HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_021406645.1)

Select a Genome:
BAKTA Annotations for GCA_021406645.1
Genome Selected: Porphyromonas gingivalis
ContigsBases CDSrRNA tmRNAtRNA
85 2265994 1894 6 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3916 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 3916 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 JAEMBJ010000030.1 GCA021406645_00161 gene open 23337-25955
3002 JAEMBJ010000030.1 GCA021406645_00162 gene open 26031-26273 cTD-A
3003 JAEMBJ010000030.1 GCA021406645_00151 gene open 10399-10471 trnG
3004 JAEMBJ010000030.1 GCA021406645_00151 tRNA open 10399-10471 trnG tRNA-Gly(ccc)
3005 JAEMBJ010000031.1 GCA021406645_01187 CDS open 730-1296 _na     188_aa efp elongation factor P
3006 JAEMBJ010000031.1 GCA021406645_01188 CDS open 1428-2984 _na     518_aa LTD domain-containing protein
3007 JAEMBJ010000031.1 GCA021406645_01189 CDS open 3180-4193 _na     337_aa asd aspartate-semialdehyde dehydrogenase
3008 JAEMBJ010000031.1 GCA021406645_01190 CDS open 4875-5810 _na     311_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
3009 JAEMBJ010000031.1 GCA021406645_01191 CDS open 5810-6283 _na     157_aa ftsL Cell division protein FtsL
3010 JAEMBJ010000031.1 GCA021406645_01192 CDS open 6293-8494 _na     733_aa ftsI Penicillin-binding protein 2%2C putative
3011 JAEMBJ010000031.1 GCA021406645_01193 CDS open 8505-9968 _na     487_aa murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
3012 JAEMBJ010000031.1 GCA021406645_01194 CDS open 9983-11242 _na     419_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
3013 JAEMBJ010000031.1 GCA021406645_01195 CDS open 11266-12618 _na     450_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
3014 JAEMBJ010000031.1 GCA021406645_01196 CDS open 12630-13886 _na     418_aa ftsW putative peptidoglycan glycosyltransferase FtsW
3015 JAEMBJ010000031.1 GCA021406645_01197 CDS open 13883-15022 _na     379_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
3016 JAEMBJ010000031.1 GCA021406645_01198 CDS open 15022-16392 _na     456_aa murC UDP-N-acetylmuramate--L-alanine ligase
3017 JAEMBJ010000031.1 GCA021406645_01199 CDS open 16386-17162 _na     258_aa ftsQ FtsQ
3018 JAEMBJ010000031.1 GCA021406645_01200 CDS open 17220-18650 _na     476_aa ftsA Cell division protein FtsA
3019 JAEMBJ010000031.1 GCA021406645_01201 CDS open 18653-20026 _na     457_aa ftsZ cell division protein FtsZ
3020 JAEMBJ010000031.1 GCA021406645_01202 CDS open 20058-20507 _na     149_aa yqeY Glutamyl-tRNA amidotransferase
3021 JAEMBJ010000031.1 GCA021406645_01203 CDS open 21278-21910 _na     210_aa yadS YadS protein
3022 JAEMBJ010000031.1 GCA021406645_01204 CDS open 21962-22783 _na     273_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
3023 JAEMBJ010000031.1 GCA021406645_01205 CDS open 22854-24374 _na     506_aa guaA glutamine-hydrolyzing GMP synthase
3024 JAEMBJ010000031.1 GCA021406645_01206 CDS open 24969-26102 _na     377_aa ISAs1 family transposase
3025 JAEMBJ010000031.1 GCA021406645_01187 gene open 730-1296 efp
3026 JAEMBJ010000031.1 GCA021406645_01188 gene open 1428-2984
3027 JAEMBJ010000031.1 GCA021406645_01189 gene open 3180-4193 asd
3028 JAEMBJ010000031.1 GCA021406645_01190 gene open 4875-5810 rsmH
3029 JAEMBJ010000031.1 GCA021406645_01191 gene open 5810-6283 ftsL
3030 JAEMBJ010000031.1 GCA021406645_01192 gene open 6293-8494 ftsI
3031 JAEMBJ010000031.1 GCA021406645_01193 gene open 8505-9968 murE
3032 JAEMBJ010000031.1 GCA021406645_01194 gene open 9983-11242 mraY
3033 JAEMBJ010000031.1 GCA021406645_01195 gene open 11266-12618 murD
3034 JAEMBJ010000031.1 GCA021406645_01196 gene open 12630-13886 ftsW
3035 JAEMBJ010000031.1 GCA021406645_01197 gene open 13883-15022 murG
3036 JAEMBJ010000031.1 GCA021406645_01198 gene open 15022-16392 murC
3037 JAEMBJ010000031.1 GCA021406645_01199 gene open 16386-17162 ftsQ
3038 JAEMBJ010000031.1 GCA021406645_01200 gene open 17220-18650 ftsA
3039 JAEMBJ010000031.1 GCA021406645_01201 gene open 18653-20026 ftsZ
3040 JAEMBJ010000031.1 GCA021406645_01202 gene open 20058-20507 yqeY
3041 JAEMBJ010000031.1 GCA021406645_01203 gene open 21278-21910 yadS
3042 JAEMBJ010000031.1 GCA021406645_01204 gene open 21962-22783 panB
3043 JAEMBJ010000031.1 GCA021406645_01205 gene open 22854-24374 guaA
3044 JAEMBJ010000031.1 GCA021406645_01206 gene open 24969-26102
3045 JAEMBJ010000032.1 GCA021406645_00042 CDS open 458-2917 _na     819_aa pheT phenylalanine--tRNA ligase subunit beta
3046 JAEMBJ010000032.1 GCA021406645_00043 CDS open 2960-3688 _na     242_aa tACO1 YebC/PmpR family DNA-binding transcriptional regulator
3047 JAEMBJ010000032.1 GCA021406645_00044 CDS open 3990-6665 _na     891_aa mutS DNA mismatch repair protein MutS
3048 JAEMBJ010000032.1 GCA021406645_00045 CDS open 7068-7187 _na     39_aa hypothetical protein
3049 JAEMBJ010000032.1 GCA021406645_00046 CDS open 7582-9087 _na     501_aa tolC Putative alkaline protease AprF
3050 JAEMBJ010000032.1 GCA021406645_00047 CDS open 9136-10131 _na     331_aa emrA Hemolysin secretion protein D
3051 JAEMBJ010000032.1 GCA021406645_00048 CDS open 10134-11315 _na     393_aa ABC-2 type transporter transmembrane domain-containing protein
3052 JAEMBJ010000032.1 GCA021406645_00049 CDS open 11317-12591 _na     424_aa yadH ABC-2 type transporter transmembrane domain-containing protein
3053 JAEMBJ010000032.1 GCA021406645_00050 CDS open 12720-13199 _na     159_aa dps DNA protection during starvation protein
3054 JAEMBJ010000032.1 GCA021406645_00051 CDS open 14185-15402 _na     405_aa pqqL Putative peptidase
3055 JAEMBJ010000032.1 GCA021406645_00052 CDS open 15581-16222 _na     213_aa gutQ putative sugar isomerase
3056 JAEMBJ010000032.1 GCA021406645_00053 CDS open 16368-18182 _na     604_aa srmB RNA helicase
3057 JAEMBJ010000032.1 GCA021406645_00054 CDS open 18201-19646 _na     481_aa Alpha-galactosidase
3058 JAEMBJ010000032.1 GCA021406645_00055 CDS open 19646-20845 _na     399_aa sdaA L-serine ammonia-lyase
3059 JAEMBJ010000032.1 GCA021406645_00056 CDS open 20940-21725 _na     261_aa porT Outer membrane protein beta-barrel domain-containing protein
3060 JAEMBJ010000032.1 GCA021406645_00057 CDS open 21731-22633 _na     300_aa Putative carbohydrate metabolism domain-containing protein
3061 JAEMBJ010000032.1 GCA021406645_00058 CDS open 22695-24680 _na     661_aa sbsA SbsA Ig-like domain-containing protein
3062 JAEMBJ010000032.1 GCA021406645_00042 gene open 458-2917 pheT
3063 JAEMBJ010000032.1 GCA021406645_00043 gene open 2960-3688 tACO1
3064 JAEMBJ010000032.1 GCA021406645_00044 gene open 3990-6665 mutS
3065 JAEMBJ010000032.1 GCA021406645_00045 gene open 7068-7187
3066 JAEMBJ010000032.1 GCA021406645_00046 gene open 7582-9087 tolC
3067 JAEMBJ010000032.1 GCA021406645_00047 gene open 9136-10131 emrA
3068 JAEMBJ010000032.1 GCA021406645_00048 gene open 10134-11315
3069 JAEMBJ010000032.1 GCA021406645_00049 gene open 11317-12591 yadH
3070 JAEMBJ010000032.1 GCA021406645_00050 gene open 12720-13199 dps
3071 JAEMBJ010000032.1 GCA021406645_00051 gene open 14185-15402 pqqL
3072 JAEMBJ010000032.1 GCA021406645_00052 gene open 15581-16222 gutQ
3073 JAEMBJ010000032.1 GCA021406645_00053 gene open 16368-18182 srmB
3074 JAEMBJ010000032.1 GCA021406645_00054 gene open 18201-19646
3075 JAEMBJ010000032.1 GCA021406645_00055 gene open 19646-20845 sdaA
3076 JAEMBJ010000032.1 GCA021406645_00056 gene open 20940-21725 porT
3077 JAEMBJ010000032.1 GCA021406645_00057 gene open 21731-22633
3078 JAEMBJ010000032.1 GCA021406645_00058 gene open 22695-24680 sbsA
3079 JAEMBJ010000033.1 GCA021406645_00198 CDS open 259-4233 _na     1324_aa sSL2 site-specific DNA-methyltransferase (adenine-specific)
3080 JAEMBJ010000033.1 GCA021406645_00199 CDS open 4243-5247 _na     334_aa Type II DNA modification methyltransferase
3081 JAEMBJ010000033.1 GCA021406645_00200 CDS open 6316-7410 _na     364_aa mltG Endolytic murein transglycosylase
3082 JAEMBJ010000033.1 GCA021406645_00201 CDS open 7407-8156 _na     249_aa tcdA HesA/MoeB/ThiF family protein
3083 JAEMBJ010000033.1 GCA021406645_00202 CDS open 8153-8812 _na     219_aa lolD Lipoprotein-releasing system ATP-binding protein LolD
3084 JAEMBJ010000033.1 GCA021406645_00203 CDS open 8842-9546 _na     234_aa comEA Competence protein ComEA helix-hairpin-helix repeat region
3085 JAEMBJ010000033.1 GCA021406645_00204 CDS open 9553-10155 _na     200_aa tsaC L-threonylcarbamoyladenylate synthase
3086 JAEMBJ010000033.1 GCA021406645_00205 CDS open 10639-11109 _na     156_aa greA transcription elongation factor GreA
3087 JAEMBJ010000033.1 GCA021406645_00206 CDS open 11124-11513 _na     129_aa hinT HIT family protein
3088 JAEMBJ010000033.1 GCA021406645_00207 CDS open 11889-12053 _na     54_aa hypothetical protein
3089 JAEMBJ010000033.1 GCA021406645_00208 CDS open 12143-12619 _na     158_aa Outer membrane protein beta-barrel domain-containing protein
3090 JAEMBJ010000033.1 GCA021406645_00209 CDS open 12616-13902 _na     428_aa Glycoside hydrolase family 57 N-terminal domain-containing protein
3091 JAEMBJ010000033.1 GCA021406645_00210 CDS open 13899-15149 _na     416_aa rfaB Glycosyl transferase%2C group 1 family protein
3092 JAEMBJ010000033.1 GCA021406645_00211 CDS open 15158-17134 _na     658_aa gDB1 Putative 4-alpha-glucanotransferase
3093 JAEMBJ010000033.1 GCA021406645_00212 CDS open 17264-17410 _na     48_aa hypothetical protein
3094 JAEMBJ010000033.1 GCA021406645_00213 CDS open 17621-18322 _na     233_aa Putative ATP-binding component of ABC transporter protein
3095 JAEMBJ010000033.1 GCA021406645_00214 CDS open 18357-19829 _na     490_aa DUF5687 domain-containing protein
3096 JAEMBJ010000033.1 GCA021406645_00215 CDS open 19946-21202 _na     418_aa pgk Phosphoglycerate kinase
3097 JAEMBJ010000033.1 GCA021406645_00216 CDS open 21499-23106 _na     535_aa pckA phosphoenolpyruvate carboxykinase (ATP)
3098 JAEMBJ010000033.1 GCA021406645_00217 CDS open 23297-23509 _na     70_aa putative partial hemagglutinin-related protein
3099 JAEMBJ010000033.1 GCA021406645_00218 CDS open 23509-23871 _na     120_aa putative partial hemagglutinin-related protein
3100 JAEMBJ010000033.1 GCA021406645_00198 gene open 259-4233 sSL2
3101 JAEMBJ010000033.1 GCA021406645_00199 gene open 4243-5247
3102 JAEMBJ010000033.1 GCA021406645_00200 gene open 6316-7410 mltG
3103 JAEMBJ010000033.1 GCA021406645_00201 gene open 7407-8156 tcdA
3104 JAEMBJ010000033.1 GCA021406645_00202 gene open 8153-8812 lolD
3105 JAEMBJ010000033.1 GCA021406645_00203 gene open 8842-9546 comEA
3106 JAEMBJ010000033.1 GCA021406645_00204 gene open 9553-10155 tsaC
3107 JAEMBJ010000033.1 GCA021406645_00205 gene open 10639-11109 greA
3108 JAEMBJ010000033.1 GCA021406645_00206 gene open 11124-11513 hinT
3109 JAEMBJ010000033.1 GCA021406645_00207 gene open 11889-12053
3110 JAEMBJ010000033.1 GCA021406645_00208 gene open 12143-12619
3111 JAEMBJ010000033.1 GCA021406645_00209 gene open 12616-13902
3112 JAEMBJ010000033.1 GCA021406645_00210 gene open 13899-15149 rfaB
3113 JAEMBJ010000033.1 GCA021406645_00211 gene open 15158-17134 gDB1
3114 JAEMBJ010000033.1 GCA021406645_00212 gene open 17264-17410
3115 JAEMBJ010000033.1 GCA021406645_00213 gene open 17621-18322
3116 JAEMBJ010000033.1 GCA021406645_00214 gene open 18357-19829
3117 JAEMBJ010000033.1 GCA021406645_00215 gene open 19946-21202 pgk
3118 JAEMBJ010000033.1 GCA021406645_00216 gene open 21499-23106 pckA
3119 JAEMBJ010000033.1 GCA021406645_00217 gene open 23297-23509
3120 JAEMBJ010000033.1 GCA021406645_00218 gene open 23509-23871
3121 JAEMBJ010000034.1 GCA021406645_00219 CDS open 151-1374 _na     407_aa rsmD THUMP-like domain-containing protein
3122 JAEMBJ010000034.1 GCA021406645_00222 CDS open 1711-2535 _na     274_aa murQ N-acetylmuramic acid 6-phosphate etherase
3123 JAEMBJ010000034.1 GCA021406645_00223 CDS open 2528-3379 _na     283_aa badF BadF/BadG/BcrA/BcrD ATPase family protein
3124 JAEMBJ010000034.1 GCA021406645_00224 CDS open 3376-4836 _na     486_aa putP Sodium:solute symporter family protein
3125 JAEMBJ010000034.1 GCA021406645_00225 CDS open 5207-5665 _na     152_aa DNA-binding protein histone-like family
3126 JAEMBJ010000034.1 GCA021406645_00226 CDS open 5734-7053 _na     439_aa rarA ATPase%2C AAA family
3127 JAEMBJ010000034.1 GCA021406645_00227 CDS open 7079-7846 _na     255_aa trmN6 tRNA1(Val) (adenine(37)-N6)-methyltransferase
3128 JAEMBJ010000034.1 GCA021406645_00228 CDS open 7810-9267 _na     485_aa rpoN RNA polymerase factor sigma-54
3129 JAEMBJ010000034.1 GCA021406645_00229 CDS open 9261-10565 _na     434_aa murF UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
3130 JAEMBJ010000034.1 GCA021406645_00230 CDS open 10775-11131 _na     118_aa panD aspartate 1-decarboxylase
3131 JAEMBJ010000034.1 GCA021406645_00231 CDS open 11208-12545 _na     445_aa ffh signal recognition particle protein
3132 JAEMBJ010000034.1 GCA021406645_00232 CDS open 12666-13556 _na     296_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD
3133 JAEMBJ010000034.1 GCA021406645_00233 CDS open 13849-15195 _na     448_aa norM Multidrug-efflux transporter
3134 JAEMBJ010000034.1 GCA021406645_00234 CDS open 15606-18197 _na     863_aa clpB ATP-dependent chaperone ClpB
3135 JAEMBJ010000034.1 GCA021406645_00235 CDS open 18416-18976 _na     186_aa fldA Flavodoxin-like domain-containing protein
3136 JAEMBJ010000034.1 GCA021406645_00236 CDS open 19816-20238 _na     140_aa dynamin family protein
3137 JAEMBJ010000034.1 GCA021406645_00219 gene open 151-1374 rsmD
3138 JAEMBJ010000034.1 GCA021406645_00222 gene open 1711-2535 murQ
3139 JAEMBJ010000034.1 GCA021406645_00223 gene open 2528-3379 badF
3140 JAEMBJ010000034.1 GCA021406645_00224 gene open 3376-4836 putP
3141 JAEMBJ010000034.1 GCA021406645_00225 gene open 5207-5665
3142 JAEMBJ010000034.1 GCA021406645_00226 gene open 5734-7053 rarA
3143 JAEMBJ010000034.1 GCA021406645_00227 gene open 7079-7846 trmN6
3144 JAEMBJ010000034.1 GCA021406645_00228 gene open 7810-9267 rpoN
3145 JAEMBJ010000034.1 GCA021406645_00229 gene open 9261-10565 murF
3146 JAEMBJ010000034.1 GCA021406645_00230 gene open 10775-11131 panD
3147 JAEMBJ010000034.1 GCA021406645_00231 gene open 11208-12545 ffh
3148 JAEMBJ010000034.1 GCA021406645_00232 gene open 12666-13556 folD
3149 JAEMBJ010000034.1 GCA021406645_00233 gene open 13849-15195 norM
3150 JAEMBJ010000034.1 GCA021406645_00234 gene open 15606-18197 clpB
3151 JAEMBJ010000034.1 GCA021406645_00235 gene open 18416-18976 fldA
3152 JAEMBJ010000034.1 GCA021406645_00236 gene open 19816-20238
3153 JAEMBJ010000034.1 GCA021406645_00220 gene open 1434-1507 trnR
3154 JAEMBJ010000034.1 GCA021406645_00221 gene open 1543-1616 trnR
3155 JAEMBJ010000034.1 GCA021406645_00220 tRNA open 1434-1507 trnR tRNA-Arg(acg)
3156 JAEMBJ010000034.1 GCA021406645_00221 tRNA open 1543-1616 trnR tRNA-Arg(acg)
3157 JAEMBJ010000035.1 GCA021406645_01388 CDS open 14-1147 _na     377_aa ISAs1 family transposase
3158 JAEMBJ010000035.1 GCA021406645_01389 CDS open 1264-2019 _na     251_aa iron-containing alcohol dehydrogenase
3159 JAEMBJ010000035.1 GCA021406645_01390 CDS open 2034-3392 _na     452_aa hpt1 Phosphoribosyltransferase%2C putative/phosphoglycerate mutase family protein
3160 JAEMBJ010000035.1 GCA021406645_01391 CDS open 3511-5514 _na     667_aa virD4 YWFCY domain-containing protein
3161 JAEMBJ010000035.1 GCA021406645_01392 CDS open 5562-7745 _na     727_aa ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein
3162 JAEMBJ010000035.1 GCA021406645_01393 CDS open 7908-8684 _na     258_aa Helicase domain protein
3163 JAEMBJ010000035.1 GCA021406645_01394 CDS open 8681-12826 _na     1381_aa type ISP restriction/modification enzyme
3164 JAEMBJ010000035.1 GCA021406645_01395 CDS open 12829-13032 _na     67_aa helix-turn-helix transcriptional regulator
3165 JAEMBJ010000035.1 GCA021406645_01396 CDS open 13273-14667 _na     464_aa DUF3945 domain-containing protein
3166 JAEMBJ010000035.1 GCA021406645_01397 CDS open 14990-17065 _na     691_aa DNA topoisomerase
3167 JAEMBJ010000035.1 GCA021406645_01398 CDS open 17149-20124 _na     991_aa site-specific DNA-methyltransferase (adenine-specific)
3168 JAEMBJ010000035.1 GCA021406645_01388 gene open 14-1147
3169 JAEMBJ010000035.1 GCA021406645_01389 gene open 1264-2019
3170 JAEMBJ010000035.1 GCA021406645_01390 gene open 2034-3392 hpt1
3171 JAEMBJ010000035.1 GCA021406645_01391 gene open 3511-5514 virD4
3172 JAEMBJ010000035.1 GCA021406645_01392 gene open 5562-7745
3173 JAEMBJ010000035.1 GCA021406645_01393 gene open 7908-8684
3174 JAEMBJ010000035.1 GCA021406645_01394 gene open 8681-12826
3175 JAEMBJ010000035.1 GCA021406645_01395 gene open 12829-13032
3176 JAEMBJ010000035.1 GCA021406645_01396 gene open 13273-14667
3177 JAEMBJ010000035.1 GCA021406645_01397 gene open 14990-17065
3178 JAEMBJ010000035.1 GCA021406645_01398 gene open 17149-20124
3179 JAEMBJ010000036.1 GCA021406645_00906 CDS open 379-498 _na     39_aa hypothetical protein
3180 JAEMBJ010000036.1 GCA021406645_00907 CDS open 691-2748 _na     685_aa NERD domain-containing protein
3181 JAEMBJ010000036.1 GCA021406645_00908 CDS open 2811-2912 _na     33_aa Transcriptional regulator
3182 JAEMBJ010000036.1 GCA021406645_00909 CDS open 3266-3574 _na     102_aa DUF3853 domain-containing protein
3183 JAEMBJ010000036.1 GCA021406645_00910 CDS open 3571-4620 _na     349_aa Mobilization protein
3184 JAEMBJ010000036.1 GCA021406645_00911 CDS open 4803-5693 _na     296_aa Mobilization protein
3185 JAEMBJ010000036.1 GCA021406645_00912 CDS open 5808-6155 _na     115_aa mobC Plasmid mobilization relaxosome protein MobC
3186 JAEMBJ010000036.1 GCA021406645_00913 CDS open 6152-7078 _na     308_aa MobA/VirD2-like nuclease domain-containing protein
3187 JAEMBJ010000036.1 GCA021406645_00914 CDS open 7100-7759 _na     219_aa Mobilization protein
3188 JAEMBJ010000036.1 GCA021406645_00915 CDS open 7897-9009 _na     370_aa Metallo-beta-lactamase domain-containing protein
3189 JAEMBJ010000036.1 GCA021406645_00916 CDS open 9086-10354 _na     422_aa yhcG YhcG PDDEXK nuclease domain-containing protein
3190 JAEMBJ010000036.1 GCA021406645_00917 CDS open 10367-11725 _na     452_aa Tyr recombinase domain-containing protein
3191 JAEMBJ010000036.1 GCA021406645_00918 CDS open 12139-13416 _na     425_aa Site-specific recombinase%2C phage integrase family
3192 JAEMBJ010000036.1 GCA021406645_00919 CDS open 13457-13915 _na     152_aa DUF1896 domain-containing protein
3193 JAEMBJ010000036.1 GCA021406645_00920 CDS open 14273-14632 _na     119_aa hypothetical protein
3194 JAEMBJ010000036.1 GCA021406645_00921 CDS open 14639-15160 _na     173_aa DUF4375 domain-containing protein
3195 JAEMBJ010000036.1 GCA021406645_00922 CDS open 15188-15400 _na     70_aa Lipoprotein
3196 JAEMBJ010000036.1 GCA021406645_00923 CDS open 15423-15704 _na     93_aa Intein
3197 JAEMBJ010000036.1 GCA021406645_00924 CDS open 15717-15950 _na     77_aa hypothetical protein
3198 JAEMBJ010000036.1 GCA021406645_00925 CDS open 16317-16961 _na     214_aa DUF998 domain-containing protein
3199 JAEMBJ010000036.1 GCA021406645_00926 CDS open 16958-17530 _na     190_aa sTE14 Isoprenylcysteine carboxylmethyltransferase family protein
3200 JAEMBJ010000036.1 GCA021406645_00927 CDS open 17608-18159 _na     183_aa ubiE Methyltransferase domain protein
3201 JAEMBJ010000036.1 GCA021406645_00928 CDS open 18200-18715 _na     171_aa DUF1579 domain-containing protein
3202 JAEMBJ010000036.1 GCA021406645_00929 CDS open 18810-19271 _na     153_aa YdbS-like PH domain-containing protein
3203 JAEMBJ010000036.1 GCA021406645_00930 CDS open 19364-19453 _na     29_aa hypothetical protein
3204 JAEMBJ010000036.1 GCA021406645_00906 gene open 379-498
3205 JAEMBJ010000036.1 GCA021406645_00907 gene open 691-2748
3206 JAEMBJ010000036.1 GCA021406645_00908 gene open 2811-2912
3207 JAEMBJ010000036.1 GCA021406645_00909 gene open 3266-3574
3208 JAEMBJ010000036.1 GCA021406645_00910 gene open 3571-4620
3209 JAEMBJ010000036.1 GCA021406645_00911 gene open 4803-5693
3210 JAEMBJ010000036.1 GCA021406645_00912 gene open 5808-6155 mobC
3211 JAEMBJ010000036.1 GCA021406645_00913 gene open 6152-7078
3212 JAEMBJ010000036.1 GCA021406645_00914 gene open 7100-7759
3213 JAEMBJ010000036.1 GCA021406645_00915 gene open 7897-9009
3214 JAEMBJ010000036.1 GCA021406645_00916 gene open 9086-10354 yhcG
3215 JAEMBJ010000036.1 GCA021406645_00917 gene open 10367-11725
3216 JAEMBJ010000036.1 GCA021406645_00918 gene open 12139-13416
3217 JAEMBJ010000036.1 GCA021406645_00919 gene open 13457-13915
3218 JAEMBJ010000036.1 GCA021406645_00920 gene open 14273-14632
3219 JAEMBJ010000036.1 GCA021406645_00921 gene open 14639-15160
3220 JAEMBJ010000036.1 GCA021406645_00922 gene open 15188-15400
3221 JAEMBJ010000036.1 GCA021406645_00923 gene open 15423-15704
3222 JAEMBJ010000036.1 GCA021406645_00924 gene open 15717-15950
3223 JAEMBJ010000036.1 GCA021406645_00925 gene open 16317-16961
3224 JAEMBJ010000036.1 GCA021406645_00926 gene open 16958-17530 sTE14
3225 JAEMBJ010000036.1 GCA021406645_00927 gene open 17608-18159 ubiE
3226 JAEMBJ010000036.1 GCA021406645_00928 gene open 18200-18715
3227 JAEMBJ010000036.1 GCA021406645_00929 gene open 18810-19271
3228 JAEMBJ010000036.1 GCA021406645_00930 gene open 19364-19453
3229 JAEMBJ010000036.1 GCA021406645_00905 gene open 278-362 trnS
3230 JAEMBJ010000036.1 GCA021406645_00905 tRNA open 278-362 trnS tRNA-Ser(tga)
3231 JAEMBJ010000037.1 GCA021406645_00527 CDS open 179-1900 _na     573_aa cls phospholipase D
3232 JAEMBJ010000037.1 GCA021406645_00528 CDS open 2029-3048 _na     339_aa ilvE branched-chain amino acid aminotransferase
3233 JAEMBJ010000037.1 GCA021406645_00529 CDS open 3187-4260 _na     357_aa wcaG GDP-L-fucose synthase
3234 JAEMBJ010000037.1 GCA021406645_00530 CDS open 4253-5350 _na     365_aa gmd GDP-mannose 4%2C6-dehydratase
3235 JAEMBJ010000037.1 GCA021406645_00531 CDS open 5874-6356 _na     160_aa ftnA Ferritin
3236 JAEMBJ010000037.1 GCA021406645_00532 CDS open 6464-8452 _na     662_aa lmbE Glucosamine-6-phosphate deaminase
3237 JAEMBJ010000037.1 GCA021406645_00533 CDS open 8610-10772 _na     720_aa dpp11 Asp/Glu-specific dipeptidyl-peptidase
3238 JAEMBJ010000037.1 GCA021406645_00534 CDS open 10835-11290 _na     151_aa cYTH CYTH domain-containing protein
3239 JAEMBJ010000037.1 GCA021406645_00535 CDS open 11314-12438 _na     374_aa Smr domain-containing protein
3240 JAEMBJ010000037.1 GCA021406645_00536 CDS open 12604-13851 _na     415_aa DUF1015 domain-containing protein
3241 JAEMBJ010000037.1 GCA021406645_00537 CDS open 13870-14790 _na     306_aa serA D-3-phosphoglycerate dehydrogenase
3242 JAEMBJ010000037.1 GCA021406645_00538 CDS open 14891-15973 _na     360_aa serC phosphoserine transaminase
3243 JAEMBJ010000037.1 GCA021406645_00539 CDS open 16307-17572 _na     421_aa wecC UDP-glucose 6-dehydrogenase
3244 JAEMBJ010000037.1 GCA021406645_00540 CDS open 17875-18381 _na     168_aa Histidinol phosphate aminotransferase
3245 JAEMBJ010000037.1 GCA021406645_00541 CDS open 18917-19354 _na     145_aa efp elongation factor P
3246 JAEMBJ010000037.1 GCA021406645_00527 gene open 179-1900 cls
3247 JAEMBJ010000037.1 GCA021406645_00528 gene open 2029-3048 ilvE
3248 JAEMBJ010000037.1 GCA021406645_00529 gene open 3187-4260 wcaG
3249 JAEMBJ010000037.1 GCA021406645_00530 gene open 4253-5350 gmd
3250 JAEMBJ010000037.1 GCA021406645_00531 gene open 5874-6356 ftnA
3251 JAEMBJ010000037.1 GCA021406645_00532 gene open 6464-8452 lmbE
3252 JAEMBJ010000037.1 GCA021406645_00533 gene open 8610-10772 dpp11
3253 JAEMBJ010000037.1 GCA021406645_00534 gene open 10835-11290 cYTH
3254 JAEMBJ010000037.1 GCA021406645_00535 gene open 11314-12438
3255 JAEMBJ010000037.1 GCA021406645_00536 gene open 12604-13851
3256 JAEMBJ010000037.1 GCA021406645_00537 gene open 13870-14790 serA
3257 JAEMBJ010000037.1 GCA021406645_00538 gene open 14891-15973 serC
3258 JAEMBJ010000037.1 GCA021406645_00539 gene open 16307-17572 wecC
3259 JAEMBJ010000037.1 GCA021406645_00540 gene open 17875-18381
3260 JAEMBJ010000037.1 GCA021406645_00541 gene open 18917-19354 efp
3261 JAEMBJ010000038.1 GCA021406645_01094 CDS open 918-3740 _na     940_aa cTD-A Peptidase S1 domain-containing protein
3262 JAEMBJ010000038.1 GCA021406645_01095 CDS open 4264-4782 _na     172_aa DNA-binding protein%2C histone-like family
3263 JAEMBJ010000038.1 GCA021406645_01096 CDS open 4936-5355 _na     139_aa hypothetical protein
3264 JAEMBJ010000038.1 GCA021406645_01097 CDS open 5515-6243 _na     242_aa GIY-YIG catalytic domain protein
3265 JAEMBJ010000038.1 GCA021406645_01098 CDS open 7357-10584 _na     1075_aa p-loop domain protein%2C KAP family
3266 JAEMBJ010000038.1 GCA021406645_01099 CDS open 10881-11555 _na     224_aa DUF3137 domain-containing protein
3267 JAEMBJ010000038.1 GCA021406645_01100 CDS open 12088-12909 _na     273_aa xapA purine nucleoside phosphorylase I%2C inosine and guanosine-specific
3268 JAEMBJ010000038.1 GCA021406645_01101 CDS open 12929-14203 _na     424_aa ssnA 5-methylthioadenosine/S-adenosylhomocysteine deaminase
3269 JAEMBJ010000038.1 GCA021406645_01102 CDS open 14278-15633 _na     451_aa argE dipeptidase
3270 JAEMBJ010000038.1 GCA021406645_01103 CDS open 15850-17526 _na     558_aa ybjL putative transporter
3271 JAEMBJ010000038.1 GCA021406645_01104 CDS open 17668-18171 _na     167_aa Histidinol phosphate aminotransferase
3272 JAEMBJ010000038.1 GCA021406645_01105 CDS open 18707-19144 _na     145_aa efp elongation factor P
3273 JAEMBJ010000038.1 GCA021406645_01094 gene open 918-3740 cTD-A
3274 JAEMBJ010000038.1 GCA021406645_01095 gene open 4264-4782
3275 JAEMBJ010000038.1 GCA021406645_01096 gene open 4936-5355
3276 JAEMBJ010000038.1 GCA021406645_01097 gene open 5515-6243
3277 JAEMBJ010000038.1 GCA021406645_01098 gene open 7357-10584
3278 JAEMBJ010000038.1 GCA021406645_01099 gene open 10881-11555
3279 JAEMBJ010000038.1 GCA021406645_01100 gene open 12088-12909 xapA
3280 JAEMBJ010000038.1 GCA021406645_01101 gene open 12929-14203 ssnA
3281 JAEMBJ010000038.1 GCA021406645_01102 gene open 14278-15633 argE
3282 JAEMBJ010000038.1 GCA021406645_01103 gene open 15850-17526 ybjL
3283 JAEMBJ010000038.1 GCA021406645_01104 gene open 17668-18171
3284 JAEMBJ010000038.1 GCA021406645_01105 gene open 18707-19144 efp
3285 JAEMBJ010000039.1 GCA021406645_00178 CDS open 287-1279 _na     330_aa phoH PhoH-like protein
3286 JAEMBJ010000039.1 GCA021406645_00179 CDS open 1336-2277 _na     313_aa purC phosphoribosylaminoimidazolesuccinocarboxamide synthase
3287 JAEMBJ010000039.1 GCA021406645_00180 CDS open 2309-3046 _na     245_aa ubiE bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1%2C4-benzoquinol methylase UbiE
3288 JAEMBJ010000039.1 GCA021406645_00181 CDS open 3043-3792 _na     249_aa aroE Shikimate dehydrogenase
3289 JAEMBJ010000039.1 GCA021406645_00182 CDS open 3820-6144 _na     774_aa bamA Bacterial surface antigen (D15) domain-containing protein
3290 JAEMBJ010000039.1 GCA021406645_00184 CDS open 7196-8284 _na     362_aa site-specific integrase
3291 JAEMBJ010000039.1 GCA021406645_00185 CDS open 9042-9470 _na     142_aa DUF3408 domain-containing protein
3292 JAEMBJ010000039.1 GCA021406645_00186 CDS open 10213-10629 _na     138_aa mobA MobA protein
3293 JAEMBJ010000039.1 GCA021406645_00187 CDS open 10718-11044 _na     108_aa rteC RteC protein
3294 JAEMBJ010000039.1 GCA021406645_00188 CDS open 11067-11318 _na     83_aa Ribosome biogenesis protein
3295 JAEMBJ010000039.1 GCA021406645_00189 CDS open 11336-12688 _na     450_aa norM Multidrug export protein MepA
3296 JAEMBJ010000039.1 GCA021406645_00190 CDS open 12785-13633 _na     282_aa araC AraC family transcriptional regulator
3297 JAEMBJ010000039.1 GCA021406645_00191 CDS open 13667-14197 _na     176_aa HXXEE domain-containing protein
3298 JAEMBJ010000039.1 GCA021406645_00192 CDS open 14214-14612 _na     132_aa Polyketide cyclase
3299 JAEMBJ010000039.1 GCA021406645_00193 CDS open 14642-15235 _na     197_aa DJ-1/PfpI family protein
3300 JAEMBJ010000039.1 GCA021406645_00194 CDS open 15249-15863 _na     204_aa DNA alkylation repair enzyme
3301 JAEMBJ010000039.1 GCA021406645_00195 CDS open 15863-16081 _na     72_aa Nucleotidyl transferase AbiEii/AbiGii toxin family protein
3302 JAEMBJ010000039.1 GCA021406645_00196 CDS open 16066-16797 _na     243_aa Transcriptional regulator
3303 JAEMBJ010000039.1 GCA021406645_00197 CDS open 16834-17799 _na     321_aa Fic family protein
3304 JAEMBJ010000039.1 GCA021406645_00178 gene open 287-1279 phoH
3305 JAEMBJ010000039.1 GCA021406645_00179 gene open 1336-2277 purC
3306 JAEMBJ010000039.1 GCA021406645_00180 gene open 2309-3046 ubiE
3307 JAEMBJ010000039.1 GCA021406645_00181 gene open 3043-3792 aroE
3308 JAEMBJ010000039.1 GCA021406645_00182 gene open 3820-6144 bamA
3309 JAEMBJ010000039.1 GCA021406645_00184 gene open 7196-8284
3310 JAEMBJ010000039.1 GCA021406645_00185 gene open 9042-9470
3311 JAEMBJ010000039.1 GCA021406645_00186 gene open 10213-10629 mobA
3312 JAEMBJ010000039.1 GCA021406645_00187 gene open 10718-11044 rteC
3313 JAEMBJ010000039.1 GCA021406645_00188 gene open 11067-11318
3314 JAEMBJ010000039.1 GCA021406645_00189 gene open 11336-12688 norM
3315 JAEMBJ010000039.1 GCA021406645_00190 gene open 12785-13633 araC
3316 JAEMBJ010000039.1 GCA021406645_00191 gene open 13667-14197
3317 JAEMBJ010000039.1 GCA021406645_00192 gene open 14214-14612
3318 JAEMBJ010000039.1 GCA021406645_00193 gene open 14642-15235
3319 JAEMBJ010000039.1 GCA021406645_00194 gene open 15249-15863
3320 JAEMBJ010000039.1 GCA021406645_00195 gene open 15863-16081
3321 JAEMBJ010000039.1 GCA021406645_00196 gene open 16066-16797
3322 JAEMBJ010000039.1 GCA021406645_00197 gene open 16834-17799
3323 JAEMBJ010000039.1 GCA021406645_00183 gene open 6808-6880 trnF
3324 JAEMBJ010000039.1 GCA021406645_00183 tRNA open 6808-6880 trnF tRNA-Phe(gaa)
3325 JAEMBJ010000040.1 regulatory_region open 13688-13900 Cobalamin riboswitch aptamer
3326 JAEMBJ010000040.1 GCA021406645_00780 CDS open 852-1088 _na     78_aa IS5/IS1182 family transposase
3327 JAEMBJ010000040.1 GCA021406645_00781 CDS open 1344-2723 _na     459_aa tnaA Beta-eliminating lyase
3328 JAEMBJ010000040.1 GCA021406645_00782 CDS open 2976-4121 _na     381_aa elsH Endonuclease/exonuclease/phosphatase domain-containing protein
3329 JAEMBJ010000040.1 GCA021406645_00783 CDS open 4118-5032 _na     304_aa glpG Rhomboid family intramembrane serine protease
3330 JAEMBJ010000040.1 GCA021406645_00784 CDS open 5016-5738 _na     240_aa glpG Rhomboid family protein
3331 JAEMBJ010000040.1 GCA021406645_00785 CDS open 5765-8620 _na     951_aa lptD LPS-assembly protein LptD central domain-containing protein
3332 JAEMBJ010000040.1 GCA021406645_00786 CDS open 9115-9858 _na     247_aa hypothetical protein
3333 JAEMBJ010000040.1 GCA021406645_00787 CDS open 9914-10879 _na     321_aa czcD Heavy metal efflux pump%2C CzcD family
3334 JAEMBJ010000040.1 GCA021406645_00788 CDS open 10876-11391 _na     171_aa GyrI-like small molecule binding domain-containing protein
3335 JAEMBJ010000040.1 GCA021406645_00789 CDS open 11484-13163 _na     559_aa ybjL putative transporter
3336 JAEMBJ010000040.1 GCA021406645_00790 CDS open 14022-14324 _na     100_aa hypothetical protein
3337 JAEMBJ010000040.1 GCA021406645_00791 CDS open 15081-17684 _na     867_aa btuB TonB-dependent receptor plug domain-containing protein
3338 JAEMBJ010000040.1 GCA021406645_00780 gene open 852-1088
3339 JAEMBJ010000040.1 GCA021406645_00781 gene open 1344-2723 tnaA
3340 JAEMBJ010000040.1 GCA021406645_00782 gene open 2976-4121 elsH
3341 JAEMBJ010000040.1 GCA021406645_00783 gene open 4118-5032 glpG
3342 JAEMBJ010000040.1 GCA021406645_00784 gene open 5016-5738 glpG
3343 JAEMBJ010000040.1 GCA021406645_00785 gene open 5765-8620 lptD
3344 JAEMBJ010000040.1 GCA021406645_00786 gene open 9115-9858
3345 JAEMBJ010000040.1 GCA021406645_00787 gene open 9914-10879 czcD
3346 JAEMBJ010000040.1 GCA021406645_00788 gene open 10876-11391
3347 JAEMBJ010000040.1 GCA021406645_00789 gene open 11484-13163 ybjL
3348 JAEMBJ010000040.1 GCA021406645_00790 gene open 14022-14324
3349 JAEMBJ010000040.1 GCA021406645_00791 gene open 15081-17684 btuB
3350 JAEMBJ010000041.1 GCA021406645_00021 CDS open 199-579 _na     126_aa ISPg5%2C transposase Orf1
3351 JAEMBJ010000041.1 GCA021406645_00022 CDS open 636-1232 _na     198_aa Lipoprotein
3352 JAEMBJ010000041.1 GCA021406645_00023 CDS open 1354-2376 _na     340_aa pheS phenylalanine--tRNA ligase subunit alpha
3353 JAEMBJ010000041.1 GCA021406645_00024 CDS open 2395-3069 _na     224_aa nth endonuclease III
3354 JAEMBJ010000041.1 GCA021406645_00025 CDS open 3131-4468 _na     445_aa lpxE Lipid A 1-phosphatase
3355 JAEMBJ010000041.1 GCA021406645_00026 CDS open 4445-7813 _na     1122_aa mfd transcription-repair coupling factor
3356 JAEMBJ010000041.1 GCA021406645_00027 CDS open 8160-8744 _na     194_aa grpE Protein GrpE
3357 JAEMBJ010000041.1 GCA021406645_00028 CDS open 8787-9938 _na     383_aa dnaJ molecular chaperone DnaJ
3358 JAEMBJ010000041.1 GCA021406645_00029 CDS open 10024-10341 _na     105_aa paaD Fe-S protein maturation auxiliary factor PG_1777
3359 JAEMBJ010000041.1 GCA021406645_00030 CDS open 10370-11158 _na     262_aa lpxH UDP-2%2C3-diacylglucosamine hydrolase
3360 JAEMBJ010000041.1 GCA021406645_00031 CDS open 11240-11734 _na     164_aa ymdB O-acetyl-ADP-ribose deacetylase
3361 JAEMBJ010000041.1 GCA021406645_00032 CDS open 12103-13290 _na     395_aa spt serine palmitoyltransferase
3362 JAEMBJ010000041.1 GCA021406645_00033 CDS open 13339-13968 _na     209_aa udk uridine kinase
3363 JAEMBJ010000041.1 GCA021406645_00034 CDS open 14010-15197 _na     395_aa DUF2029 domain-containing protein
3364 JAEMBJ010000041.1 GCA021406645_00035 CDS open 15184-15894 _na     236_aa wcaA Glycosyltransferase 2-like domain-containing protein
3365 JAEMBJ010000041.1 GCA021406645_00036 CDS open 15882-16676 _na     264_aa pgaB NodB-like y domain-containing protein
3366 JAEMBJ010000041.1 GCA021406645_00021 gene open 199-579
3367 JAEMBJ010000041.1 GCA021406645_00022 gene open 636-1232
3368 JAEMBJ010000041.1 GCA021406645_00023 gene open 1354-2376 pheS
3369 JAEMBJ010000041.1 GCA021406645_00024 gene open 2395-3069 nth
3370 JAEMBJ010000041.1 GCA021406645_00025 gene open 3131-4468 lpxE
3371 JAEMBJ010000041.1 GCA021406645_00026 gene open 4445-7813 mfd
3372 JAEMBJ010000041.1 GCA021406645_00027 gene open 8160-8744 grpE
3373 JAEMBJ010000041.1 GCA021406645_00028 gene open 8787-9938 dnaJ
3374 JAEMBJ010000041.1 GCA021406645_00029 gene open 10024-10341 paaD
3375 JAEMBJ010000041.1 GCA021406645_00030 gene open 10370-11158 lpxH
3376 JAEMBJ010000041.1 GCA021406645_00031 gene open 11240-11734 ymdB
3377 JAEMBJ010000041.1 GCA021406645_00032 gene open 12103-13290 spt
3378 JAEMBJ010000041.1 GCA021406645_00033 gene open 13339-13968 udk
3379 JAEMBJ010000041.1 GCA021406645_00034 gene open 14010-15197
3380 JAEMBJ010000041.1 GCA021406645_00035 gene open 15184-15894 wcaA
3381 JAEMBJ010000041.1 GCA021406645_00036 gene open 15882-16676 pgaB
3382 JAEMBJ010000042.1 GCA021406645_00797 gene open 10218-10387 Bacteroidales-1
3383 JAEMBJ010000042.1 GCA021406645_00797 ncRNA open 10218-10387 Bacteroidales-1 6S-Bacteroidales RNA suggested
3384 JAEMBJ010000042.1 GCA021406645_00792 CDS open 625-1533 _na     302_aa hypothetical protein
3385 JAEMBJ010000042.1 GCA021406645_00793 CDS open 2144-6664 _na     1506_aa tamB DUF490 domain-containing protein
3386 JAEMBJ010000042.1 GCA021406645_00794 CDS open 7506-8765 _na     419_aa plug Type 9 secretion system plug protein N-terminal domain-containing protein
3387 JAEMBJ010000042.1 GCA021406645_00795 CDS open 8836-9189 _na     117_aa folB dihydroneopterin aldolase
3388 JAEMBJ010000042.1 GCA021406645_00796 CDS open 9232-10140 _na     302_aa fieF Cation efflux family protein
3389 JAEMBJ010000042.1 GCA021406645_00798 CDS open 10546-11730 _na     394_aa Transglutaminase-like domain-containing protein
3390 JAEMBJ010000042.1 GCA021406645_00799 CDS open 11787-12845 _na     352_aa msrB bifunctional methionine sulfoxide reductase B/A protein
3391 JAEMBJ010000042.1 GCA021406645_00800 CDS open 12907-13380 _na     157_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
3392 JAEMBJ010000042.1 GCA021406645_00801 CDS open 13380-13799 _na     139_aa DUF3127 domain-containing protein
3393 JAEMBJ010000042.1 GCA021406645_00802 CDS open 13854-14837 _na     327_aa trpS tryptophan--tRNA ligase
3394 JAEMBJ010000042.1 GCA021406645_00803 CDS open 15616-16749 _na     377_aa ISAs1 family transposase
3395 JAEMBJ010000042.1 GCA021406645_00792 gene open 625-1533
3396 JAEMBJ010000042.1 GCA021406645_00793 gene open 2144-6664 tamB
3397 JAEMBJ010000042.1 GCA021406645_00794 gene open 7506-8765 plug
3398 JAEMBJ010000042.1 GCA021406645_00795 gene open 8836-9189 folB
3399 JAEMBJ010000042.1 GCA021406645_00796 gene open 9232-10140 fieF
3400 JAEMBJ010000042.1 GCA021406645_00798 gene open 10546-11730
3401 JAEMBJ010000042.1 GCA021406645_00799 gene open 11787-12845 msrB
3402 JAEMBJ010000042.1 GCA021406645_00800 gene open 12907-13380 rlmH
3403 JAEMBJ010000042.1 GCA021406645_00801 gene open 13380-13799
3404 JAEMBJ010000042.1 GCA021406645_00802 gene open 13854-14837 trpS
3405 JAEMBJ010000042.1 GCA021406645_00803 gene open 15616-16749
3406 JAEMBJ010000043.1 repeat_region open 15466-16129 CRISPR array with 9 repeats of length 46%2C consensus sequence ACTGGGAATAGCTTTCAGATTTAGTATTTTTGTTGCAACGCACAGC and spacer length 30
3407 JAEMBJ010000043.1 GCA021406645_00397 CDS open 250-1338 _na     362_aa gcvT glycine cleavage system aminomethyltransferase GcvT
3408 JAEMBJ010000043.1 GCA021406645_00398 CDS open 1413-2477 _na     354_aa rfbB dTDP-glucose 4%2C6-dehydratase
3409 JAEMBJ010000043.1 GCA021406645_00399 CDS open 2484-3341 _na     285_aa rfbD dTDP-4-dehydrorhamnose reductase
3410 JAEMBJ010000043.1 GCA021406645_00400 CDS open 3338-3928 _na     196_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
3411 JAEMBJ010000043.1 GCA021406645_00401 CDS open 3943-4812 _na     289_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
3412 JAEMBJ010000043.1 GCA021406645_00402 CDS open 4927-6882 _na     651_aa mdoB Sulfatase-like hydrolase/transferase
3413 JAEMBJ010000043.1 GCA021406645_00403 CDS open 6967-8205 _na     412_aa kdtA 3-deoxy-D-manno-octulosonic acid transferase
3414 JAEMBJ010000043.1 GCA021406645_00404 CDS open 8230-9945 _na     571_aa gltX glutamate--tRNA ligase
3415 JAEMBJ010000043.1 GCA021406645_00405 CDS open 10088-10336 _na     82_aa H repeat-associated protein N-terminal domain-containing protein
3416 JAEMBJ010000043.1 GCA021406645_00406 CDS open 10906-11289 _na     127_aa pspE Rhodanese domain-containing protein
3417 JAEMBJ010000043.1 GCA021406645_00407 CDS open 11262-12677 _na     471_aa pspE Metallo-beta-lactamase superfamily protein
3418 JAEMBJ010000043.1 GCA021406645_00408 CDS open 12770-13576 _na     268_aa tauE putative membrane transporter protein
3419 JAEMBJ010000043.1 GCA021406645_00409 CDS open 13641-14345 _na     234_aa crp Transcriptional regulator%2C Crp family
3420 JAEMBJ010000043.1 GCA021406645_00397 gene open 250-1338 gcvT
3421 JAEMBJ010000043.1 GCA021406645_00398 gene open 1413-2477 rfbB
3422 JAEMBJ010000043.1 GCA021406645_00399 gene open 2484-3341 rfbD
3423 JAEMBJ010000043.1 GCA021406645_00400 gene open 3338-3928 rfbC
3424 JAEMBJ010000043.1 GCA021406645_00401 gene open 3943-4812 rfbA
3425 JAEMBJ010000043.1 GCA021406645_00402 gene open 4927-6882 mdoB
3426 JAEMBJ010000043.1 GCA021406645_00403 gene open 6967-8205 kdtA
3427 JAEMBJ010000043.1 GCA021406645_00404 gene open 8230-9945 gltX
3428 JAEMBJ010000043.1 GCA021406645_00405 gene open 10088-10336
3429 JAEMBJ010000043.1 GCA021406645_00406 gene open 10906-11289 pspE
3430 JAEMBJ010000043.1 GCA021406645_00407 gene open 11262-12677 pspE
3431 JAEMBJ010000043.1 GCA021406645_00408 gene open 12770-13576 tauE
3432 JAEMBJ010000043.1 GCA021406645_00409 gene open 13641-14345 crp
3433 JAEMBJ010000044.1 GCA021406645_01939 CDS open 537-1739 _na     400_aa bepA Tetratricopeptide repeat protein
3434 JAEMBJ010000044.1 GCA021406645_01940 CDS open 1773-4352 _na     859_aa gyrA DNA gyrase subunit A
3435 JAEMBJ010000044.1 GCA021406645_01941 CDS open 4536-5462 _na     308_aa Chromosome segregation protein SMC
3436 JAEMBJ010000044.1 GCA021406645_01942 CDS open 5499-6209 _na     236_aa DUF3256 domain-containing protein
3437 JAEMBJ010000044.1 GCA021406645_01943 CDS open 6274-6732 _na     152_aa hupA Histidinol phosphate aminotransferase
3438 JAEMBJ010000044.1 GCA021406645_01944 CDS open 7216-8427 _na     403_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
3439 JAEMBJ010000044.1 GCA021406645_01945 CDS open 8455-9912 _na     485_aa ftsW Rod shape-determining protein RodA
3440 JAEMBJ010000044.1 GCA021406645_01946 CDS open 9902-11767 _na     621_aa mrdA penicillin-binding protein 2
3441 JAEMBJ010000044.1 GCA021406645_01947 CDS open 11760-12278 _na     172_aa mreD rod shape-determining protein MreD
3442 JAEMBJ010000044.1 GCA021406645_01948 CDS open 12278-13165 _na     295_aa mreC rod shape-determining protein MreC
3443 JAEMBJ010000044.1 GCA021406645_01949 CDS open 13203-14222 _na     339_aa mreB Cell shape-determining protein MreB
3444 JAEMBJ010000044.1 GCA021406645_01950 CDS open 14325-15842 _na     505_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
3445 JAEMBJ010000044.1 GCA021406645_01939 gene open 537-1739 bepA
3446 JAEMBJ010000044.1 GCA021406645_01940 gene open 1773-4352 gyrA
3447 JAEMBJ010000044.1 GCA021406645_01941 gene open 4536-5462
3448 JAEMBJ010000044.1 GCA021406645_01942 gene open 5499-6209
3449 JAEMBJ010000044.1 GCA021406645_01943 gene open 6274-6732 hupA
3450 JAEMBJ010000044.1 GCA021406645_01944 gene open 7216-8427
3451 JAEMBJ010000044.1 GCA021406645_01945 gene open 8455-9912 ftsW
3452 JAEMBJ010000044.1 GCA021406645_01946 gene open 9902-11767 mrdA
3453 JAEMBJ010000044.1 GCA021406645_01947 gene open 11760-12278 mreD
3454 JAEMBJ010000044.1 GCA021406645_01948 gene open 12278-13165 mreC
3455 JAEMBJ010000044.1 GCA021406645_01949 gene open 13203-14222 mreB
3456 JAEMBJ010000044.1 GCA021406645_01950 gene open 14325-15842 purH
3457 JAEMBJ010000045.1 GCA021406645_00418 CDS open 565-2373 _na     602_aa Glutamine amidotransferase%2C class II/dipeptidase
3458 JAEMBJ010000045.1 GCA021406645_00419 CDS open 2366-4330 _na     654_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
3459 JAEMBJ010000045.1 GCA021406645_00420 CDS open 4388-5173 _na     261_aa mazG nucleoside triphosphate pyrophosphohydrolase
3460 JAEMBJ010000045.1 GCA021406645_00421 CDS open 5191-7239 _na     682_aa dsbD Thiol:disulfide interchange protein dsbD%2C putative
3461 JAEMBJ010000045.1 GCA021406645_00422 CDS open 7276-8250 _na     324_aa rluA Pseudouridine synthase
3462 JAEMBJ010000045.1 GCA021406645_00423 CDS open 8270-8632 _na     120_aa Lipoprotein
3463 JAEMBJ010000045.1 GCA021406645_00424 CDS open 8653-9006 _na     117_aa Septum formation initiator
3464 JAEMBJ010000045.1 GCA021406645_00425 CDS open 9558-11858 _na     766_aa Alpha-mannosidase
3465 JAEMBJ010000045.1 GCA021406645_00426 CDS open 11880-14228 _na     782_aa GH92 family glycosyl hydrolase
3466 JAEMBJ010000045.1 GCA021406645_00427 CDS open 14310-14714 _na     134_aa pspE Rhodanese domain-containing protein
3467 JAEMBJ010000045.1 GCA021406645_00428 CDS open 14751-15395 _na     214_aa pdxH pyridoxamine 5'-phosphate oxidase
3468 JAEMBJ010000045.1 GCA021406645_00418 gene open 565-2373
3469 JAEMBJ010000045.1 GCA021406645_00419 gene open 2366-4330 gyrB
3470 JAEMBJ010000045.1 GCA021406645_00420 gene open 4388-5173 mazG
3471 JAEMBJ010000045.1 GCA021406645_00421 gene open 5191-7239 dsbD
3472 JAEMBJ010000045.1 GCA021406645_00422 gene open 7276-8250 rluA
3473 JAEMBJ010000045.1 GCA021406645_00423 gene open 8270-8632
3474 JAEMBJ010000045.1 GCA021406645_00424 gene open 8653-9006
3475 JAEMBJ010000045.1 GCA021406645_00425 gene open 9558-11858
3476 JAEMBJ010000045.1 GCA021406645_00426 gene open 11880-14228
3477 JAEMBJ010000045.1 GCA021406645_00427 gene open 14310-14714 pspE
3478 JAEMBJ010000045.1 GCA021406645_00428 gene open 14751-15395 pdxH
3479 JAEMBJ010000046.1 GCA021406645_01622 CDS open 478-3063 _na     861_aa lacZ beta-mannosidase
3480 JAEMBJ010000046.1 GCA021406645_01623 CDS open 3093-4391 _na     432_aa rmuC DNA recombination protein RmuC
3481 JAEMBJ010000046.1 GCA021406645_01624 CDS open 5111-5425 _na     104_aa trxA thioredoxin
3482 JAEMBJ010000046.1 GCA021406645_01625 CDS open 5474-9160 _na     1228_aa dnaE DNA polymerase III subunit alpha
3483 JAEMBJ010000046.1 GCA021406645_01626 CDS open 9445-9810 _na     121_aa rplS 50S ribosomal protein L19
3484 JAEMBJ010000046.1 GCA021406645_01627 CDS open 11042-12322 _na     426_aa glyA Serine hydroxymethyltransferase
3485 JAEMBJ010000046.1 GCA021406645_01628 CDS open 12479-14812 _na     777_aa nahA Beta-hexosaminidase
3486 JAEMBJ010000046.1 GCA021406645_01622 gene open 478-3063 lacZ
3487 JAEMBJ010000046.1 GCA021406645_01623 gene open 3093-4391 rmuC
3488 JAEMBJ010000046.1 GCA021406645_01624 gene open 5111-5425 trxA
3489 JAEMBJ010000046.1 GCA021406645_01625 gene open 5474-9160 dnaE
3490 JAEMBJ010000046.1 GCA021406645_01626 gene open 9445-9810 rplS
3491 JAEMBJ010000046.1 GCA021406645_01627 gene open 11042-12322 glyA
3492 JAEMBJ010000046.1 GCA021406645_01628 gene open 12479-14812 nahA
3493 JAEMBJ010000047.1 GCA021406645_01084 CDS open 848-1315 _na     155_aa hupA Histidinol phosphate aminotransferase
3494 JAEMBJ010000047.1 GCA021406645_01085 CDS open 1940-2431 _na     163_aa dnaQ Exonuclease
3495 JAEMBJ010000047.1 GCA021406645_01086 CDS open 2435-3073 _na     212_aa marC UPF0056 inner membrane protein
3496 JAEMBJ010000047.1 GCA021406645_01087 CDS open 3255-5948 _na     897_aa yebA Transglutaminase-like domain-containing protein
3497 JAEMBJ010000047.1 GCA021406645_01088 CDS open 6010-7395 _na     461_aa radA DNA repair protein RadA
3498 JAEMBJ010000047.1 GCA021406645_01089 CDS open 7441-8367 _na     308_aa ddaH Amidinotransferase
3499 JAEMBJ010000047.1 GCA021406645_01090 CDS open 8846-9508 _na     220_aa fsa fructose-6-phosphate aldolase
3500 JAEMBJ010000047.1 GCA021406645_01091 CDS open 9505-10803 _na     432_aa ybbC Lipoprotein