BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_021406705.1)
Select a Genome:
|
BAKTA Annotations for GCA_021406705.1
|
Search & Sort all 4269 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1501 | JAEMBM010000008.1 | GCA021406705_00520 | gene | open | 13662-14177 | |||
| 1502 | JAEMBM010000008.1 | GCA021406705_00521 | gene | open | 14161-14622 | |||
| 1503 | JAEMBM010000008.1 | GCA021406705_00522 | gene | open | 14650-15495 | |||
| 1504 | JAEMBM010000008.1 | GCA021406705_00523 | gene | open | 15495-16079 | traO | ||
| 1505 | JAEMBM010000008.1 | GCA021406705_00524 | gene | open | 16081-17001 | traN | ||
| 1506 | JAEMBM010000008.1 | GCA021406705_00525 | gene | open | 17040-18401 | traM | ||
| 1507 | JAEMBM010000008.1 | GCA021406705_00526 | gene | open | 18352-18660 | traL | ||
| 1508 | JAEMBM010000008.1 | GCA021406705_00527 | gene | open | 18681-19304 | traK | ||
| 1509 | JAEMBM010000008.1 | GCA021406705_00528 | gene | open | 19311-20402 | traJ | ||
| 1510 | JAEMBM010000008.1 | GCA021406705_00529 | gene | open | 20405-21034 | |||
| 1511 | JAEMBM010000008.1 | GCA021406705_00530 | gene | open | 21068-23554 | traC | ||
| 1512 | JAEMBM010000008.1 | GCA021406705_00531 | gene | open | 23551-23928 | traF | ||
| 1513 | JAEMBM010000008.1 | GCA021406705_00532 | gene | open | 23933-24232 | traE | ||
| 1514 | JAEMBM010000008.1 | GCA021406705_00533 | gene | open | 24408-24995 | |||
| 1515 | JAEMBM010000008.1 | GCA021406705_00534 | gene | open | 24983-25723 | |||
| 1516 | JAEMBM010000008.1 | GCA021406705_00535 | gene | open | 25753-26346 | |||
| 1517 | JAEMBM010000008.1 | GCA021406705_00536 | gene | open | 26343-26696 | |||
| 1518 | JAEMBM010000008.1 | GCA021406705_00537 | gene | open | 26722-27150 | |||
| 1519 | JAEMBM010000008.1 | GCA021406705_00538 | gene | open | 27134-27916 | |||
| 1520 | JAEMBM010000008.1 | GCA021406705_00539 | gene | open | 28726-29124 | mobA | ||
| 1521 | JAEMBM010000008.1 | GCA021406705_00540 | gene | open | 29109-30338 | mobB | ||
| 1522 | JAEMBM010000008.1 | GCA021406705_00541 | gene | open | 30354-32366 | virD4 | ||
| 1523 | JAEMBM010000008.1 | GCA021406705_00542 | gene | open | 32432-32875 | |||
| 1524 | JAEMBM010000008.1 | GCA021406705_00543 | gene | open | 32932-33291 | rteC | ||
| 1525 | JAEMBM010000008.1 | GCA021406705_00544 | gene | open | 33278-33532 | |||
| 1526 | JAEMBM010000008.1 | GCA021406705_00545 | gene | open | 33582-34076 | |||
| 1527 | JAEMBM010000008.1 | GCA021406705_00546 | gene | open | 34078-36261 | |||
| 1528 | JAEMBM010000008.1 | GCA021406705_00547 | gene | open | 36418-38703 | |||
| 1529 | JAEMBM010000008.1 | GCA021406705_00548 | gene | open | 38700-39998 | |||
| 1530 | JAEMBM010000008.1 | GCA021406705_00549 | gene | open | 40063-40257 | |||
| 1531 | JAEMBM010000008.1 | GCA021406705_00550 | gene | open | 40505-40864 | |||
| 1532 | JAEMBM010000008.1 | GCA021406705_00551 | gene | open | 40861-41658 | |||
| 1533 | JAEMBM010000008.1 | GCA021406705_00552 | gene | open | 41671-42249 | tetR | ||
| 1534 | JAEMBM010000008.1 | GCA021406705_00553 | gene | open | 42503-43897 | |||
| 1535 | JAEMBM010000008.1 | GCA021406705_00554 | gene | open | 43932-46061 | |||
| 1536 | JAEMBM010000008.1 | GCA021406705_00555 | gene | open | 46336-46767 | |||
| 1537 | JAEMBM010000008.1 | GCA021406705_00556 | gene | open | 46754-52246 | |||
| 1538 | JAEMBM010000008.1 | GCA021406705_00557 | gene | open | 52351-52668 | |||
| 1539 | JAEMBM010000008.1 | GCA021406705_00558 | gene | open | 52652-53005 | |||
| 1540 | JAEMBM010000008.1 | GCA021406705_00559 | gene | open | 53227-53505 | |||
| 1541 | JAEMBM010000008.1 | GCA021406705_00560 | gene | open | 53542-53844 | |||
| 1542 | JAEMBM010000008.1 | GCA021406705_00561 | gene | open | 53894-54256 | |||
| 1543 | JAEMBM010000008.1 | GCA021406705_00562 | gene | open | 54274-55509 | xerD | ||
| 1544 | JAEMBM010000008.1 | GCA021406705_00563 | gene | open | 55817-56554 | |||
| 1545 | JAEMBM010000008.1 | GCA021406705_00564 | gene | open | 56665-56799 | |||
| 1546 | JAEMBM010000008.1 | GCA021406705_00565 | gene | open | 56792-57454 | |||
| 1547 | JAEMBM010000008.1 | GCA021406705_00566 | gene | open | 58244-58447 | |||
| 1548 | JAEMBM010000008.1 | GCA021406705_00567 | gene | open | 58441-59787 | |||
| 1549 | JAEMBM010000008.1 | GCA021406705_00568 | gene | open | 60021-61340 | cobB | ||
| 1550 | JAEMBM010000008.1 | GCA021406705_00569 | gene | open | 61363-61929 | pduO | ||
| 1551 | JAEMBM010000008.1 | GCA021406705_00570 | gene | open | 61926-63422 | |||
| 1552 | JAEMBM010000008.1 | GCA021406705_00571 | gene | open | 63415-64422 | cobD | ||
| 1553 | JAEMBM010000008.1 | GCA021406705_00572 | gene | open | 64397-65452 | cbiB | ||
| 1554 | JAEMBM010000008.1 | GCA021406705_00573 | gene | open | 65885-66337 | rsuA | ||
| 1555 | JAEMBM010000008.1 | GCA021406705_00574 | gene | open | 66321-67376 | rfaF | ||
| 1556 | JAEMBM010000008.1 | GCA021406705_00575 | gene | open | 67460-68065 | |||
| 1557 | JAEMBM010000008.1 | GCA021406705_00576 | gene | open | 68225-68635 | |||
| 1558 | JAEMBM010000008.1 | GCA021406705_00577 | gene | open | 68774-69922 | yqdH | ||
| 1559 | JAEMBM010000008.1 | GCA021406705_00578 | gene | open | 70147-71235 | rfaB | ||
| 1560 | JAEMBM010000008.1 | GCA021406705_00579 | gene | open | 71396-71614 | |||
| 1561 | JAEMBM010000008.1 | GCA021406705_00580 | gene | open | 73397-73627 | |||
| 1562 | JAEMBM010000008.1 | GCA021406705_00581 | gene | open | 73640-73822 | |||
| 1563 | JAEMBM010000009.1 | regulatory_region | open | 4016-4228 | Cobalamin riboswitch aptamer | |||
| 1564 | JAEMBM010000009.1 | GCA021406705_01835 | CDS | open | 232-2835 | _na 867_aa | btuB | TonB-dependent receptor plug domain-containing protein |
| 1565 | JAEMBM010000009.1 | GCA021406705_01836 | CDS | open | 3592-3894 | _na 100_aa | hypothetical protein | |
| 1566 | JAEMBM010000009.1 | GCA021406705_01837 | CDS | open | 4753-6432 | _na 559_aa | ybjL | putative transporter |
| 1567 | JAEMBM010000009.1 | GCA021406705_01838 | CDS | open | 6525-7040 | _na 171_aa | GyrI-like small molecule binding domain-containing protein | |
| 1568 | JAEMBM010000009.1 | GCA021406705_01839 | CDS | open | 7037-8002 | _na 321_aa | czcD | Heavy metal efflux pump%2C CzcD family |
| 1569 | JAEMBM010000009.1 | GCA021406705_01840 | CDS | open | 8058-8801 | _na 247_aa | hypothetical protein | |
| 1570 | JAEMBM010000009.1 | GCA021406705_01841 | CDS | open | 9060-9239 | _na 59_aa | hypothetical protein | |
| 1571 | JAEMBM010000009.1 | GCA021406705_01842 | CDS | open | 9296-12151 | _na 951_aa | lptD | LPS-assembly protein LptD central domain-containing protein |
| 1572 | JAEMBM010000009.1 | GCA021406705_01843 | CDS | open | 12178-12900 | _na 240_aa | glpG | Rhomboid family protein |
| 1573 | JAEMBM010000009.1 | GCA021406705_01844 | CDS | open | 12884-13798 | _na 304_aa | glpG | Rhomboid family intramembrane serine protease |
| 1574 | JAEMBM010000009.1 | GCA021406705_01845 | CDS | open | 13795-14940 | _na 381_aa | elsH | Endonuclease/exonuclease/phosphatase domain-containing protein |
| 1575 | JAEMBM010000009.1 | GCA021406705_01846 | CDS | open | 15193-16572 | _na 459_aa | tnaA | Beta-eliminating lyase |
| 1576 | JAEMBM010000009.1 | GCA021406705_01847 | CDS | open | 16827-17063 | _na 78_aa | IS5/IS1182 family transposase | |
| 1577 | JAEMBM010000009.1 | GCA021406705_01848 | CDS | open | 18283-19800 | _na 505_aa | purH | bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase |
| 1578 | JAEMBM010000009.1 | GCA021406705_01849 | CDS | open | 19903-20922 | _na 339_aa | mreB | Cell shape-determining protein MreB |
| 1579 | JAEMBM010000009.1 | GCA021406705_01850 | CDS | open | 20960-21847 | _na 295_aa | mreC | rod shape-determining protein MreC |
| 1580 | JAEMBM010000009.1 | GCA021406705_01851 | CDS | open | 21847-22365 | _na 172_aa | mreD | rod shape-determining protein MreD |
| 1581 | JAEMBM010000009.1 | GCA021406705_01852 | CDS | open | 22358-24223 | _na 621_aa | mrdA | penicillin-binding protein 2 |
| 1582 | JAEMBM010000009.1 | GCA021406705_01853 | CDS | open | 24213-25670 | _na 485_aa | ftsW | Rod shape-determining protein RodA |
| 1583 | JAEMBM010000009.1 | GCA021406705_01854 | CDS | open | 25698-26909 | _na 403_aa | Glycosyltransferase RgtA/B/C/D-like domain-containing protein | |
| 1584 | JAEMBM010000009.1 | GCA021406705_01855 | CDS | open | 27301-27759 | _na 152_aa | hupA | Histidinol phosphate aminotransferase |
| 1585 | JAEMBM010000009.1 | GCA021406705_01856 | CDS | open | 27824-28534 | _na 236_aa | DUF3256 domain-containing protein | |
| 1586 | JAEMBM010000009.1 | GCA021406705_01857 | CDS | open | 28571-29497 | _na 308_aa | Chromosome segregation protein SMC | |
| 1587 | JAEMBM010000009.1 | GCA021406705_01858 | CDS | open | 29681-32260 | _na 859_aa | gyrA | DNA gyrase subunit A |
| 1588 | JAEMBM010000009.1 | GCA021406705_01859 | CDS | open | 32294-33496 | _na 400_aa | bepA | Tetratricopeptide repeat protein |
| 1589 | JAEMBM010000009.1 | GCA021406705_01860 | CDS | open | 33934-34572 | _na 212_aa | rhtB | Amino acid exporter%2C putative |
| 1590 | JAEMBM010000009.1 | GCA021406705_01861 | CDS | open | 34771-35820 | _na 349_aa | Porin | |
| 1591 | JAEMBM010000009.1 | GCA021406705_01862 | CDS | open | 35870-36619 | _na 249_aa | tauC | putative ABC transporter permease protein |
| 1592 | JAEMBM010000009.1 | GCA021406705_01863 | CDS | open | 36616-37314 | _na 232_aa | tauB | ABC transporter%2C ATP-binding protein |
| 1593 | JAEMBM010000009.1 | GCA021406705_01864 | CDS | open | 37366-38385 | _na 339_aa | tauA | SsuA/THI5-like domain-containing protein |
| 1594 | JAEMBM010000009.1 | GCA021406705_01865 | CDS | open | 38431-39576 | _na 381_aa | mutY | A/G-specific adenine glycosylase |
| 1595 | JAEMBM010000009.1 | GCA021406705_01866 | CDS | open | 39895-40665 | _na 256_aa | Peptidase C39-like domain-containing protein | |
| 1596 | JAEMBM010000009.1 | GCA021406705_01867 | CDS | open | 41813-43099 | _na 428_aa | cTD-A | Secretion system C-terminal sorting domain-containing protein |
| 1597 | JAEMBM010000009.1 | GCA021406705_01868 | CDS | open | 42962-43246 | _na 94_aa | hypothetical protein | |
| 1598 | JAEMBM010000009.1 | GCA021406705_01869 | CDS | open | 43276-43551 | _na 91_aa | hypothetical protein | |
| 1599 | JAEMBM010000009.1 | GCA021406705_01870 | CDS | open | 43630-45051 | _na 473_aa | Anaphase-promoting protein | |
| 1600 | JAEMBM010000009.1 | GCA021406705_01871 | CDS | open | 45122-46000 | _na 292_aa | udp | Uridine phosphorylase |
| 1601 | JAEMBM010000009.1 | GCA021406705_01872 | CDS | open | 46123-47859 | _na 578_aa | lysS | lysine--tRNA ligase |
| 1602 | JAEMBM010000009.1 | GCA021406705_01873 | CDS | open | 47945-48949 | _na 334_aa | gpsA | Glycerol-3-phosphate dehydrogenase |
| 1603 | JAEMBM010000009.1 | GCA021406705_01874 | CDS | open | 48982-50319 | _na 445_aa | pgi | glucose-6-phosphate isomerase |
| 1604 | JAEMBM010000009.1 | GCA021406705_01875 | CDS | open | 50339-50941 | _na 200_aa | DUF4290 domain-containing protein | |
| 1605 | JAEMBM010000009.1 | GCA021406705_01876 | CDS | open | 50972-52276 | _na 434_aa | murA | UDP-N-acetylglucosamine 1-carboxyvinyltransferase |
| 1606 | JAEMBM010000009.1 | GCA021406705_01877 | CDS | open | 52283-52810 | _na 175_aa | rimM | ribosome maturation factor RimM |
| 1607 | JAEMBM010000009.1 | GCA021406705_01878 | CDS | open | 52807-53964 | _na 385_aa | dxr | 1-deoxy-D-xylulose-5-phosphate reductoisomerase |
| 1608 | JAEMBM010000009.1 | GCA021406705_01879 | CDS | open | 53977-54120 | _na 47_aa | hypothetical protein | |
| 1609 | JAEMBM010000009.1 | GCA021406705_01880 | CDS | open | 54761-56215 | _na 484_aa | rlmL | THUMP domain-containing protein |
| 1610 | JAEMBM010000009.1 | GCA021406705_01881 | CDS | open | 56247-58445 | _na 732_aa | ptpA | Prolyl tripeptidyl peptidase |
| 1611 | JAEMBM010000009.1 | GCA021406705_01882 | CDS | open | 58442-59737 | _na 431_aa | purD | Phosphoribosylamine--glycine ligase |
| 1612 | JAEMBM010000009.1 | GCA021406705_01883 | CDS | open | 59803-60711 | _na 302_aa | Glycosyltransferase RgtA/B/C/D-like domain-containing protein | |
| 1613 | JAEMBM010000009.1 | GCA021406705_01884 | CDS | open | 61031-61711 | _na 226_aa | [ribosomal protein uS5]-alanine N-acetyltransferase | |
| 1614 | JAEMBM010000009.1 | GCA021406705_01885 | CDS | open | 61906-62037 | _na 43_aa | hypothetical protein | |
| 1615 | JAEMBM010000009.1 | GCA021406705_01835 | gene | open | 232-2835 | btuB | ||
| 1616 | JAEMBM010000009.1 | GCA021406705_01836 | gene | open | 3592-3894 | |||
| 1617 | JAEMBM010000009.1 | GCA021406705_01837 | gene | open | 4753-6432 | ybjL | ||
| 1618 | JAEMBM010000009.1 | GCA021406705_01838 | gene | open | 6525-7040 | |||
| 1619 | JAEMBM010000009.1 | GCA021406705_01839 | gene | open | 7037-8002 | czcD | ||
| 1620 | JAEMBM010000009.1 | GCA021406705_01840 | gene | open | 8058-8801 | |||
| 1621 | JAEMBM010000009.1 | GCA021406705_01841 | gene | open | 9060-9239 | |||
| 1622 | JAEMBM010000009.1 | GCA021406705_01842 | gene | open | 9296-12151 | lptD | ||
| 1623 | JAEMBM010000009.1 | GCA021406705_01843 | gene | open | 12178-12900 | glpG | ||
| 1624 | JAEMBM010000009.1 | GCA021406705_01844 | gene | open | 12884-13798 | glpG | ||
| 1625 | JAEMBM010000009.1 | GCA021406705_01845 | gene | open | 13795-14940 | elsH | ||
| 1626 | JAEMBM010000009.1 | GCA021406705_01846 | gene | open | 15193-16572 | tnaA | ||
| 1627 | JAEMBM010000009.1 | GCA021406705_01847 | gene | open | 16827-17063 | |||
| 1628 | JAEMBM010000009.1 | GCA021406705_01848 | gene | open | 18283-19800 | purH | ||
| 1629 | JAEMBM010000009.1 | GCA021406705_01849 | gene | open | 19903-20922 | mreB | ||
| 1630 | JAEMBM010000009.1 | GCA021406705_01850 | gene | open | 20960-21847 | mreC | ||
| 1631 | JAEMBM010000009.1 | GCA021406705_01851 | gene | open | 21847-22365 | mreD | ||
| 1632 | JAEMBM010000009.1 | GCA021406705_01852 | gene | open | 22358-24223 | mrdA | ||
| 1633 | JAEMBM010000009.1 | GCA021406705_01853 | gene | open | 24213-25670 | ftsW | ||
| 1634 | JAEMBM010000009.1 | GCA021406705_01854 | gene | open | 25698-26909 | |||
| 1635 | JAEMBM010000009.1 | GCA021406705_01855 | gene | open | 27301-27759 | hupA | ||
| 1636 | JAEMBM010000009.1 | GCA021406705_01856 | gene | open | 27824-28534 | |||
| 1637 | JAEMBM010000009.1 | GCA021406705_01857 | gene | open | 28571-29497 | |||
| 1638 | JAEMBM010000009.1 | GCA021406705_01858 | gene | open | 29681-32260 | gyrA | ||
| 1639 | JAEMBM010000009.1 | GCA021406705_01859 | gene | open | 32294-33496 | bepA | ||
| 1640 | JAEMBM010000009.1 | GCA021406705_01860 | gene | open | 33934-34572 | rhtB | ||
| 1641 | JAEMBM010000009.1 | GCA021406705_01861 | gene | open | 34771-35820 | |||
| 1642 | JAEMBM010000009.1 | GCA021406705_01862 | gene | open | 35870-36619 | tauC | ||
| 1643 | JAEMBM010000009.1 | GCA021406705_01863 | gene | open | 36616-37314 | tauB | ||
| 1644 | JAEMBM010000009.1 | GCA021406705_01864 | gene | open | 37366-38385 | tauA | ||
| 1645 | JAEMBM010000009.1 | GCA021406705_01865 | gene | open | 38431-39576 | mutY | ||
| 1646 | JAEMBM010000009.1 | GCA021406705_01866 | gene | open | 39895-40665 | |||
| 1647 | JAEMBM010000009.1 | GCA021406705_01867 | gene | open | 41813-43099 | cTD-A | ||
| 1648 | JAEMBM010000009.1 | GCA021406705_01868 | gene | open | 42962-43246 | |||
| 1649 | JAEMBM010000009.1 | GCA021406705_01869 | gene | open | 43276-43551 | |||
| 1650 | JAEMBM010000009.1 | GCA021406705_01870 | gene | open | 43630-45051 | |||
| 1651 | JAEMBM010000009.1 | GCA021406705_01871 | gene | open | 45122-46000 | udp | ||
| 1652 | JAEMBM010000009.1 | GCA021406705_01872 | gene | open | 46123-47859 | lysS | ||
| 1653 | JAEMBM010000009.1 | GCA021406705_01873 | gene | open | 47945-48949 | gpsA | ||
| 1654 | JAEMBM010000009.1 | GCA021406705_01874 | gene | open | 48982-50319 | pgi | ||
| 1655 | JAEMBM010000009.1 | GCA021406705_01875 | gene | open | 50339-50941 | |||
| 1656 | JAEMBM010000009.1 | GCA021406705_01876 | gene | open | 50972-52276 | murA | ||
| 1657 | JAEMBM010000009.1 | GCA021406705_01877 | gene | open | 52283-52810 | rimM | ||
| 1658 | JAEMBM010000009.1 | GCA021406705_01878 | gene | open | 52807-53964 | dxr | ||
| 1659 | JAEMBM010000009.1 | GCA021406705_01879 | gene | open | 53977-54120 | |||
| 1660 | JAEMBM010000009.1 | GCA021406705_01880 | gene | open | 54761-56215 | rlmL | ||
| 1661 | JAEMBM010000009.1 | GCA021406705_01881 | gene | open | 56247-58445 | ptpA | ||
| 1662 | JAEMBM010000009.1 | GCA021406705_01882 | gene | open | 58442-59737 | purD | ||
| 1663 | JAEMBM010000009.1 | GCA021406705_01883 | gene | open | 59803-60711 | |||
| 1664 | JAEMBM010000009.1 | GCA021406705_01884 | gene | open | 61031-61711 | |||
| 1665 | JAEMBM010000009.1 | GCA021406705_01885 | gene | open | 61906-62037 | |||
| 1666 | JAEMBM010000010.1 | GCA021406705_00829 | CDS | open | 4-384 | _na 126_aa | tnp | IS3 family ISPg5 transposase ORF A |
| 1667 | JAEMBM010000010.1 | GCA021406705_00831 | CDS | open | 807-992 | _na 61_aa | hypothetical protein | |
| 1668 | JAEMBM010000010.1 | GCA021406705_00832 | CDS | open | 1019-1918 | _na 299_aa | traB | TraB/GumN family protein |
| 1669 | JAEMBM010000010.1 | GCA021406705_00833 | CDS | open | 1955-2701 | _na 248_aa | rsmE | 16S rRNA (uracil(1498)-N(3))-methyltransferase |
| 1670 | JAEMBM010000010.1 | GCA021406705_00834 | CDS | open | 3047-4048 | _na 333_aa | iap | putative leucine aminopeptidase |
| 1671 | JAEMBM010000010.1 | GCA021406705_00835 | CDS | open | 4072-4497 | _na 141_aa | sufE | Fe-S metabolism associated domain-containing protein |
| 1672 | JAEMBM010000010.1 | GCA021406705_00836 | CDS | open | 4501-5898 | _na 465_aa | hemG | protoporphyrinogen oxidase |
| 1673 | JAEMBM010000010.1 | GCA021406705_00837 | CDS | open | 6748-7647 | _na 299_aa | araC | HTH araC/xylS-type domain-containing protein |
| 1674 | JAEMBM010000010.1 | GCA021406705_00838 | CDS | open | 7644-8795 | _na 383_aa | lpxB | lipid-A-disaccharide synthase |
| 1675 | JAEMBM010000010.1 | GCA021406705_00839 | CDS | open | 8832-9602 | _na 256_aa | surE | 5'/3'-nucleotidase SurE |
| 1676 | JAEMBM010000010.1 | GCA021406705_00840 | CDS | open | 9599-10156 | _na 185_aa | fkpA | Peptidyl-prolyl cis-trans isomerase |
| 1677 | JAEMBM010000010.1 | GCA021406705_00841 | CDS | open | 10153-11700 | _na 515_aa | gRS1 | glycine--tRNA ligase |
| 1678 | JAEMBM010000010.1 | GCA021406705_00842 | CDS | open | 11902-12141 | _na 79_aa | hypothetical protein | |
| 1679 | JAEMBM010000010.1 | GCA021406705_00843 | CDS | open | 12164-13603 | _na 479_aa | ompA | OmpA-like domain-containing protein |
| 1680 | JAEMBM010000010.1 | GCA021406705_00844 | CDS | open | 13644-14237 | _na 197_aa | DUF3575 domain-containing protein | |
| 1681 | JAEMBM010000010.1 | GCA021406705_00845 | CDS | open | 14617-14886 | _na 89_aa | DNA-binding protein | |
| 1682 | JAEMBM010000010.1 | GCA021406705_00846 | CDS | open | 15160-16449 | _na 429_aa | fucP | Putative transmembrane glucose/galactose transporter |
| 1683 | JAEMBM010000010.1 | GCA021406705_00847 | CDS | open | 16488-17447 | _na 319_aa | ldhA | D-isomer specific 2-hydroxyacid dehydrogenase family protein |
| 1684 | JAEMBM010000010.1 | GCA021406705_00848 | CDS | open | 17666-18388 | _na 240_aa | T9SS C-terminal target domain-containing protein | |
| 1685 | JAEMBM010000010.1 | GCA021406705_00849 | CDS | open | 18412-19284 | _na 290_aa | omp28 | outer membrane lipoprotein Omp28 |
| 1686 | JAEMBM010000010.1 | GCA021406705_00850 | CDS | open | 19304-21049 | _na 581_aa | DUF5723 domain-containing protein | |
| 1687 | JAEMBM010000010.1 | GCA021406705_00851 | CDS | open | 21105-21587 | _na 160_aa | bcp | Thioredoxin domain-containing protein |
| 1688 | JAEMBM010000010.1 | GCA021406705_00853 | CDS | open | 22518-23756 | _na 412_aa | nqrF | NADH:ubiquinone reductase (Na(+)-transporting) subunit F |
| 1689 | JAEMBM010000010.1 | GCA021406705_00854 | CDS | open | 23775-24389 | _na 204_aa | nqrE | NADH:ubiquinone reductase (Na(+)-transporting) subunit E |
| 1690 | JAEMBM010000010.1 | GCA021406705_00855 | CDS | open | 24429-25058 | _na 209_aa | nqrD | NADH:ubiquinone reductase (Na(+)-transporting) subunit D |
| 1691 | JAEMBM010000010.1 | GCA021406705_00856 | CDS | open | 25064-25798 | _na 244_aa | nqrC | Na(+)-translocating NADH-quinone reductase subunit C |
| 1692 | JAEMBM010000010.1 | GCA021406705_00857 | CDS | open | 25822-27021 | _na 399_aa | nqrB | NADH:ubiquinone reductase (Na(+)-transporting) subunit B |
| 1693 | JAEMBM010000010.1 | GCA021406705_00858 | CDS | open | 27052-28407 | _na 451_aa | nqrA | NADH:ubiquinone reductase (Na(+)-transporting) subunit A |
| 1694 | JAEMBM010000010.1 | GCA021406705_00859 | CDS | open | 29184-30500 | _na 438_aa | mecR1 | Putative TonB |
| 1695 | JAEMBM010000010.1 | GCA021406705_00860 | CDS | open | 30535-30915 | _na 126_aa | copY | Transcriptional regulator%2C putative |
| 1696 | JAEMBM010000010.1 | GCA021406705_00861 | CDS | open | 31007-31894 | _na 295_aa | menA | 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase |
| 1697 | JAEMBM010000010.1 | GCA021406705_00862 | CDS | open | 31884-33077 | _na 397_aa | lysA | diaminopimelate decarboxylase |
| 1698 | JAEMBM010000010.1 | GCA021406705_00863 | CDS | open | 33061-34401 | _na 446_aa | metL1 | Aspartokinase |
| 1699 | JAEMBM010000010.1 | GCA021406705_00864 | CDS | open | 34419-35159 | _na 246_aa | ftsE | Cell-division ATP-binding protein |
| 1700 | JAEMBM010000010.1 | GCA021406705_00865 | CDS | open | 35229-35423 | _na 64_aa | hypothetical protein | |
| 1701 | JAEMBM010000010.1 | GCA021406705_00866 | CDS | open | 35551-36564 | _na 337_aa | lysM | Peptidase M24 |
| 1702 | JAEMBM010000010.1 | GCA021406705_00867 | CDS | open | 37045-38148 | _na 367_aa | ychF | redox-regulated ATPase YchF |
| 1703 | JAEMBM010000010.1 | GCA021406705_00868 | CDS | open | 38352-40373 | _na 673_aa | ftsH | ATP-dependent zinc metalloprotease FtsH |
| 1704 | JAEMBM010000010.1 | GCA021406705_00869 | CDS | open | 40402-41256 | _na 284_aa | cdsA | Phosphatidate cytidylyltransferase |
| 1705 | JAEMBM010000010.1 | GCA021406705_00870 | CDS | open | 41439-43493 | _na 684_aa | htpG | molecular chaperone HtpG |
| 1706 | JAEMBM010000010.1 | GCA021406705_00871 | CDS | open | 43490-43747 | _na 85_aa | hypothetical protein | |
| 1707 | JAEMBM010000010.1 | GCA021406705_00872 | CDS | open | 44156-46489 | _na 777_aa | nahA | Beta-hexosaminidase |
| 1708 | JAEMBM010000010.1 | GCA021406705_00873 | CDS | open | 46646-47926 | _na 426_aa | glyA | Serine hydroxymethyltransferase |
| 1709 | JAEMBM010000010.1 | GCA021406705_00874 | CDS | open | 48114-48413 | _na 99_aa | hypothetical protein | |
| 1710 | JAEMBM010000010.1 | GCA021406705_00875 | CDS | open | 49158-49523 | _na 121_aa | rplS | 50S ribosomal protein L19 |
| 1711 | JAEMBM010000010.1 | GCA021406705_00876 | CDS | open | 49808-53494 | _na 1228_aa | dnaE | DNA polymerase III subunit alpha |
| 1712 | JAEMBM010000010.1 | GCA021406705_00877 | CDS | open | 53543-53857 | _na 104_aa | trxA | thioredoxin |
| 1713 | JAEMBM010000010.1 | GCA021406705_00878 | CDS | open | 54577-55875 | _na 432_aa | rmuC | DNA recombination protein RmuC |
| 1714 | JAEMBM010000010.1 | GCA021406705_00879 | CDS | open | 55905-58490 | _na 861_aa | lacZ | beta-mannosidase |
| 1715 | JAEMBM010000010.1 | GCA021406705_00829 | gene | open | 4-384 | tnp | ||
| 1716 | JAEMBM010000010.1 | GCA021406705_00831 | gene | open | 807-992 | |||
| 1717 | JAEMBM010000010.1 | GCA021406705_00832 | gene | open | 1019-1918 | traB | ||
| 1718 | JAEMBM010000010.1 | GCA021406705_00833 | gene | open | 1955-2701 | rsmE | ||
| 1719 | JAEMBM010000010.1 | GCA021406705_00834 | gene | open | 3047-4048 | iap | ||
| 1720 | JAEMBM010000010.1 | GCA021406705_00835 | gene | open | 4072-4497 | sufE | ||
| 1721 | JAEMBM010000010.1 | GCA021406705_00836 | gene | open | 4501-5898 | hemG | ||
| 1722 | JAEMBM010000010.1 | GCA021406705_00837 | gene | open | 6748-7647 | araC | ||
| 1723 | JAEMBM010000010.1 | GCA021406705_00838 | gene | open | 7644-8795 | lpxB | ||
| 1724 | JAEMBM010000010.1 | GCA021406705_00839 | gene | open | 8832-9602 | surE | ||
| 1725 | JAEMBM010000010.1 | GCA021406705_00840 | gene | open | 9599-10156 | fkpA | ||
| 1726 | JAEMBM010000010.1 | GCA021406705_00841 | gene | open | 10153-11700 | gRS1 | ||
| 1727 | JAEMBM010000010.1 | GCA021406705_00842 | gene | open | 11902-12141 | |||
| 1728 | JAEMBM010000010.1 | GCA021406705_00843 | gene | open | 12164-13603 | ompA | ||
| 1729 | JAEMBM010000010.1 | GCA021406705_00844 | gene | open | 13644-14237 | |||
| 1730 | JAEMBM010000010.1 | GCA021406705_00845 | gene | open | 14617-14886 | |||
| 1731 | JAEMBM010000010.1 | GCA021406705_00846 | gene | open | 15160-16449 | fucP | ||
| 1732 | JAEMBM010000010.1 | GCA021406705_00847 | gene | open | 16488-17447 | ldhA | ||
| 1733 | JAEMBM010000010.1 | GCA021406705_00848 | gene | open | 17666-18388 | |||
| 1734 | JAEMBM010000010.1 | GCA021406705_00849 | gene | open | 18412-19284 | omp28 | ||
| 1735 | JAEMBM010000010.1 | GCA021406705_00850 | gene | open | 19304-21049 | |||
| 1736 | JAEMBM010000010.1 | GCA021406705_00851 | gene | open | 21105-21587 | bcp | ||
| 1737 | JAEMBM010000010.1 | GCA021406705_00853 | gene | open | 22518-23756 | nqrF | ||
| 1738 | JAEMBM010000010.1 | GCA021406705_00854 | gene | open | 23775-24389 | nqrE | ||
| 1739 | JAEMBM010000010.1 | GCA021406705_00855 | gene | open | 24429-25058 | nqrD | ||
| 1740 | JAEMBM010000010.1 | GCA021406705_00856 | gene | open | 25064-25798 | nqrC | ||
| 1741 | JAEMBM010000010.1 | GCA021406705_00857 | gene | open | 25822-27021 | nqrB | ||
| 1742 | JAEMBM010000010.1 | GCA021406705_00858 | gene | open | 27052-28407 | nqrA | ||
| 1743 | JAEMBM010000010.1 | GCA021406705_00859 | gene | open | 29184-30500 | mecR1 | ||
| 1744 | JAEMBM010000010.1 | GCA021406705_00860 | gene | open | 30535-30915 | copY | ||
| 1745 | JAEMBM010000010.1 | GCA021406705_00861 | gene | open | 31007-31894 | menA | ||
| 1746 | JAEMBM010000010.1 | GCA021406705_00862 | gene | open | 31884-33077 | lysA | ||
| 1747 | JAEMBM010000010.1 | GCA021406705_00863 | gene | open | 33061-34401 | metL1 | ||
| 1748 | JAEMBM010000010.1 | GCA021406705_00864 | gene | open | 34419-35159 | ftsE | ||
| 1749 | JAEMBM010000010.1 | GCA021406705_00865 | gene | open | 35229-35423 | |||
| 1750 | JAEMBM010000010.1 | GCA021406705_00866 | gene | open | 35551-36564 | lysM | ||
| 1751 | JAEMBM010000010.1 | GCA021406705_00867 | gene | open | 37045-38148 | ychF | ||
| 1752 | JAEMBM010000010.1 | GCA021406705_00868 | gene | open | 38352-40373 | ftsH | ||
| 1753 | JAEMBM010000010.1 | GCA021406705_00869 | gene | open | 40402-41256 | cdsA | ||
| 1754 | JAEMBM010000010.1 | GCA021406705_00870 | gene | open | 41439-43493 | htpG | ||
| 1755 | JAEMBM010000010.1 | GCA021406705_00871 | gene | open | 43490-43747 | |||
| 1756 | JAEMBM010000010.1 | GCA021406705_00872 | gene | open | 44156-46489 | nahA | ||
| 1757 | JAEMBM010000010.1 | GCA021406705_00873 | gene | open | 46646-47926 | glyA | ||
| 1758 | JAEMBM010000010.1 | GCA021406705_00874 | gene | open | 48114-48413 | |||
| 1759 | JAEMBM010000010.1 | GCA021406705_00875 | gene | open | 49158-49523 | rplS | ||
| 1760 | JAEMBM010000010.1 | GCA021406705_00876 | gene | open | 49808-53494 | dnaE | ||
| 1761 | JAEMBM010000010.1 | GCA021406705_00877 | gene | open | 53543-53857 | trxA | ||
| 1762 | JAEMBM010000010.1 | GCA021406705_00878 | gene | open | 54577-55875 | rmuC | ||
| 1763 | JAEMBM010000010.1 | GCA021406705_00879 | gene | open | 55905-58490 | lacZ | ||
| 1764 | JAEMBM010000010.1 | GCA021406705_00830 | gene | open | 612-684 | trnP | ||
| 1765 | JAEMBM010000010.1 | GCA021406705_00852 | gene | open | 22113-22184 | trnfM | ||
| 1766 | JAEMBM010000010.1 | GCA021406705_00830 | tRNA | open | 612-684 | trnP | tRNA-Pro(cgg) | |
| 1767 | JAEMBM010000010.1 | GCA021406705_00852 | tRNA | open | 22113-22184 | trnfM | tRNA-fMet(cat) | |
| 1768 | JAEMBM010000011.1 | repeat_region | open | 56776-58122 | CRISPR array with 18 repeats of length 46%2C consensus sequence ACTGGGAATAGCTTTCAGATTTAGTATTTTTGTTGCAACGCACAGC and spacer length 29 | |||
| 1769 | JAEMBM010000011.1 | GCA021406705_00001 | CDS | open | 456-1397 | _na 313_aa | yrpB | Enoyl-(Acyl-carrier-protein) reductase II |
| 1770 | JAEMBM010000011.1 | GCA021406705_00002 | CDS | open | 1313-1618 | _na 101_aa | hypothetical protein | |
| 1771 | JAEMBM010000011.1 | GCA021406705_00003 | CDS | open | 1697-3343 | _na 548_aa | ttdA | Fumarate hydratase class I |
| 1772 | JAEMBM010000011.1 | GCA021406705_00004 | CDS | open | 3466-5274 | _na 602_aa | dnaX | DNA polymerase III subunit gamma/tau |
| 1773 | JAEMBM010000011.1 | GCA021406705_00005 | CDS | open | 5711-5881 | _na 56_aa | Ferredoxin | |
| 1774 | JAEMBM010000011.1 | GCA021406705_00006 | CDS | open | 5865-6074 | _na 69_aa | hypothetical protein | |
| 1775 | JAEMBM010000011.1 | GCA021406705_00007 | CDS | open | 6215-7735 | _na 506_aa | dacB | D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase |
| 1776 | JAEMBM010000011.1 | GCA021406705_00008 | CDS | open | 7957-9627 | _na 556_aa | cTD-A | peptidylarginine deiminase PPAD |
| 1777 | JAEMBM010000011.1 | GCA021406705_00009 | CDS | open | 10958-13489 | _na 843_aa | cTD-A | Thiol protease/hemagglutinin PrtT%2C putative |
| 1778 | JAEMBM010000011.1 | GCA021406705_00010 | CDS | open | 13629-14114 | _na 161_aa | ribH | 6%2C7-dimethyl-8-ribityllumazine synthase |
| 1779 | JAEMBM010000011.1 | GCA021406705_00011 | CDS | open | 14206-14892 | _na 228_aa | cpoB | TPR domain protein |
| 1780 | JAEMBM010000011.1 | GCA021406705_00012 | CDS | open | 15078-15761 | _na 227_aa | citB | FimR protein |
| 1781 | JAEMBM010000011.1 | GCA021406705_00013 | CDS | open | 15774-17486 | _na 570_aa | pilF | histidine kinase |
| 1782 | JAEMBM010000011.1 | GCA021406705_00014 | CDS | open | 17426-17635 | _na 69_aa | hypothetical protein | |
| 1783 | JAEMBM010000011.1 | GCA021406705_00015 | CDS | open | 17971-18165 | _na 64_aa | xseB | exodeoxyribonuclease VII small subunit |
| 1784 | JAEMBM010000011.1 | GCA021406705_00016 | CDS | open | 18162-18830 | _na 222_aa | ispD | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase |
| 1785 | JAEMBM010000011.1 | GCA021406705_00018 | CDS | open | 20253-21080 | _na 275_aa | ftsX | Cell division protein FtsX |
| 1786 | JAEMBM010000011.1 | GCA021406705_00019 | CDS | open | 21127-21354 | _na 75_aa | DUF3098 domain-containing protein | |
| 1787 | JAEMBM010000011.1 | GCA021406705_00020 | CDS | open | 21462-22304 | _na 280_aa | uppP | undecaprenyl-diphosphate phosphatase |
| 1788 | JAEMBM010000011.1 | GCA021406705_00021 | CDS | open | 22314-23090 | _na 258_aa | truB | tRNA pseudouridine(55) synthase TruB |
| 1789 | JAEMBM010000011.1 | GCA021406705_00022 | CDS | open | 23108-24160 | _na 350_aa | queA | tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA |
| 1790 | JAEMBM010000011.1 | GCA021406705_00023 | CDS | open | 24163-24606 | _na 147_aa | folK | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase |
| 1791 | JAEMBM010000011.1 | GCA021406705_00024 | CDS | open | 24610-25863 | _na 417_aa | prtC | Collagenase |
| 1792 | JAEMBM010000011.1 | GCA021406705_00025 | CDS | open | 25919-26338 | _na 139_aa | fadM | Thioesterase family protein |
| 1793 | JAEMBM010000011.1 | GCA021406705_00026 | CDS | open | 26424-27194 | _na 256_aa | yaaA | peroxide stress protein YaaA |
| 1794 | JAEMBM010000011.1 | GCA021406705_00027 | CDS | open | 27331-27906 | _na 191_aa | sodB | Superoxide dismutase [Mn/Fe] |
| 1795 | JAEMBM010000011.1 | GCA021406705_00028 | CDS | open | 28093-28446 | _na 117_aa | hypothetical protein | |
| 1796 | JAEMBM010000011.1 | GCA021406705_00030 | CDS | open | 28672-31194 | _na 840_aa | prtT | Thiol protease/hemagglutinin PrtT |
| 1797 | JAEMBM010000011.1 | GCA021406705_00031 | CDS | open | 31883-32014 | _na 43_aa | hypothetical protein | |
| 1798 | JAEMBM010000011.1 | GCA021406705_00032 | CDS | open | 32043-32693 | _na 216_aa | hmuY | HmuY protein |
| 1799 | JAEMBM010000011.1 | GCA021406705_00033 | CDS | open | 32708-34648 | _na 646_aa | hmuR | TonB-dependent receptor HmuR |
| 1800 | JAEMBM010000011.1 | GCA021406705_00034 | CDS | open | 34685-39025 | _na 1446_aa | cobN | Putative cobalamin biosynthesis-related protein |
| 1801 | JAEMBM010000011.1 | GCA021406705_00035 | CDS | open | 39022-39708 | _na 228_aa | hypothetical protein | |
| 1802 | JAEMBM010000011.1 | GCA021406705_00036 | CDS | open | 39764-40342 | _na 192_aa | tolQ | MotA/TolQ/ExbB proton channel domain-containing protein |
| 1803 | JAEMBM010000011.1 | GCA021406705_00037 | CDS | open | 40348-40674 | _na 108_aa | DUF2149 domain-containing protein | |
| 1804 | JAEMBM010000011.1 | GCA021406705_00038 | CDS | open | 41560-42648 | _na 362_aa | gcvT | glycine cleavage system aminomethyltransferase GcvT |
| 1805 | JAEMBM010000011.1 | GCA021406705_00039 | CDS | open | 42723-43787 | _na 354_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 1806 | JAEMBM010000011.1 | GCA021406705_00040 | CDS | open | 43794-44651 | _na 285_aa | rfbD | dTDP-4-dehydrorhamnose reductase |
| 1807 | JAEMBM010000011.1 | GCA021406705_00041 | CDS | open | 44648-45238 | _na 196_aa | rfbC | dTDP-4-dehydrorhamnose 3%2C5-epimerase |
| 1808 | JAEMBM010000011.1 | GCA021406705_00042 | CDS | open | 45253-46122 | _na 289_aa | rfbA | glucose-1-phosphate thymidylyltransferase RfbA |
| 1809 | JAEMBM010000011.1 | GCA021406705_00043 | CDS | open | 46237-48192 | _na 651_aa | mdoB | Sulfatase-like hydrolase/transferase |
| 1810 | JAEMBM010000011.1 | GCA021406705_00044 | CDS | open | 48277-49515 | _na 412_aa | kdtA | 3-deoxy-D-manno-octulosonic acid transferase |
| 1811 | JAEMBM010000011.1 | GCA021406705_00045 | CDS | open | 49540-51255 | _na 571_aa | gltX | glutamate--tRNA ligase |
| 1812 | JAEMBM010000011.1 | GCA021406705_00046 | CDS | open | 51398-51646 | _na 82_aa | H repeat-associated protein N-terminal domain-containing protein | |
| 1813 | JAEMBM010000011.1 | GCA021406705_00047 | CDS | open | 52216-52599 | _na 127_aa | pspE | Rhodanese domain-containing protein |
| 1814 | JAEMBM010000011.1 | GCA021406705_00048 | CDS | open | 52572-53987 | _na 471_aa | pspE | Metallo-beta-lactamase superfamily protein |
| 1815 | JAEMBM010000011.1 | GCA021406705_00049 | CDS | open | 54080-54886 | _na 268_aa | tauE | putative membrane transporter protein |
| 1816 | JAEMBM010000011.1 | GCA021406705_00050 | CDS | open | 54951-55574 | _na 207_aa | putative transcriptional regulator Crp family | |
| 1817 | JAEMBM010000011.1 | GCA021406705_00001 | gene | open | 456-1397 | yrpB | ||
| 1818 | JAEMBM010000011.1 | GCA021406705_00002 | gene | open | 1313-1618 | |||
| 1819 | JAEMBM010000011.1 | GCA021406705_00003 | gene | open | 1697-3343 | ttdA | ||
| 1820 | JAEMBM010000011.1 | GCA021406705_00004 | gene | open | 3466-5274 | dnaX | ||
| 1821 | JAEMBM010000011.1 | GCA021406705_00005 | gene | open | 5711-5881 | |||
| 1822 | JAEMBM010000011.1 | GCA021406705_00006 | gene | open | 5865-6074 | |||
| 1823 | JAEMBM010000011.1 | GCA021406705_00007 | gene | open | 6215-7735 | dacB | ||
| 1824 | JAEMBM010000011.1 | GCA021406705_00008 | gene | open | 7957-9627 | cTD-A | ||
| 1825 | JAEMBM010000011.1 | GCA021406705_00009 | gene | open | 10958-13489 | cTD-A | ||
| 1826 | JAEMBM010000011.1 | GCA021406705_00010 | gene | open | 13629-14114 | ribH | ||
| 1827 | JAEMBM010000011.1 | GCA021406705_00011 | gene | open | 14206-14892 | cpoB | ||
| 1828 | JAEMBM010000011.1 | GCA021406705_00012 | gene | open | 15078-15761 | citB | ||
| 1829 | JAEMBM010000011.1 | GCA021406705_00013 | gene | open | 15774-17486 | pilF | ||
| 1830 | JAEMBM010000011.1 | GCA021406705_00014 | gene | open | 17426-17635 | |||
| 1831 | JAEMBM010000011.1 | GCA021406705_00015 | gene | open | 17971-18165 | xseB | ||
| 1832 | JAEMBM010000011.1 | GCA021406705_00016 | gene | open | 18162-18830 | ispD | ||
| 1833 | JAEMBM010000011.1 | GCA021406705_00018 | gene | open | 20253-21080 | ftsX | ||
| 1834 | JAEMBM010000011.1 | GCA021406705_00019 | gene | open | 21127-21354 | |||
| 1835 | JAEMBM010000011.1 | GCA021406705_00020 | gene | open | 21462-22304 | uppP | ||
| 1836 | JAEMBM010000011.1 | GCA021406705_00021 | gene | open | 22314-23090 | truB | ||
| 1837 | JAEMBM010000011.1 | GCA021406705_00022 | gene | open | 23108-24160 | queA | ||
| 1838 | JAEMBM010000011.1 | GCA021406705_00023 | gene | open | 24163-24606 | folK | ||
| 1839 | JAEMBM010000011.1 | GCA021406705_00024 | gene | open | 24610-25863 | prtC | ||
| 1840 | JAEMBM010000011.1 | GCA021406705_00025 | gene | open | 25919-26338 | fadM | ||
| 1841 | JAEMBM010000011.1 | GCA021406705_00026 | gene | open | 26424-27194 | yaaA | ||
| 1842 | JAEMBM010000011.1 | GCA021406705_00027 | gene | open | 27331-27906 | sodB | ||
| 1843 | JAEMBM010000011.1 | GCA021406705_00028 | gene | open | 28093-28446 | |||
| 1844 | JAEMBM010000011.1 | GCA021406705_00030 | gene | open | 28672-31194 | prtT | ||
| 1845 | JAEMBM010000011.1 | GCA021406705_00031 | gene | open | 31883-32014 | |||
| 1846 | JAEMBM010000011.1 | GCA021406705_00032 | gene | open | 32043-32693 | hmuY | ||
| 1847 | JAEMBM010000011.1 | GCA021406705_00033 | gene | open | 32708-34648 | hmuR | ||
| 1848 | JAEMBM010000011.1 | GCA021406705_00034 | gene | open | 34685-39025 | cobN | ||
| 1849 | JAEMBM010000011.1 | GCA021406705_00035 | gene | open | 39022-39708 | |||
| 1850 | JAEMBM010000011.1 | GCA021406705_00036 | gene | open | 39764-40342 | tolQ | ||
| 1851 | JAEMBM010000011.1 | GCA021406705_00037 | gene | open | 40348-40674 | |||
| 1852 | JAEMBM010000011.1 | GCA021406705_00038 | gene | open | 41560-42648 | gcvT | ||
| 1853 | JAEMBM010000011.1 | GCA021406705_00039 | gene | open | 42723-43787 | rfbB | ||
| 1854 | JAEMBM010000011.1 | GCA021406705_00040 | gene | open | 43794-44651 | rfbD | ||
| 1855 | JAEMBM010000011.1 | GCA021406705_00041 | gene | open | 44648-45238 | rfbC | ||
| 1856 | JAEMBM010000011.1 | GCA021406705_00042 | gene | open | 45253-46122 | rfbA | ||
| 1857 | JAEMBM010000011.1 | GCA021406705_00043 | gene | open | 46237-48192 | mdoB | ||
| 1858 | JAEMBM010000011.1 | GCA021406705_00044 | gene | open | 48277-49515 | kdtA | ||
| 1859 | JAEMBM010000011.1 | GCA021406705_00045 | gene | open | 49540-51255 | gltX | ||
| 1860 | JAEMBM010000011.1 | GCA021406705_00046 | gene | open | 51398-51646 | |||
| 1861 | JAEMBM010000011.1 | GCA021406705_00047 | gene | open | 52216-52599 | pspE | ||
| 1862 | JAEMBM010000011.1 | GCA021406705_00048 | gene | open | 52572-53987 | pspE | ||
| 1863 | JAEMBM010000011.1 | GCA021406705_00049 | gene | open | 54080-54886 | tauE | ||
| 1864 | JAEMBM010000011.1 | GCA021406705_00050 | gene | open | 54951-55574 | |||
| 1865 | JAEMBM010000011.1 | GCA021406705_00017 | gene | open | 19059-19132 | trnD | ||
| 1866 | JAEMBM010000011.1 | GCA021406705_00029 | gene | open | 28451-28524 | trnR | ||
| 1867 | JAEMBM010000011.1 | GCA021406705_00017 | tRNA | open | 19059-19132 | trnD | tRNA-Asp(gtc) | |
| 1868 | JAEMBM010000011.1 | GCA021406705_00029 | tRNA | open | 28451-28524 | trnR | tRNA-Arg(tct) | |
| 1869 | JAEMBM010000012.1 | GCA021406705_00941 | CDS | open | 752-4333 | _na 1193_aa | nifJ | pyruvate:ferredoxin (flavodoxin) oxidoreductase |
| 1870 | JAEMBM010000012.1 | GCA021406705_00942 | CDS | open | 4522-5703 | _na 393_aa | AAA domain-containing protein | |
| 1871 | JAEMBM010000012.1 | GCA021406705_00943 | CDS | open | 5696-5896 | _na 66_aa | hypothetical protein | |
| 1872 | JAEMBM010000012.1 | GCA021406705_00944 | CDS | open | 6002-6316 | _na 104_aa | hypothetical protein | |
| 1873 | JAEMBM010000012.1 | GCA021406705_00945 | CDS | open | 6527-7000 | _na 157_aa | Histidinol phosphate phosphatase | |
| 1874 | JAEMBM010000012.1 | GCA021406705_00946 | CDS | open | 7045-7311 | _na 88_aa | CRISPR-associated protein Cas2 | |
| 1875 | JAEMBM010000012.1 | GCA021406705_00947 | CDS | open | 7314-7799 | _na 161_aa | hypothetical protein | |
| 1876 | JAEMBM010000012.1 | GCA021406705_00948 | CDS | open | 7893-8129 | _na 78_aa | tyrosine-type recombinase/integrase | |
| 1877 | JAEMBM010000012.1 | GCA021406705_00949 | CDS | open | 8188-8586 | _na 132_aa | Site-specific recombinase%2C phage integrase family | |
| 1878 | JAEMBM010000012.1 | GCA021406705_00950 | CDS | open | 8586-8783 | _na 65_aa | hypothetical protein | |
| 1879 | JAEMBM010000012.1 | GCA021406705_00951 | CDS | open | 9131-9430 | _na 99_aa | PG0541 family transporter-associated protein | |
| 1880 | JAEMBM010000012.1 | GCA021406705_00952 | CDS | open | 9415-12564 | _na 1049_aa | acrB | AcrB/AcrD/AcrF family protein |
| 1881 | JAEMBM010000012.1 | GCA021406705_00953 | CDS | open | 12561-13622 | _na 353_aa | acrA | Efflux transporter%2C MFP component%2C RND family |
| 1882 | JAEMBM010000012.1 | GCA021406705_00954 | CDS | open | 13657-15045 | _na 462_aa | tolC | putative outer membrane efflux protein |
| 1883 | JAEMBM010000012.1 | GCA021406705_00955 | CDS | open | 15872-17332 | _na 486_aa | pepD2 | Aminoacyl-histidine dipeptidase |
| 1884 | JAEMBM010000012.1 | GCA021406705_00956 | CDS | open | 17413-17628 | _na 71_aa | Conjugal transfer protein | |
| 1885 | JAEMBM010000012.1 | GCA021406705_00957 | CDS | open | 17661-18281 | _na 206_aa | ompH | OmpH family outer membrane protein |
| 1886 | JAEMBM010000012.1 | GCA021406705_00958 | CDS | open | 18462-20945 | _na 827_aa | fepA | TonB-dependent receptor plug domain-containing protein |
| 1887 | JAEMBM010000012.1 | GCA021406705_00963 | CDS | open | 22140-22988 | _na 282_aa | yoaR | Putative vancomycin B-type resistance protein VanW |
| 1888 | JAEMBM010000012.1 | GCA021406705_00964 | CDS | open | 23098-25041 | _na 647_aa | nit1 | NAD(+) synthase |
| 1889 | JAEMBM010000012.1 | GCA021406705_00965 | CDS | open | 25236-28463 | _na 1075_aa | carB | carbamoyl-phosphate synthase large subunit |
| 1890 | JAEMBM010000012.1 | GCA021406705_00966 | CDS | open | 28482-29555 | _na 357_aa | carA | carbamoyl phosphate synthase small subunit |
| 1891 | JAEMBM010000012.1 | GCA021406705_00967 | CDS | open | 29589-31472 | _na 627_aa | purF | Amidophosphoribosyltransferase%2C putative |
| 1892 | JAEMBM010000012.1 | GCA021406705_00968 | CDS | open | 31563-33446 | _na 627_aa | yidC | membrane protein insertase YidC |
| 1893 | JAEMBM010000012.1 | GCA021406705_00969 | CDS | open | 33574-35193 | _na 539_aa | pyrG | CTP synthase |
| 1894 | JAEMBM010000012.1 | GCA021406705_00970 | CDS | open | 35848-37344 | _na 498_aa | cBS | IMP dehydrogenase |
| 1895 | JAEMBM010000012.1 | GCA021406705_00971 | CDS | open | 37341-38249 | _na 302_aa | miaA | tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA |
| 1896 | JAEMBM010000012.1 | GCA021406705_00972 | CDS | open | 38467-38736 | _na 89_aa | groES | Co-chaperonin GroES |
| 1897 | JAEMBM010000012.1 | GCA021406705_00973 | CDS | open | 38867-40504 | _na 545_aa | groL | chaperonin GroEL |
| 1898 | JAEMBM010000012.1 | GCA021406705_00975 | CDS | open | 41183-41908 | _na 241_aa | ydiL | Abortive infection protein family |
| 1899 | JAEMBM010000012.1 | GCA021406705_00976 | CDS | open | 41884-44907 | _na 1007_aa | addB | PD-(D/E)XK endonuclease-like domain-containing protein |
| 1900 | JAEMBM010000012.1 | GCA021406705_00977 | CDS | open | 44938-46185 | _na 415_aa | DUF4105 domain-containing protein | |
| 1901 | JAEMBM010000012.1 | GCA021406705_00978 | CDS | open | 46164-47759 | _na 531_aa | Alanine dehydrogenase | |
| 1902 | JAEMBM010000012.1 | GCA021406705_00979 | CDS | open | 47852-51193 | _na 1113_aa | secA | preprotein translocase subunit SecA |
| 1903 | JAEMBM010000012.1 | GCA021406705_00980 | CDS | open | 51285-52175 | _na 296_aa | yicC | YicC family protein |
| 1904 | JAEMBM010000012.1 | GCA021406705_00981 | CDS | open | 52208-52774 | _na 188_aa | gmk | guanylate kinase |
| 1905 | JAEMBM010000012.1 | GCA021406705_00982 | CDS | open | 52794-54026 | _na 410_aa | spmA | Spore maturation protein A/spore maturation protein B |
| 1906 | JAEMBM010000012.1 | GCA021406705_00983 | CDS | open | 54062-54517 | _na 151_aa | ybeY | rRNA maturation RNase YbeY |
| 1907 | JAEMBM010000012.1 | GCA021406705_00984 | CDS | open | 54534-55394 | _na 286_aa | ubiA | Phosphoribose diphosphate:decaprenyl-phosphate phosphoribosyltransferase |
| 1908 | JAEMBM010000012.1 | GCA021406705_00985 | CDS | open | 55384-55986 | _na 200_aa | serB | HAD-superfamily subfamily IB hydrolase%2C TIGR01490 |
| 1909 | JAEMBM010000012.1 | GCA021406705_00986 | CDS | open | 56567-57478 | _na 303_aa | hypothetical protein | |
| 1910 | JAEMBM010000012.1 | GCA021406705_00941 | gene | open | 752-4333 | nifJ | ||
| 1911 | JAEMBM010000012.1 | GCA021406705_00942 | gene | open | 4522-5703 | |||
| 1912 | JAEMBM010000012.1 | GCA021406705_00943 | gene | open | 5696-5896 | |||
| 1913 | JAEMBM010000012.1 | GCA021406705_00944 | gene | open | 6002-6316 | |||
| 1914 | JAEMBM010000012.1 | GCA021406705_00945 | gene | open | 6527-7000 | |||
| 1915 | JAEMBM010000012.1 | GCA021406705_00946 | gene | open | 7045-7311 | |||
| 1916 | JAEMBM010000012.1 | GCA021406705_00947 | gene | open | 7314-7799 | |||
| 1917 | JAEMBM010000012.1 | GCA021406705_00948 | gene | open | 7893-8129 | |||
| 1918 | JAEMBM010000012.1 | GCA021406705_00949 | gene | open | 8188-8586 | |||
| 1919 | JAEMBM010000012.1 | GCA021406705_00950 | gene | open | 8586-8783 | |||
| 1920 | JAEMBM010000012.1 | GCA021406705_00951 | gene | open | 9131-9430 | |||
| 1921 | JAEMBM010000012.1 | GCA021406705_00952 | gene | open | 9415-12564 | acrB | ||
| 1922 | JAEMBM010000012.1 | GCA021406705_00953 | gene | open | 12561-13622 | acrA | ||
| 1923 | JAEMBM010000012.1 | GCA021406705_00954 | gene | open | 13657-15045 | tolC | ||
| 1924 | JAEMBM010000012.1 | GCA021406705_00955 | gene | open | 15872-17332 | pepD2 | ||
| 1925 | JAEMBM010000012.1 | GCA021406705_00956 | gene | open | 17413-17628 | |||
| 1926 | JAEMBM010000012.1 | GCA021406705_00957 | gene | open | 17661-18281 | ompH | ||
| 1927 | JAEMBM010000012.1 | GCA021406705_00958 | gene | open | 18462-20945 | fepA | ||
| 1928 | JAEMBM010000012.1 | GCA021406705_00963 | gene | open | 22140-22988 | yoaR | ||
| 1929 | JAEMBM010000012.1 | GCA021406705_00964 | gene | open | 23098-25041 | nit1 | ||
| 1930 | JAEMBM010000012.1 | GCA021406705_00965 | gene | open | 25236-28463 | carB | ||
| 1931 | JAEMBM010000012.1 | GCA021406705_00966 | gene | open | 28482-29555 | carA | ||
| 1932 | JAEMBM010000012.1 | GCA021406705_00967 | gene | open | 29589-31472 | purF | ||
| 1933 | JAEMBM010000012.1 | GCA021406705_00968 | gene | open | 31563-33446 | yidC | ||
| 1934 | JAEMBM010000012.1 | GCA021406705_00969 | gene | open | 33574-35193 | pyrG | ||
| 1935 | JAEMBM010000012.1 | GCA021406705_00970 | gene | open | 35848-37344 | cBS | ||
| 1936 | JAEMBM010000012.1 | GCA021406705_00971 | gene | open | 37341-38249 | miaA | ||
| 1937 | JAEMBM010000012.1 | GCA021406705_00972 | gene | open | 38467-38736 | groES | ||
| 1938 | JAEMBM010000012.1 | GCA021406705_00973 | gene | open | 38867-40504 | groL | ||
| 1939 | JAEMBM010000012.1 | GCA021406705_00975 | gene | open | 41183-41908 | ydiL | ||
| 1940 | JAEMBM010000012.1 | GCA021406705_00976 | gene | open | 41884-44907 | addB | ||
| 1941 | JAEMBM010000012.1 | GCA021406705_00977 | gene | open | 44938-46185 | |||
| 1942 | JAEMBM010000012.1 | GCA021406705_00978 | gene | open | 46164-47759 | |||
| 1943 | JAEMBM010000012.1 | GCA021406705_00979 | gene | open | 47852-51193 | secA | ||
| 1944 | JAEMBM010000012.1 | GCA021406705_00980 | gene | open | 51285-52175 | yicC | ||
| 1945 | JAEMBM010000012.1 | GCA021406705_00981 | gene | open | 52208-52774 | gmk | ||
| 1946 | JAEMBM010000012.1 | GCA021406705_00982 | gene | open | 52794-54026 | spmA | ||
| 1947 | JAEMBM010000012.1 | GCA021406705_00983 | gene | open | 54062-54517 | ybeY | ||
| 1948 | JAEMBM010000012.1 | GCA021406705_00984 | gene | open | 54534-55394 | ubiA | ||
| 1949 | JAEMBM010000012.1 | GCA021406705_00985 | gene | open | 55384-55986 | serB | ||
| 1950 | JAEMBM010000012.1 | GCA021406705_00986 | gene | open | 56567-57478 | |||
| 1951 | JAEMBM010000012.1 | GCA021406705_00959 | gene | open | 21361-21433 | trnG | ||
| 1952 | JAEMBM010000012.1 | GCA021406705_00960 | gene | open | 21482-21566 | trnL | ||
| 1953 | JAEMBM010000012.1 | GCA021406705_00961 | gene | open | 21583-21655 | trnG | ||
| 1954 | JAEMBM010000012.1 | GCA021406705_00962 | gene | open | 21689-21771 | trnY | ||
| 1955 | JAEMBM010000012.1 | GCA021406705_00974 | gene | open | 40889-40975 | trnS | ||
| 1956 | JAEMBM010000012.1 | GCA021406705_00959 | tRNA | open | 21361-21433 | trnG | tRNA-Gly(gcc) | |
| 1957 | JAEMBM010000012.1 | GCA021406705_00960 | tRNA | open | 21482-21566 | trnL | tRNA-Leu(taa) | |
| 1958 | JAEMBM010000012.1 | GCA021406705_00961 | tRNA | open | 21583-21655 | trnG | tRNA-Gly(tcc) | |
| 1959 | JAEMBM010000012.1 | GCA021406705_00962 | tRNA | open | 21689-21771 | trnY | tRNA-Tyr(gta) | |
| 1960 | JAEMBM010000012.1 | GCA021406705_00974 | tRNA | open | 40889-40975 | trnS | tRNA-Ser(gct) | |
| 1961 | JAEMBM010000013.1 | rep_origin | open | 34084-34560 | ||||
| 1962 | JAEMBM010000013.1 | GCA021406705_01740 | CDS | open | 669-1145 | _na 158_aa | cdd | cytidine deaminase |
| 1963 | JAEMBM010000013.1 | GCA021406705_01742 | CDS | open | 1865-2449 | _na 194_aa | spoU | RNA methyltransferase%2C TrmH family |
| 1964 | JAEMBM010000013.1 | GCA021406705_01743 | CDS | open | 2552-3040 | _na 162_aa | ispF | 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase |
| 1965 | JAEMBM010000013.1 | GCA021406705_01744 | CDS | open | 3047-4222 | _na 391_aa | porV | type IX secretion system outer membrane channel protein PorV |
| 1966 | JAEMBM010000013.1 | GCA021406705_01745 | CDS | open | 4298-7774 | _na 1158_aa | porU | Por secretion system protein porU |
| 1967 | JAEMBM010000013.1 | GCA021406705_01746 | CDS | open | 7787-8446 | _na 219_aa | ycgM | 2-hydroxyhepta-2%2C4-diene-1%2C7-dioate isomerase |
| 1968 | JAEMBM010000013.1 | GCA021406705_01747 | CDS | open | 8515-9171 | _na 218_aa | rex | redox-sensing transcriptional repressor Rex |
| 1969 | JAEMBM010000013.1 | GCA021406705_01748 | CDS | open | 9191-9346 | _na 51_aa | hypothetical protein | |
| 1970 | JAEMBM010000013.1 | GCA021406705_01749 | CDS | open | 10157-11833 | _na 558_aa | sUL1 | Sulfate permease |
| 1971 | JAEMBM010000013.1 | GCA021406705_01750 | CDS | open | 11830-12831 | _na 333_aa | dusB | tRNA dihydrouridine synthase DusB |
| 1972 | JAEMBM010000013.1 | GCA021406705_01751 | CDS | open | 12817-13521 | _na 234_aa | marR | Transcriptional regulator%2C MarR family |
| 1973 | JAEMBM010000013.1 | GCA021406705_01752 | CDS | open | 13606-15852 | _na 748_aa | Lipoprotein | |
| 1974 | JAEMBM010000013.1 | GCA021406705_01753 | CDS | open | 15856-17193 | _na 445_aa | histidine kinase | |
| 1975 | JAEMBM010000013.1 | GCA021406705_01754 | CDS | open | 17204-18553 | _na 449_aa | atoC | Sigma-54 dependent DNA-binding response regulator |
| 1976 | JAEMBM010000013.1 | GCA021406705_01755 | CDS | open | 19098-19868 | _na 256_aa | comB | putative 2-phosphosulfolactate phosphatase |
| 1977 | JAEMBM010000013.1 | GCA021406705_01756 | CDS | open | 19878-20906 | _na 342_aa | hisC | L-threonine-O-3-phosphate decarboxylase%2C putative |
| 1978 | JAEMBM010000013.1 | GCA021406705_01757 | CDS | open | 20954-23965 | _na 1003_aa | ampC | beta-N-acetylhexosaminidase |
| 1979 | JAEMBM010000013.1 | GCA021406705_01758 | CDS | open | 24105-26684 | _na 859_aa | clpC | ATP-dependent Clp protease%2C ATP-binding subunit ClpC |
| 1980 | JAEMBM010000013.1 | GCA021406705_01759 | CDS | open | 26704-27126 | _na 140_aa | DUF1661 domain-containing protein | |
| 1981 | JAEMBM010000013.1 | GCA021406705_01762 | CDS | open | 27611-28990 | _na 459_aa | norM | Multidrug export protein MepA |
| 1982 | JAEMBM010000013.1 | GCA021406705_01763 | CDS | open | 29043-30197 | _na 384_aa | yaeI | Calcineurin-like phosphoesterase domain-containing protein |
| 1983 | JAEMBM010000013.1 | GCA021406705_01764 | CDS | open | 30272-30976 | _na 234_aa | sIR2 | NAD-dependent protein deacylase |
| 1984 | JAEMBM010000013.1 | GCA021406705_01765 | CDS | open | 31056-32075 | _na 339_aa | wecH | Acyltransferase 3 domain-containing protein |
| 1985 | JAEMBM010000013.1 | GCA021406705_01766 | CDS | open | 32077-32649 | _na 190_aa | wbbJ | Hexapeptide transferase family protein |
| 1986 | JAEMBM010000013.1 | GCA021406705_01767 | CDS | open | 32662-34083 | _na 473_aa | dnaA | chromosomal replication initiator protein DnaA |
| 1987 | JAEMBM010000013.1 | GCA021406705_01768 | CDS | open | 34757-35413 | _na 218_aa | TPR domain protein | |
| 1988 | JAEMBM010000013.1 | GCA021406705_01769 | CDS | open | 35410-37632 | _na 740_aa | fepA | Collagen-binding protein |
| 1989 | JAEMBM010000013.1 | GCA021406705_01770 | CDS | open | 37712-38008 | _na 98_aa | marR | Winged helix DNA-binding domain-containing protein |
| 1990 | JAEMBM010000013.1 | GCA021406705_01771 | CDS | open | 38001-38597 | _na 198_aa | terC | TerC family integral membrane protein |
| 1991 | JAEMBM010000013.1 | GCA021406705_01772 | CDS | open | 38740-39750 | _na 336_aa | wcaE | Glycosyltransferase 2-like domain-containing protein |
| 1992 | JAEMBM010000013.1 | GCA021406705_01773 | CDS | open | 39747-40664 | _na 305_aa | lpxP | Acyltransferase%2C HtrB/MsbB family |
| 1993 | JAEMBM010000013.1 | GCA021406705_01774 | CDS | open | 40661-41995 | _na 444_aa | mtaB | tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB |
| 1994 | JAEMBM010000013.1 | GCA021406705_01775 | CDS | open | 42132-42296 | _na 54_aa | hypothetical protein | |
| 1995 | JAEMBM010000013.1 | GCA021406705_01777 | CDS | open | 43030-44493 | _na 487_aa | trkH | Potassium uptake protein TrkH |
| 1996 | JAEMBM010000013.1 | GCA021406705_01778 | CDS | open | 44520-45860 | _na 446_aa | trkA | Trk system potassium transporter TrkA |
| 1997 | JAEMBM010000013.1 | GCA021406705_01779 | CDS | open | 45913-47814 | _na 633_aa | dxs | 1-deoxy-D-xylulose-5-phosphate synthase |
| 1998 | JAEMBM010000013.1 | GCA021406705_01780 | CDS | open | 47990-49504 | _na 504_aa | cTD-A | GLUG domain-containing protein |
| 1999 | JAEMBM010000013.1 | GCA021406705_01781 | CDS | open | 49795-50880 | _na 361_aa | cpsB | Mannose-1-phosphate guanylyltransferase |
| 2000 | JAEMBM010000013.1 | GCA021406705_01782 | CDS | open | 50915-52189 | _na 424_aa | DUF2851 domain-containing protein |

