HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Neisseria flava (GCA_019815155.1)

Select a Genome:
BAKTA Annotations for GCA_019815155.1
Genome Selected: Neisseria flava
ContigsBases CDSrRNA tmRNAtRNA
77 2485932 2225 3 1 57
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4604 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 4604 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 JAIMJK010000008.1 GCA019815155_00852 CDS open 32558-32860 _na     100_aa ihfA integration host factor subunit alpha
1002 JAIMJK010000008.1 GCA019815155_00853 CDS open 32844-33161 _na     105_aa HTH merR-type domain-containing protein
1003 JAIMJK010000008.1 GCA019815155_00854 CDS open 33511-34248 _na     245_aa MORN repeat protein
1004 JAIMJK010000008.1 GCA019815155_00855 CDS open 34400-34675 _na     91_aa rpmE2 type B 50S ribosomal protein L31
1005 JAIMJK010000008.1 GCA019815155_00856 CDS open 34675-34800 _na     41_aa ykgO type B 50S ribosomal protein L36
1006 JAIMJK010000008.1 GCA019815155_00857 CDS open 35022-35486 _na     154_aa C-type lysozyme inhibitor domain-containing protein
1007 JAIMJK010000008.1 GCA019815155_00858 CDS open 35680-37434 _na     584_aa cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
1008 JAIMJK010000008.1 GCA019815155_00859 CDS open 38120-39634 _na     504_aa polyamine aminopropyltransferase
1009 JAIMJK010000008.1 GCA019815155_00860 CDS open 39848-41392 _na     514_aa purF amidophosphoribosyltransferase
1010 JAIMJK010000008.1 GCA019815155_00861 CDS open 41661-42311 _na     216_aa Lipoprotein
1011 JAIMJK010000008.1 GCA019815155_00862 CDS open 42500-44725 _na     741_aa icdM NADP-dependent isocitrate dehydrogenase
1012 JAIMJK010000008.1 GCA019815155_00863 CDS open 45064-46404 _na     446_aa DUF2868 domain-containing protein
1013 JAIMJK010000008.1 GCA019815155_00864 CDS open 46474-47814 _na     446_aa mnmE G domain-containing protein
1014 JAIMJK010000008.1 GCA019815155_00865 CDS open 48059-49318 _na     419_aa dadA D-amino acid dehydrogenase small subunit
1015 JAIMJK010000008.1 GCA019815155_00866 CDS open 49452-49916 _na     154_aa Putative AsnC-family transcriptional regulator
1016 JAIMJK010000008.1 GCA019815155_00868 CDS open 50329-50760 _na     143_aa nusB transcription antitermination factor NusB
1017 JAIMJK010000008.1 GCA019815155_00869 CDS open 50905-51384 _na     159_aa ribH 6%2C7-dimethyl-8-ribityllumazine synthase
1018 JAIMJK010000008.1 GCA019815155_00870 CDS open 51460-51825 _na     121_aa DUF2185 domain-containing protein
1019 JAIMJK010000008.1 GCA019815155_00871 CDS open 52055-52774 _na     239_aa rnc ribonuclease III
1020 JAIMJK010000008.1 GCA019815155_00872 CDS open 52842-53765 _na     307_aa era GTPase Era
1021 JAIMJK010000008.1 GCA019815155_00873 CDS open 53812-54729 _na     305_aa thrB homoserine kinase
1022 JAIMJK010000008.1 GCA019815155_00821 gene open 32-517 lrp
1023 JAIMJK010000008.1 GCA019815155_00822 gene open 652-879
1024 JAIMJK010000008.1 GCA019815155_00823 gene open 1027-2127 gcvT
1025 JAIMJK010000008.1 GCA019815155_00824 gene open 2247-2633 gcvH
1026 JAIMJK010000008.1 GCA019815155_00825 gene open 2741-3292
1027 JAIMJK010000008.1 GCA019815155_00826 gene open 3262-3426
1028 JAIMJK010000008.1 GCA019815155_00827 gene open 3530-4822
1029 JAIMJK010000008.1 GCA019815155_00828 gene open 4792-5307
1030 JAIMJK010000008.1 GCA019815155_00829 gene open 5430-8282 gcvP
1031 JAIMJK010000008.1 GCA019815155_00830 gene open 8386-8544 ytjA
1032 JAIMJK010000008.1 GCA019815155_00831 gene open 8997-10349 yegQ
1033 JAIMJK010000008.1 GCA019815155_00832 gene open 10709-11455 hisM
1034 JAIMJK010000008.1 GCA019815155_00833 gene open 11710-13179 selO
1035 JAIMJK010000008.1 GCA019815155_00834 gene open 13362-14420 mutY
1036 JAIMJK010000008.1 GCA019815155_00835 gene open 14583-15623 tdh
1037 JAIMJK010000008.1 GCA019815155_00836 gene open 16051-18132 cstA
1038 JAIMJK010000008.1 GCA019815155_00837 gene open 18122-18316 ybdD
1039 JAIMJK010000008.1 GCA019815155_00838 gene open 18397-19302 prmB
1040 JAIMJK010000008.1 GCA019815155_00839 gene open 19435-19833 cccA
1041 JAIMJK010000008.1 GCA019815155_00840 gene open 19928-20893 tnp
1042 JAIMJK010000008.1 GCA019815155_00841 gene open 21055-22065 hemH
1043 JAIMJK010000008.1 GCA019815155_00842 gene open 22175-23290 tgt
1044 JAIMJK010000008.1 GCA019815155_00844 gene open 23677-25590 thrS
1045 JAIMJK010000008.1 GCA019815155_00845 gene open 25725-26129 infC
1046 JAIMJK010000008.1 GCA019815155_00846 gene open 26276-26473 infC
1047 JAIMJK010000008.1 GCA019815155_00847 gene open 26486-26845 rplT
1048 JAIMJK010000008.1 GCA019815155_00848 gene open 27048-28085 pheS
1049 JAIMJK010000008.1 GCA019815155_00849 gene open 28123-28920
1050 JAIMJK010000008.1 GCA019815155_00850 gene open 28917-30029
1051 JAIMJK010000008.1 GCA019815155_00851 gene open 30121-32484 pheT
1052 JAIMJK010000008.1 GCA019815155_00852 gene open 32558-32860 ihfA
1053 JAIMJK010000008.1 GCA019815155_00853 gene open 32844-33161
1054 JAIMJK010000008.1 GCA019815155_00854 gene open 33511-34248
1055 JAIMJK010000008.1 GCA019815155_00855 gene open 34400-34675 rpmE2
1056 JAIMJK010000008.1 GCA019815155_00856 gene open 34675-34800 ykgO
1057 JAIMJK010000008.1 GCA019815155_00857 gene open 35022-35486
1058 JAIMJK010000008.1 GCA019815155_00858 gene open 35680-37434 cysI
1059 JAIMJK010000008.1 GCA019815155_00859 gene open 38120-39634
1060 JAIMJK010000008.1 GCA019815155_00860 gene open 39848-41392 purF
1061 JAIMJK010000008.1 GCA019815155_00861 gene open 41661-42311
1062 JAIMJK010000008.1 GCA019815155_00862 gene open 42500-44725 icdM
1063 JAIMJK010000008.1 GCA019815155_00863 gene open 45064-46404
1064 JAIMJK010000008.1 GCA019815155_00864 gene open 46474-47814 mnmE
1065 JAIMJK010000008.1 GCA019815155_00865 gene open 48059-49318 dadA
1066 JAIMJK010000008.1 GCA019815155_00866 gene open 49452-49916
1067 JAIMJK010000008.1 GCA019815155_00868 gene open 50329-50760 nusB
1068 JAIMJK010000008.1 GCA019815155_00869 gene open 50905-51384 ribH
1069 JAIMJK010000008.1 GCA019815155_00870 gene open 51460-51825
1070 JAIMJK010000008.1 GCA019815155_00871 gene open 52055-52774 rnc
1071 JAIMJK010000008.1 GCA019815155_00872 gene open 52842-53765 era
1072 JAIMJK010000008.1 GCA019815155_00873 gene open 53812-54729 thrB
1073 JAIMJK010000008.1 GCA019815155_00843 gene open 23546-23622 trnV
1074 JAIMJK010000008.1 GCA019815155_00843 tRNA open 23546-23622 trnV tRNA-Val(gac)
1075 JAIMJK010000009.1 GCA019815155_00915 gene open 52597-52676 nse_sRNA
1076 JAIMJK010000009.1 GCA019815155_00915 ncRNA open 52597-52676 Neisseria sigma-E sRNA
1077 JAIMJK010000009.1 GCA019815155_00874 CDS open 151-1695 _na     514_aa nadB L-aspartate oxidase
1078 JAIMJK010000009.1 GCA019815155_00875 CDS open 1747-2859 _na     370_aa nadA quinolinate synthase NadA
1079 JAIMJK010000009.1 GCA019815155_00876 CDS open 3062-4003 _na     313_aa nadQ NrtR DNA-binding winged helix domain-containing protein
1080 JAIMJK010000009.1 GCA019815155_00877 CDS open 4227-5108 _na     293_aa nadC carboxylating nicotinate-nucleotide diphosphorylase
1081 JAIMJK010000009.1 GCA019815155_00878 CDS open 5609-6310 _na     233_aa mtgA monofunctional biosynthetic peptidoglycan transglycosylase
1082 JAIMJK010000009.1 GCA019815155_00879 CDS open 6312-7121 _na     269_aa aroE shikimate dehydrogenase
1083 JAIMJK010000009.1 GCA019815155_00880 CDS open 7365-8783 _na     472_aa glnA type I glutamate--ammonia ligase
1084 JAIMJK010000009.1 GCA019815155_00881 CDS open 9040-10104 _na     354_aa budC (R%2CR)-butanediol dehydrogenase
1085 JAIMJK010000009.1 GCA019815155_00882 CDS open 10312-12483 _na     723_aa fhuE Outer membrane ferripyoverdine receptor
1086 JAIMJK010000009.1 GCA019815155_00883 CDS open 12842-13480 _na     212_aa queE 7-carboxy-7-deazaguanine synthase
1087 JAIMJK010000009.1 GCA019815155_00884 CDS open 13477-13848 _na     123_aa DUF1304 domain-containing protein
1088 JAIMJK010000009.1 GCA019815155_00885 CDS open 14207-14641 _na     144_aa queD 6-carboxytetrahydropterin synthase QueD
1089 JAIMJK010000009.1 GCA019815155_00886 CDS open 14652-15167 _na     171_aa DUF1543 domain-containing protein
1090 JAIMJK010000009.1 GCA019815155_00887 CDS open 15200-15859 _na     219_aa queC 7-cyano-7-deazaguanine synthase QueC
1091 JAIMJK010000009.1 GCA019815155_00888 CDS open 16022-16660 _na     212_aa eda 2-dehydro-3-deoxy-phosphogluconate aldolase
1092 JAIMJK010000009.1 GCA019815155_00889 CDS open 16875-18710 _na     611_aa edd phosphogluconate dehydratase
1093 JAIMJK010000009.1 GCA019815155_00890 CDS open 19175-20620 _na     481_aa zwf glucose-6-phosphate dehydrogenase
1094 JAIMJK010000009.1 GCA019815155_00891 CDS open 20835-21530 _na     231_aa nagB 6-phosphogluconolactonase
1095 JAIMJK010000009.1 GCA019815155_00892 CDS open 21511-22512 _na     333_aa glk glucokinase
1096 JAIMJK010000009.1 GCA019815155_00893 CDS open 22562-23410 _na     282_aa hexR DNA-binding transcriptional regulator HexR
1097 JAIMJK010000009.1 GCA019815155_00894 CDS open 23629-25272 _na     547_aa pgi glucose-6-phosphate isomerase
1098 JAIMJK010000009.1 GCA019815155_00895 CDS open 25549-26142 _na     197_aa mug Uracil-DNA glycosylase family protein
1099 JAIMJK010000009.1 GCA019815155_00896 CDS open 26196-27098 _na     300_aa rhaT EamA domain-containing protein
1100 JAIMJK010000009.1 GCA019815155_00897 CDS open 27146-27763 _na     205_aa trpF phosphoribosylanthranilate isomerase
1101 JAIMJK010000009.1 GCA019815155_00898 CDS open 27937-28095 _na     52_aa Cytochrome c oxidase subunit 2A
1102 JAIMJK010000009.1 GCA019815155_00899 CDS open 28351-29271 _na     306_aa ABC transporter permease
1103 JAIMJK010000009.1 GCA019815155_00900 CDS open 29355-30785 _na     476_aa rho transcription termination factor Rho
1104 JAIMJK010000009.1 GCA019815155_00901 CDS open 30883-31281 _na     132_aa hinT HIT domain-containing protein
1105 JAIMJK010000009.1 GCA019815155_00902 CDS open 31384-32574 _na     396_aa ldcA Muramoyltetrapeptide carboxypeptidase
1106 JAIMJK010000009.1 GCA019815155_00903 CDS open 32736-34331 _na     531_aa prfC peptide chain release factor 3
1107 JAIMJK010000009.1 GCA019815155_00904 CDS open 34393-34938 _na     181_aa ubiC Chorismate lyase
1108 JAIMJK010000009.1 GCA019815155_00905 CDS open 34942-35610 _na     222_aa bioD dethiobiotin synthase
1109 JAIMJK010000009.1 GCA019815155_00906 CDS open 35607-36899 _na     430_aa bioA adenosylmethionine--8-amino-7-oxononanoate transaminase
1110 JAIMJK010000009.1 GCA019815155_00907 CDS open 37080-39158 _na     692_aa spoVID LysM peptidoglycan-binding domain-containing protein
1111 JAIMJK010000009.1 GCA019815155_00908 CDS open 39442-40860 _na     472_aa tolC Outer membrane efflux protein OprM
1112 JAIMJK010000009.1 GCA019815155_00909 CDS open 40919-44134 _na     1071_aa Efflux pump membrane transporter
1113 JAIMJK010000009.1 GCA019815155_00910 CDS open 44146-45435 _na     429_aa Efflux transporter%2C RND family%2C MFP subunit
1114 JAIMJK010000009.1 GCA019815155_00911 CDS open 45674-46309 _na     211_aa acrR HTH-type transcriptional regulator MtrR
1115 JAIMJK010000009.1 GCA019815155_00912 CDS open 46582-49185 _na     867_aa pepN aminopeptidase N
1116 JAIMJK010000009.1 GCA019815155_00913 CDS open 49532-51175 _na     547_aa lldP L-lactate permease
1117 JAIMJK010000009.1 GCA019815155_00914 CDS open 51571-52347 _na     258_aa fadR Pyruvate dehydrogenase complex repressor
1118 JAIMJK010000009.1 GCA019815155_00916 CDS open 52694-54406 _na     570_aa yddA ABC superfamily ATP binding cassette transporter ABC protein
1119 JAIMJK010000009.1 GCA019815155_00874 gene open 151-1695 nadB
1120 JAIMJK010000009.1 GCA019815155_00875 gene open 1747-2859 nadA
1121 JAIMJK010000009.1 GCA019815155_00876 gene open 3062-4003 nadQ
1122 JAIMJK010000009.1 GCA019815155_00877 gene open 4227-5108 nadC
1123 JAIMJK010000009.1 GCA019815155_00878 gene open 5609-6310 mtgA
1124 JAIMJK010000009.1 GCA019815155_00879 gene open 6312-7121 aroE
1125 JAIMJK010000009.1 GCA019815155_00880 gene open 7365-8783 glnA
1126 JAIMJK010000009.1 GCA019815155_00881 gene open 9040-10104 budC
1127 JAIMJK010000009.1 GCA019815155_00882 gene open 10312-12483 fhuE
1128 JAIMJK010000009.1 GCA019815155_00883 gene open 12842-13480 queE
1129 JAIMJK010000009.1 GCA019815155_00884 gene open 13477-13848
1130 JAIMJK010000009.1 GCA019815155_00885 gene open 14207-14641 queD
1131 JAIMJK010000009.1 GCA019815155_00886 gene open 14652-15167
1132 JAIMJK010000009.1 GCA019815155_00887 gene open 15200-15859 queC
1133 JAIMJK010000009.1 GCA019815155_00888 gene open 16022-16660 eda
1134 JAIMJK010000009.1 GCA019815155_00889 gene open 16875-18710 edd
1135 JAIMJK010000009.1 GCA019815155_00890 gene open 19175-20620 zwf
1136 JAIMJK010000009.1 GCA019815155_00891 gene open 20835-21530 nagB
1137 JAIMJK010000009.1 GCA019815155_00892 gene open 21511-22512 glk
1138 JAIMJK010000009.1 GCA019815155_00893 gene open 22562-23410 hexR
1139 JAIMJK010000009.1 GCA019815155_00894 gene open 23629-25272 pgi
1140 JAIMJK010000009.1 GCA019815155_00895 gene open 25549-26142 mug
1141 JAIMJK010000009.1 GCA019815155_00896 gene open 26196-27098 rhaT
1142 JAIMJK010000009.1 GCA019815155_00897 gene open 27146-27763 trpF
1143 JAIMJK010000009.1 GCA019815155_00898 gene open 27937-28095
1144 JAIMJK010000009.1 GCA019815155_00899 gene open 28351-29271
1145 JAIMJK010000009.1 GCA019815155_00900 gene open 29355-30785 rho
1146 JAIMJK010000009.1 GCA019815155_00901 gene open 30883-31281 hinT
1147 JAIMJK010000009.1 GCA019815155_00902 gene open 31384-32574 ldcA
1148 JAIMJK010000009.1 GCA019815155_00903 gene open 32736-34331 prfC
1149 JAIMJK010000009.1 GCA019815155_00904 gene open 34393-34938 ubiC
1150 JAIMJK010000009.1 GCA019815155_00905 gene open 34942-35610 bioD
1151 JAIMJK010000009.1 GCA019815155_00906 gene open 35607-36899 bioA
1152 JAIMJK010000009.1 GCA019815155_00907 gene open 37080-39158 spoVID
1153 JAIMJK010000009.1 GCA019815155_00908 gene open 39442-40860 tolC
1154 JAIMJK010000009.1 GCA019815155_00909 gene open 40919-44134
1155 JAIMJK010000009.1 GCA019815155_00910 gene open 44146-45435
1156 JAIMJK010000009.1 GCA019815155_00911 gene open 45674-46309 acrR
1157 JAIMJK010000009.1 GCA019815155_00912 gene open 46582-49185 pepN
1158 JAIMJK010000009.1 GCA019815155_00913 gene open 49532-51175 lldP
1159 JAIMJK010000009.1 GCA019815155_00914 gene open 51571-52347 fadR
1160 JAIMJK010000009.1 GCA019815155_00916 gene open 52694-54406 yddA
1161 JAIMJK010000010.1 GCA019815155_00917 CDS open 190-2415 _na     741_aa comEC DNA internalization-related competence protein ComEC/Rec2
1162 JAIMJK010000010.1 GCA019815155_00918 CDS open 2429-2650 _na     73_aa hypothetical protein
1163 JAIMJK010000010.1 GCA019815155_00919 CDS open 2775-3395 _na     206_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
1164 JAIMJK010000010.1 GCA019815155_00920 CDS open 3483-4793 _na     436_aa Trigger factor
1165 JAIMJK010000010.1 GCA019815155_00921 CDS open 5126-5812 _na     228_aa nlpD Peptidoglycan DD-metalloendopeptidase family protein
1166 JAIMJK010000010.1 GCA019815155_00922 CDS open 6050-8434 _na     794_aa ppsA phosphoenolpyruvate synthase
1167 JAIMJK010000010.1 GCA019815155_00923 CDS open 8853-9674 _na     273_aa ppsR Putative phosphoenolpyruvate synthase regulatory protein
1168 JAIMJK010000010.1 GCA019815155_00924 CDS open 9895-10734 _na     279_aa Nickel uptake substrate-specific transmembrane region
1169 JAIMJK010000010.1 GCA019815155_00925 CDS open 10818-11666 _na     282_aa fghA S-formylglutathione hydrolase
1170 JAIMJK010000010.1 GCA019815155_00926 CDS open 12116-13828 _na     570_aa proS proline--tRNA ligase
1171 JAIMJK010000010.1 GCA019815155_00927 CDS open 14155-14595 _na     146_aa ubiT Ubiquinone biosynthesis accessory factor UbiT
1172 JAIMJK010000010.1 GCA019815155_00928 CDS open 14582-15499 _na     305_aa rlhA U32 family peptidase
1173 JAIMJK010000010.1 GCA019815155_00929 CDS open 15512-16519 _na     335_aa rlhA Ubiquinone biosynthesis protein UbiU
1174 JAIMJK010000010.1 GCA019815155_00930 CDS open 16802-17407 _na     201_aa putative S-adenosylmethionine-dependent methyltransferase MSMEG_2350
1175 JAIMJK010000010.1 GCA019815155_00931 CDS open 17612-18433 _na     273_aa CAAX amino terminal protease family protein
1176 JAIMJK010000010.1 GCA019815155_00932 CDS open 18895-20496 _na     533_aa DUF262 domain-containing protein
1177 JAIMJK010000010.1 GCA019815155_00933 CDS open 20580-23474 _na     964_aa alaS alanine--tRNA ligase
1178 JAIMJK010000010.1 GCA019815155_00934 CDS open 23703-24833 _na     376_aa potD Putrescine-binding periplasmic protein
1179 JAIMJK010000010.1 GCA019815155_00935 CDS open 24906-26405 _na     499_aa cls Phospholipase D domain protein
1180 JAIMJK010000010.1 GCA019815155_00936 CDS open 26576-27580 _na     334_aa add adenosine deaminase
1181 JAIMJK010000010.1 GCA019815155_00937 CDS open 27598-28137 _na     179_aa Lipoprotein
1182 JAIMJK010000010.1 GCA019815155_00938 CDS open 28320-29330 _na     336_aa trpS tryptophan--tRNA ligase
1183 JAIMJK010000010.1 GCA019815155_00939 CDS open 29590-32163 _na     857_aa clpB ATP-dependent chaperone ClpB
1184 JAIMJK010000010.1 GCA019815155_00940 CDS open 32278-33186 _na     302_aa efeB Dyp-type peroxidase family protein
1185 JAIMJK010000010.1 GCA019815155_00941 CDS open 33320-34417 _na     365_aa yaeI Ser/Thr protein phosphatase
1186 JAIMJK010000010.1 GCA019815155_00942 CDS open 34609-35205 _na     198_aa lemA LemA family protein
1187 JAIMJK010000010.1 GCA019815155_00943 CDS open 35333-35479 _na     48_aa CCGSCS motif protein
1188 JAIMJK010000010.1 GCA019815155_00944 CDS open 35788-36642 _na     284_aa lgt prolipoprotein diacylglyceryl transferase
1189 JAIMJK010000010.1 GCA019815155_00945 CDS open 36755-37885 _na     376_aa mpaA Peptidase M14 carboxypeptidase A domain-containing protein
1190 JAIMJK010000010.1 GCA019815155_00946 CDS open 38194-39084 _na     296_aa argB Acetylglutamate kinase
1191 JAIMJK010000010.1 GCA019815155_00947 CDS open 39234-40742 _na     502_aa ppx exopolyphosphatase
1192 JAIMJK010000010.1 GCA019815155_00948 CDS open 41002-41631 _na     209_aa mltE Transglycosylase
1193 JAIMJK010000010.1 GCA019815155_00949 CDS open 41762-43144 _na     460_aa araJ Major facilitator superfamily (MFS) profile domain-containing protein
1194 JAIMJK010000010.1 GCA019815155_00950 CDS open 43148-43663 _na     171_aa ssb Single-stranded DNA-binding protein
1195 JAIMJK010000010.1 GCA019815155_00951 CDS open 43813-45102 _na     429_aa Integrase
1196 JAIMJK010000010.1 GCA019815155_00952 CDS open 45080-46600 _na     506_aa site-specific integrase
1197 JAIMJK010000010.1 GCA019815155_00953 CDS open 46603-48645 _na     680_aa Integrase
1198 JAIMJK010000010.1 GCA019815155_00954 CDS open 48647-49057 _na     136_aa kfrA KfrA N-terminal DNA-binding domain-containing protein
1199 JAIMJK010000010.1 GCA019815155_00917 gene open 190-2415 comEC
1200 JAIMJK010000010.1 GCA019815155_00918 gene open 2429-2650
1201 JAIMJK010000010.1 GCA019815155_00919 gene open 2775-3395 clpP
1202 JAIMJK010000010.1 GCA019815155_00920 gene open 3483-4793
1203 JAIMJK010000010.1 GCA019815155_00921 gene open 5126-5812 nlpD
1204 JAIMJK010000010.1 GCA019815155_00922 gene open 6050-8434 ppsA
1205 JAIMJK010000010.1 GCA019815155_00923 gene open 8853-9674 ppsR
1206 JAIMJK010000010.1 GCA019815155_00924 gene open 9895-10734
1207 JAIMJK010000010.1 GCA019815155_00925 gene open 10818-11666 fghA
1208 JAIMJK010000010.1 GCA019815155_00926 gene open 12116-13828 proS
1209 JAIMJK010000010.1 GCA019815155_00927 gene open 14155-14595 ubiT
1210 JAIMJK010000010.1 GCA019815155_00928 gene open 14582-15499 rlhA
1211 JAIMJK010000010.1 GCA019815155_00929 gene open 15512-16519 rlhA
1212 JAIMJK010000010.1 GCA019815155_00930 gene open 16802-17407
1213 JAIMJK010000010.1 GCA019815155_00931 gene open 17612-18433
1214 JAIMJK010000010.1 GCA019815155_00932 gene open 18895-20496
1215 JAIMJK010000010.1 GCA019815155_00933 gene open 20580-23474 alaS
1216 JAIMJK010000010.1 GCA019815155_00934 gene open 23703-24833 potD
1217 JAIMJK010000010.1 GCA019815155_00935 gene open 24906-26405 cls
1218 JAIMJK010000010.1 GCA019815155_00936 gene open 26576-27580 add
1219 JAIMJK010000010.1 GCA019815155_00937 gene open 27598-28137
1220 JAIMJK010000010.1 GCA019815155_00938 gene open 28320-29330 trpS
1221 JAIMJK010000010.1 GCA019815155_00939 gene open 29590-32163 clpB
1222 JAIMJK010000010.1 GCA019815155_00940 gene open 32278-33186 efeB
1223 JAIMJK010000010.1 GCA019815155_00941 gene open 33320-34417 yaeI
1224 JAIMJK010000010.1 GCA019815155_00942 gene open 34609-35205 lemA
1225 JAIMJK010000010.1 GCA019815155_00943 gene open 35333-35479
1226 JAIMJK010000010.1 GCA019815155_00944 gene open 35788-36642 lgt
1227 JAIMJK010000010.1 GCA019815155_00945 gene open 36755-37885 mpaA
1228 JAIMJK010000010.1 GCA019815155_00946 gene open 38194-39084 argB
1229 JAIMJK010000010.1 GCA019815155_00947 gene open 39234-40742 ppx
1230 JAIMJK010000010.1 GCA019815155_00948 gene open 41002-41631 mltE
1231 JAIMJK010000010.1 GCA019815155_00949 gene open 41762-43144 araJ
1232 JAIMJK010000010.1 GCA019815155_00950 gene open 43148-43663 ssb
1233 JAIMJK010000010.1 GCA019815155_00951 gene open 43813-45102
1234 JAIMJK010000010.1 GCA019815155_00952 gene open 45080-46600
1235 JAIMJK010000010.1 GCA019815155_00953 gene open 46603-48645
1236 JAIMJK010000010.1 GCA019815155_00954 gene open 48647-49057 kfrA
1237 JAIMJK010000011.1 GCA019815155_00332 gene open 355253-355615 ssrA
1238 JAIMJK010000011.1 GCA019815155_00332 tmRNA open 355253-355615 ssrA transfer-messenger RNA%2C SsrA
1239 JAIMJK010000011.1 GCA019815155_00002 gene open 4476-4572 Bacteria_small_SRP
1240 JAIMJK010000011.1 GCA019815155_00002 ncRNA open 4476-4572 Bacterial small signal recognition particle RNA
1241 JAIMJK010000011.1 repeat_region open 166571-169396 CRISPR array with 43 repeats of length 31%2C consensus sequence CAGCCGCCTTCAGGCGGCTGTGTGTTGAAAC and spacer length 35
1242 JAIMJK010000011.1 GCA019815155_00001 CDS open 310-4143 _na     1277_aa glcD FAD-linked oxidase
1243 JAIMJK010000011.1 GCA019815155_00003 CDS open 4685-4906 _na     73_aa MFS transporter
1244 JAIMJK010000011.1 GCA019815155_00004 CDS open 5406-7097 _na     563_aa dld D-lactate dehydrogenase
1245 JAIMJK010000011.1 GCA019815155_00005 CDS open 7235-7825 _na     196_aa Peroxidase-like protein
1246 JAIMJK010000011.1 GCA019815155_00006 CDS open 7977-9065 _na     362_aa caiA Acyl-CoA dehydrogenase family protein
1247 JAIMJK010000011.1 GCA019815155_00007 CDS open 9151-9321 _na     56_aa norV Rubredoxin
1248 JAIMJK010000011.1 GCA019815155_00010 CDS open 9849-10628 _na     259_aa yaaA peroxide stress protein YaaA
1249 JAIMJK010000011.1 GCA019815155_00011 CDS open 10791-12803 _na     670_aa Arylsulfatase
1250 JAIMJK010000011.1 GCA019815155_00012 CDS open 13094-15073 _na     659_aa tkt transketolase
1251 JAIMJK010000011.1 GCA019815155_00013 CDS open 15692-17203 _na     503_aa ccoG cytochrome c oxidase accessory protein CcoG
1252 JAIMJK010000011.1 GCA019815155_00014 CDS open 17207-17752 _na     181_aa ccoH FixH
1253 JAIMJK010000011.1 GCA019815155_00015 CDS open 18123-18668 _na     181_aa Type IV secretion protein Rhs
1254 JAIMJK010000011.1 GCA019815155_00016 CDS open 18770-19330 _na     186_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
1255 JAIMJK010000011.1 GCA019815155_00024 CDS open 20268-20753 _na     161_aa Integrase
1256 JAIMJK010000011.1 GCA019815155_00025 CDS open 21063-21293 _na     76_aa tyrosine-type recombinase/integrase
1257 JAIMJK010000011.1 GCA019815155_00026 CDS open 21555-22682 _na     375_aa pilU Twitching motility protein
1258 JAIMJK010000011.1 GCA019815155_00027 CDS open 22870-23571 _na     233_aa mtnN 5'-methylthioadenosine/adenosylhomocysteine nucleosidase
1259 JAIMJK010000011.1 GCA019815155_00028 CDS open 23614-25506 _na     630_aa lepA translation elongation factor 4
1260 JAIMJK010000011.1 GCA019815155_00029 CDS open 25506-26525 _na     339_aa lepB signal peptidase I
1261 JAIMJK010000011.1 GCA019815155_00030 CDS open 26838-27722 _na     294_aa rhaT Putative membrane protein
1262 JAIMJK010000011.1 GCA019815155_00031 CDS open 28046-29023 _na     325_aa tauA SsuA/THI5-like domain-containing protein
1263 JAIMJK010000011.1 GCA019815155_00032 CDS open 29365-29955 _na     196_aa Apea-like HEPN domain-containing protein
1264 JAIMJK010000011.1 GCA019815155_00033 CDS open 30040-30837 _na     265_aa tauC ABC transmembrane type-1 domain-containing protein
1265 JAIMJK010000011.1 GCA019815155_00034 CDS open 30837-31529 _na     230_aa tauB ABC transporter ATP-binding protein
1266 JAIMJK010000011.1 GCA019815155_00035 CDS open 31851-32465 _na     204_aa cadD Cadmium resistance transporter family protein
1267 JAIMJK010000011.1 GCA019815155_00036 CDS open 32761-33858 _na     365_aa Integral membrane protein
1268 JAIMJK010000011.1 GCA019815155_00037 CDS open 33972-34409 _na     145_aa yciA acyl-CoA thioester hydrolase YciA
1269 JAIMJK010000011.1 GCA019815155_00038 CDS open 34514-35287 _na     257_aa pgeF peptidoglycan editing factor PgeF
1270 JAIMJK010000011.1 GCA019815155_00039 CDS open 35329-35913 _na     194_aa DUF4145 domain-containing protein
1271 JAIMJK010000011.1 GCA019815155_00040 CDS open 35996-36976 _na     326_aa rluD 23S rRNA pseudouridine(1911/1915/1917) synthase RluD
1272 JAIMJK010000011.1 GCA019815155_00041 CDS open 37119-37925 _na     268_aa bamD Outer membrane protein assembly factor BamD
1273 JAIMJK010000011.1 GCA019815155_00042 CDS open 38036-39562 _na     508_aa ilvA threonine ammonia-lyase%2C biosynthetic
1274 JAIMJK010000011.1 GCA019815155_00043 CDS open 39778-41031 _na     417_aa dacC serine-type D-Ala-D-Ala carboxypeptidase
1275 JAIMJK010000011.1 GCA019815155_00044 CDS open 41117-41779 _na     220_aa yecA YecA family protein
1276 JAIMJK010000011.1 GCA019815155_00045 CDS open 41852-42340 _na     162_aa yqgC DUF456 domain-containing protein
1277 JAIMJK010000011.1 GCA019815155_00046 CDS open 42655-43614 _na     319_aa ttcA tRNA 2-thiocytidine(32) synthetase TtcA
1278 JAIMJK010000011.1 GCA019815155_00047 CDS open 43761-45923 _na     720_aa Copper-translocating P-type ATPase
1279 JAIMJK010000011.1 GCA019815155_00048 CDS open 46023-46232 _na     69_aa copZ HMA domain-containing protein
1280 JAIMJK010000011.1 GCA019815155_00049 CDS open 46380-46772 _na     130_aa cueR Cu(I)-responsive transcriptional regulator
1281 JAIMJK010000011.1 GCA019815155_00050 CDS open 47052-47381 _na     109_aa osmC OsmC family protein
1282 JAIMJK010000011.1 GCA019815155_00051 CDS open 47474-47809 _na     111_aa Thioredoxin domain-containing protein
1283 JAIMJK010000011.1 GCA019815155_00052 CDS open 48077-48388 _na     103_aa arsR HTH arsR-type domain-containing protein
1284 JAIMJK010000011.1 GCA019815155_00053 CDS open 48463-49674 _na     403_aa fadH NADH:flavin oxidoreductase/NADH oxidase N-terminal domain-containing protein
1285 JAIMJK010000011.1 GCA019815155_00054 CDS open 49943-50728 _na     261_aa ygiD 4%2C5-DOPA dioxygenase extradiol
1286 JAIMJK010000011.1 GCA019815155_00055 CDS open 50982-51917 _na     311_aa dihydroorotate oxidase
1287 JAIMJK010000011.1 GCA019815155_00056 CDS open 52170-53351 _na     393_aa argD Acetylornithine aminotransferase
1288 JAIMJK010000011.1 GCA019815155_00057 CDS open 53497-53835 _na     112_aa gspG General secretion pathway protein GspG
1289 JAIMJK010000011.1 GCA019815155_00058 CDS open 53795-54145 _na     116_aa Lipoprotein
1290 JAIMJK010000011.1 GCA019815155_00059 CDS open 54382-54843 _na     153_aa Repressor
1291 JAIMJK010000011.1 GCA019815155_00060 CDS open 55001-55396 _na     131_aa HTH cro/C1-type domain-containing protein
1292 JAIMJK010000011.1 GCA019815155_00061 CDS open 55504-55686 _na     60_aa hypothetical protein
1293 JAIMJK010000011.1 GCA019815155_00062 CDS open 55683-56483 _na     266_aa Phosphatidylserine decarboxylase proenzyme
1294 JAIMJK010000011.1 GCA019815155_00063 CDS open 56703-59579 _na     958_aa uvrA excinuclease ABC subunit UvrA
1295 JAIMJK010000011.1 GCA019815155_00064 CDS open 59623-61953 _na     776_aa lapB lipopolysaccharide assembly protein LapB
1296 JAIMJK010000011.1 GCA019815155_00065 CDS open 62690-63079 _na     129_aa Lipoprotein
1297 JAIMJK010000011.1 GCA019815155_00066 CDS open 63700-64236 _na     178_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
1298 JAIMJK010000011.1 GCA019815155_00067 CDS open 64271-66052 _na     593_aa nrdD anaerobic ribonucleoside-triphosphate reductase
1299 JAIMJK010000011.1 GCA019815155_00068 CDS open 66362-66691 _na     109_aa Secreted protein
1300 JAIMJK010000011.1 GCA019815155_00069 CDS open 66734-66985 _na     83_aa Lipoprotein
1301 JAIMJK010000011.1 GCA019815155_00070 CDS open 67402-68274 _na     290_aa yhaK Short-chain dehydrogenase/reductase family oxidoreductase
1302 JAIMJK010000011.1 GCA019815155_00071 CDS open 68439-68795 _na     118_aa hxlR Transcriptional regulator%2C HxlR family
1303 JAIMJK010000011.1 GCA019815155_00072 CDS open 68921-69406 _na     161_aa DUF4189 domain-containing protein
1304 JAIMJK010000011.1 GCA019815155_00073 CDS open 69519-70085 _na     188_aa ppiB Peptidyl-prolyl cis-trans isomerase
1305 JAIMJK010000011.1 GCA019815155_00074 CDS open 70234-70797 _na     187_aa yceI Lipid/polyisoprenoid-binding YceI-like domain-containing protein
1306 JAIMJK010000011.1 GCA019815155_00075 CDS open 70960-73407 _na     815_aa ftsK Cell division protein FtsK
1307 JAIMJK010000011.1 GCA019815155_00076 CDS open 73577-74941 _na     454_aa yocR Transporter
1308 JAIMJK010000011.1 GCA019815155_00078 CDS open 75574-76047 _na     157_aa fxsA FxsA cytoplasmic membrane protein
1309 JAIMJK010000011.1 GCA019815155_00079 CDS open 76138-76698 _na     186_aa Membrane lipoprotein
1310 JAIMJK010000011.1 GCA019815155_00080 CDS open 76826-77326 _na     166_aa hypothetical protein
1311 JAIMJK010000011.1 GCA019815155_00081 CDS open 77808-79718 _na     636_aa amyA Amylosucrase
1312 JAIMJK010000011.1 GCA019815155_00082 CDS open 80172-82460 _na     762_aa cirA putative TonB-dependent receptor NMB0964
1313 JAIMJK010000011.1 GCA019815155_00083 CDS open 82763-83239 _na     158_aa Mannose-6-phosphate isomerase
1314 JAIMJK010000011.1 GCA019815155_00084 CDS open 83400-83762 _na     120_aa SnoaL-like domain-containing protein
1315 JAIMJK010000011.1 GCA019815155_00085 CDS open 83868-85277 _na     469_aa pepA leucyl aminopeptidase
1316 JAIMJK010000011.1 GCA019815155_00086 CDS open 85392-86561 _na     389_aa lptF LPS export ABC transporter permease LptF
1317 JAIMJK010000011.1 GCA019815155_00087 CDS open 86558-87628 _na     356_aa lptG LPS export ABC transporter permease LptG
1318 JAIMJK010000011.1 GCA019815155_00088 CDS open 87901-88668 _na     255_aa aroD 3-dehydroquinate dehydratase
1319 JAIMJK010000011.1 GCA019815155_00089 CDS open 88665-89363 _na     232_aa TIGR02117 family protein
1320 JAIMJK010000011.1 GCA019815155_00090 CDS open 89487-90293 _na     268_aa Integrase core domain protein
1321 JAIMJK010000011.1 GCA019815155_00091 CDS open 90620-92035 _na     471_aa citT Transporter%2C NadC family
1322 JAIMJK010000011.1 GCA019815155_00092 CDS open 92145-92654 _na     169_aa ppiB Peptidyl-prolyl cis-trans isomerase
1323 JAIMJK010000011.1 GCA019815155_00093 CDS open 93241-94068 _na     275_aa fghA S-formylglutathione hydrolase
1324 JAIMJK010000011.1 GCA019815155_00094 CDS open 94077-95213 _na     378_aa frmA S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase
1325 JAIMJK010000011.1 GCA019815155_00095 CDS open 95433-95915 _na     160_aa Type I secretion target GGXGXDXXX repeat (2 copies)
1326 JAIMJK010000011.1 GCA019815155_00096 CDS open 95900-96115 _na     71_aa hypothetical protein
1327 JAIMJK010000011.1 GCA019815155_00097 CDS open 96336-96833 _na     165_aa ybhB YbhB/YbcL family Raf kinase inhibitor-like protein
1328 JAIMJK010000011.1 GCA019815155_00098 CDS open 96941-97633 _na     230_aa ung uracil-DNA glycosylase
1329 JAIMJK010000011.1 GCA019815155_00099 CDS open 97703-99505 _na     600_aa dsbD Thiol:disulfide interchange protein DsbD
1330 JAIMJK010000011.1 GCA019815155_00100 CDS open 99778-100434 _na     218_aa citB Response regulator receiver domain protein
1331 JAIMJK010000011.1 GCA019815155_00101 CDS open 100431-102236 _na     601_aa narQ Sensor protein
1332 JAIMJK010000011.1 GCA019815155_00102 CDS open 102479-103039 _na     186_aa mobA Putative molybdopterin-guanine dinucleotide biosynthesis protein MobA
1333 JAIMJK010000011.1 GCA019815155_00103 CDS open 103167-105662 _na     831_aa rnr ribonuclease R
1334 JAIMJK010000011.1 GCA019815155_00107 CDS open 106286-107092 _na     268_aa insO Integrase core domain protein
1335 JAIMJK010000011.1 GCA019815155_00108 CDS open 107406-107789 _na     127_aa CRISPR-associated protein Cas6 C-terminal domain-containing protein
1336 JAIMJK010000011.1 GCA019815155_00109 CDS open 109155-109877 _na     240_aa csm6 CRISPR-associated ring nuclease Csm6
1337 JAIMJK010000011.1 GCA019815155_00110 CDS open 110248-111393 _na     381_aa Card1 endonuclease domain-containing protein
1338 JAIMJK010000011.1 GCA019815155_00111 CDS open 111582-113009 _na     475_aa caiA Acyl-Coenzyme A dehydrogenase%2C very long chain
1339 JAIMJK010000011.1 GCA019815155_00112 CDS open 113201-113893 _na     230_aa ccc1 VIT family protein
1340 JAIMJK010000011.1 GCA019815155_00113 CDS open 114142-118452 _na     1436_aa glgB 1%2C4-alpha-glucan branching protein GlgB
1341 JAIMJK010000011.1 GCA019815155_00114 CDS open 118749-119228 _na     159_aa Peptidyl-prolyl cis-trans isomerase
1342 JAIMJK010000011.1 GCA019815155_00115 CDS open 120215-121582 _na     455_aa glcD D-lactate dehydrogenase (Cytochrome)
1343 JAIMJK010000011.1 GCA019815155_00116 CDS open 121722-122708 _na     328_aa mdh malate dehydrogenase
1344 JAIMJK010000011.1 GCA019815155_00117 CDS open 122776-123948 _na     390_aa labA HTH OST-type domain-containing protein
1345 JAIMJK010000011.1 GCA019815155_00118 CDS open 124064-125365 _na     433_aa mpfA Polyamine export protein
1346 JAIMJK010000011.1 GCA019815155_00119 CDS open 125681-127147 _na     488_aa Permease
1347 JAIMJK010000011.1 GCA019815155_00120 CDS open 127622-128098 _na     158_aa fur Ferric uptake regulation protein
1348 JAIMJK010000011.1 GCA019815155_00121 CDS open 128086-129015 _na     309_aa yejR Zinc-binding GTPase YeiR
1349 JAIMJK010000011.1 GCA019815155_00122 CDS open 129259-130164 _na     301_aa Nuclease
1350 JAIMJK010000011.1 GCA019815155_00123 CDS open 130212-131264 _na     350_aa yejB Oligopeptide/dipeptide ABC superfamily ATP binding cassette transporter%2C permease protein
1351 JAIMJK010000011.1 GCA019815155_00124 CDS open 131292-132338 _na     348_aa yejE ABC transporter%2C permease protein
1352 JAIMJK010000011.1 GCA019815155_00125 CDS open 132446-133987 _na     513_aa menE Long-chain-fatty-acid--CoA ligase
1353 JAIMJK010000011.1 GCA019815155_00126 CDS open 134174-135721 _na     515_aa cntF staphylopine uptake ABC transporter ATP-binding protein CntF
1354 JAIMJK010000011.1 GCA019815155_00127 CDS open 135872-136204 _na     110_aa trxA thioredoxin TrxA
1355 JAIMJK010000011.1 GCA019815155_00128 CDS open 136302-138329 _na     675_aa uvrB excinuclease ABC subunit UvrB
1356 JAIMJK010000011.1 GCA019815155_00129 CDS open 138354-139004 _na     216_aa hypothetical protein
1357 JAIMJK010000011.1 GCA019815155_00130 CDS open 139221-139469 _na     82_aa SMI1/KNR4 family protein
1358 JAIMJK010000011.1 GCA019815155_00131 CDS open 139421-139768 _na     115_aa SMI1/KNR4 family protein
1359 JAIMJK010000011.1 GCA019815155_00132 CDS open 139967-141952 _na     661_aa Band 7 domain-containing protein
1360 JAIMJK010000011.1 GCA019815155_00136 CDS open 143609-144928 _na     439_aa uhpC Transporter%2C major facilitator family protein
1361 JAIMJK010000011.1 GCA019815155_00137 CDS open 145269-146117 _na     282_aa opuBA ABC superfamily ATP binding cassette transporter%2C ABC protein
1362 JAIMJK010000011.1 GCA019815155_00138 CDS open 146357-146902 _na     181_aa DUF4303 domain-containing protein
1363 JAIMJK010000011.1 GCA019815155_00139 CDS open 147093-148079 _na     328_aa HTH araC/xylS-type domain-containing protein
1364 JAIMJK010000011.1 GCA019815155_00140 CDS open 148177-149028 _na     283_aa Metallo-beta-lactamase domain-containing protein
1365 JAIMJK010000011.1 GCA019815155_00141 CDS open 149599-150045 _na     148_aa hypothetical protein
1366 JAIMJK010000011.1 GCA019815155_00142 CDS open 150137-151078 _na     313_aa tehA dicarboxylate transporter/tellurite-resistance protein TehA
1367 JAIMJK010000011.1 GCA019815155_00143 CDS open 151301-152050 _na     249_aa ubiE Demethylmenaquinone methyltransferase
1368 JAIMJK010000011.1 GCA019815155_00144 CDS open 152376-152624 _na     82_aa csbD CsbD family protein
1369 JAIMJK010000011.1 GCA019815155_00145 CDS open 152752-154281 _na     509_aa osmF ABC transporter%2C substrate-binding protein%2C QAT family
1370 JAIMJK010000011.1 GCA019815155_00146 CDS open 154358-154567 _na     69_aa copZ HMA domain-containing protein
1371 JAIMJK010000011.1 GCA019815155_00147 CDS open 155120-157402 _na     760_aa CRISPR-associated helicase/endonuclease Cas3
1372 JAIMJK010000011.1 GCA019815155_00148 CDS open 157441-158763 _na     440_aa nucleotide-binding domain-containing protein
1373 JAIMJK010000011.1 GCA019815155_00149 CDS open 158756-159349 _na     197_aa SLATT domain-containing protein
1374 JAIMJK010000011.1 GCA019815155_00150 CDS open 159394-160068 _na     224_aa cas5c type I-C CRISPR-associated protein Cas5c
1375 JAIMJK010000011.1 GCA019815155_00151 CDS open 160065-161843 _na     592_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
1376 JAIMJK010000011.1 GCA019815155_00152 CDS open 161855-162721 _na     288_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
1377 JAIMJK010000011.1 GCA019815155_00153 CDS open 162736-163389 _na     217_aa cas4 CRISPR-associated protein Cas4
1378 JAIMJK010000011.1 GCA019815155_00154 CDS open 163442-164926 _na     494_aa RNA-directed DNA polymerase
1379 JAIMJK010000011.1 GCA019815155_00155 CDS open 164999-166012 _na     337_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
1380 JAIMJK010000011.1 GCA019815155_00156 CDS open 166087-166380 _na     97_aa cas2 CRISPR-associated endonuclease Cas2
1381 JAIMJK010000011.1 GCA019815155_00157 CDS open 169836-170054 _na     72_aa ydcH DUF465 domain-containing protein
1382 JAIMJK010000011.1 GCA019815155_00158 CDS open 170138-171553 _na     471_aa cysG siroheme synthase CysG
1383 JAIMJK010000011.1 GCA019815155_00159 CDS open 171825-172739 _na     304_aa cysD sulfate adenylyltransferase subunit CysD
1384 JAIMJK010000011.1 GCA019815155_00160 CDS open 172883-173641 _na     252_aa cah Carbonic anhydrase
1385 JAIMJK010000011.1 GCA019815155_00161 CDS open 173961-174692 _na     243_aa cysH phosphoadenylyl-sulfate reductase
1386 JAIMJK010000011.1 GCA019815155_00162 CDS open 174822-175880 _na     352_aa dinB DNA polymerase IV
1387 JAIMJK010000011.1 GCA019815155_00163 CDS open 175975-176820 _na     281_aa rlmJ Ribosomal RNA large subunit methyltransferase J
1388 JAIMJK010000011.1 GCA019815155_00164 CDS open 177035-178792 _na     585_aa recD exodeoxyribonuclease V subunit alpha
1389 JAIMJK010000011.1 GCA019815155_00165 CDS open 179037-180155 _na     372_aa Porin
1390 JAIMJK010000011.1 GCA019815155_00166 CDS open 180304-180705 _na     133_aa RNA-binding S4 domain-containing protein
1391 JAIMJK010000011.1 GCA019815155_00167 CDS open 180922-181881 _na     319_aa accA acetyl-CoA carboxylase carboxyltransferase subunit alpha
1392 JAIMJK010000011.1 GCA019815155_00168 CDS open 182066-183316 _na     416_aa ttcA tRNA(Ile)-lysidine synthase
1393 JAIMJK010000011.1 GCA019815155_00169 CDS open 183399-183998 _na     199_aa rpoE RNA polymerase sigma factor RpoE
1394 JAIMJK010000011.1 GCA019815155_00170 CDS open 184004-184588 _na     194_aa Anti-sigma factor
1395 JAIMJK010000011.1 GCA019815155_00171 CDS open 184766-185557 _na     263_aa spoU RNA methyltransferase%2C TrmH family
1396 JAIMJK010000011.1 GCA019815155_00172 CDS open 185686-186858 _na     390_aa lldD L-lactate dehydrogenase
1397 JAIMJK010000011.1 GCA019815155_00173 CDS open 187215-187661 _na     148_aa iscR Fe-S cluster assembly transcriptional regulator IscR
1398 JAIMJK010000011.1 GCA019815155_00174 CDS open 187691-188905 _na     404_aa iscS IscS subfamily cysteine desulfurase
1399 JAIMJK010000011.1 GCA019815155_00175 CDS open 189108-189401 _na     97_aa hypothetical protein
1400 JAIMJK010000011.1 GCA019815155_00176 CDS open 189578-189706 _na     42_aa FxLD family lantipeptide
1401 JAIMJK010000011.1 GCA019815155_00177 CDS open 189776-190162 _na     128_aa iscU Iron-sulfur cluster assembly scaffold protein IscU
1402 JAIMJK010000011.1 GCA019815155_00178 CDS open 190783-191028 _na     81_aa recA Recombinase RecA
1403 JAIMJK010000011.1 GCA019815155_00179 CDS open 191094-191414 _na     106_aa iscA iron-sulfur cluster assembly protein IscA
1404 JAIMJK010000011.1 GCA019815155_00180 CDS open 191374-191595 _na     73_aa arfA Alternative ribosome-rescue factor A
1405 JAIMJK010000011.1 GCA019815155_00181 CDS open 191678-192178 _na     166_aa hscB Fe-S protein assembly co-chaperone HscB
1406 JAIMJK010000011.1 GCA019815155_00182 CDS open 192544-194823 _na     759_aa nrdA class 1a ribonucleoside-diphosphate reductase subunit alpha
1407 JAIMJK010000011.1 GCA019815155_00183 CDS open 194993-195667 _na     224_aa hypothetical protein
1408 JAIMJK010000011.1 GCA019815155_00184 CDS open 195750-196904 _na     384_aa nrdB class Ia ribonucleoside-diphosphate reductase subunit beta
1409 JAIMJK010000011.1 GCA019815155_00185 CDS open 197024-197326 _na     100_aa yfaE class I ribonucleotide reductase maintenance protein YfaE
1410 JAIMJK010000011.1 GCA019815155_00186 CDS open 197438-198265 _na     275_aa NMB0938 family lipoprotein
1411 JAIMJK010000011.1 GCA019815155_00187 CDS open 198577-199872 _na     431_aa dadA FAD-binding oxidoreductase
1412 JAIMJK010000011.1 GCA019815155_00188 CDS open 200003-200890 _na     295_aa potC Spermidine/putrescine ABC transporter%2C permease protein
1413 JAIMJK010000011.1 GCA019815155_00189 CDS open 200890-201855 _na     321_aa potB ABC transporter permease%2C polyamine
1414 JAIMJK010000011.1 GCA019815155_00190 CDS open 201871-202995 _na     374_aa potA Spermidine/putrescine import ATP-binding protein PotA
1415 JAIMJK010000011.1 GCA019815155_00191 CDS open 203641-204321 _na     226_aa radC DNA repair protein RadC
1416 JAIMJK010000011.1 GCA019815155_00192 CDS open 204522-205025 _na     167_aa DUF1841 domain-containing protein
1417 JAIMJK010000011.1 GCA019815155_00193 CDS open 205120-205752 _na     210_aa mlaC Toluene tolerance family protein
1418 JAIMJK010000011.1 GCA019815155_00194 CDS open 205813-206472 _na     219_aa cytB Nickel-dependent hydrogenases B-type cytochrome subunit
1419 JAIMJK010000011.1 GCA019815155_00195 CDS open 206601-207500 _na     299_aa nnr2 ADP-dependent (S)-NAD(P)H-hydrate dehydratase
1420 JAIMJK010000011.1 GCA019815155_00196 CDS open 207592-208659 _na     355_aa PD-(D/E)XK nuclease superfamily protein
1421 JAIMJK010000011.1 GCA019815155_00197 CDS open 208935-210461 _na     508_aa fbpB ABC transporter%2C permease protein
1422 JAIMJK010000011.1 GCA019815155_00198 CDS open 210514-211233 _na     239_aa trmR Class I SAM-dependent methyltransferase
1423 JAIMJK010000011.1 GCA019815155_00199 CDS open 211368-212744 _na     458_aa mpl UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase
1424 JAIMJK010000011.1 GCA019815155_00200 CDS open 212985-214001 _na     338_aa tnp IS30 family transposase
1425 JAIMJK010000011.1 GCA019815155_00201 CDS open 214283-214627 _na     114_aa Cupin domain-containing protein
1426 JAIMJK010000011.1 GCA019815155_00202 CDS open 214786-215802 _na     338_aa tnp IS30 family transposase
1427 JAIMJK010000011.1 GCA019815155_00203 CDS open 215845-215973 _na     42_aa FeoB-associated Cys-rich membrane protein
1428 JAIMJK010000011.1 GCA019815155_00204 CDS open 215970-217838 _na     622_aa ferrous iron transporter B
1429 JAIMJK010000011.1 GCA019815155_00205 CDS open 218009-218275 _na     88_aa feoA FeoA domain protein
1430 JAIMJK010000011.1 GCA019815155_00206 CDS open 218593-219240 _na     215_aa nnr1 NAD(P)H-hydrate epimerase
1431 JAIMJK010000011.1 GCA019815155_00207 CDS open 219400-220443 _na     347_aa sbp Sulfate ABC transporter%2C sulfate-binding protein
1432 JAIMJK010000011.1 GCA019815155_00208 CDS open 220612-221520 _na     302_aa yddG aromatic amino acid DMT transporter YddG
1433 JAIMJK010000011.1 GCA019815155_00209 CDS open 222003-223064 _na     353_aa bioB biotin synthase BioB
1434 JAIMJK010000011.1 GCA019815155_00210 CDS open 223483-224457 _na     324_aa fbp class 1 fructose-bisphosphatase
1435 JAIMJK010000011.1 GCA019815155_00211 CDS open 224535-224900 _na     121_aa Lipoprotein
1436 JAIMJK010000011.1 GCA019815155_00212 CDS open 225079-226422 _na     447_aa pcnB Poly(A) polymerase I
1437 JAIMJK010000011.1 GCA019815155_00213 CDS open 226603-227520 _na     305_aa truB tRNA pseudouridine(55) synthase TruB
1438 JAIMJK010000011.1 GCA019815155_00214 CDS open 227629-228000 _na     123_aa rbfA 30S ribosome-binding factor RbfA
1439 JAIMJK010000011.1 GCA019815155_00215 CDS open 228119-229159 _na     346_aa mviM Oxidoreductase%2C NAD-binding domain protein
1440 JAIMJK010000011.1 GCA019815155_00216 CDS open 229494-230540 _na     348_aa recA recombinase RecA
1441 JAIMJK010000011.1 GCA019815155_00217 CDS open 230776-231588 _na     270_aa pflA pyruvate formate lyase 1-activating protein
1442 JAIMJK010000011.1 GCA019815155_00218 CDS open 231881-234166 _na     761_aa pflB formate C-acetyltransferase
1443 JAIMJK010000011.1 GCA019815155_00219 CDS open 234584-235057 _na     157_aa bfr bacterioferritin
1444 JAIMJK010000011.1 GCA019815155_00220 CDS open 235080-235544 _na     154_aa bfr bacterioferritin
1445 JAIMJK010000011.1 GCA019815155_00221 CDS open 235964-237775 _na     603_aa typA translational GTPase TypA
1446 JAIMJK010000011.1 GCA019815155_00222 CDS open 237879-238229 _na     116_aa Helix-turn-helix domain-containing protein
1447 JAIMJK010000011.1 GCA019815155_00223 CDS open 238433-239029 _na     198_aa IS3 family transposase
1448 JAIMJK010000011.1 GCA019815155_00224 CDS open 239397-239933 _na     178_aa hypothetical protein
1449 JAIMJK010000011.1 GCA019815155_00225 CDS open 240090-241076 _na     328_aa lipA lipoyl synthase
1450 JAIMJK010000011.1 GCA019815155_00226 CDS open 241076-241693 _na     205_aa lipB lipoyl(octanoyl) transferase LipB
1451 JAIMJK010000011.1 GCA019815155_00227 CDS open 241695-241961 _na     88_aa ybeD UPF0250 protein MCC93_17350
1452 JAIMJK010000011.1 GCA019815155_00228 CDS open 242162-244624 _na     820_aa lon endopeptidase La
1453 JAIMJK010000011.1 GCA019815155_00229 CDS open 244725-245105 _na     126_aa hypothetical protein
1454 JAIMJK010000011.1 GCA019815155_00230 CDS open 245164-245547 _na     127_aa vanZ VanZ family protein
1455 JAIMJK010000011.1 GCA019815155_00231 CDS open 245544-245750 _na     68_aa Dioxygenase
1456 JAIMJK010000011.1 GCA019815155_00232 CDS open 245778-246356 _na     192_aa pth aminoacyl-tRNA hydrolase
1457 JAIMJK010000011.1 GCA019815155_00233 CDS open 246423-246698 _na     91_aa pasI RnfH family protein
1458 JAIMJK010000011.1 GCA019815155_00234 CDS open 246691-247122 _na     143_aa pasT Polyketide cyclase/dehydrase
1459 JAIMJK010000011.1 GCA019815155_00235 CDS open 247350-248759 _na     469_aa tPR Sel1 repeat protein
1460 JAIMJK010000011.1 GCA019815155_00236 CDS open 249203-250018 _na     271_aa hpnC squalene synthase HpnC
1461 JAIMJK010000011.1 GCA019815155_00237 CDS open 250123-250686 _na     187_aa ydeN Serine hydrolase
1462 JAIMJK010000011.1 GCA019815155_00238 CDS open 250901-251263 _na     120_aa crcB fluoride efflux transporter CrcB
1463 JAIMJK010000011.1 GCA019815155_00239 CDS open 251370-252089 _na     239_aa ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
1464 JAIMJK010000011.1 GCA019815155_00240 CDS open 252056-252775 _na     239_aa dnaQ DNA polymerase III subunit epsilon
1465 JAIMJK010000011.1 GCA019815155_00241 CDS open 253177-253659 _na     160_aa Pyridoxamine 5'-phosphate oxidase family protein
1466 JAIMJK010000011.1 GCA019815155_00242 CDS open 253828-254271 _na     147_aa YSIRK family Signal peptide
1467 JAIMJK010000011.1 GCA019815155_00243 CDS open 254355-255389 _na     344_aa purM Phosphoribosylformylglycinamidine cyclo-ligase
1468 JAIMJK010000011.1 GCA019815155_00244 CDS open 255595-256665 _na     356_aa perM ATP synthase F0%2C A subunit
1469 JAIMJK010000011.1 GCA019815155_00245 CDS open 256931-257647 _na     238_aa xapA S-methyl-5'-thioinosine phosphorylase
1470 JAIMJK010000011.1 GCA019815155_00246 CDS open 257891-260167 _na     758_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
1471 JAIMJK010000011.1 GCA019815155_00247 CDS open 260303-261181 _na     292_aa metF methylenetetrahydrofolate reductase
1472 JAIMJK010000011.1 GCA019815155_00248 CDS open 261524-261721 _na     65_aa iscX Fe-S cluster assembly protein IscX
1473 JAIMJK010000011.1 GCA019815155_00249 CDS open 262056-262667 _na     203_aa Terminase
1474 JAIMJK010000011.1 GCA019815155_00250 CDS open 262811-263152 _na     113_aa fdx ISC system 2Fe-2S type ferredoxin
1475 JAIMJK010000011.1 GCA019815155_00251 CDS open 263238-263600 _na     120_aa Pyrimidine dimer DNA glycosylase
1476 JAIMJK010000011.1 GCA019815155_00252 CDS open 263680-265542 _na     620_aa hscA Fe-S protein assembly chaperone HscA
1477 JAIMJK010000011.1 GCA019815155_00253 CDS open 265739-266587 _na     282_aa hpnD presqualene diphosphate synthase HpnD
1478 JAIMJK010000011.1 GCA019815155_00254 CDS open 266584-267897 _na     437_aa hpnE hydroxysqualene dehydroxylase HpnE
1479 JAIMJK010000011.1 GCA019815155_00255 CDS open 268014-268733 _na     239_aa fabG SDR family oxidoreductase
1480 JAIMJK010000011.1 GCA019815155_00256 CDS open 268958-269452 _na     164_aa DUF1436 domain-containing protein
1481 JAIMJK010000011.1 GCA019815155_00257 CDS open 269608-270234 _na     208_aa hypothetical protein
1482 JAIMJK010000011.1 GCA019815155_00258 CDS open 270379-273855 _na     1158_aa mfd transcription-repair coupling factor
1483 JAIMJK010000011.1 GCA019815155_00259 CDS open 273997-274728 _na     243_aa tadA tRNA adenosine(34) deaminase TadA
1484 JAIMJK010000011.1 GCA019815155_00260 CDS open 274735-275676 _na     313_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
1485 JAIMJK010000011.1 GCA019815155_00261 CDS open 275799-277097 _na     432_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
1486 JAIMJK010000011.1 GCA019815155_00262 CDS open 277327-278802 _na     491_aa trpE anthranilate synthase component I
1487 JAIMJK010000011.1 GCA019815155_00263 CDS open 278869-279777 _na     302_aa hypothetical protein
1488 JAIMJK010000011.1 GCA019815155_00264 CDS open 279782-280918 _na     378_aa purK 5-(carboxyamino)imidazole ribonucleotide synthase
1489 JAIMJK010000011.1 GCA019815155_00265 CDS open 280997-281479 _na     160_aa phnO Acetyltransferase%2C GNAT family
1490 JAIMJK010000011.1 GCA019815155_00266 CDS open 281574-282191 _na     205_aa smrB Smr domain protein
1491 JAIMJK010000011.1 GCA019815155_00267 CDS open 282574-285237 _na     887_aa aceE pyruvate dehydrogenase (acetyl-transferring)%2C homodimeric type
1492 JAIMJK010000011.1 GCA019815155_00268 CDS open 285478-287097 _na     539_aa aceF dihydrolipoyllysine-residue acetyltransferase
1493 JAIMJK010000011.1 GCA019815155_00269 CDS open 287185-288972 _na     595_aa lpdA dihydrolipoyl dehydrogenase
1494 JAIMJK010000011.1 GCA019815155_00270 CDS open 289314-290021 _na     235_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
1495 JAIMJK010000011.1 GCA019815155_00271 CDS open 290041-290670 _na     209_aa ribC riboflavin synthase subunit alpha
1496 JAIMJK010000011.1 GCA019815155_00272 CDS open 290679-291545 _na     288_aa atu1564 Type I restriction-modification system
1497 JAIMJK010000011.1 GCA019815155_00273 CDS open 291723-292151 _na     142_aa cpxP Periplasmic protein
1498 JAIMJK010000011.1 GCA019815155_00274 CDS open 292407-293090 _na     227_aa rpe ribulose-phosphate 3-epimerase
1499 JAIMJK010000011.1 GCA019815155_00275 CDS open 293178-293498 _na     106_aa Phage associated membrane protein
1500 JAIMJK010000011.1 GCA019815155_00276 CDS open 293752-294903 _na     383_aa hisZ ATP phosphoribosyltransferase regulatory subunit