HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_021406655.1)

Select a Genome:
BAKTA Annotations for GCA_021406655.1
Genome Selected: Porphyromonas gingivalis
ContigsBases CDSrRNA tmRNAtRNA
97 2382938 2029 9 1 51
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4202 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 4202 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 JAEMBH010000006.1 GCA021406655_01326 gene open 25157-25705
1002 JAEMBH010000006.1 GCA021406655_01327 gene open 25702-27120
1003 JAEMBH010000006.1 GCA021406655_01328 gene open 27238-28470 hemH
1004 JAEMBH010000006.1 GCA021406655_01329 gene open 28477-29451 bud32
1005 JAEMBH010000006.1 GCA021406655_01330 gene open 29468-30613 rfaB
1006 JAEMBH010000006.1 GCA021406655_01331 gene open 30752-31498 gpmA
1007 JAEMBH010000006.1 GCA021406655_01332 gene open 31782-33092
1008 JAEMBH010000006.1 GCA021406655_01333 gene open 33089-34594 rfbX
1009 JAEMBH010000006.1 GCA021406655_01334 gene open 34613-35965 mgtE
1010 JAEMBH010000006.1 GCA021406655_01335 gene open 35997-36770 rsmA
1011 JAEMBH010000006.1 GCA021406655_01336 gene open 36931-37953
1012 JAEMBH010000006.1 GCA021406655_01337 gene open 37984-39438 pepD2
1013 JAEMBH010000006.1 GCA021406655_01338 gene open 39553-40434 fabD
1014 JAEMBH010000006.1 GCA021406655_01339 gene open 40616-41971 mltF
1015 JAEMBH010000006.1 GCA021406655_01340 gene open 41981-42688
1016 JAEMBH010000006.1 GCA021406655_01341 gene open 42708-43577 spo0J
1017 JAEMBH010000006.1 GCA021406655_01342 gene open 43585-44361 parA
1018 JAEMBH010000006.1 GCA021406655_01343 gene open 44577-45455 nit1
1019 JAEMBH010000006.1 GCA021406655_01344 gene open 45473-46534 aguA
1020 JAEMBH010000006.1 GCA021406655_01345 gene open 46848-47234 secG
1021 JAEMBH010000006.1 GCA021406655_01346 gene open 47237-47944
1022 JAEMBH010000006.1 GCA021406655_01347 gene open 47957-48496
1023 JAEMBH010000006.1 GCA021406655_01348 gene open 48483-49736 atoC
1024 JAEMBH010000006.1 GCA021406655_01349 gene open 49764-51032 lysM
1025 JAEMBH010000006.1 GCA021406655_01350 gene open 51069-52373 rimO
1026 JAEMBH010000006.1 GCA021406655_01351 gene open 52370-53323 ftsY
1027 JAEMBH010000006.1 GCA021406655_01352 gene open 53350-54486 nspC
1028 JAEMBH010000006.1 GCA021406655_01353 gene open 54496-56259 aspS
1029 JAEMBH010000006.1 GCA021406655_01354 gene open 56690-57682 ribD
1030 JAEMBH010000006.1 GCA021406655_01355 gene open 57707-58588 prmC
1031 JAEMBH010000006.1 GCA021406655_01356 gene open 58585-59070 recX
1032 JAEMBH010000006.1 GCA021406655_01357 gene open 59054-59794 comFC
1033 JAEMBH010000006.1 GCA021406655_01358 gene open 59924-61993 pepO
1034 JAEMBH010000006.1 GCA021406655_01359 gene open 62012-62914 rmlA1
1035 JAEMBH010000006.1 GCA021406655_01360 gene open 63334-63915 rpoE
1036 JAEMBH010000006.1 GCA021406655_01361 gene open 64064-65713 pfp
1037 JAEMBH010000006.1 GCA021406655_01362 gene open 65908-66222
1038 JAEMBH010000006.1 GCA021406655_01363 gene open 66197-66634 hslR
1039 JAEMBH010000006.1 GCA021406655_01364 gene open 66640-67197 pth
1040 JAEMBH010000006.1 GCA021406655_01365 gene open 67339-67917 rplY
1041 JAEMBH010000006.1 GCA021406655_01366 gene open 68528-70570 metG
1042 JAEMBH010000006.1 GCA021406655_01367 gene open 70600-72372 ushA
1043 JAEMBH010000006.1 GCA021406655_01368 gene open 72369-73151 dnaQ
1044 JAEMBH010000006.1 GCA021406655_01369 gene open 73214-73594 marR
1045 JAEMBH010000006.1 GCA021406655_01370 gene open 73638-76316 yrkE
1046 JAEMBH010000006.1 GCA021406655_01371 gene open 77443-79146 mfa1
1047 JAEMBH010000006.1 GCA021406655_01372 gene open 79243-80199 mfa2
1048 JAEMBH010000006.1 GCA021406655_01373 gene open 80500-81840 mfa3
1049 JAEMBH010000006.1 GCA021406655_01374 gene open 81849-82850 mfa4
1050 JAEMBH010000006.1 GCA021406655_01375 gene open 83170-83499
1051 JAEMBH010000006.1 GCA021406655_01376 gene open 83759-84049
1052 JAEMBH010000006.1 GCA021406655_01377 gene open 84227-84352
1053 JAEMBH010000006.1 GCA021406655_01304 gene open 2631-2704 trnI
1054 JAEMBH010000006.1 GCA021406655_01305 gene open 2706-2779 trnA
1055 JAEMBH010000006.1 GCA021406655_01304 tRNA open 2631-2704 trnI tRNA-Ile(gat)
1056 JAEMBH010000006.1 GCA021406655_01305 tRNA open 2706-2779 trnA tRNA-Ala(tgc)
1057 JAEMBH010000007.1 repeat_region open 67293-67602 CRISPR array with 5 repeats of length 36%2C consensus sequence GTTGTCTCCACCCTTCTAACTAAGGGTATTCCCAAC and spacer length 30
1058 JAEMBH010000007.1 GCA021406655_00369 CDS open 296-1519 _na     407_aa rsmD THUMP-like domain-containing protein
1059 JAEMBH010000007.1 GCA021406655_00372 CDS open 1856-2680 _na     274_aa murQ N-acetylmuramic acid 6-phosphate etherase
1060 JAEMBH010000007.1 GCA021406655_00373 CDS open 2673-3524 _na     283_aa badF BadF/BadG/BcrA/BcrD ATPase family protein
1061 JAEMBH010000007.1 GCA021406655_00374 CDS open 3521-4981 _na     486_aa putP Sodium:solute symporter family protein
1062 JAEMBH010000007.1 GCA021406655_00375 CDS open 5308-5766 _na     152_aa DNA-binding protein histone-like family
1063 JAEMBH010000007.1 GCA021406655_00376 CDS open 5835-7154 _na     439_aa rarA ATPase%2C AAA family
1064 JAEMBH010000007.1 GCA021406655_00377 CDS open 7180-7947 _na     255_aa trmN6 tRNA1(Val) (adenine(37)-N6)-methyltransferase
1065 JAEMBH010000007.1 GCA021406655_00378 CDS open 7911-9368 _na     485_aa rpoN RNA polymerase factor sigma-54
1066 JAEMBH010000007.1 GCA021406655_00379 CDS open 9362-10666 _na     434_aa murF UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
1067 JAEMBH010000007.1 GCA021406655_00380 CDS open 10876-11232 _na     118_aa panD aspartate 1-decarboxylase
1068 JAEMBH010000007.1 GCA021406655_00381 CDS open 11309-12646 _na     445_aa ffh signal recognition particle protein
1069 JAEMBH010000007.1 GCA021406655_00382 CDS open 12767-13657 _na     296_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD
1070 JAEMBH010000007.1 GCA021406655_00383 CDS open 13846-15297 _na     483_aa norM Multidrug-efflux transporter
1071 JAEMBH010000007.1 GCA021406655_00384 CDS open 16028-18619 _na     863_aa clpB ATP-dependent chaperone ClpB
1072 JAEMBH010000007.1 GCA021406655_00385 CDS open 18838-19398 _na     186_aa fldA Flavodoxin-like domain-containing protein
1073 JAEMBH010000007.1 GCA021406655_00386 CDS open 20089-21498 _na     469_aa asnS asparagine--tRNA ligase
1074 JAEMBH010000007.1 GCA021406655_00387 CDS open 21530-22849 _na     439_aa rsuA Pseudouridine synthase
1075 JAEMBH010000007.1 GCA021406655_00388 CDS open 22950-24293 _na     447_aa purB adenylosuccinate lyase
1076 JAEMBH010000007.1 GCA021406655_00389 CDS open 24428-24991 _na     187_aa pduO Corrinoid adenosyltransferase
1077 JAEMBH010000007.1 GCA021406655_00390 CDS open 25014-25664 _na     216_aa SAM-dependent methyltransferase
1078 JAEMBH010000007.1 GCA021406655_00391 CDS open 25689-26876 _na     395_aa uraA Uracil permease
1079 JAEMBH010000007.1 GCA021406655_00392 CDS open 27221-27688 _na     155_aa lrp Transcriptional regulator%2C AsnC Family
1080 JAEMBH010000007.1 GCA021406655_00393 CDS open 27735-29117 _na     460_aa xseA exodeoxyribonuclease VII large subunit
1081 JAEMBH010000007.1 GCA021406655_00394 CDS open 29390-31942 _na     850_aa nrdA adenosylcobalamin-dependent ribonucleoside-diphosphate reductase
1082 JAEMBH010000007.1 GCA021406655_00395 CDS open 32133-34313 _na     726_aa hypothetical protein
1083 JAEMBH010000007.1 GCA021406655_00396 CDS open 34930-37779 _na     949_aa valS valine--tRNA ligase
1084 JAEMBH010000007.1 GCA021406655_00397 CDS open 37808-38260 _na     150_aa hypothetical protein
1085 JAEMBH010000007.1 GCA021406655_00399 CDS open 38583-39524 _na     313_aa trxB thioredoxin-disulfide reductase
1086 JAEMBH010000007.1 GCA021406655_00400 CDS open 40088-40702 _na     204_aa wcaJ Bacterial sugar transferase domain-containing protein
1087 JAEMBH010000007.1 GCA021406655_00401 CDS open 40877-42505 _na     542_aa asnB asparagine synthase (glutamine-hydrolyzing)
1088 JAEMBH010000007.1 GCA021406655_00402 CDS open 42468-43775 _na     435_aa rfbX PorS protein
1089 JAEMBH010000007.1 GCA021406655_00403 CDS open 43772-44926 _na     384_aa wecE Pigmentation and extracellular proteinase regulator
1090 JAEMBH010000007.1 GCA021406655_00404 CDS open 45107-46234 _na     375_aa DUF4369 domain-containing protein
1091 JAEMBH010000007.1 GCA021406655_00405 CDS open 46364-47224 _na     286_aa wcaE Glycosyl transferase%2C group 2 family protein
1092 JAEMBH010000007.1 GCA021406655_00406 CDS open 47230-48381 _na     383_aa Glycosyltransferase%2C group 1 family protein
1093 JAEMBH010000007.1 GCA021406655_00407 CDS open 48573-49616 _na     347_aa epsG EpsG family protein
1094 JAEMBH010000007.1 GCA021406655_00408 CDS open 49623-51074 _na     483_aa ugd UDP-glucose 6-dehydrogenase
1095 JAEMBH010000007.1 GCA021406655_00409 CDS open 51230-52189 _na     319_aa prfB peptide chain release factor 2
1096 JAEMBH010000007.1 GCA021406655_00410 CDS open 52470-54293 _na     607_aa fAA1 Long-chain-fatty-acid-CoA ligase
1097 JAEMBH010000007.1 GCA021406655_00411 CDS open 55670-56827 _na     385_aa rfaB Glycosyl transferase%2C group 1 family protein
1098 JAEMBH010000007.1 GCA021406655_00412 CDS open 57003-58199 _na     398_aa yqdH Iron-containing alcohol dehydrogenase
1099 JAEMBH010000007.1 GCA021406655_00413 CDS open 58338-58754 _na     138_aa hypothetical protein
1100 JAEMBH010000007.1 GCA021406655_00414 CDS open 58915-59520 _na     201_aa DUF4254 domain-containing protein
1101 JAEMBH010000007.1 GCA021406655_00415 CDS open 59604-60659 _na     351_aa rfaF ADP-heptose--LPS heptosyltransferase%2C putative
1102 JAEMBH010000007.1 GCA021406655_00416 CDS open 60643-61095 _na     150_aa rsuA RNA-binding S4 domain-containing protein
1103 JAEMBH010000007.1 GCA021406655_00417 CDS open 61531-62580 _na     349_aa cbiB adenosylcobinamide-phosphate synthase CbiB
1104 JAEMBH010000007.1 GCA021406655_00418 CDS open 62555-63562 _na     335_aa cobD threonine-phosphate decarboxylase CobD
1105 JAEMBH010000007.1 GCA021406655_00419 CDS open 63555-65051 _na     498_aa cobyric acid synthase
1106 JAEMBH010000007.1 GCA021406655_00420 CDS open 65048-65614 _na     188_aa pduO Corrinoid adenosyltransferase
1107 JAEMBH010000007.1 GCA021406655_00421 CDS open 65637-66956 _na     439_aa cobB cobyrinate a%2Cc-diamide synthase
1108 JAEMBH010000007.1 GCA021406655_00422 CDS open 71004-71720 _na     238_aa csx27 CRISPR-associated protein Csx27
1109 JAEMBH010000007.1 GCA021406655_00423 CDS open 71793-72014 _na     73_aa 30S ribosomal protein S21 domain protein
1110 JAEMBH010000007.1 GCA021406655_00424 CDS open 72710-73582 _na     290_aa serB phosphoserine phosphatase SerB
1111 JAEMBH010000007.1 GCA021406655_00425 CDS open 73822-74643 _na     273_aa glpC Oxidoreductase%2C putative
1112 JAEMBH010000007.1 GCA021406655_00426 CDS open 74640-76007 _na     455_aa lutB Putative electron transport protein
1113 JAEMBH010000007.1 GCA021406655_00427 CDS open 76013-76597 _na     194_aa lutC LUD domain-containing protein
1114 JAEMBH010000007.1 GCA021406655_00428 CDS open 76708-77181 _na     157_aa paaI Thioesterase family protein
1115 JAEMBH010000007.1 GCA021406655_00369 gene open 296-1519 rsmD
1116 JAEMBH010000007.1 GCA021406655_00372 gene open 1856-2680 murQ
1117 JAEMBH010000007.1 GCA021406655_00373 gene open 2673-3524 badF
1118 JAEMBH010000007.1 GCA021406655_00374 gene open 3521-4981 putP
1119 JAEMBH010000007.1 GCA021406655_00375 gene open 5308-5766
1120 JAEMBH010000007.1 GCA021406655_00376 gene open 5835-7154 rarA
1121 JAEMBH010000007.1 GCA021406655_00377 gene open 7180-7947 trmN6
1122 JAEMBH010000007.1 GCA021406655_00378 gene open 7911-9368 rpoN
1123 JAEMBH010000007.1 GCA021406655_00379 gene open 9362-10666 murF
1124 JAEMBH010000007.1 GCA021406655_00380 gene open 10876-11232 panD
1125 JAEMBH010000007.1 GCA021406655_00381 gene open 11309-12646 ffh
1126 JAEMBH010000007.1 GCA021406655_00382 gene open 12767-13657 folD
1127 JAEMBH010000007.1 GCA021406655_00383 gene open 13846-15297 norM
1128 JAEMBH010000007.1 GCA021406655_00384 gene open 16028-18619 clpB
1129 JAEMBH010000007.1 GCA021406655_00385 gene open 18838-19398 fldA
1130 JAEMBH010000007.1 GCA021406655_00386 gene open 20089-21498 asnS
1131 JAEMBH010000007.1 GCA021406655_00387 gene open 21530-22849 rsuA
1132 JAEMBH010000007.1 GCA021406655_00388 gene open 22950-24293 purB
1133 JAEMBH010000007.1 GCA021406655_00389 gene open 24428-24991 pduO
1134 JAEMBH010000007.1 GCA021406655_00390 gene open 25014-25664
1135 JAEMBH010000007.1 GCA021406655_00391 gene open 25689-26876 uraA
1136 JAEMBH010000007.1 GCA021406655_00392 gene open 27221-27688 lrp
1137 JAEMBH010000007.1 GCA021406655_00393 gene open 27735-29117 xseA
1138 JAEMBH010000007.1 GCA021406655_00394 gene open 29390-31942 nrdA
1139 JAEMBH010000007.1 GCA021406655_00395 gene open 32133-34313
1140 JAEMBH010000007.1 GCA021406655_00396 gene open 34930-37779 valS
1141 JAEMBH010000007.1 GCA021406655_00397 gene open 37808-38260
1142 JAEMBH010000007.1 GCA021406655_00399 gene open 38583-39524 trxB
1143 JAEMBH010000007.1 GCA021406655_00400 gene open 40088-40702 wcaJ
1144 JAEMBH010000007.1 GCA021406655_00401 gene open 40877-42505 asnB
1145 JAEMBH010000007.1 GCA021406655_00402 gene open 42468-43775 rfbX
1146 JAEMBH010000007.1 GCA021406655_00403 gene open 43772-44926 wecE
1147 JAEMBH010000007.1 GCA021406655_00404 gene open 45107-46234
1148 JAEMBH010000007.1 GCA021406655_00405 gene open 46364-47224 wcaE
1149 JAEMBH010000007.1 GCA021406655_00406 gene open 47230-48381
1150 JAEMBH010000007.1 GCA021406655_00407 gene open 48573-49616 epsG
1151 JAEMBH010000007.1 GCA021406655_00408 gene open 49623-51074 ugd
1152 JAEMBH010000007.1 GCA021406655_00409 gene open 51230-52189 prfB
1153 JAEMBH010000007.1 GCA021406655_00410 gene open 52470-54293 fAA1
1154 JAEMBH010000007.1 GCA021406655_00411 gene open 55670-56827 rfaB
1155 JAEMBH010000007.1 GCA021406655_00412 gene open 57003-58199 yqdH
1156 JAEMBH010000007.1 GCA021406655_00413 gene open 58338-58754
1157 JAEMBH010000007.1 GCA021406655_00414 gene open 58915-59520
1158 JAEMBH010000007.1 GCA021406655_00415 gene open 59604-60659 rfaF
1159 JAEMBH010000007.1 GCA021406655_00416 gene open 60643-61095 rsuA
1160 JAEMBH010000007.1 GCA021406655_00417 gene open 61531-62580 cbiB
1161 JAEMBH010000007.1 GCA021406655_00418 gene open 62555-63562 cobD
1162 JAEMBH010000007.1 GCA021406655_00419 gene open 63555-65051
1163 JAEMBH010000007.1 GCA021406655_00420 gene open 65048-65614 pduO
1164 JAEMBH010000007.1 GCA021406655_00421 gene open 65637-66956 cobB
1165 JAEMBH010000007.1 GCA021406655_00422 gene open 71004-71720 csx27
1166 JAEMBH010000007.1 GCA021406655_00423 gene open 71793-72014
1167 JAEMBH010000007.1 GCA021406655_00424 gene open 72710-73582 serB
1168 JAEMBH010000007.1 GCA021406655_00425 gene open 73822-74643 glpC
1169 JAEMBH010000007.1 GCA021406655_00426 gene open 74640-76007 lutB
1170 JAEMBH010000007.1 GCA021406655_00427 gene open 76013-76597 lutC
1171 JAEMBH010000007.1 GCA021406655_00428 gene open 76708-77181 paaI
1172 JAEMBH010000007.1 GCA021406655_00370 gene open 1579-1652 trnR
1173 JAEMBH010000007.1 GCA021406655_00371 gene open 1688-1761 trnR
1174 JAEMBH010000007.1 GCA021406655_00398 gene open 38321-38393 trnT
1175 JAEMBH010000007.1 GCA021406655_00370 tRNA open 1579-1652 trnR tRNA-Arg(acg)
1176 JAEMBH010000007.1 GCA021406655_00371 tRNA open 1688-1761 trnR tRNA-Arg(acg)
1177 JAEMBH010000007.1 GCA021406655_00398 tRNA open 38321-38393 trnT tRNA-Thr(cgt)
1178 JAEMBH010000008.1 GCA021406655_01900 CDS open 315-653 _na     112_aa hypothetical protein
1179 JAEMBH010000008.1 GCA021406655_01901 CDS open 681-1706 _na     341_aa hypothetical protein
1180 JAEMBH010000008.1 GCA021406655_01902 CDS open 1932-2780 _na     282_aa lipA lipoyl synthase
1181 JAEMBH010000008.1 GCA021406655_01903 CDS open 2884-5055 _na     723_aa dAP2 Dipeptidyl aminopeptidase IV
1182 JAEMBH010000008.1 GCA021406655_01904 CDS open 5095-5556 _na     153_aa smpB SsrA-binding protein SmpB
1183 JAEMBH010000008.1 GCA021406655_01905 CDS open 5589-6671 _na     360_aa lptF YjgP/YjgQ family permease
1184 JAEMBH010000008.1 GCA021406655_01906 CDS open 6688-7818 _na     376_aa tgt tRNA guanosine(34) transglycosylase Tgt
1185 JAEMBH010000008.1 GCA021406655_01907 CDS open 7955-8065 _na     36_aa hypothetical protein
1186 JAEMBH010000008.1 GCA021406655_01908 CDS open 8567-9052 _na     161_aa luxS S-ribosylhomocysteine lyase
1187 JAEMBH010000008.1 GCA021406655_01909 CDS open 9071-9757 _na     228_aa mtnN 5'-methylthioadenosine/adenosylhomocysteine nucleosidase
1188 JAEMBH010000008.1 GCA021406655_01910 CDS open 10159-11553 _na     464_aa cTD-A T9SS C-terminal target domain-containing protein
1189 JAEMBH010000008.1 GCA021406655_01911 CDS open 12762-14900 _na     712_aa dpp7 Dipeptidyl-peptidase 7
1190 JAEMBH010000008.1 GCA021406655_01912 CDS open 14916-16334 _na     472_aa aF0785 TIGR00341 family protein
1191 JAEMBH010000008.1 GCA021406655_01913 CDS open 16356-17837 _na     493_aa rfbX Polysaccharide biosynthesis-related protein
1192 JAEMBH010000008.1 GCA021406655_01914 CDS open 17884-18936 _na     350_aa ruvB Holliday junction branch migration DNA helicase RuvB
1193 JAEMBH010000008.1 GCA021406655_01915 CDS open 18987-19169 _na     60_aa hypothetical protein
1194 JAEMBH010000008.1 GCA021406655_01916 CDS open 19555-20322 _na     255_aa Methylated-DNA--protein-cysteine methyltransferase
1195 JAEMBH010000008.1 GCA021406655_01917 CDS open 20405-20743 _na     112_aa yajC preprotein translocase subunit YajC
1196 JAEMBH010000008.1 GCA021406655_01918 CDS open 20871-21878 _na     335_aa ybbR YbbR-like domain-containing protein
1197 JAEMBH010000008.1 GCA021406655_01919 CDS open 21885-22493 _na     202_aa coaE dephospho-CoA kinase
1198 JAEMBH010000008.1 GCA021406655_01920 CDS open 22600-23031 _na     143_aa hypothetical protein
1199 JAEMBH010000008.1 GCA021406655_01921 CDS open 23107-24297 _na     396_aa kbl glycine C-acetyltransferase
1200 JAEMBH010000008.1 GCA021406655_01922 CDS open 24410-25123 _na     237_aa cobF Cobalt-precorrin-2 C(20)-methyltransferase
1201 JAEMBH010000008.1 GCA021406655_01923 CDS open 25214-25948 _na     244_aa Outer membrane protein beta-barrel domain-containing protein
1202 JAEMBH010000008.1 GCA021406655_01924 CDS open 26133-26978 _na     281_aa panC pantoate--beta-alanine ligase
1203 JAEMBH010000008.1 GCA021406655_01925 CDS open 26968-28515 _na     515_aa digH Fibronectin type-III domain-containing protein
1204 JAEMBH010000008.1 GCA021406655_01926 CDS open 28512-29642 _na     376_aa hemW radical SAM family heme chaperone HemW
1205 JAEMBH010000008.1 GCA021406655_01927 CDS open 29682-30719 _na     345_aa gLY1 Aminotransferase class V-fold PLP-dependent enzyme
1206 JAEMBH010000008.1 GCA021406655_01928 CDS open 30815-31081 _na     88_aa DUF4248 domain-containing protein
1207 JAEMBH010000008.1 GCA021406655_01929 CDS open 31346-32353 _na     335_aa queG tRNA epoxyqueuosine(34) reductase QueG
1208 JAEMBH010000008.1 GCA021406655_01930 CDS open 32328-33386 _na     352_aa SPOR domain-containing protein
1209 JAEMBH010000008.1 GCA021406655_01931 CDS open 34072-34323 _na     83_aa Conjugal transfer protein
1210 JAEMBH010000008.1 GCA021406655_01932 CDS open 34346-35356 _na     336_aa manA mannose-6-phosphate isomerase%2C class I
1211 JAEMBH010000008.1 GCA021406655_01933 CDS open 35369-36241 _na     290_aa DUF3298 domain-containing protein
1212 JAEMBH010000008.1 GCA021406655_01934 CDS open 36225-36827 _na     200_aa fur Ferric uptake transcriptional regulator
1213 JAEMBH010000008.1 GCA021406655_01935 CDS open 36856-38127 _na     423_aa purA adenylosuccinate synthase
1214 JAEMBH010000008.1 GCA021406655_01936 CDS open 38124-39413 _na     429_aa folC tetrahydrofolate synthase
1215 JAEMBH010000008.1 GCA021406655_01937 CDS open 39450-40853 _na     467_aa narK Lysosomal dipeptide transporter MFSD1
1216 JAEMBH010000008.1 GCA021406655_01938 CDS open 41260-41955 _na     231_aa CDP-alcohol phosphatidyltransferase family protein
1217 JAEMBH010000008.1 GCA021406655_01939 CDS open 41970-42656 _na     228_aa hypothetical protein
1218 JAEMBH010000008.1 GCA021406655_01940 CDS open 42770-43819 _na     349_aa Lipoprotein
1219 JAEMBH010000008.1 GCA021406655_01941 CDS open 44410-45684 _na     424_aa mgtC DUF4010 domain-containing protein
1220 JAEMBH010000008.1 GCA021406655_01942 CDS open 45973-48120 _na     715_aa Peptidylprolyl isomerase
1221 JAEMBH010000008.1 GCA021406655_01943 CDS open 48227-49480 _na     417_aa mpfA CBS domain protein
1222 JAEMBH010000008.1 GCA021406655_01944 CDS open 49477-50181 _na     234_aa lptC LPS export ABC transporter periplasmic protein LptC
1223 JAEMBH010000008.1 GCA021406655_01945 CDS open 50212-51564 _na     450_aa bepA TPR domain protein
1224 JAEMBH010000008.1 GCA021406655_01946 CDS open 51606-52910 _na     434_aa Outer membrane protein
1225 JAEMBH010000008.1 GCA021406655_01947 CDS open 52903-53637 _na     244_aa coaX type III pantothenate kinase
1226 JAEMBH010000008.1 GCA021406655_01948 CDS open 53693-54442 _na     249_aa thiF ThiF protein
1227 JAEMBH010000008.1 GCA021406655_01949 CDS open 54530-55747 _na     405_aa pepT peptidase T
1228 JAEMBH010000008.1 GCA021406655_01950 CDS open 55764-57743 _na     659_aa oPT OPT family oligopeptide transporter
1229 JAEMBH010000008.1 GCA021406655_01951 CDS open 57932-58951 _na     339_aa Hemagglutinin-related protein
1230 JAEMBH010000008.1 GCA021406655_01952 CDS open 59632-62262 _na     876_aa cirA Carboxypeptidase-like regulatory domain-containing protein
1231 JAEMBH010000008.1 GCA021406655_01953 CDS open 62269-63144 _na     291_aa GLPGLI family protein
1232 JAEMBH010000008.1 GCA021406655_01954 CDS open 63165-64040 _na     291_aa GLPGLI family protein
1233 JAEMBH010000008.1 GCA021406655_01955 CDS open 64172-65095 _na     307_aa wza Polysaccharide export protein%2C BexD/CtrA/VexA family
1234 JAEMBH010000008.1 GCA021406655_01956 CDS open 65120-67588 _na     822_aa ptk1 polysaccharide biosynthesis tyrosine autokinase Ptk1
1235 JAEMBH010000008.1 GCA021406655_01957 CDS open 67598-68341 _na     247_aa php1 polysaccharide biosynthesis protein-tyrosine phosphatase Php1
1236 JAEMBH010000008.1 GCA021406655_01958 CDS open 68498-69613 _na     371_aa Nudix hydrolase domain-containing protein
1237 JAEMBH010000008.1 GCA021406655_01959 CDS open 69650-70363 _na     237_aa rsmI Tetrapyrrole methylase domain-containing protein
1238 JAEMBH010000008.1 GCA021406655_01960 CDS open 70367-71773 _na     468_aa ncl1 SAM-dependent MTase RsmB/NOP-type domain-containing protein
1239 JAEMBH010000008.1 GCA021406655_01961 CDS open 72003-73040 _na     345_aa porB Oxidoreductase%2C putative
1240 JAEMBH010000008.1 GCA021406655_01962 CDS open 73037-74896 _na     619_aa porG Pyruvate synthase
1241 JAEMBH010000008.1 GCA021406655_01900 gene open 315-653
1242 JAEMBH010000008.1 GCA021406655_01901 gene open 681-1706
1243 JAEMBH010000008.1 GCA021406655_01902 gene open 1932-2780 lipA
1244 JAEMBH010000008.1 GCA021406655_01903 gene open 2884-5055 dAP2
1245 JAEMBH010000008.1 GCA021406655_01904 gene open 5095-5556 smpB
1246 JAEMBH010000008.1 GCA021406655_01905 gene open 5589-6671 lptF
1247 JAEMBH010000008.1 GCA021406655_01906 gene open 6688-7818 tgt
1248 JAEMBH010000008.1 GCA021406655_01907 gene open 7955-8065
1249 JAEMBH010000008.1 GCA021406655_01908 gene open 8567-9052 luxS
1250 JAEMBH010000008.1 GCA021406655_01909 gene open 9071-9757 mtnN
1251 JAEMBH010000008.1 GCA021406655_01910 gene open 10159-11553 cTD-A
1252 JAEMBH010000008.1 GCA021406655_01911 gene open 12762-14900 dpp7
1253 JAEMBH010000008.1 GCA021406655_01912 gene open 14916-16334 aF0785
1254 JAEMBH010000008.1 GCA021406655_01913 gene open 16356-17837 rfbX
1255 JAEMBH010000008.1 GCA021406655_01914 gene open 17884-18936 ruvB
1256 JAEMBH010000008.1 GCA021406655_01915 gene open 18987-19169
1257 JAEMBH010000008.1 GCA021406655_01916 gene open 19555-20322
1258 JAEMBH010000008.1 GCA021406655_01917 gene open 20405-20743 yajC
1259 JAEMBH010000008.1 GCA021406655_01918 gene open 20871-21878 ybbR
1260 JAEMBH010000008.1 GCA021406655_01919 gene open 21885-22493 coaE
1261 JAEMBH010000008.1 GCA021406655_01920 gene open 22600-23031
1262 JAEMBH010000008.1 GCA021406655_01921 gene open 23107-24297 kbl
1263 JAEMBH010000008.1 GCA021406655_01922 gene open 24410-25123 cobF
1264 JAEMBH010000008.1 GCA021406655_01923 gene open 25214-25948
1265 JAEMBH010000008.1 GCA021406655_01924 gene open 26133-26978 panC
1266 JAEMBH010000008.1 GCA021406655_01925 gene open 26968-28515 digH
1267 JAEMBH010000008.1 GCA021406655_01926 gene open 28512-29642 hemW
1268 JAEMBH010000008.1 GCA021406655_01927 gene open 29682-30719 gLY1
1269 JAEMBH010000008.1 GCA021406655_01928 gene open 30815-31081
1270 JAEMBH010000008.1 GCA021406655_01929 gene open 31346-32353 queG
1271 JAEMBH010000008.1 GCA021406655_01930 gene open 32328-33386
1272 JAEMBH010000008.1 GCA021406655_01931 gene open 34072-34323
1273 JAEMBH010000008.1 GCA021406655_01932 gene open 34346-35356 manA
1274 JAEMBH010000008.1 GCA021406655_01933 gene open 35369-36241
1275 JAEMBH010000008.1 GCA021406655_01934 gene open 36225-36827 fur
1276 JAEMBH010000008.1 GCA021406655_01935 gene open 36856-38127 purA
1277 JAEMBH010000008.1 GCA021406655_01936 gene open 38124-39413 folC
1278 JAEMBH010000008.1 GCA021406655_01937 gene open 39450-40853 narK
1279 JAEMBH010000008.1 GCA021406655_01938 gene open 41260-41955
1280 JAEMBH010000008.1 GCA021406655_01939 gene open 41970-42656
1281 JAEMBH010000008.1 GCA021406655_01940 gene open 42770-43819
1282 JAEMBH010000008.1 GCA021406655_01941 gene open 44410-45684 mgtC
1283 JAEMBH010000008.1 GCA021406655_01942 gene open 45973-48120
1284 JAEMBH010000008.1 GCA021406655_01943 gene open 48227-49480 mpfA
1285 JAEMBH010000008.1 GCA021406655_01944 gene open 49477-50181 lptC
1286 JAEMBH010000008.1 GCA021406655_01945 gene open 50212-51564 bepA
1287 JAEMBH010000008.1 GCA021406655_01946 gene open 51606-52910
1288 JAEMBH010000008.1 GCA021406655_01947 gene open 52903-53637 coaX
1289 JAEMBH010000008.1 GCA021406655_01948 gene open 53693-54442 thiF
1290 JAEMBH010000008.1 GCA021406655_01949 gene open 54530-55747 pepT
1291 JAEMBH010000008.1 GCA021406655_01950 gene open 55764-57743 oPT
1292 JAEMBH010000008.1 GCA021406655_01951 gene open 57932-58951
1293 JAEMBH010000008.1 GCA021406655_01952 gene open 59632-62262 cirA
1294 JAEMBH010000008.1 GCA021406655_01953 gene open 62269-63144
1295 JAEMBH010000008.1 GCA021406655_01954 gene open 63165-64040
1296 JAEMBH010000008.1 GCA021406655_01955 gene open 64172-65095 wza
1297 JAEMBH010000008.1 GCA021406655_01956 gene open 65120-67588 ptk1
1298 JAEMBH010000008.1 GCA021406655_01957 gene open 67598-68341 php1
1299 JAEMBH010000008.1 GCA021406655_01958 gene open 68498-69613
1300 JAEMBH010000008.1 GCA021406655_01959 gene open 69650-70363 rsmI
1301 JAEMBH010000008.1 GCA021406655_01960 gene open 70367-71773 ncl1
1302 JAEMBH010000008.1 GCA021406655_01961 gene open 72003-73040 porB
1303 JAEMBH010000008.1 GCA021406655_01962 gene open 73037-74896 porG
1304 JAEMBH010000009.1 GCA021406655_01440 CDS open 71-244 _na     57_aa hypothetical protein
1305 JAEMBH010000009.1 GCA021406655_01441 CDS open 569-2800 _na     743_aa pnp polyribonucleotide nucleotidyltransferase
1306 JAEMBH010000009.1 GCA021406655_01442 CDS open 2953-5646 _na     897_aa malQ 4-alpha-glucanotransferase
1307 JAEMBH010000009.1 GCA021406655_01443 CDS open 5671-6777 _na     368_aa DUF2891 domain-containing protein
1308 JAEMBH010000009.1 GCA021406655_01444 CDS open 6952-9093 _na     713_aa Fibronectin type-III domain-containing protein
1309 JAEMBH010000009.1 GCA021406655_01445 CDS open 9899-10006 _na     35_aa hypothetical protein
1310 JAEMBH010000009.1 GCA021406655_01446 CDS open 10021-11265 _na     414_aa Peptidase M48 domain-containing protein
1311 JAEMBH010000009.1 GCA021406655_01448 CDS open 11756-13477 _na     573_aa caiA Alkylation response protein AidB-like acyl-CoA dehydrogenase
1312 JAEMBH010000009.1 GCA021406655_01449 CDS open 13489-14508 _na     339_aa fixB Electron transfer flavoprotein%2C alpha subunit
1313 JAEMBH010000009.1 GCA021406655_01450 CDS open 14517-15383 _na     288_aa fixA Electron transfer flavoprotein%2C beta subunit
1314 JAEMBH010000009.1 GCA021406655_01451 CDS open 15474-16193 _na     239_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
1315 JAEMBH010000009.1 GCA021406655_01452 CDS open 16424-16897 _na     157_aa exbD Biopolymer transporter ExbD
1316 JAEMBH010000009.1 GCA021406655_01453 CDS open 16913-17527 _na     204_aa exbD Biopolymer transporter ExbD
1317 JAEMBH010000009.1 GCA021406655_01454 CDS open 17563-18033 _na     156_aa hypothetical protein
1318 JAEMBH010000009.1 GCA021406655_01455 CDS open 18042-18854 _na     270_aa tolQ MotA/TolQ/ExbB proton channel family protein
1319 JAEMBH010000009.1 GCA021406655_01457 CDS open 19202-20005 _na     267_aa tatD Hydrolase%2C putative
1320 JAEMBH010000009.1 GCA021406655_01458 CDS open 20076-21053 _na     325_aa ispA putative isoprenyl synthetase
1321 JAEMBH010000009.1 GCA021406655_01459 CDS open 21224-21916 _na     230_aa tonB TonB protein%2C putative
1322 JAEMBH010000009.1 GCA021406655_01460 CDS open 22367-24985 _na     872_aa Collagen-binding protein
1323 JAEMBH010000009.1 GCA021406655_01461 CDS open 25026-25784 _na     252_aa B3/B4 tRNA-binding domain-containing protein
1324 JAEMBH010000009.1 GCA021406655_01462 CDS open 25723-26910 _na     395_aa obgE GTPase ObgE
1325 JAEMBH010000009.1 GCA021406655_01463 CDS open 26920-27504 _na     194_aa adk adenylate kinase
1326 JAEMBH010000009.1 GCA021406655_01464 CDS open 27505-28041 _na     178_aa hptA Hypoxanthine phosphoribosyltransferase
1327 JAEMBH010000009.1 GCA021406655_01465 CDS open 28213-28584 _na     123_aa C2H2-type domain-containing protein
1328 JAEMBH010000009.1 GCA021406655_01466 CDS open 28635-30632 _na     665_aa fbp Fructose-1%2C6-bisphosphatase class 3
1329 JAEMBH010000009.1 GCA021406655_01467 CDS open 30788-33142 _na     784_aa mrcB peptidoglycan glycosyltransferase
1330 JAEMBH010000009.1 GCA021406655_01468 CDS open 33190-33900 _na     236_aa ybhL BAX inhibitor (BI)-1/YccA family protein
1331 JAEMBH010000009.1 GCA021406655_01469 CDS open 34000-36777 _na     925_aa leuS leucine--tRNA ligase
1332 JAEMBH010000009.1 GCA021406655_01471 CDS open 38154-39713 _na     519_aa NAD(P)/FAD-dependent oxidoreductase
1333 JAEMBH010000009.1 GCA021406655_01472 CDS open 39698-41149 _na     483_aa pcnB PolyA polymerase family protein
1334 JAEMBH010000009.1 GCA021406655_01473 CDS open 41855-43204 _na     449_aa lpdA dihydrolipoyl dehydrogenase
1335 JAEMBH010000009.1 GCA021406655_01474 CDS open 43209-44000 _na     263_aa nagB glucosamine-6-phosphate deaminase
1336 JAEMBH010000009.1 GCA021406655_01475 CDS open 44039-45250 _na     403_aa norV Flavodoxin
1337 JAEMBH010000009.1 GCA021406655_01476 CDS open 45281-46132 _na     283_aa lgt prolipoprotein diacylglyceryl transferase
1338 JAEMBH010000009.1 GCA021406655_01477 CDS open 46169-47074 _na     301_aa aspD diaminopimelate dehydrogenase
1339 JAEMBH010000009.1 GCA021406655_01478 CDS open 47112-48158 _na     348_aa nusB transcription antitermination factor NusB
1340 JAEMBH010000009.1 GCA021406655_01479 CDS open 48180-48380 _na     66_aa hypothetical protein
1341 JAEMBH010000009.1 GCA021406655_01480 CDS open 48822-56321 _na     2499_aa sprA cell surface protein SprA
1342 JAEMBH010000009.1 GCA021406655_01481 CDS open 56361-56969 _na     202_aa ruvA Holliday junction branch migration protein RuvA
1343 JAEMBH010000009.1 GCA021406655_01482 CDS open 57405-57830 _na     141_aa Partial transposase in ISPg1
1344 JAEMBH010000009.1 GCA021406655_01483 CDS open 57893-58552 _na     219_aa Partial transposase in ISPg1
1345 JAEMBH010000009.1 GCA021406655_01440 gene open 71-244
1346 JAEMBH010000009.1 GCA021406655_01441 gene open 569-2800 pnp
1347 JAEMBH010000009.1 GCA021406655_01442 gene open 2953-5646 malQ
1348 JAEMBH010000009.1 GCA021406655_01443 gene open 5671-6777
1349 JAEMBH010000009.1 GCA021406655_01444 gene open 6952-9093
1350 JAEMBH010000009.1 GCA021406655_01445 gene open 9899-10006
1351 JAEMBH010000009.1 GCA021406655_01446 gene open 10021-11265
1352 JAEMBH010000009.1 GCA021406655_01448 gene open 11756-13477 caiA
1353 JAEMBH010000009.1 GCA021406655_01449 gene open 13489-14508 fixB
1354 JAEMBH010000009.1 GCA021406655_01450 gene open 14517-15383 fixA
1355 JAEMBH010000009.1 GCA021406655_01451 gene open 15474-16193 tsaB
1356 JAEMBH010000009.1 GCA021406655_01452 gene open 16424-16897 exbD
1357 JAEMBH010000009.1 GCA021406655_01453 gene open 16913-17527 exbD
1358 JAEMBH010000009.1 GCA021406655_01454 gene open 17563-18033
1359 JAEMBH010000009.1 GCA021406655_01455 gene open 18042-18854 tolQ
1360 JAEMBH010000009.1 GCA021406655_01457 gene open 19202-20005 tatD
1361 JAEMBH010000009.1 GCA021406655_01458 gene open 20076-21053 ispA
1362 JAEMBH010000009.1 GCA021406655_01459 gene open 21224-21916 tonB
1363 JAEMBH010000009.1 GCA021406655_01460 gene open 22367-24985
1364 JAEMBH010000009.1 GCA021406655_01461 gene open 25026-25784
1365 JAEMBH010000009.1 GCA021406655_01462 gene open 25723-26910 obgE
1366 JAEMBH010000009.1 GCA021406655_01463 gene open 26920-27504 adk
1367 JAEMBH010000009.1 GCA021406655_01464 gene open 27505-28041 hptA
1368 JAEMBH010000009.1 GCA021406655_01465 gene open 28213-28584
1369 JAEMBH010000009.1 GCA021406655_01466 gene open 28635-30632 fbp
1370 JAEMBH010000009.1 GCA021406655_01467 gene open 30788-33142 mrcB
1371 JAEMBH010000009.1 GCA021406655_01468 gene open 33190-33900 ybhL
1372 JAEMBH010000009.1 GCA021406655_01469 gene open 34000-36777 leuS
1373 JAEMBH010000009.1 GCA021406655_01471 gene open 38154-39713
1374 JAEMBH010000009.1 GCA021406655_01472 gene open 39698-41149 pcnB
1375 JAEMBH010000009.1 GCA021406655_01473 gene open 41855-43204 lpdA
1376 JAEMBH010000009.1 GCA021406655_01474 gene open 43209-44000 nagB
1377 JAEMBH010000009.1 GCA021406655_01475 gene open 44039-45250 norV
1378 JAEMBH010000009.1 GCA021406655_01476 gene open 45281-46132 lgt
1379 JAEMBH010000009.1 GCA021406655_01477 gene open 46169-47074 aspD
1380 JAEMBH010000009.1 GCA021406655_01478 gene open 47112-48158 nusB
1381 JAEMBH010000009.1 GCA021406655_01479 gene open 48180-48380
1382 JAEMBH010000009.1 GCA021406655_01480 gene open 48822-56321 sprA
1383 JAEMBH010000009.1 GCA021406655_01481 gene open 56361-56969 ruvA
1384 JAEMBH010000009.1 GCA021406655_01482 gene open 57405-57830
1385 JAEMBH010000009.1 GCA021406655_01483 gene open 57893-58552
1386 JAEMBH010000009.1 GCA021406655_01447 gene open 11534-11608 trnP
1387 JAEMBH010000009.1 GCA021406655_01456 gene open 18922-19009 trnS
1388 JAEMBH010000009.1 GCA021406655_01470 gene open 38016-38088 trnG
1389 JAEMBH010000009.1 GCA021406655_01447 tRNA open 11534-11608 trnP tRNA-Pro(tgg)
1390 JAEMBH010000009.1 GCA021406655_01456 tRNA open 18922-19009 trnS tRNA-Ser(gga)
1391 JAEMBH010000009.1 GCA021406655_01470 tRNA open 38016-38088 trnG tRNA-Gly(ccc)
1392 JAEMBH010000010.1 GCA021406655_01656 CDS open 484-2943 _na     819_aa pheT phenylalanine--tRNA ligase subunit beta
1393 JAEMBH010000010.1 GCA021406655_01657 CDS open 2986-3714 _na     242_aa tACO1 YebC/PmpR family DNA-binding transcriptional regulator
1394 JAEMBH010000010.1 GCA021406655_01658 CDS open 4007-6682 _na     891_aa mutS DNA mismatch repair protein MutS
1395 JAEMBH010000010.1 GCA021406655_01659 CDS open 7085-7204 _na     39_aa hypothetical protein
1396 JAEMBH010000010.1 GCA021406655_01660 CDS open 7599-9104 _na     501_aa tolC Putative alkaline protease AprF
1397 JAEMBH010000010.1 GCA021406655_01661 CDS open 9153-10148 _na     331_aa emrA Hemolysin secretion protein D
1398 JAEMBH010000010.1 GCA021406655_01662 CDS open 10151-11332 _na     393_aa ABC-2 type transporter transmembrane domain-containing protein
1399 JAEMBH010000010.1 GCA021406655_01663 CDS open 11334-12608 _na     424_aa yadH ABC-2 type transporter transmembrane domain-containing protein
1400 JAEMBH010000010.1 GCA021406655_01664 CDS open 12737-13216 _na     159_aa dps DNA protection during starvation protein
1401 JAEMBH010000010.1 GCA021406655_01665 CDS open 13835-14119 _na     94_aa hypothetical protein
1402 JAEMBH010000010.1 GCA021406655_01666 CDS open 14271-15488 _na     405_aa pqqL Putative peptidase
1403 JAEMBH010000010.1 GCA021406655_01667 CDS open 15667-16308 _na     213_aa gutQ putative sugar isomerase
1404 JAEMBH010000010.1 GCA021406655_01668 CDS open 16454-18268 _na     604_aa srmB RNA helicase
1405 JAEMBH010000010.1 GCA021406655_01669 CDS open 18287-19732 _na     481_aa Alpha-galactosidase
1406 JAEMBH010000010.1 GCA021406655_01670 CDS open 19732-20931 _na     399_aa sdaA L-serine ammonia-lyase
1407 JAEMBH010000010.1 GCA021406655_01671 CDS open 21026-21811 _na     261_aa porT Outer membrane protein beta-barrel domain-containing protein
1408 JAEMBH010000010.1 GCA021406655_01672 CDS open 21817-22719 _na     300_aa Putative carbohydrate metabolism domain-containing protein
1409 JAEMBH010000010.1 GCA021406655_01673 CDS open 22781-24958 _na     725_aa sbsA SbsA Ig-like domain-containing protein
1410 JAEMBH010000010.1 GCA021406655_01674 CDS open 25275-26576 _na     433_aa ATPase AAA-type core domain-containing protein
1411 JAEMBH010000010.1 GCA021406655_01675 CDS open 26692-26973 _na     93_aa hypothetical protein
1412 JAEMBH010000010.1 GCA021406655_01676 CDS open 27353-28294 _na     313_aa flgJ Peptidoglycan hydrolase
1413 JAEMBH010000010.1 GCA021406655_01677 CDS open 28323-29489 _na     388_aa purM Phosphoribosylformylglycinamidine cyclo-ligase
1414 JAEMBH010000010.1 GCA021406655_01678 CDS open 29514-30599 _na     361_aa prfA peptide chain release factor 1
1415 JAEMBH010000010.1 GCA021406655_01679 CDS open 30616-31446 _na     276_aa pyrF orotidine-5'-phosphate decarboxylase
1416 JAEMBH010000010.1 GCA021406655_01680 CDS open 31539-32588 _na     349_aa lpxD UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase
1417 JAEMBH010000010.1 GCA021406655_01681 CDS open 32567-33955 _na     462_aa lpxC bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase
1418 JAEMBH010000010.1 GCA021406655_01682 CDS open 33955-34746 _na     263_aa lpxA acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
1419 JAEMBH010000010.1 GCA021406655_01683 CDS open 34724-36265 _na     513_aa nnr2 Bifunctional NAD(P)H-hydrate repair enzyme
1420 JAEMBH010000010.1 GCA021406655_01684 CDS open 36337-36756 _na     139_aa DUF2946 domain-containing protein
1421 JAEMBH010000010.1 GCA021406655_01685 CDS open 37291-38469 _na     392_aa acrA Cation efflux system protein
1422 JAEMBH010000010.1 GCA021406655_01686 CDS open 38489-41590 _na     1033_aa cusA Heavy metal efflux pump%2C CzcA family
1423 JAEMBH010000010.1 GCA021406655_01687 CDS open 41626-42804 _na     392_aa tolC Outer membrane efflux protein
1424 JAEMBH010000010.1 GCA021406655_01688 CDS open 42902-44944 _na     680_aa recD TPR domain protein
1425 JAEMBH010000010.1 GCA021406655_01689 CDS open 44949-46487 _na     512_aa digH Glycosyl hydrolase-like 10 domain-containing protein
1426 JAEMBH010000010.1 GCA021406655_01690 CDS open 46534-46716 _na     60_aa hypothetical protein
1427 JAEMBH010000010.1 GCA021406655_01691 CDS open 46723-47106 _na     127_aa DUF2007 domain-containing protein
1428 JAEMBH010000010.1 GCA021406655_01692 CDS open 47120-47713 _na     197_aa nadD nicotinate (nicotinamide) nucleotide adenylyltransferase
1429 JAEMBH010000010.1 GCA021406655_01693 CDS open 47713-48897 _na     394_aa pncB nicotinate phosphoribosyltransferase
1430 JAEMBH010000010.1 GCA021406655_01694 CDS open 48930-50630 _na     566_aa Chain length determinant protein
1431 JAEMBH010000010.1 GCA021406655_01695 CDS open 50761-51816 _na     351_aa pspC Phage shock protein PspC N-terminal domain-containing protein
1432 JAEMBH010000010.1 GCA021406655_01696 CDS open 51813-53567 _na     584_aa recJ single-stranded-DNA-specific exonuclease RecJ
1433 JAEMBH010000010.1 GCA021406655_01697 CDS open 54026-55213 _na     395_aa histidine kinase
1434 JAEMBH010000010.1 GCA021406655_01698 CDS open 55310-55534 _na     74_aa hypothetical protein
1435 JAEMBH010000010.1 GCA021406655_01656 gene open 484-2943 pheT
1436 JAEMBH010000010.1 GCA021406655_01657 gene open 2986-3714 tACO1
1437 JAEMBH010000010.1 GCA021406655_01658 gene open 4007-6682 mutS
1438 JAEMBH010000010.1 GCA021406655_01659 gene open 7085-7204
1439 JAEMBH010000010.1 GCA021406655_01660 gene open 7599-9104 tolC
1440 JAEMBH010000010.1 GCA021406655_01661 gene open 9153-10148 emrA
1441 JAEMBH010000010.1 GCA021406655_01662 gene open 10151-11332
1442 JAEMBH010000010.1 GCA021406655_01663 gene open 11334-12608 yadH
1443 JAEMBH010000010.1 GCA021406655_01664 gene open 12737-13216 dps
1444 JAEMBH010000010.1 GCA021406655_01665 gene open 13835-14119
1445 JAEMBH010000010.1 GCA021406655_01666 gene open 14271-15488 pqqL
1446 JAEMBH010000010.1 GCA021406655_01667 gene open 15667-16308 gutQ
1447 JAEMBH010000010.1 GCA021406655_01668 gene open 16454-18268 srmB
1448 JAEMBH010000010.1 GCA021406655_01669 gene open 18287-19732
1449 JAEMBH010000010.1 GCA021406655_01670 gene open 19732-20931 sdaA
1450 JAEMBH010000010.1 GCA021406655_01671 gene open 21026-21811 porT
1451 JAEMBH010000010.1 GCA021406655_01672 gene open 21817-22719
1452 JAEMBH010000010.1 GCA021406655_01673 gene open 22781-24958 sbsA
1453 JAEMBH010000010.1 GCA021406655_01674 gene open 25275-26576
1454 JAEMBH010000010.1 GCA021406655_01675 gene open 26692-26973
1455 JAEMBH010000010.1 GCA021406655_01676 gene open 27353-28294 flgJ
1456 JAEMBH010000010.1 GCA021406655_01677 gene open 28323-29489 purM
1457 JAEMBH010000010.1 GCA021406655_01678 gene open 29514-30599 prfA
1458 JAEMBH010000010.1 GCA021406655_01679 gene open 30616-31446 pyrF
1459 JAEMBH010000010.1 GCA021406655_01680 gene open 31539-32588 lpxD
1460 JAEMBH010000010.1 GCA021406655_01681 gene open 32567-33955 lpxC
1461 JAEMBH010000010.1 GCA021406655_01682 gene open 33955-34746 lpxA
1462 JAEMBH010000010.1 GCA021406655_01683 gene open 34724-36265 nnr2
1463 JAEMBH010000010.1 GCA021406655_01684 gene open 36337-36756
1464 JAEMBH010000010.1 GCA021406655_01685 gene open 37291-38469 acrA
1465 JAEMBH010000010.1 GCA021406655_01686 gene open 38489-41590 cusA
1466 JAEMBH010000010.1 GCA021406655_01687 gene open 41626-42804 tolC
1467 JAEMBH010000010.1 GCA021406655_01688 gene open 42902-44944 recD
1468 JAEMBH010000010.1 GCA021406655_01689 gene open 44949-46487 digH
1469 JAEMBH010000010.1 GCA021406655_01690 gene open 46534-46716
1470 JAEMBH010000010.1 GCA021406655_01691 gene open 46723-47106
1471 JAEMBH010000010.1 GCA021406655_01692 gene open 47120-47713 nadD
1472 JAEMBH010000010.1 GCA021406655_01693 gene open 47713-48897 pncB
1473 JAEMBH010000010.1 GCA021406655_01694 gene open 48930-50630
1474 JAEMBH010000010.1 GCA021406655_01695 gene open 50761-51816 pspC
1475 JAEMBH010000010.1 GCA021406655_01696 gene open 51813-53567 recJ
1476 JAEMBH010000010.1 GCA021406655_01697 gene open 54026-55213
1477 JAEMBH010000010.1 GCA021406655_01698 gene open 55310-55534
1478 JAEMBH010000011.1 GCA021406655_00857 CDS open 447-701 _na     84_aa rpsT 30S ribosomal protein S20
1479 JAEMBH010000011.1 GCA021406655_00859 CDS open 1118-2143 _na     341_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
1480 JAEMBH010000011.1 GCA021406655_00860 CDS open 2143-2625 _na     160_aa pncC Competence/damage-inducible protein CinA domain protein
1481 JAEMBH010000011.1 GCA021406655_00861 CDS open 2659-4077 _na     472_aa ctpA PDZ domain-containing protein
1482 JAEMBH010000011.1 GCA021406655_00862 CDS open 4087-4950 _na     287_aa cvfB GntR family transcriptional regulator
1483 JAEMBH010000011.1 GCA021406655_00863 CDS open 4984-5475 _na     163_aa tadA Cytidine/deoxycytidylate deaminase family protein
1484 JAEMBH010000011.1 GCA021406655_00864 CDS open 5671-6210 _na     179_aa tpx thiol peroxidase
1485 JAEMBH010000011.1 GCA021406655_00865 CDS open 6256-6888 _na     210_aa trmR O-methyltransferase family protein
1486 JAEMBH010000011.1 GCA021406655_00866 CDS open 7007-7432 _na     141_aa aroQ 3-dehydroquinate dehydratase
1487 JAEMBH010000011.1 GCA021406655_00867 CDS open 7550-8476 _na     308_aa xerC Tyrosine recombinase XerC
1488 JAEMBH010000011.1 GCA021406655_00868 CDS open 8515-8952 _na     145_aa DUF695 domain-containing protein
1489 JAEMBH010000011.1 GCA021406655_00869 CDS open 8949-9860 _na     303_aa yfeH Sodium bile acid symporter family protein
1490 JAEMBH010000011.1 GCA021406655_00870 CDS open 9857-10048 _na     63_aa hypothetical protein
1491 JAEMBH010000011.1 GCA021406655_00871 CDS open 10119-10799 _na     226_aa hypothetical protein
1492 JAEMBH010000011.1 GCA021406655_00872 CDS open 10796-11704 _na     302_aa Putative exopolyphosphatase
1493 JAEMBH010000011.1 GCA021406655_00873 CDS open 11851-13278 _na     475_aa aspA Aspartate ammonia-lyase
1494 JAEMBH010000011.1 GCA021406655_00874 CDS open 13526-14344 _na     272_aa kdsA 3-deoxy-8-phosphooctulonate synthase
1495 JAEMBH010000011.1 GCA021406655_00875 CDS open 15430-17094 _na     554_aa udk Phosphoribulokinase family protein
1496 JAEMBH010000011.1 GCA021406655_00876 CDS open 17185-18312 _na     375_aa N-acetyltransferase domain-containing protein
1497 JAEMBH010000011.1 GCA021406655_00877 CDS open 18450-18959 _na     169_aa cnoX Putative thioredoxin
1498 JAEMBH010000011.1 GCA021406655_00878 CDS open 19375-19494 _na     39_aa hypothetical protein
1499 JAEMBH010000011.1 GCA021406655_00879 CDS open 19574-20170 _na     198_aa sfp 4'-phosphopantetheinyl transferase domain-containing protein
1500 JAEMBH010000011.1 GCA021406655_00880 CDS open 20206-21534 _na     442_aa mpfA CBS domain protein