HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_021406655.1)

Select a Genome:
BAKTA Annotations for GCA_021406655.1
Genome Selected: Porphyromonas gingivalis
ContigsBases CDSrRNA tmRNAtRNA
97 2382938 2029 9 1 51
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4202 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:9]    |    Number of Records Found: 4202 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer
Range
(bp)
Show Sequences
(length) NA / AA
BAKTA
Gene
BAKTA
GeneProduct
4001 JAEMBH010000073.1 GCA021406655_00996 gene open 3103-3612 ybaK
4002 JAEMBH010000073.1 GCA021406655_00997 gene open 3621-4145
4003 JAEMBH010000073.1 GCA021406655_00998 gene open 4174-4707 phoE
4004 JAEMBH010000073.1 GCA021406655_00999 gene open 5298-5471
4005 JAEMBH010000073.1 GCA021406655_01000 gene open 5807-6481
4006 JAEMBH010000073.1 GCA021406655_01001 gene open 6509-6847
4007 JAEMBH010000074.1 GCA021406655_01963 CDS open 303-629 _na     108_aa hypothetical protein
4008 JAEMBH010000074.1 GCA021406655_01964 CDS open 744-1352 _na     202_aa hypothetical protein
4009 JAEMBH010000074.1 GCA021406655_01965 CDS open 1389-1736 _na     115_aa hypothetical protein
4010 JAEMBH010000074.1 GCA021406655_01966 CDS open 1833-2288 _na     151_aa hypothetical protein
4011 JAEMBH010000074.1 GCA021406655_01967 CDS open 2379-3032 _na     217_aa hypothetical protein
4012 JAEMBH010000074.1 GCA021406655_01968 CDS open 3288-3518 _na     76_aa hypothetical protein
4013 JAEMBH010000074.1 GCA021406655_01969 CDS open 3945-4175 _na     76_aa hypothetical protein
4014 JAEMBH010000074.1 GCA021406655_01970 CDS open 4197-4418 _na     73_aa hypothetical protein
4015 JAEMBH010000074.1 GCA021406655_01971 CDS open 4575-5045 _na     156_aa hypothetical protein
4016 JAEMBH010000074.1 GCA021406655_01972 CDS open 5367-5636 _na     89_aa hypothetical protein
4017 JAEMBH010000074.1 GCA021406655_01973 CDS open 5877-6461 _na     194_aa hypothetical protein
4018 JAEMBH010000074.1 GCA021406655_01963 gene open 303-629
4019 JAEMBH010000074.1 GCA021406655_01964 gene open 744-1352
4020 JAEMBH010000074.1 GCA021406655_01965 gene open 1389-1736
4021 JAEMBH010000074.1 GCA021406655_01966 gene open 1833-2288
4022 JAEMBH010000074.1 GCA021406655_01967 gene open 2379-3032
4023 JAEMBH010000074.1 GCA021406655_01968 gene open 3288-3518
4024 JAEMBH010000074.1 GCA021406655_01969 gene open 3945-4175
4025 JAEMBH010000074.1 GCA021406655_01970 gene open 4197-4418
4026 JAEMBH010000074.1 GCA021406655_01971 gene open 4575-5045
4027 JAEMBH010000074.1 GCA021406655_01972 gene open 5367-5636
4028 JAEMBH010000074.1 GCA021406655_01973 gene open 5877-6461
4029 JAEMBH010000075.1 GCA021406655_01752 CDS open 8-1315 _na     435_aa IS5 family transposase
4030 JAEMBH010000075.1 GCA021406655_01753 CDS open 1653-3827 _na     724_aa Rad50/SbcC-type AAA domain-containing protein
4031 JAEMBH010000075.1 GCA021406655_01754 CDS open 3834-4409 _na     191_aa Glycoside hydrolase family 15
4032 JAEMBH010000075.1 GCA021406655_01755 CDS open 4991-6076 _na     361_aa Site-specific integrase
4033 JAEMBH010000075.1 GCA021406655_01752 gene open 8-1315
4034 JAEMBH010000075.1 GCA021406655_01753 gene open 1653-3827
4035 JAEMBH010000075.1 GCA021406655_01754 gene open 3834-4409
4036 JAEMBH010000075.1 GCA021406655_01755 gene open 4991-6076
4037 JAEMBH010000075.1 GCA021406655_01756 gene open 6387-6471 trnS
4038 JAEMBH010000075.1 GCA021406655_01756 tRNA open 6387-6471 trnS tRNA-Ser(tga)
4039 JAEMBH010000076.1 GCA021406655_01997 CDS open 107-448 _na     113_aa rodZ HTH cro/C1-type domain-containing protein
4040 JAEMBH010000076.1 GCA021406655_01998 CDS open 451-840 _na     129_aa Conserved domain protein
4041 JAEMBH010000076.1 GCA021406655_01999 CDS open 837-2885 _na     682_aa Topoisomerase
4042 JAEMBH010000076.1 GCA021406655_02000 CDS open 2882-3076 _na     64_aa Helix-turn-helix domain-containing protein
4043 JAEMBH010000076.1 GCA021406655_02001 CDS open 3148-3753 _na     201_aa PF13338 domain protein
4044 JAEMBH010000076.1 GCA021406655_02002 CDS open 3750-4760 _na     336_aa Nucleotidyl transferase%2C PF08843 family
4045 JAEMBH010000076.1 GCA021406655_02003 CDS open 4927-6441 _na     504_aa helicase C-terminal domain-containing protein
4046 JAEMBH010000076.1 GCA021406655_01997 gene open 107-448 rodZ
4047 JAEMBH010000076.1 GCA021406655_01998 gene open 451-840
4048 JAEMBH010000076.1 GCA021406655_01999 gene open 837-2885
4049 JAEMBH010000076.1 GCA021406655_02000 gene open 2882-3076
4050 JAEMBH010000076.1 GCA021406655_02001 gene open 3148-3753
4051 JAEMBH010000076.1 GCA021406655_02002 gene open 3750-4760
4052 JAEMBH010000076.1 GCA021406655_02003 gene open 4927-6441
4053 JAEMBH010000077.1 GCA021406655_01002 CDS open 783-1145 _na     120_aa hypothetical protein
4054 JAEMBH010000077.1 GCA021406655_01003 CDS open 1207-1731 _na     174_aa hypothetical protein
4055 JAEMBH010000077.1 GCA021406655_01004 CDS open 1932-3164 _na     410_aa nupG Nucleoside permease NupG
4056 JAEMBH010000077.1 GCA021406655_01005 CDS open 3516-4850 _na     444_aa DUF4270 domain-containing protein
4057 JAEMBH010000077.1 GCA021406655_01006 CDS open 4986-5849 _na     287_aa glgA starch synthase
4058 JAEMBH010000077.1 GCA021406655_01002 gene open 783-1145
4059 JAEMBH010000077.1 GCA021406655_01003 gene open 1207-1731
4060 JAEMBH010000077.1 GCA021406655_01004 gene open 1932-3164 nupG
4061 JAEMBH010000077.1 GCA021406655_01005 gene open 3516-4850
4062 JAEMBH010000077.1 GCA021406655_01006 gene open 4986-5849 glgA
4063 JAEMBH010000078.1 GCA021406655_01047 CDS open 372-1148 _na     258_aa hypothetical protein
4064 JAEMBH010000078.1 GCA021406655_01048 CDS open 1335-2465 _na     376_aa hypothetical protein
4065 JAEMBH010000078.1 GCA021406655_01049 CDS open 2682-2849 _na     55_aa hypothetical protein
4066 JAEMBH010000078.1 GCA021406655_01050 CDS open 3114-4133 _na     339_aa eis GNAT family N-acetyltransferase
4067 JAEMBH010000078.1 GCA021406655_01051 CDS open 4114-5043 _na     309_aa Phosphatidylglycerol lysyltransferase C-terminal domain-containing protein
4068 JAEMBH010000078.1 GCA021406655_01052 CDS open 5693-6325 _na     210_aa Cleaved adhesin domain-containing protein
4069 JAEMBH010000078.1 GCA021406655_01047 gene open 372-1148
4070 JAEMBH010000078.1 GCA021406655_01048 gene open 1335-2465
4071 JAEMBH010000078.1 GCA021406655_01049 gene open 2682-2849
4072 JAEMBH010000078.1 GCA021406655_01050 gene open 3114-4133 eis
4073 JAEMBH010000078.1 GCA021406655_01051 gene open 4114-5043
4074 JAEMBH010000078.1 GCA021406655_01052 gene open 5693-6325
4075 JAEMBH010000079.1 GCA021406655_01010 CDS open 83-589 _na     168_aa Histidinol phosphate aminotransferase
4076 JAEMBH010000079.1 GCA021406655_01011 CDS open 1125-1691 _na     188_aa efp elongation factor P
4077 JAEMBH010000079.1 GCA021406655_01012 CDS open 2099-3370 _na     423_aa rocD ornithine--oxo-acid transaminase
4078 JAEMBH010000079.1 GCA021406655_01013 CDS open 3377-4306 _na     309_aa ctlX citrulline utilization hydrolase CtlX
4079 JAEMBH010000079.1 GCA021406655_01014 CDS open 4383-6014 _na     543_aa pruA L-glutamate gamma-semialdehyde dehydrogenase
4080 JAEMBH010000079.1 GCA021406655_01010 gene open 83-589
4081 JAEMBH010000079.1 GCA021406655_01011 gene open 1125-1691 efp
4082 JAEMBH010000079.1 GCA021406655_01012 gene open 2099-3370 rocD
4083 JAEMBH010000079.1 GCA021406655_01013 gene open 3377-4306 ctlX
4084 JAEMBH010000079.1 GCA021406655_01014 gene open 4383-6014 pruA
4085 JAEMBH010000080.1 GCA021406655_00211 CDS open 144-1442 _na     432_aa dinP UmuC protein
4086 JAEMBH010000080.1 GCA021406655_00212 CDS open 1450-1875 _na     141_aa lexA Translesion error-prone DNA polymerase V autoproteolytic subunit
4087 JAEMBH010000080.1 GCA021406655_00213 CDS open 1939-2124 _na     61_aa hypothetical protein
4088 JAEMBH010000080.1 GCA021406655_00214 CDS open 2188-2361 _na     57_aa hypothetical protein
4089 JAEMBH010000080.1 GCA021406655_00215 CDS open 2843-3307 _na     154_aa ybbJ Membrane protein%2C putative
4090 JAEMBH010000080.1 GCA021406655_00216 CDS open 3335-4315 _na     326_aa hflC Band 7/Mec-2 family protein
4091 JAEMBH010000080.1 GCA021406655_00217 CDS open 4312-5511 _na     399_aa lipid A deacylase
4092 JAEMBH010000080.1 GCA021406655_00218 CDS open 5657-5944 _na     95_aa NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta
4093 JAEMBH010000080.1 GCA021406655_00211 gene open 144-1442 dinP
4094 JAEMBH010000080.1 GCA021406655_00212 gene open 1450-1875 lexA
4095 JAEMBH010000080.1 GCA021406655_00213 gene open 1939-2124
4096 JAEMBH010000080.1 GCA021406655_00214 gene open 2188-2361
4097 JAEMBH010000080.1 GCA021406655_00215 gene open 2843-3307 ybbJ
4098 JAEMBH010000080.1 GCA021406655_00216 gene open 3335-4315 hflC
4099 JAEMBH010000080.1 GCA021406655_00217 gene open 4312-5511
4100 JAEMBH010000080.1 GCA021406655_00218 gene open 5657-5944
4101 JAEMBH010000081.1 GCA021406655_01032 CDS open 198-719 _na     173_aa DUF4375 domain-containing protein
4102 JAEMBH010000081.1 GCA021406655_01033 CDS open 732-959 _na     75_aa Lipoprotein
4103 JAEMBH010000081.1 GCA021406655_01034 CDS open 982-1263 _na     93_aa Intein
4104 JAEMBH010000081.1 GCA021406655_01035 CDS open 1276-1578 _na     100_aa hypothetical protein
4105 JAEMBH010000081.1 GCA021406655_01036 CDS open 1585-2013 _na     142_aa PcfK-like protein
4106 JAEMBH010000081.1 GCA021406655_01037 CDS open 2025-3296 _na     423_aa PcfJ-like protein
4107 JAEMBH010000081.1 GCA021406655_01038 CDS open 3321-3575 _na     84_aa hypothetical protein
4108 JAEMBH010000081.1 GCA021406655_01039 CDS open 3580-3798 _na     72_aa Phage protein
4109 JAEMBH010000081.1 GCA021406655_01040 CDS open 4037-4681 _na     214_aa DUF998 domain-containing protein
4110 JAEMBH010000081.1 GCA021406655_01041 CDS open 4678-5250 _na     190_aa sTE14 Isoprenylcysteine carboxylmethyltransferase family protein
4111 JAEMBH010000081.1 GCA021406655_01032 gene open 198-719
4112 JAEMBH010000081.1 GCA021406655_01033 gene open 732-959
4113 JAEMBH010000081.1 GCA021406655_01034 gene open 982-1263
4114 JAEMBH010000081.1 GCA021406655_01035 gene open 1276-1578
4115 JAEMBH010000081.1 GCA021406655_01036 gene open 1585-2013
4116 JAEMBH010000081.1 GCA021406655_01037 gene open 2025-3296
4117 JAEMBH010000081.1 GCA021406655_01038 gene open 3321-3575
4118 JAEMBH010000081.1 GCA021406655_01039 gene open 3580-3798
4119 JAEMBH010000081.1 GCA021406655_01040 gene open 4037-4681
4120 JAEMBH010000081.1 GCA021406655_01041 gene open 4678-5250 sTE14
4121 JAEMBH010000082.1 repeat_region open 1-2548 CRISPR array with 39 repeats of length 30%2C consensus sequence ATTTCAATTGCACCATACAGGAATTAAAAC and spacer length 36
4122 JAEMBH010000082.1 repeat_region open 2707-5441 CRISPR array with 42 repeats of length 30%2C consensus sequence ATTTCAATTGCACCATACAGGAATTAAAAC and spacer length 35
4123 JAEMBH010000083.1 GCA021406655_01042 CDS open 192-740 _na     182_aa hypothetical protein
4124 JAEMBH010000083.1 GCA021406655_01043 CDS open 728-2212 _na     494_aa Peptidase%2C M23 family
4125 JAEMBH010000083.1 GCA021406655_01044 CDS open 2370-4376 _na     668_aa DNA-binding protein
4126 JAEMBH010000083.1 GCA021406655_01045 CDS open 4406-4996 _na     196_aa Outer membrane protein beta-barrel domain-containing protein
4127 JAEMBH010000083.1 GCA021406655_01046 CDS open 5017-5265 _na     82_aa hypothetical protein
4128 JAEMBH010000083.1 GCA021406655_01042 gene open 192-740
4129 JAEMBH010000083.1 GCA021406655_01043 gene open 728-2212
4130 JAEMBH010000083.1 GCA021406655_01044 gene open 2370-4376
4131 JAEMBH010000083.1 GCA021406655_01045 gene open 4406-4996
4132 JAEMBH010000083.1 GCA021406655_01046 gene open 5017-5265
4133 JAEMBH010000084.1 GCA021406655_02022 CDS open 374-946 _na     190_aa sTE14 Isoprenylcysteine carboxylmethyltransferase family protein
4134 JAEMBH010000084.1 GCA021406655_02023 CDS open 943-1587 _na     214_aa DUF998 domain-containing protein
4135 JAEMBH010000084.1 GCA021406655_02024 CDS open 2144-2479 _na     111_aa DUF1896 domain-containing protein
4136 JAEMBH010000084.1 GCA021406655_02025 CDS open 2506-3039 _na     177_aa KilA-N DNA-binding domain-containing protein
4137 JAEMBH010000084.1 GCA021406655_02026 CDS open 3098-4330 _na     410_aa Tyr recombinase domain-containing protein
4138 JAEMBH010000084.1 GCA021406655_02028 CDS open 4959-5195 _na     78_aa hypothetical protein
4139 JAEMBH010000084.1 GCA021406655_02022 gene open 374-946 sTE14
4140 JAEMBH010000084.1 GCA021406655_02023 gene open 943-1587
4141 JAEMBH010000084.1 GCA021406655_02024 gene open 2144-2479
4142 JAEMBH010000084.1 GCA021406655_02025 gene open 2506-3039
4143 JAEMBH010000084.1 GCA021406655_02026 gene open 3098-4330
4144 JAEMBH010000084.1 GCA021406655_02028 gene open 4959-5195
4145 JAEMBH010000084.1 GCA021406655_02027 gene open 4641-4714 trnD
4146 JAEMBH010000084.1 GCA021406655_02027 tRNA open 4641-4714 trnD tRNA-Asp(gtc)
4147 JAEMBH010000085.1 GCA021406655_02018 CDS open 185-2233 _na     682_aa Topoisomerase
4148 JAEMBH010000085.1 GCA021406655_02019 CDS open 2230-2619 _na     129_aa Conserved domain protein
4149 JAEMBH010000085.1 GCA021406655_02020 CDS open 2622-2963 _na     113_aa rodZ HTH cro/C1-type domain-containing protein
4150 JAEMBH010000085.1 GCA021406655_02021 CDS open 3997-4527 _na     176_aa phage integrase SAM-like domain-containing protein
4151 JAEMBH010000085.1 GCA021406655_02018 gene open 185-2233
4152 JAEMBH010000085.1 GCA021406655_02019 gene open 2230-2619
4153 JAEMBH010000085.1 GCA021406655_02020 gene open 2622-2963 rodZ
4154 JAEMBH010000085.1 GCA021406655_02021 gene open 3997-4527
4155 JAEMBH010000086.1 GCA021406655_00052 CDS open 62-355 _na     97_aa hypothetical protein
4156 JAEMBH010000086.1 GCA021406655_00053 CDS open 238-693 _na     151_aa Bacterial Pleckstrin-like y domain-containing protein
4157 JAEMBH010000086.1 GCA021406655_00054 CDS open 701-886 _na     61_aa FeoB-associated Cys-rich membrane protein
4158 JAEMBH010000086.1 GCA021406655_00055 CDS open 906-3440 _na     844_aa feoB ferrous iron transport protein B
4159 JAEMBH010000086.1 GCA021406655_00056 CDS open 3468-3626 _na     52_aa hypothetical protein
4160 JAEMBH010000086.1 GCA021406655_00052 gene open 62-355
4161 JAEMBH010000086.1 GCA021406655_00053 gene open 238-693
4162 JAEMBH010000086.1 GCA021406655_00054 gene open 701-886
4163 JAEMBH010000086.1 GCA021406655_00055 gene open 906-3440 feoB
4164 JAEMBH010000086.1 GCA021406655_00056 gene open 3468-3626
4165 JAEMBH010000087.1 GCA021406655_00057 CDS open 632-2272 _na     546_aa hcp hydroxylamine reductase
4166 JAEMBH010000087.1 GCA021406655_00058 CDS open 2508-3200 _na     230_aa radC DNA repair protein RadC
4167 JAEMBH010000087.1 GCA021406655_00057 gene open 632-2272 hcp
4168 JAEMBH010000087.1 GCA021406655_00058 gene open 2508-3200 radC
4169 JAEMBH010000087.1 GCA021406655_00059 gene open 3376-3449 trnI
4170 JAEMBH010000087.1 GCA021406655_00059 tRNA open 3376-3449 trnI tRNA-Ile2(cat)
4171 JAEMBH010000088.1 GCA021406655_00569 CDS open 696-2072 _na     458_aa tig trigger factor
4172 JAEMBH010000088.1 GCA021406655_00570 CDS open 2407-2691 _na     94_aa hypothetical protein
4173 JAEMBH010000088.1 GCA021406655_00569 gene open 696-2072 tig
4174 JAEMBH010000088.1 GCA021406655_00570 gene open 2407-2691
4175 JAEMBH010000089.1 GCA021406655_01007 CDS open 82-498 _na     138_aa hypothetical protein
4176 JAEMBH010000089.1 GCA021406655_01008 CDS open 838-1398 _na     186_aa hypothetical protein
4177 JAEMBH010000089.1 GCA021406655_01009 CDS open 2167-2505 _na     112_aa hypothetical protein
4178 JAEMBH010000089.1 GCA021406655_01007 gene open 82-498
4179 JAEMBH010000089.1 GCA021406655_01008 gene open 838-1398
4180 JAEMBH010000089.1 GCA021406655_01009 gene open 2167-2505
4181 JAEMBH010000090.1 GCA021406655_00208 CDS open 310-645 _na     111_aa hypothetical protein
4182 JAEMBH010000090.1 GCA021406655_00209 CDS open 712-1557 _na     281_aa GLPGLI family protein
4183 JAEMBH010000090.1 GCA021406655_00208 gene open 310-645
4184 JAEMBH010000090.1 GCA021406655_00209 gene open 712-1557
4185 JAEMBH010000091.1 GCA021406655_00252 CDS open 118-450 _na     110_aa transposase
4186 JAEMBH010000091.1 GCA021406655_00253 CDS open 1208-1318 _na     36_aa hypothetical protein
4187 JAEMBH010000091.1 GCA021406655_00254 CDS open 1331-1666 _na     111_aa DUF4143 domain-containing protein
4188 JAEMBH010000091.1 GCA021406655_00252 gene open 118-450
4189 JAEMBH010000091.1 GCA021406655_00253 gene open 1208-1318
4190 JAEMBH010000091.1 GCA021406655_00254 gene open 1331-1666
4191 JAEMBH010000092.1 GCA021406655_00210 CDS open 466-810 _na     114_aa hypothetical protein
4192 JAEMBH010000092.1 GCA021406655_00210 gene open 466-810
4193 JAEMBH010000093.1 GCA021406655_00250 CDS open 64-429 _na     121_aa Lipoprotein
4194 JAEMBH010000093.1 GCA021406655_00250 gene open 64-429
4195 JAEMBH010000094.1 GCA021406655_00251 CDS open 535-672 _na     45_aa hypothetical protein
4196 JAEMBH010000094.1 GCA021406655_00251 gene open 535-672
4197 JAEMBH010000095.1 GCA021406655_00219 CDS open 220-621 _na     133_aa hypothetical protein
4198 JAEMBH010000095.1 GCA021406655_00219 gene open 220-621
4199 JAEMBH010000096.1 GCA021406655_00060 CDS open 211-426 _na     71_aa hypothetical protein
4200 JAEMBH010000096.1 GCA021406655_00060 gene open 211-426
4201 JAEMBH010000097.1 GCA021406655_00121 CDS open 340-576 _na     78_aa hypothetical protein
4202 JAEMBH010000097.1 GCA021406655_00121 gene open 340-576