028 JAESPI010000097.1 GCA016806985_03008 CDS open 270-500 _na     76_aa restriction endonuclease subunit S
6029 JAESPI010000097.1 GCA016806985_03009 CDS open 497-967 _na     156_aa restriction endonuclease subunit S
6030 JAESPI010000097.1 GCA016806985_03008 gene open 270-500
6031 JAESPI010000097.1 GCA016806985_03009 gene open 497-967
6032 JAESPI010000098.1 GCA016806985_03010 gene open 57-167 rrf
6033 JAESPI010000098.1 GCA016806985_03010 rRNA open 57-167 rrf 5S ribosomal RNA