HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella illustrans (GCA_017426725.1)

Select a Genome:
BAKTA Annotations for GCA_017426725.1
Genome Selected: Prevotella illustrans
ContigsBases CDSrRNA tmRNAtRNA
139 3088950 2510 6 1 51
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5149 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:10]    |    Number of Records Found: 5149 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4501 JAERMS010000044.1 GCA017426725_01688 gene open 5639-7828
4502 JAERMS010000044.1 GCA017426725_01689 gene open 7951-8130
4503 JAERMS010000044.1 GCA017426725_01690 gene open 8348-9172
4504 JAERMS010000044.1 GCA017426725_01691 gene open 9240-10898
4505 JAERMS010000044.1 GCA017426725_01692 gene open 11067-11957 pfkB
4506 JAERMS010000044.1 GCA017426725_01693 gene open 12014-13186
4507 JAERMS010000044.1 GCA017426725_01694 gene open 13333-13593
4508 JAERMS010000044.1 GCA017426725_01695 gene open 13794-14645
4509 JAERMS010000044.1 GCA017426725_01696 gene open 15292-17646
4510 JAERMS010000044.1 GCA017426725_01697 gene open 18314-18811 araC
4511 JAERMS010000044.1 GCA017426725_01698 gene open 18935-21007
4512 JAERMS010000045.1 GCA017426725_01699 CDS open 246-2174 _na     642_aa dnaK molecular chaperone DnaK
4513 JAERMS010000045.1 GCA017426725_01700 CDS open 2302-3186 _na     294_aa Acyltransferase
4514 JAERMS010000045.1 GCA017426725_01701 CDS open 3257-4327 _na     356_aa Agamatine deiminase
4515 JAERMS010000045.1 GCA017426725_01702 CDS open 4589-4708 _na     39_aa hypothetical protein
4516 JAERMS010000045.1 GCA017426725_01703 CDS open 4911-5552 _na     213_aa ABC transporter domain-containing protein
4517 JAERMS010000045.1 GCA017426725_01704 CDS open 5554-6318 _na     254_aa ABC transporter permease
4518 JAERMS010000045.1 GCA017426725_01705 CDS open 6315-7166 _na     283_aa Endonuclease
4519 JAERMS010000045.1 GCA017426725_01706 CDS open 7302-8099 _na     265_aa Nif3-like dinuclear metal center hexameric protein
4520 JAERMS010000045.1 GCA017426725_01707 CDS open 8162-8983 _na     273_aa C4-type zinc ribbon domain-containing protein
4521 JAERMS010000045.1 GCA017426725_01708 CDS open 9087-9551 _na     154_aa Putative enoyl-CoA hydratase 1
4522 JAERMS010000045.1 GCA017426725_01709 CDS open 9568-11046 _na     492_aa Type I phosphodiesterase/nucleotide pyrophosphatase
4523 JAERMS010000045.1 GCA017426725_01710 CDS open 11129-12547 _na     472_aa Amidophosphoribosyltransferase
4524 JAERMS010000045.1 GCA017426725_01711 CDS open 12993-13211 _na     72_aa hypothetical protein
4525 JAERMS010000045.1 GCA017426725_01712 CDS open 13254-15800 _na     848_aa Outer membrane protein beta-barrel domain-containing protein
4526 JAERMS010000045.1 GCA017426725_01713 CDS open 15804-16451 _na     215_aa fecR Protein FecR C-terminal domain-containing protein
4527 JAERMS010000045.1 GCA017426725_01714 CDS open 16448-16942 _na     164_aa RNA polymerase
4528 JAERMS010000045.1 GCA017426725_01715 CDS open 17135-18220 _na     361_aa AAA domain protein
4529 JAERMS010000045.1 GCA017426725_01716 CDS open 18513-18986 _na     157_aa asnC Transcriptional regulator%2C AsnC family
4530 JAERMS010000045.1 GCA017426725_01717 CDS open 19164-20288 _na     374_aa Methionine synthase%2C vitamin-B12 independent
4531 JAERMS010000045.1 GCA017426725_01718 CDS open 20329-21264 _na     311_aa S1/P1 Nuclease
4532 JAERMS010000045.1 GCA017426725_01699 gene open 246-2174 dnaK
4533 JAERMS010000045.1 GCA017426725_01700 gene open 2302-3186
4534 JAERMS010000045.1 GCA017426725_01701 gene open 3257-4327
4535 JAERMS010000045.1 GCA017426725_01702 gene open 4589-4708
4536 JAERMS010000045.1 GCA017426725_01703 gene open 4911-5552
4537 JAERMS010000045.1 GCA017426725_01704 gene open 5554-6318
4538 JAERMS010000045.1 GCA017426725_01705 gene open 6315-7166
4539 JAERMS010000045.1 GCA017426725_01706 gene open 7302-8099
4540 JAERMS010000045.1 GCA017426725_01707 gene open 8162-8983
4541 JAERMS010000045.1 GCA017426725_01708 gene open 9087-9551
4542 JAERMS010000045.1 GCA017426725_01709 gene open 9568-11046
4543 JAERMS010000045.1 GCA017426725_01710 gene open 11129-12547
4544 JAERMS010000045.1 GCA017426725_01711 gene open 12993-13211
4545 JAERMS010000045.1 GCA017426725_01712 gene open 13254-15800
4546 JAERMS010000045.1 GCA017426725_01713 gene open 15804-16451 fecR
4547 JAERMS010000045.1 GCA017426725_01714 gene open 16448-16942
4548 JAERMS010000045.1 GCA017426725_01715 gene open 17135-18220
4549 JAERMS010000045.1 GCA017426725_01716 gene open 18513-18986 asnC
4550 JAERMS010000045.1 GCA017426725_01717 gene open 19164-20288
4551 JAERMS010000045.1 GCA017426725_01718 gene open 20329-21264
4552 JAERMS010000046.1 GCA017426725_01719 CDS open 202-819 _na     205_aa 2-hydroxyhepta-2%2C4-diene-1%2C7-dioate isomerase
4553 JAERMS010000046.1 GCA017426725_01720 CDS open 859-4413 _na     1184_aa Por secretion system protein
4554 JAERMS010000046.1 GCA017426725_01721 CDS open 4468-5643 _na     391_aa porV type IX secretion system outer membrane channel protein PorV
4555 JAERMS010000046.1 GCA017426725_01722 CDS open 5667-6173 _na     168_aa 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase
4556 JAERMS010000046.1 GCA017426725_01723 CDS open 6384-6584 _na     66_aa hypothetical protein
4557 JAERMS010000046.1 GCA017426725_01724 CDS open 7006-9087 _na     693_aa Leucine-rich repeat domain-containing protein
4558 JAERMS010000046.1 GCA017426725_01725 CDS open 9090-10451 _na     453_aa hypothetical protein
4559 JAERMS010000046.1 GCA017426725_01726 CDS open 10466-10669 _na     67_aa Toxin PIN
4560 JAERMS010000046.1 GCA017426725_01727 CDS open 10944-11561 _na     205_aa Cytidylate kinase-like family protein
4561 JAERMS010000046.1 GCA017426725_01728 CDS open 11667-12191 _na     174_aa RNA polymerase sigma-70 factor
4562 JAERMS010000046.1 GCA017426725_01729 CDS open 12266-13222 _na     318_aa Anti-sigma factor
4563 JAERMS010000046.1 GCA017426725_01730 CDS open 13282-16650 _na     1122_aa SusC/RagA family TonB-linked outer membrane protein
4564 JAERMS010000046.1 GCA017426725_01731 CDS open 16675-17955 _na     426_aa RagB/SusD family nutrient uptake outer membrane protein
4565 JAERMS010000046.1 GCA017426725_01732 CDS open 17998-18906 _na     302_aa Phosphodiester glycosidase domain-containing protein
4566 JAERMS010000046.1 GCA017426725_01733 CDS open 18919-20325 _na     468_aa BACON domain-containing protein
4567 JAERMS010000046.1 GCA017426725_01734 CDS open 20496-21335 _na     279_aa Phosphodiester glycosidase domain-containing protein
4568 JAERMS010000046.1 GCA017426725_01719 gene open 202-819
4569 JAERMS010000046.1 GCA017426725_01720 gene open 859-4413
4570 JAERMS010000046.1 GCA017426725_01721 gene open 4468-5643 porV
4571 JAERMS010000046.1 GCA017426725_01722 gene open 5667-6173
4572 JAERMS010000046.1 GCA017426725_01723 gene open 6384-6584
4573 JAERMS010000046.1 GCA017426725_01724 gene open 7006-9087
4574 JAERMS010000046.1 GCA017426725_01725 gene open 9090-10451
4575 JAERMS010000046.1 GCA017426725_01726 gene open 10466-10669
4576 JAERMS010000046.1 GCA017426725_01727 gene open 10944-11561
4577 JAERMS010000046.1 GCA017426725_01728 gene open 11667-12191
4578 JAERMS010000046.1 GCA017426725_01729 gene open 12266-13222
4579 JAERMS010000046.1 GCA017426725_01730 gene open 13282-16650
4580 JAERMS010000046.1 GCA017426725_01731 gene open 16675-17955
4581 JAERMS010000046.1 GCA017426725_01732 gene open 17998-18906
4582 JAERMS010000046.1 GCA017426725_01733 gene open 18919-20325
4583 JAERMS010000046.1 GCA017426725_01734 gene open 20496-21335
4584 JAERMS010000047.1 GCA017426725_01735 CDS open 244-2466 _na     740_aa Response regulator receiver protein
4585 JAERMS010000047.1 GCA017426725_01736 CDS open 2581-3699 _na     372_aa Esterase
4586 JAERMS010000047.1 GCA017426725_01737 CDS open 3713-5986 _na     757_aa Putative alpha-1%2C2-mannosidase
4587 JAERMS010000047.1 GCA017426725_01738 CDS open 6075-8351 _na     758_aa prtT Thiol protease/hemagglutinin PrtT
4588 JAERMS010000047.1 GCA017426725_01739 CDS open 8669-8875 _na     68_aa hypothetical protein
4589 JAERMS010000047.1 GCA017426725_01740 CDS open 8995-10173 _na     392_aa galK galactokinase
4590 JAERMS010000047.1 GCA017426725_01741 CDS open 10222-10734 _na     170_aa N-acetyltransferase
4591 JAERMS010000047.1 GCA017426725_01742 CDS open 10742-10966 _na     74_aa hypothetical protein
4592 JAERMS010000047.1 GCA017426725_01743 CDS open 11022-12731 _na     569_aa Pseudouridine synthase
4593 JAERMS010000047.1 GCA017426725_01744 CDS open 12736-13641 _na     301_aa DUF2179 domain-containing protein
4594 JAERMS010000047.1 GCA017426725_01745 CDS open 13678-14997 _na     439_aa lpdA dihydrolipoyl dehydrogenase
4595 JAERMS010000047.1 GCA017426725_01746 CDS open 14984-16393 _na     469_aa gcvPB aminomethyl-transferring glycine dehydrogenase subunit GcvPB
4596 JAERMS010000047.1 GCA017426725_01747 CDS open 16390-17709 _na     439_aa gcvPA aminomethyl-transferring glycine dehydrogenase subunit GcvPA
4597 JAERMS010000047.1 GCA017426725_01748 CDS open 17713-18093 _na     126_aa gcvH glycine cleavage system protein GcvH
4598 JAERMS010000047.1 GCA017426725_01749 CDS open 18151-19227 _na     358_aa gcvT glycine cleavage system aminomethyltransferase GcvT
4599 JAERMS010000047.1 GCA017426725_01750 CDS open 19291-20262 _na     323_aa lipoate--protein ligase
4600 JAERMS010000047.1 GCA017426725_01735 gene open 244-2466
4601 JAERMS010000047.1 GCA017426725_01736 gene open 2581-3699
4602 JAERMS010000047.1 GCA017426725_01737 gene open 3713-5986
4603 JAERMS010000047.1 GCA017426725_01738 gene open 6075-8351 prtT
4604 JAERMS010000047.1 GCA017426725_01739 gene open 8669-8875
4605 JAERMS010000047.1 GCA017426725_01740 gene open 8995-10173 galK
4606 JAERMS010000047.1 GCA017426725_01741 gene open 10222-10734
4607 JAERMS010000047.1 GCA017426725_01742 gene open 10742-10966
4608 JAERMS010000047.1 GCA017426725_01743 gene open 11022-12731
4609 JAERMS010000047.1 GCA017426725_01744 gene open 12736-13641
4610 JAERMS010000047.1 GCA017426725_01745 gene open 13678-14997 lpdA
4611 JAERMS010000047.1 GCA017426725_01746 gene open 14984-16393 gcvPB
4612 JAERMS010000047.1 GCA017426725_01747 gene open 16390-17709 gcvPA
4613 JAERMS010000047.1 GCA017426725_01748 gene open 17713-18093 gcvH
4614 JAERMS010000047.1 GCA017426725_01749 gene open 18151-19227 gcvT
4615 JAERMS010000047.1 GCA017426725_01750 gene open 19291-20262
4616 JAERMS010000048.1 GCA017426725_01751 CDS open 216-1202 _na     328_aa Acetyltransferase (GNAT) domain protein
4617 JAERMS010000048.1 GCA017426725_01752 CDS open 1259-2083 _na     274_aa Glycerol acyltransferase
4618 JAERMS010000048.1 GCA017426725_01753 CDS open 2284-2436 _na     50_aa hypothetical protein
4619 JAERMS010000048.1 GCA017426725_01754 CDS open 2815-3270 _na     151_aa mraZ division/cell wall cluster transcriptional repressor MraZ
4620 JAERMS010000048.1 GCA017426725_01755 CDS open 3314-4243 _na     309_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
4621 JAERMS010000048.1 GCA017426725_01756 CDS open 4247-4696 _na     149_aa ftsL Cell division protein FtsL
4622 JAERMS010000048.1 GCA017426725_01757 CDS open 4753-6906 _na     717_aa Penicillin-binding protein
4623 JAERMS010000048.1 GCA017426725_01758 CDS open 6962-8413 _na     483_aa UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
4624 JAERMS010000048.1 GCA017426725_01759 CDS open 8453-9724 _na     423_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
4625 JAERMS010000048.1 GCA017426725_01760 CDS open 9819-11150 _na     443_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
4626 JAERMS010000048.1 GCA017426725_01761 CDS open 11162-12427 _na     421_aa ftsW putative peptidoglycan glycosyltransferase FtsW
4627 JAERMS010000048.1 GCA017426725_01762 CDS open 12518-13639 _na     373_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
4628 JAERMS010000048.1 GCA017426725_01763 CDS open 13630-15006 _na     458_aa murC UDP-N-acetylmuramate--L-alanine ligase
4629 JAERMS010000048.1 GCA017426725_01764 CDS open 15003-15797 _na     264_aa ftsQ Cell division protein FtsQ
4630 JAERMS010000048.1 GCA017426725_01765 CDS open 15826-17277 _na     483_aa ftsA cell division protein FtsA
4631 JAERMS010000048.1 GCA017426725_01766 CDS open 17300-18616 _na     438_aa ftsZ cell division protein FtsZ
4632 JAERMS010000048.1 GCA017426725_01751 gene open 216-1202
4633 JAERMS010000048.1 GCA017426725_01752 gene open 1259-2083
4634 JAERMS010000048.1 GCA017426725_01753 gene open 2284-2436
4635 JAERMS010000048.1 GCA017426725_01754 gene open 2815-3270 mraZ
4636 JAERMS010000048.1 GCA017426725_01755 gene open 3314-4243 rsmH
4637 JAERMS010000048.1 GCA017426725_01756 gene open 4247-4696 ftsL
4638 JAERMS010000048.1 GCA017426725_01757 gene open 4753-6906
4639 JAERMS010000048.1 GCA017426725_01758 gene open 6962-8413
4640 JAERMS010000048.1 GCA017426725_01759 gene open 8453-9724 mraY
4641 JAERMS010000048.1 GCA017426725_01760 gene open 9819-11150 murD
4642 JAERMS010000048.1 GCA017426725_01761 gene open 11162-12427 ftsW
4643 JAERMS010000048.1 GCA017426725_01762 gene open 12518-13639 murG
4644 JAERMS010000048.1 GCA017426725_01763 gene open 13630-15006 murC
4645 JAERMS010000048.1 GCA017426725_01764 gene open 15003-15797 ftsQ
4646 JAERMS010000048.1 GCA017426725_01765 gene open 15826-17277 ftsA
4647 JAERMS010000048.1 GCA017426725_01766 gene open 17300-18616 ftsZ
4648 JAERMS010000049.1 GCA017426725_01767 CDS open 324-1580 _na     418_aa DUF4843 domain-containing protein
4649 JAERMS010000049.1 GCA017426725_01768 CDS open 1592-1792 _na     66_aa hypothetical protein
4650 JAERMS010000049.1 GCA017426725_01769 CDS open 1808-3232 _na     474_aa RagB/SusD family nutrient uptake outer membrane protein
4651 JAERMS010000049.1 GCA017426725_01770 CDS open 3244-6561 _na     1105_aa SusC/RagA family TonB-linked outer membrane protein
4652 JAERMS010000049.1 GCA017426725_01771 CDS open 6628-8865 _na     745_aa S9 family peptidase
4653 JAERMS010000049.1 GCA017426725_01772 CDS open 8872-10416 _na     514_aa Serine protease
4654 JAERMS010000049.1 GCA017426725_01773 CDS open 11260-11616 _na     118_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
4655 JAERMS010000049.1 GCA017426725_01774 CDS open 11675-12859 _na     394_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
4656 JAERMS010000049.1 GCA017426725_01775 CDS open 12861-13571 _na     236_aa truB tRNA pseudouridine(55) synthase TruB
4657 JAERMS010000049.1 GCA017426725_01776 CDS open 13572-14492 _na     306_aa undecaprenyl-diphosphate phosphatase
4658 JAERMS010000049.1 GCA017426725_01777 CDS open 14492-14728 _na     78_aa PF11297 family protein
4659 JAERMS010000049.1 GCA017426725_01778 CDS open 14789-15667 _na     292_aa ftsX Cell division protein FtsX
4660 JAERMS010000049.1 GCA017426725_01779 CDS open 15779-16537 _na     252_aa Radical SAM core domain-containing protein
4661 JAERMS010000049.1 GCA017426725_01780 CDS open 16537-16659 _na     40_aa hypothetical protein
4662 JAERMS010000049.1 GCA017426725_01781 CDS open 16699-17667 _na     322_aa Anti-sigma factor
4663 JAERMS010000049.1 GCA017426725_01782 CDS open 17769-18299 _na     176_aa RNA polymerase sigma-70 factor
4664 JAERMS010000049.1 GCA017426725_01767 gene open 324-1580
4665 JAERMS010000049.1 GCA017426725_01768 gene open 1592-1792
4666 JAERMS010000049.1 GCA017426725_01769 gene open 1808-3232
4667 JAERMS010000049.1 GCA017426725_01770 gene open 3244-6561
4668 JAERMS010000049.1 GCA017426725_01771 gene open 6628-8865
4669 JAERMS010000049.1 GCA017426725_01772 gene open 8872-10416
4670 JAERMS010000049.1 GCA017426725_01773 gene open 11260-11616 folK
4671 JAERMS010000049.1 GCA017426725_01774 gene open 11675-12859 queA
4672 JAERMS010000049.1 GCA017426725_01775 gene open 12861-13571 truB
4673 JAERMS010000049.1 GCA017426725_01776 gene open 13572-14492
4674 JAERMS010000049.1 GCA017426725_01777 gene open 14492-14728
4675 JAERMS010000049.1 GCA017426725_01778 gene open 14789-15667 ftsX
4676 JAERMS010000049.1 GCA017426725_01779 gene open 15779-16537
4677 JAERMS010000049.1 GCA017426725_01780 gene open 16537-16659
4678 JAERMS010000049.1 GCA017426725_01781 gene open 16699-17667
4679 JAERMS010000049.1 GCA017426725_01782 gene open 17769-18299
4680 JAERMS010000050.1 GCA017426725_01888 CDS open 507-1082 _na     191_aa RNA polymerase subunit sigma-24
4681 JAERMS010000050.1 GCA017426725_01889 CDS open 1177-1833 _na     218_aa rpe ribulose-phosphate 3-epimerase
4682 JAERMS010000050.1 GCA017426725_01890 CDS open 2305-3756 _na     483_aa Glycoside hydrolase%2C family 57
4683 JAERMS010000050.1 GCA017426725_01891 CDS open 3826-5082 _na     418_aa 4-alpha-glucanotransferase
4684 JAERMS010000050.1 GCA017426725_01892 CDS open 5097-7052 _na     651_aa Putative glycogen debranching enzyme
4685 JAERMS010000050.1 GCA017426725_01893 CDS open 7468-8004 _na     178_aa hypothetical protein
4686 JAERMS010000050.1 GCA017426725_01894 CDS open 8008-8931 _na     307_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
4687 JAERMS010000050.1 GCA017426725_01895 CDS open 9005-10033 _na     342_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
4688 JAERMS010000050.1 GCA017426725_01896 CDS open 10332-10757 _na     141_aa mscL large-conductance mechanosensitive channel protein MscL
4689 JAERMS010000050.1 GCA017426725_01897 CDS open 11642-13450 _na     602_aa mutS DNA mismatch repair protein MutS
4690 JAERMS010000050.1 GCA017426725_01898 CDS open 13515-13652 _na     45_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
4691 JAERMS010000050.1 GCA017426725_01899 CDS open 13657-15201 _na     514_aa guaA glutamine-hydrolyzing GMP synthase
4692 JAERMS010000050.1 GCA017426725_01900 CDS open 15288-16127 _na     279_aa Mannose-1-phosphate guanyltransferase
4693 JAERMS010000050.1 GCA017426725_01901 CDS open 16124-17854 _na     576_aa Phosphotransferase
4694 JAERMS010000050.1 GCA017426725_01888 gene open 507-1082
4695 JAERMS010000050.1 GCA017426725_01889 gene open 1177-1833 rpe
4696 JAERMS010000050.1 GCA017426725_01890 gene open 2305-3756
4697 JAERMS010000050.1 GCA017426725_01891 gene open 3826-5082
4698 JAERMS010000050.1 GCA017426725_01892 gene open 5097-7052
4699 JAERMS010000050.1 GCA017426725_01893 gene open 7468-8004
4700 JAERMS010000050.1 GCA017426725_01894 gene open 8008-8931 miaA
4701 JAERMS010000050.1 GCA017426725_01895 gene open 9005-10033 gap
4702 JAERMS010000050.1 GCA017426725_01896 gene open 10332-10757 mscL
4703 JAERMS010000050.1 GCA017426725_01897 gene open 11642-13450 mutS
4704 JAERMS010000050.1 GCA017426725_01898 gene open 13515-13652
4705 JAERMS010000050.1 GCA017426725_01899 gene open 13657-15201 guaA
4706 JAERMS010000050.1 GCA017426725_01900 gene open 15288-16127
4707 JAERMS010000050.1 GCA017426725_01901 gene open 16124-17854
4708 JAERMS010000051.1 GCA017426725_01902 CDS open 714-1154 _na     146_aa Transglycosylase
4709 JAERMS010000051.1 GCA017426725_01903 CDS open 1298-1858 _na     186_aa lemA LemA family protein
4710 JAERMS010000051.1 GCA017426725_01904 CDS open 1863-2873 _na     336_aa Protease
4711 JAERMS010000051.1 GCA017426725_01905 CDS open 2876-3568 _na     230_aa Serine acetyltransferase
4712 JAERMS010000051.1 GCA017426725_01907 CDS open 4582-5175 _na     197_aa acrR HTH tetR-type domain-containing protein
4713 JAERMS010000051.1 GCA017426725_01908 CDS open 5204-5950 _na     248_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
4714 JAERMS010000051.1 GCA017426725_01909 CDS open 5952-6620 _na     222_aa RNA pseudouridine synthase
4715 JAERMS010000051.1 GCA017426725_01910 CDS open 6703-11325 _na     1540_aa Phage tail protein
4716 JAERMS010000051.1 GCA017426725_01911 CDS open 11333-13627 _na     764_aa Bacterial surface antigen (D15) domain-containing protein
4717 JAERMS010000051.1 GCA017426725_01912 CDS open 13708-14199 _na     163_aa 5-nitroimidazole antibiotic resistance protein
4718 JAERMS010000051.1 GCA017426725_01913 CDS open 14226-15293 _na     355_aa aroB 3-dehydroquinate synthase
4719 JAERMS010000051.1 GCA017426725_01914 CDS open 15809-17086 _na     425_aa DKNYY family protein
4720 JAERMS010000051.1 GCA017426725_01915 CDS open 17249-18148 _na     299_aa araC AraC family transcriptional regulator
4721 JAERMS010000051.1 GCA017426725_01902 gene open 714-1154
4722 JAERMS010000051.1 GCA017426725_01903 gene open 1298-1858 lemA
4723 JAERMS010000051.1 GCA017426725_01904 gene open 1863-2873
4724 JAERMS010000051.1 GCA017426725_01905 gene open 2876-3568
4725 JAERMS010000051.1 GCA017426725_01907 gene open 4582-5175 acrR
4726 JAERMS010000051.1 GCA017426725_01908 gene open 5204-5950 fabG
4727 JAERMS010000051.1 GCA017426725_01909 gene open 5952-6620
4728 JAERMS010000051.1 GCA017426725_01910 gene open 6703-11325
4729 JAERMS010000051.1 GCA017426725_01911 gene open 11333-13627
4730 JAERMS010000051.1 GCA017426725_01912 gene open 13708-14199
4731 JAERMS010000051.1 GCA017426725_01913 gene open 14226-15293 aroB
4732 JAERMS010000051.1 GCA017426725_01914 gene open 15809-17086
4733 JAERMS010000051.1 GCA017426725_01915 gene open 17249-18148 araC
4734 JAERMS010000051.1 GCA017426725_01906 gene open 4213-4285 trnfM
4735 JAERMS010000051.1 GCA017426725_01906 tRNA open 4213-4285 trnfM tRNA-fMet(cat)
4736 JAERMS010000052.1 GCA017426725_01916 CDS open 149-1777 _na     542_aa groL chaperonin GroEL
4737 JAERMS010000052.1 GCA017426725_01917 CDS open 1840-2109 _na     89_aa Co-chaperonin GroES
4738 JAERMS010000052.1 GCA017426725_01918 CDS open 2701-4584 _na     627_aa sppA signal peptide peptidase SppA
4739 JAERMS010000052.1 GCA017426725_01919 CDS open 4598-5779 _na     393_aa lpxK tetraacyldisaccharide 4'-kinase
4740 JAERMS010000052.1 GCA017426725_01920 CDS open 5883-6473 _na     196_aa purine-nucleoside phosphorylase
4741 JAERMS010000052.1 GCA017426725_01921 CDS open 6507-7571 _na     354_aa thiL thiamine-phosphate kinase
4742 JAERMS010000052.1 GCA017426725_01923 CDS open 8465-9124 _na     219_aa rhuM Virulence RhuM family protein
4743 JAERMS010000052.1 GCA017426725_01924 CDS open 9136-9462 _na     108_aa rhuM RhuM family protein
4744 JAERMS010000052.1 GCA017426725_01925 CDS open 9637-9843 _na     68_aa tatA Sec-independent protein translocase protein TatA
4745 JAERMS010000052.1 GCA017426725_01926 CDS open 9843-10622 _na     259_aa tatC twin-arginine translocase subunit TatC
4746 JAERMS010000052.1 GCA017426725_01927 CDS open 10650-11333 _na     227_aa tsaA tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO
4747 JAERMS010000052.1 GCA017426725_01928 CDS open 11330-11998 _na     222_aa Phospholipid phosphatase
4748 JAERMS010000052.1 GCA017426725_01929 CDS open 12005-13843 _na     612_aa Sulfatase
4749 JAERMS010000052.1 GCA017426725_01930 CDS open 13853-14704 _na     283_aa Patatin family protein
4750 JAERMS010000052.1 GCA017426725_01931 CDS open 14802-14930 _na     42_aa hypothetical protein
4751 JAERMS010000052.1 GCA017426725_01916 gene open 149-1777 groL
4752 JAERMS010000052.1 GCA017426725_01917 gene open 1840-2109
4753 JAERMS010000052.1 GCA017426725_01918 gene open 2701-4584 sppA
4754 JAERMS010000052.1 GCA017426725_01919 gene open 4598-5779 lpxK
4755 JAERMS010000052.1 GCA017426725_01920 gene open 5883-6473
4756 JAERMS010000052.1 GCA017426725_01921 gene open 6507-7571 thiL
4757 JAERMS010000052.1 GCA017426725_01923 gene open 8465-9124 rhuM
4758 JAERMS010000052.1 GCA017426725_01924 gene open 9136-9462 rhuM
4759 JAERMS010000052.1 GCA017426725_01925 gene open 9637-9843 tatA
4760 JAERMS010000052.1 GCA017426725_01926 gene open 9843-10622 tatC
4761 JAERMS010000052.1 GCA017426725_01927 gene open 10650-11333 tsaA
4762 JAERMS010000052.1 GCA017426725_01928 gene open 11330-11998
4763 JAERMS010000052.1 GCA017426725_01929 gene open 12005-13843
4764 JAERMS010000052.1 GCA017426725_01930 gene open 13853-14704
4765 JAERMS010000052.1 GCA017426725_01931 gene open 14802-14930
4766 JAERMS010000052.1 GCA017426725_01922 gene open 7954-8026 trnF
4767 JAERMS010000052.1 GCA017426725_01922 tRNA open 7954-8026 trnF tRNA-Phe(gaa)
4768 JAERMS010000053.1 GCA017426725_01932 CDS open 387-1349 _na     320_aa Tetratricopeptide repeat protein
4769 JAERMS010000053.1 GCA017426725_01933 CDS open 1309-1971 _na     220_aa hypothetical protein
4770 JAERMS010000053.1 GCA017426725_01934 CDS open 2295-2405 _na     36_aa hypothetical protein
4771 JAERMS010000053.1 GCA017426725_01935 CDS open 2428-5520 _na     1030_aa SusC/RagA family TonB-linked outer membrane protein
4772 JAERMS010000053.1 GCA017426725_01936 CDS open 5548-7152 _na     534_aa RagB/SusD family nutrient uptake outer membrane protein
4773 JAERMS010000053.1 GCA017426725_01937 CDS open 7174-7932 _na     252_aa DUF4843 domain-containing protein
4774 JAERMS010000053.1 GCA017426725_01938 CDS open 7954-9633 _na     559_aa PKD-like family
4775 JAERMS010000053.1 GCA017426725_01939 CDS open 9868-10968 _na     366_aa DUF4861 domain-containing protein
4776 JAERMS010000053.1 GCA017426725_01940 CDS open 10996-13815 _na     939_aa Peptidase M16
4777 JAERMS010000053.1 GCA017426725_01932 gene open 387-1349
4778 JAERMS010000053.1 GCA017426725_01933 gene open 1309-1971
4779 JAERMS010000053.1 GCA017426725_01934 gene open 2295-2405
4780 JAERMS010000053.1 GCA017426725_01935 gene open 2428-5520
4781 JAERMS010000053.1 GCA017426725_01936 gene open 5548-7152
4782 JAERMS010000053.1 GCA017426725_01937 gene open 7174-7932
4783 JAERMS010000053.1 GCA017426725_01938 gene open 7954-9633
4784 JAERMS010000053.1 GCA017426725_01939 gene open 9868-10968
4785 JAERMS010000053.1 GCA017426725_01940 gene open 10996-13815
4786 JAERMS010000054.1 GCA017426725_01941 CDS open 278-1171 _na     297_aa 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
4787 JAERMS010000054.1 GCA017426725_01942 CDS open 1174-2229 _na     351_aa DUF1573 domain-containing protein
4788 JAERMS010000054.1 GCA017426725_01943 CDS open 2232-7715 _na     1827_aa Alpha-2-macroglobulin
4789 JAERMS010000054.1 GCA017426725_01944 CDS open 8318-9250 _na     310_aa motA Flagellar motor protein MotA
4790 JAERMS010000054.1 GCA017426725_01945 CDS open 9247-9762 _na     171_aa DUF2975 domain-containing protein
4791 JAERMS010000054.1 GCA017426725_01946 CDS open 9759-10289 _na     176_aa exbD Biopolymer transporter ExbD
4792 JAERMS010000054.1 GCA017426725_01947 CDS open 10286-10741 _na     151_aa exbD Biopolymer transporter ExbD
4793 JAERMS010000054.1 GCA017426725_01948 CDS open 10717-10860 _na     47_aa hypothetical protein
4794 JAERMS010000054.1 GCA017426725_01949 CDS open 10919-13006 _na     695_aa Peptidase
4795 JAERMS010000054.1 GCA017426725_01941 gene open 278-1171
4796 JAERMS010000054.1 GCA017426725_01942 gene open 1174-2229
4797 JAERMS010000054.1 GCA017426725_01943 gene open 2232-7715
4798 JAERMS010000054.1 GCA017426725_01944 gene open 8318-9250 motA
4799 JAERMS010000054.1 GCA017426725_01945 gene open 9247-9762
4800 JAERMS010000054.1 GCA017426725_01946 gene open 9759-10289 exbD
4801 JAERMS010000054.1 GCA017426725_01947 gene open 10286-10741 exbD
4802 JAERMS010000054.1 GCA017426725_01948 gene open 10717-10860
4803 JAERMS010000054.1 GCA017426725_01949 gene open 10919-13006
4804 JAERMS010000055.1 GCA017426725_01958 gene open 7679-7869 Bacteroidales-1
4805 JAERMS010000055.1 GCA017426725_01958 ncRNA open 7679-7869 Bacteroidales-1 6S-Bacteroidales RNA suggested
4806 JAERMS010000055.1 GCA017426725_01950 CDS open 87-1133 _na     348_aa Endolytic murein transglycosylase
4807 JAERMS010000055.1 GCA017426725_01951 CDS open 1223-1873 _na     216_aa Putative phosphoglycolate phosphatase
4808 JAERMS010000055.1 GCA017426725_01952 CDS open 1894-3132 _na     412_aa MacB-like periplasmic core domain protein
4809 JAERMS010000055.1 GCA017426725_01953 CDS open 3193-3969 _na     258_aa ABC transporter%2C ATP-binding protein
4810 JAERMS010000055.1 GCA017426725_01954 CDS open 4047-5213 _na     388_aa Efflux RND transporter periplasmic adaptor subunit
4811 JAERMS010000055.1 GCA017426725_01955 CDS open 5479-6819 _na     446_aa tolC TolC family protein
4812 JAERMS010000055.1 GCA017426725_01956 CDS open 7014-7616 _na     200_aa riboflavin synthase
4813 JAERMS010000055.1 GCA017426725_01957 CDS open 7609-7809 _na     66_aa hypothetical protein
4814 JAERMS010000055.1 GCA017426725_01959 CDS open 7937-9586 _na     549_aa Glycosyl hydrolase-like 10 domain-containing protein
4815 JAERMS010000055.1 GCA017426725_01960 CDS open 9696-10184 _na     162_aa Outer membrane protein beta-barrel domain-containing protein
4816 JAERMS010000055.1 GCA017426725_01961 CDS open 10188-10796 _na     202_aa recR recombination mediator RecR
4817 JAERMS010000055.1 GCA017426725_01962 CDS open 10850-11284 _na     144_aa hypothetical protein
4818 JAERMS010000055.1 GCA017426725_01963 CDS open 11203-11463 _na     86_aa hypothetical protein
4819 JAERMS010000055.1 GCA017426725_01964 CDS open 11536-12534 _na     332_aa Glycosyl transferase family 2
4820 JAERMS010000055.1 GCA017426725_01965 CDS open 12512-13036 _na     174_aa GNAT family N-acetyltransferase
4821 JAERMS010000055.1 GCA017426725_01950 gene open 87-1133
4822 JAERMS010000055.1 GCA017426725_01951 gene open 1223-1873
4823 JAERMS010000055.1 GCA017426725_01952 gene open 1894-3132
4824 JAERMS010000055.1 GCA017426725_01953 gene open 3193-3969
4825 JAERMS010000055.1 GCA017426725_01954 gene open 4047-5213
4826 JAERMS010000055.1 GCA017426725_01955 gene open 5479-6819 tolC
4827 JAERMS010000055.1 GCA017426725_01956 gene open 7014-7616
4828 JAERMS010000055.1 GCA017426725_01957 gene open 7609-7809
4829 JAERMS010000055.1 GCA017426725_01959 gene open 7937-9586
4830 JAERMS010000055.1 GCA017426725_01960 gene open 9696-10184
4831 JAERMS010000055.1 GCA017426725_01961 gene open 10188-10796 recR
4832 JAERMS010000055.1 GCA017426725_01962 gene open 10850-11284
4833 JAERMS010000055.1 GCA017426725_01963 gene open 11203-11463
4834 JAERMS010000055.1 GCA017426725_01964 gene open 11536-12534
4835 JAERMS010000055.1 GCA017426725_01965 gene open 12512-13036
4836 JAERMS010000056.1 GCA017426725_01966 CDS open 101-1264 _na     387_aa nspC carboxynorspermidine decarboxylase
4837 JAERMS010000056.1 GCA017426725_01967 CDS open 1729-2667 _na     312_aa prsA Ribose-phosphate pyrophosphokinase
4838 JAERMS010000056.1 GCA017426725_01968 CDS open 3377-5068 _na     563_aa Glycosyl hydrolase family 32
4839 JAERMS010000056.1 GCA017426725_01969 CDS open 5882-8011 _na     709_aa Peptidase family M3
4840 JAERMS010000056.1 GCA017426725_01970 CDS open 8040-8138 _na     32_aa hypothetical protein
4841 JAERMS010000056.1 GCA017426725_01971 CDS open 8224-10785 _na     853_aa Alpha-glucan phosphorylase
4842 JAERMS010000056.1 GCA017426725_01972 CDS open 10842-12554 _na     570_aa Glycosyl transferase
4843 JAERMS010000056.1 GCA017426725_01973 CDS open 12666-13100 _na     144_aa DUF4251 domain-containing protein
4844 JAERMS010000056.1 GCA017426725_01966 gene open 101-1264 nspC
4845 JAERMS010000056.1 GCA017426725_01967 gene open 1729-2667 prsA
4846 JAERMS010000056.1 GCA017426725_01968 gene open 3377-5068
4847 JAERMS010000056.1 GCA017426725_01969 gene open 5882-8011
4848 JAERMS010000056.1 GCA017426725_01970 gene open 8040-8138
4849 JAERMS010000056.1 GCA017426725_01971 gene open 8224-10785
4850 JAERMS010000056.1 GCA017426725_01972 gene open 10842-12554
4851 JAERMS010000056.1 GCA017426725_01973 gene open 12666-13100
4852 JAERMS010000057.1 GCA017426725_01974 CDS open 89-1636 _na     515_aa Arylsulfatase
4853 JAERMS010000057.1 GCA017426725_01975 CDS open 1924-3474 _na     516_aa Serine hydrolase
4854 JAERMS010000057.1 GCA017426725_01977 CDS open 3892-4683 _na     263_aa ADP-ribosylglycohydrolase
4855 JAERMS010000057.1 GCA017426725_01978 CDS open 4796-5428 _na     210_aa DUF4294 domain-containing protein
4856 JAERMS010000057.1 GCA017426725_01979 CDS open 5565-7463 _na     632_aa 2-oxoacid:acceptor oxidoreductase%2C alpha subunit
4857 JAERMS010000057.1 GCA017426725_01980 CDS open 7536-8546 _na     336_aa Thiamine pyrophosphate enzyme%2C C-terminal TPP binding domain protein
4858 JAERMS010000057.1 GCA017426725_01981 CDS open 8763-11396 _na     877_aa mutS DNA mismatch repair protein MutS
4859 JAERMS010000057.1 GCA017426725_01974 gene open 89-1636
4860 JAERMS010000057.1 GCA017426725_01975 gene open 1924-3474
4861 JAERMS010000057.1 GCA017426725_01977 gene open 3892-4683
4862 JAERMS010000057.1 GCA017426725_01978 gene open 4796-5428
4863 JAERMS010000057.1 GCA017426725_01979 gene open 5565-7463
4864 JAERMS010000057.1 GCA017426725_01980 gene open 7536-8546
4865 JAERMS010000057.1 GCA017426725_01981 gene open 8763-11396 mutS
4866 JAERMS010000057.1 GCA017426725_01976 gene open 3782-3853 trnR
4867 JAERMS010000057.1 GCA017426725_01976 tRNA open 3782-3853 trnR tRNA-Arg(cct)
4868 JAERMS010000058.1 repeat_region open 26-1555 CRISPR array with 24 repeats of length 30%2C consensus sequence GTTTTAATCGTACCTTAGTGGAATTGAAAT and spacer length 34
4869 JAERMS010000058.1 GCA017426725_01982 CDS open 2947-3111 _na     54_aa hypothetical protein
4870 JAERMS010000058.1 GCA017426725_01983 CDS open 3302-3847 _na     181_aa Alpha galactosidase A
4871 JAERMS010000058.1 GCA017426725_01984 CDS open 3888-4517 _na     209_aa glycoside hydrolase family 27 protein
4872 JAERMS010000058.1 GCA017426725_01985 CDS open 4565-4900 _na     111_aa Glycosyl hydrolase family 95 N-terminal domain-containing protein
4873 JAERMS010000058.1 GCA017426725_01986 CDS open 5365-7152 _na     595_aa RagB/SusD family nutrient uptake outer membrane protein
4874 JAERMS010000058.1 GCA017426725_01987 CDS open 7194-10496 _na     1100_aa TonB-dependent receptor
4875 JAERMS010000058.1 GCA017426725_01988 CDS open 10493-10582 _na     29_aa hypothetical protein
4876 JAERMS010000058.1 GCA017426725_01982 gene open 2947-3111
4877 JAERMS010000058.1 GCA017426725_01983 gene open 3302-3847
4878 JAERMS010000058.1 GCA017426725_01984 gene open 3888-4517
4879 JAERMS010000058.1 GCA017426725_01985 gene open 4565-4900
4880 JAERMS010000058.1 GCA017426725_01986 gene open 5365-7152
4881 JAERMS010000058.1 GCA017426725_01987 gene open 7194-10496
4882 JAERMS010000058.1 GCA017426725_01988 gene open 10493-10582
4883 JAERMS010000059.1 GCA017426725_01989 CDS open 176-1093 _na     305_aa Peptidoglycan hydrolase
4884 JAERMS010000059.1 GCA017426725_01990 CDS open 1214-1669 _na     151_aa DUF4293 domain-containing protein
4885 JAERMS010000059.1 GCA017426725_01991 CDS open 1675-2007 _na     110_aa RNA polymerase Rpb6
4886 JAERMS010000059.1 GCA017426725_01992 CDS open 2030-2887 _na     285_aa bamD Outer membrane protein assembly factor BamD
4887 JAERMS010000059.1 GCA017426725_01993 CDS open 3030-5060 _na     676_aa uvrB excinuclease ABC subunit UvrB
4888 JAERMS010000059.1 GCA017426725_01994 CDS open 5197-6009 _na     270_aa DUF4468 domain-containing protein
4889 JAERMS010000059.1 GCA017426725_01995 CDS open 6006-6257 _na     83_aa mscS Mechanosensitive ion channel protein MscS
4890 JAERMS010000059.1 GCA017426725_01996 CDS open 6261-8570 _na     769_aa Porin
4891 JAERMS010000059.1 GCA017426725_01997 CDS open 8573-9505 _na     310_aa menA 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase
4892 JAERMS010000059.1 GCA017426725_01998 CDS open 9542-10150 _na     202_aa Phosphohydrolase
4893 JAERMS010000059.1 GCA017426725_01989 gene open 176-1093
4894 JAERMS010000059.1 GCA017426725_01990 gene open 1214-1669
4895 JAERMS010000059.1 GCA017426725_01991 gene open 1675-2007
4896 JAERMS010000059.1 GCA017426725_01992 gene open 2030-2887 bamD
4897 JAERMS010000059.1 GCA017426725_01993 gene open 3030-5060 uvrB
4898 JAERMS010000059.1 GCA017426725_01994 gene open 5197-6009
4899 JAERMS010000059.1 GCA017426725_01995 gene open 6006-6257 mscS
4900 JAERMS010000059.1 GCA017426725_01996 gene open 6261-8570
4901 JAERMS010000059.1 GCA017426725_01997 gene open 8573-9505 menA
4902 JAERMS010000059.1 GCA017426725_01998 gene open 9542-10150
4903 JAERMS010000059.1 GCA017426725_01999 gene open 10190-10262 trnT
4904 JAERMS010000059.1 GCA017426725_02000 gene open 10295-10367 trnG
4905 JAERMS010000059.1 GCA017426725_01999 tRNA open 10190-10262 trnT tRNA-Thr(cgt)
4906 JAERMS010000059.1 GCA017426725_02000 tRNA open 10295-10367 trnG tRNA-Gly(ccc)
4907 JAERMS010000060.1 GCA017426725_02117 CDS open 96-764 _na     222_aa B3/B4 tRNA-binding domain-containing protein
4908 JAERMS010000060.1 GCA017426725_02118 CDS open 834-1013 _na     59_aa hypothetical protein
4909 JAERMS010000060.1 GCA017426725_02119 CDS open 1405-4425 _na     1006_aa TonB-dependent receptor
4910 JAERMS010000060.1 GCA017426725_02120 CDS open 4452-5903 _na     483_aa RagB/SusD family nutrient uptake outer membrane protein
4911 JAERMS010000060.1 GCA017426725_02121 CDS open 6015-7391 _na     458_aa Beta-glucosidase
4912 JAERMS010000060.1 GCA017426725_02122 CDS open 7542-10283 _na     913_aa Two component regulator propeller
4913 JAERMS010000060.1 GCA017426725_02117 gene open 96-764
4914 JAERMS010000060.1 GCA017426725_02118 gene open 834-1013
4915 JAERMS010000060.1 GCA017426725_02119 gene open 1405-4425
4916 JAERMS010000060.1 GCA017426725_02120 gene open 4452-5903
4917 JAERMS010000060.1 GCA017426725_02121 gene open 6015-7391
4918 JAERMS010000060.1 GCA017426725_02122 gene open 7542-10283
4919 JAERMS010000061.1 GCA017426725_02123 CDS open 11-829 _na     272_aa ATP-binding protein
4920 JAERMS010000061.1 GCA017426725_02124 CDS open 1089-1841 _na     250_aa DUF6261 domain-containing protein
4921 JAERMS010000061.1 GCA017426725_02125 CDS open 2518-2712 _na     64_aa toxin PIN
4922 JAERMS010000061.1 GCA017426725_02126 CDS open 2773-2964 _na     63_aa hypothetical protein
4923 JAERMS010000061.1 GCA017426725_02127 CDS open 3102-7424 _na     1440_aa peptidase M26
4924 JAERMS010000061.1 GCA017426725_02128 CDS open 7523-7789 _na     88_aa hypothetical protein
4925 JAERMS010000061.1 GCA017426725_02129 CDS open 7942-9525 _na     527_aa GLUG domain-containing protein
4926 JAERMS010000061.1 GCA017426725_02130 CDS open 9597-9929 _na     110_aa hypothetical protein
4927 JAERMS010000061.1 GCA017426725_02131 CDS open 9905-10156 _na     83_aa hypothetical protein
4928 JAERMS010000061.1 GCA017426725_02123 gene open 11-829
4929 JAERMS010000061.1 GCA017426725_02124 gene open 1089-1841
4930 JAERMS010000061.1 GCA017426725_02125 gene open 2518-2712
4931 JAERMS010000061.1 GCA017426725_02126 gene open 2773-2964
4932 JAERMS010000061.1 GCA017426725_02127 gene open 3102-7424
4933 JAERMS010000061.1 GCA017426725_02128 gene open 7523-7789
4934 JAERMS010000061.1 GCA017426725_02129 gene open 7942-9525
4935 JAERMS010000061.1 GCA017426725_02130 gene open 9597-9929
4936 JAERMS010000061.1 GCA017426725_02131 gene open 9905-10156
4937 JAERMS010000062.1 GCA017426725_02132 CDS open 473-574 _na     33_aa hypothetical protein
4938 JAERMS010000062.1 GCA017426725_02133 CDS open 622-858 _na     78_aa 4Fe-4S binding domain protein
4939 JAERMS010000062.1 GCA017426725_02134 CDS open 870-1958 _na     362_aa Pyruvate flavodoxin/ferredoxin oxidoreductase%2C thiamine diP-binding domain protein
4940 JAERMS010000062.1 GCA017426725_02135 CDS open 1962-2732 _na     256_aa Thiamine pyrophosphate enzyme%2C C-terminal TPP binding domain protein
4941 JAERMS010000062.1 GCA017426725_02136 CDS open 2743-3285 _na     180_aa 2-oxoacid:ferredoxin/flavodoxin oxidoreductase%2C gamma subunit
4942 JAERMS010000062.1 GCA017426725_02137 CDS open 3282-3698 _na     138_aa Thioesterase domain-containing protein
4943 JAERMS010000062.1 GCA017426725_02138 CDS open 3755-4789 _na     344_aa isochorismate synthase
4944 JAERMS010000062.1 GCA017426725_02139 CDS open 4776-6482 _na     568_aa menD 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase
4945 JAERMS010000062.1 GCA017426725_02140 CDS open 6485-7312 _na     275_aa menB 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
4946 JAERMS010000062.1 GCA017426725_02141 CDS open 7317-8402 _na     361_aa O-succinylbenzoate synthase
4947 JAERMS010000062.1 GCA017426725_02142 CDS open 8412-9497 _na     361_aa O-succinylbenzoic acid--CoA ligase
4948 JAERMS010000062.1 GCA017426725_02132 gene open 473-574
4949 JAERMS010000062.1 GCA017426725_02133 gene open 622-858
4950 JAERMS010000062.1 GCA017426725_02134 gene open 870-1958
4951 JAERMS010000062.1 GCA017426725_02135 gene open 1962-2732
4952 JAERMS010000062.1 GCA017426725_02136 gene open 2743-3285
4953 JAERMS010000062.1 GCA017426725_02137 gene open 3282-3698
4954 JAERMS010000062.1 GCA017426725_02138 gene open 3755-4789
4955 JAERMS010000062.1 GCA017426725_02139 gene open 4776-6482 menD
4956 JAERMS010000062.1 GCA017426725_02140 gene open 6485-7312 menB
4957 JAERMS010000062.1 GCA017426725_02141 gene open 7317-8402
4958 JAERMS010000062.1 GCA017426725_02142 gene open 8412-9497
4959 JAERMS010000063.1 GCA017426725_02143 CDS open 195-2003 _na     602_aa Long-chain fatty acid--CoA ligase
4960 JAERMS010000063.1 GCA017426725_02144 CDS open 2009-3127 _na     372_aa prfB peptide chain release factor 2
4961 JAERMS010000063.1 GCA017426725_02145 CDS open 3294-3413 _na     39_aa Flagellin N-terminal-like domain protein
4962 JAERMS010000063.1 GCA017426725_02146 CDS open 3413-3931 _na     172_aa Adenylate cyclase
4963 JAERMS010000063.1 GCA017426725_02147 CDS open 4163-5047 _na     294_aa DNA-binding protein
4964 JAERMS010000063.1 GCA017426725_02148 CDS open 5167-6168 _na     333_aa D-alanine--D-alanine ligase
4965 JAERMS010000063.1 GCA017426725_02149 CDS open 6181-7260 _na     359_aa Pseudouridine synthase
4966 JAERMS010000063.1 GCA017426725_02150 CDS open 7280-7987 _na     235_aa Penicillin-binding protein
4967 JAERMS010000063.1 GCA017426725_02151 CDS open 8090-8245 _na     51_aa rpmH 50S ribosomal protein L34
4968 JAERMS010000063.1 GCA017426725_02143 gene open 195-2003
4969 JAERMS010000063.1 GCA017426725_02144 gene open 2009-3127 prfB
4970 JAERMS010000063.1 GCA017426725_02145 gene open 3294-3413
4971 JAERMS010000063.1 GCA017426725_02146 gene open 3413-3931
4972 JAERMS010000063.1 GCA017426725_02147 gene open 4163-5047
4973 JAERMS010000063.1 GCA017426725_02148 gene open 5167-6168
4974 JAERMS010000063.1 GCA017426725_02149 gene open 6181-7260
4975 JAERMS010000063.1 GCA017426725_02150 gene open 7280-7987
4976 JAERMS010000063.1 GCA017426725_02151 gene open 8090-8245 rpmH
4977 JAERMS010000064.1 GCA017426725_02152 CDS open 1102-1317 _na     71_aa MATE efflux family protein
4978 JAERMS010000064.1 GCA017426725_02153 CDS open 1329-1550 _na     73_aa Transposase
4979 JAERMS010000064.1 GCA017426725_02154 CDS open 1564-1980 _na     138_aa PcfK-like protein
4980 JAERMS010000064.1 GCA017426725_02155 CDS open 1977-3308 _na     443_aa PcfJ-like protein
4981 JAERMS010000064.1 GCA017426725_02156 CDS open 3333-3590 _na     85_aa Transposase
4982 JAERMS010000064.1 GCA017426725_02157 CDS open 3610-3840 _na     76_aa DUF3873 domain-containing protein
4983 JAERMS010000064.1 GCA017426725_02158 CDS open 3780-4082 _na     100_aa DUF6956 domain-containing protein
4984 JAERMS010000064.1 GCA017426725_02159 CDS open 4137-4445 _na     102_aa yahA YahA
4985 JAERMS010000064.1 GCA017426725_02160 CDS open 4563-4784 _na     73_aa GNAT family N-acetyltransferase
4986 JAERMS010000064.1 GCA017426725_02161 CDS open 4836-5348 _na     170_aa rrrD Lysozyme
4987 JAERMS010000064.1 GCA017426725_02162 CDS open 5360-5863 _na     167_aa DUF3872 domain-containing protein
4988 JAERMS010000064.1 GCA017426725_02163 CDS open 5860-6762 _na     300_aa Zinc finger CHC2-type domain-containing protein
4989 JAERMS010000064.1 GCA017426725_02164 CDS open 6770-7345 _na     191_aa traO Conjugative transposon protein TraO
4990 JAERMS010000064.1 GCA017426725_02165 CDS open 7348-7929 _na     193_aa traN conjugative transposon protein TraN
4991 JAERMS010000064.1 GCA017426725_02152 gene open 1102-1317
4992 JAERMS010000064.1 GCA017426725_02153 gene open 1329-1550
4993 JAERMS010000064.1 GCA017426725_02154 gene open 1564-1980
4994 JAERMS010000064.1 GCA017426725_02155 gene open 1977-3308
4995 JAERMS010000064.1 GCA017426725_02156 gene open 3333-3590
4996 JAERMS010000064.1 GCA017426725_02157 gene open 3610-3840
4997 JAERMS010000064.1 GCA017426725_02158 gene open 3780-4082
4998 JAERMS010000064.1 GCA017426725_02159 gene open 4137-4445 yahA
4999 JAERMS010000064.1 GCA017426725_02160 gene open 4563-4784
5000 JAERMS010000064.1 GCA017426725_02161 gene open 4836-5348 rrrD