BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_021406705.1)
Select a Genome:
|
BAKTA Annotations for GCA_021406705.1
|
Search & Sort all 4269 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3001 | JAEMBM010000029.1 | GCA021406705_01381 | gene | open | 19154-19627 | ftsL | ||
| 3002 | JAEMBM010000029.1 | GCA021406705_01382 | gene | open | 19627-20562 | rsmH | ||
| 3003 | JAEMBM010000029.1 | GCA021406705_01383 | gene | open | 21244-22257 | asd | ||
| 3004 | JAEMBM010000029.1 | GCA021406705_01384 | gene | open | 22453-24009 | |||
| 3005 | JAEMBM010000029.1 | GCA021406705_01385 | gene | open | 24141-24707 | efp | ||
| 3006 | JAEMBM010000030.1 | GCA021406705_00598 | CDS | open | 4-219 | _na 71_aa | hypothetical protein | |
| 3007 | JAEMBM010000030.1 | GCA021406705_00599 | CDS | open | 537-1871 | _na 444_aa | ugd | UDP-glucose 6-dehydrogenase |
| 3008 | JAEMBM010000030.1 | GCA021406705_00600 | CDS | open | 1878-2921 | _na 347_aa | epsG | EpsG family protein |
| 3009 | JAEMBM010000030.1 | GCA021406705_00601 | CDS | open | 3113-4264 | _na 383_aa | Glycosyltransferase%2C group 1 family protein | |
| 3010 | JAEMBM010000030.1 | GCA021406705_00602 | CDS | open | 4270-5130 | _na 286_aa | wcaE | Glycosyl transferase%2C group 2 family protein |
| 3011 | JAEMBM010000030.1 | GCA021406705_00603 | CDS | open | 5262-6389 | _na 375_aa | DUF4369 domain-containing protein | |
| 3012 | JAEMBM010000030.1 | GCA021406705_00604 | CDS | open | 6569-7723 | _na 384_aa | wecE | Pigmentation and extracellular proteinase regulator |
| 3013 | JAEMBM010000030.1 | GCA021406705_00605 | CDS | open | 7720-9027 | _na 435_aa | rfbX | PorS protein |
| 3014 | JAEMBM010000030.1 | GCA021406705_00606 | CDS | open | 8990-10618 | _na 542_aa | asnB | asparagine synthase (glutamine-hydrolyzing) |
| 3015 | JAEMBM010000030.1 | GCA021406705_00607 | CDS | open | 10793-11407 | _na 204_aa | wcaJ | Bacterial sugar transferase domain-containing protein |
| 3016 | JAEMBM010000030.1 | GCA021406705_00608 | CDS | open | 11976-12917 | _na 313_aa | trxB | thioredoxin-disulfide reductase |
| 3017 | JAEMBM010000030.1 | GCA021406705_00610 | CDS | open | 13243-13695 | _na 150_aa | hypothetical protein | |
| 3018 | JAEMBM010000030.1 | GCA021406705_00611 | CDS | open | 13724-16354 | _na 876_aa | valS | valine--tRNA ligase |
| 3019 | JAEMBM010000030.1 | GCA021406705_00612 | CDS | open | 17215-19389 | _na 724_aa | hypothetical protein | |
| 3020 | JAEMBM010000030.1 | GCA021406705_00613 | CDS | open | 19588-22140 | _na 850_aa | nrdA | adenosylcobalamin-dependent ribonucleoside-diphosphate reductase |
| 3021 | JAEMBM010000030.1 | GCA021406705_00614 | CDS | open | 22413-23795 | _na 460_aa | xseA | exodeoxyribonuclease VII large subunit |
| 3022 | JAEMBM010000030.1 | GCA021406705_00615 | CDS | open | 23842-24309 | _na 155_aa | lrp | Transcriptional regulator%2C AsnC Family |
| 3023 | JAEMBM010000030.1 | GCA021406705_00616 | CDS | open | 24338-24466 | _na 42_aa | hypothetical protein | |
| 3024 | JAEMBM010000030.1 | GCA021406705_00598 | gene | open | 4-219 | |||
| 3025 | JAEMBM010000030.1 | GCA021406705_00599 | gene | open | 537-1871 | ugd | ||
| 3026 | JAEMBM010000030.1 | GCA021406705_00600 | gene | open | 1878-2921 | epsG | ||
| 3027 | JAEMBM010000030.1 | GCA021406705_00601 | gene | open | 3113-4264 | |||
| 3028 | JAEMBM010000030.1 | GCA021406705_00602 | gene | open | 4270-5130 | wcaE | ||
| 3029 | JAEMBM010000030.1 | GCA021406705_00603 | gene | open | 5262-6389 | |||
| 3030 | JAEMBM010000030.1 | GCA021406705_00604 | gene | open | 6569-7723 | wecE | ||
| 3031 | JAEMBM010000030.1 | GCA021406705_00605 | gene | open | 7720-9027 | rfbX | ||
| 3032 | JAEMBM010000030.1 | GCA021406705_00606 | gene | open | 8990-10618 | asnB | ||
| 3033 | JAEMBM010000030.1 | GCA021406705_00607 | gene | open | 10793-11407 | wcaJ | ||
| 3034 | JAEMBM010000030.1 | GCA021406705_00608 | gene | open | 11976-12917 | trxB | ||
| 3035 | JAEMBM010000030.1 | GCA021406705_00610 | gene | open | 13243-13695 | |||
| 3036 | JAEMBM010000030.1 | GCA021406705_00611 | gene | open | 13724-16354 | valS | ||
| 3037 | JAEMBM010000030.1 | GCA021406705_00612 | gene | open | 17215-19389 | |||
| 3038 | JAEMBM010000030.1 | GCA021406705_00613 | gene | open | 19588-22140 | nrdA | ||
| 3039 | JAEMBM010000030.1 | GCA021406705_00614 | gene | open | 22413-23795 | xseA | ||
| 3040 | JAEMBM010000030.1 | GCA021406705_00615 | gene | open | 23842-24309 | lrp | ||
| 3041 | JAEMBM010000030.1 | GCA021406705_00616 | gene | open | 24338-24466 | |||
| 3042 | JAEMBM010000030.1 | GCA021406705_00609 | gene | open | 13110-13182 | trnT | ||
| 3043 | JAEMBM010000030.1 | GCA021406705_00609 | tRNA | open | 13110-13182 | trnT | tRNA-Thr(cgt) | |
| 3044 | JAEMBM010000031.1 | GCA021406705_00111 | CDS | open | 105-3080 | _na 991_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 3045 | JAEMBM010000031.1 | GCA021406705_00112 | CDS | open | 3164-5239 | _na 691_aa | DNA topoisomerase | |
| 3046 | JAEMBM010000031.1 | GCA021406705_00113 | CDS | open | 5562-6956 | _na 464_aa | DUF3945 domain-containing protein | |
| 3047 | JAEMBM010000031.1 | GCA021406705_00114 | CDS | open | 7197-7400 | _na 67_aa | helix-turn-helix transcriptional regulator | |
| 3048 | JAEMBM010000031.1 | GCA021406705_00115 | CDS | open | 7403-11548 | _na 1381_aa | type ISP restriction/modification enzyme | |
| 3049 | JAEMBM010000031.1 | GCA021406705_00116 | CDS | open | 11545-12321 | _na 258_aa | Helicase domain protein | |
| 3050 | JAEMBM010000031.1 | GCA021406705_00117 | CDS | open | 12484-14667 | _na 727_aa | ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein | |
| 3051 | JAEMBM010000031.1 | GCA021406705_00118 | CDS | open | 14715-16718 | _na 667_aa | virD4 | YWFCY domain-containing protein |
| 3052 | JAEMBM010000031.1 | GCA021406705_00119 | CDS | open | 16837-18195 | _na 452_aa | hpt1 | Phosphoribosyltransferase%2C putative/phosphoglycerate mutase family protein |
| 3053 | JAEMBM010000031.1 | GCA021406705_00120 | CDS | open | 18210-19199 | _na 329_aa | gldA | Glycerol dehydrogenase-related protein |
| 3054 | JAEMBM010000031.1 | GCA021406705_00121 | CDS | open | 19187-20206 | _na 339_aa | rbcL | Ribulose bisphosphate carboxylase-related protein |
| 3055 | JAEMBM010000031.1 | GCA021406705_00122 | CDS | open | 20216-20983 | _na 255_aa | hypothetical protein | |
| 3056 | JAEMBM010000031.1 | GCA021406705_00123 | CDS | open | 20996-21559 | _na 187_aa | hypothetical protein | |
| 3057 | JAEMBM010000031.1 | GCA021406705_00124 | CDS | open | 21565-22032 | _na 155_aa | ABC transporter permease | |
| 3058 | JAEMBM010000031.1 | GCA021406705_00125 | CDS | open | 22052-22696 | _na 214_aa | Relaxase/mobilization nuclease domain protein | |
| 3059 | JAEMBM010000031.1 | GCA021406705_00111 | gene | open | 105-3080 | |||
| 3060 | JAEMBM010000031.1 | GCA021406705_00112 | gene | open | 3164-5239 | |||
| 3061 | JAEMBM010000031.1 | GCA021406705_00113 | gene | open | 5562-6956 | |||
| 3062 | JAEMBM010000031.1 | GCA021406705_00114 | gene | open | 7197-7400 | |||
| 3063 | JAEMBM010000031.1 | GCA021406705_00115 | gene | open | 7403-11548 | |||
| 3064 | JAEMBM010000031.1 | GCA021406705_00116 | gene | open | 11545-12321 | |||
| 3065 | JAEMBM010000031.1 | GCA021406705_00117 | gene | open | 12484-14667 | |||
| 3066 | JAEMBM010000031.1 | GCA021406705_00118 | gene | open | 14715-16718 | virD4 | ||
| 3067 | JAEMBM010000031.1 | GCA021406705_00119 | gene | open | 16837-18195 | hpt1 | ||
| 3068 | JAEMBM010000031.1 | GCA021406705_00120 | gene | open | 18210-19199 | gldA | ||
| 3069 | JAEMBM010000031.1 | GCA021406705_00121 | gene | open | 19187-20206 | rbcL | ||
| 3070 | JAEMBM010000031.1 | GCA021406705_00122 | gene | open | 20216-20983 | |||
| 3071 | JAEMBM010000031.1 | GCA021406705_00123 | gene | open | 20996-21559 | |||
| 3072 | JAEMBM010000031.1 | GCA021406705_00124 | gene | open | 21565-22032 | |||
| 3073 | JAEMBM010000031.1 | GCA021406705_00125 | gene | open | 22052-22696 | |||
| 3074 | JAEMBM010000032.1 | GCA021406705_02105 | CDS | open | 193-738 | _na 181_aa | yajL | DJ-1 family glyoxalase III |
| 3075 | JAEMBM010000032.1 | GCA021406705_02106 | CDS | open | 753-1580 | _na 275_aa | tonB | TonB family domain protein |
| 3076 | JAEMBM010000032.1 | GCA021406705_02107 | CDS | open | 1585-2004 | _na 139_aa | exbD | Biopolymer transport protein ExbD%2C putative |
| 3077 | JAEMBM010000032.1 | GCA021406705_02108 | CDS | open | 2001-2735 | _na 244_aa | tolQ | MotA/TolQ/ExbB proton channel family protein |
| 3078 | JAEMBM010000032.1 | GCA021406705_02109 | CDS | open | 2773-3489 | _na 238_aa | pdxJ | pyridoxine 5'-phosphate synthase |
| 3079 | JAEMBM010000032.1 | GCA021406705_02110 | CDS | open | 3567-4433 | _na 288_aa | nadK | NAD kinase |
| 3080 | JAEMBM010000032.1 | GCA021406705_02111 | CDS | open | 4510-5247 | _na 245_aa | lptB | LPS export ABC transporter ATP-binding protein |
| 3081 | JAEMBM010000032.1 | GCA021406705_02112 | CDS | open | 5502-5789 | _na 95_aa | rRM | RNA-binding protein |
| 3082 | JAEMBM010000032.1 | GCA021406705_02113 | CDS | open | 6770-7351 | _na 193_aa | folE | GTP cyclohydrolase I FolE |
| 3083 | JAEMBM010000032.1 | GCA021406705_02114 | CDS | open | 7355-7861 | _na 168_aa | SPOR domain-containing protein | |
| 3084 | JAEMBM010000032.1 | GCA021406705_02115 | CDS | open | 7923-8678 | _na 251_aa | tpiA | triose-phosphate isomerase |
| 3085 | JAEMBM010000032.1 | GCA021406705_02116 | CDS | open | 8710-10002 | _na 430_aa | mauE | Methylamine utilisation protein MauE domain-containing protein |
| 3086 | JAEMBM010000032.1 | GCA021406705_02117 | CDS | open | 9999-10547 | _na 182_aa | Nucleotide modification associated domain-containing protein | |
| 3087 | JAEMBM010000032.1 | GCA021406705_02118 | CDS | open | 10544-13081 | _na 845_aa | lon | endopeptidase La |
| 3088 | JAEMBM010000032.1 | GCA021406705_02119 | CDS | open | 13288-14835 | _na 515_aa | ahpF | alkyl hydroperoxide reductase subunit F |
| 3089 | JAEMBM010000032.1 | GCA021406705_02120 | CDS | open | 15001-15567 | _na 188_aa | ahpC | alkyl hydroperoxide reductase subunit C |
| 3090 | JAEMBM010000032.1 | GCA021406705_02121 | CDS | open | 15581-15799 | _na 72_aa | hypothetical protein | |
| 3091 | JAEMBM010000032.1 | GCA021406705_02122 | CDS | open | 15971-17005 | _na 344_aa | cTD-A | Thioredoxin domain-containing protein |
| 3092 | JAEMBM010000032.1 | GCA021406705_02123 | CDS | open | 17108-18907 | _na 599_aa | typA | translational GTPase TypA |
| 3093 | JAEMBM010000032.1 | GCA021406705_02124 | CDS | open | 19114-20040 | _na 308_aa | Lipoprotein | |
| 3094 | JAEMBM010000032.1 | GCA021406705_02125 | CDS | open | 20048-20743 | _na 231_aa | DUF5666 domain-containing protein | |
| 3095 | JAEMBM010000032.1 | GCA021406705_02126 | CDS | open | 20767-20970 | _na 67_aa | hypothetical protein | |
| 3096 | JAEMBM010000032.1 | GCA021406705_02127 | CDS | open | 20967-21872 | _na 301_aa | Lipoprotein | |
| 3097 | JAEMBM010000032.1 | GCA021406705_02128 | CDS | open | 22018-22410 | _na 130_aa | hypothetical protein | |
| 3098 | JAEMBM010000032.1 | GCA021406705_02105 | gene | open | 193-738 | yajL | ||
| 3099 | JAEMBM010000032.1 | GCA021406705_02106 | gene | open | 753-1580 | tonB | ||
| 3100 | JAEMBM010000032.1 | GCA021406705_02107 | gene | open | 1585-2004 | exbD | ||
| 3101 | JAEMBM010000032.1 | GCA021406705_02108 | gene | open | 2001-2735 | tolQ | ||
| 3102 | JAEMBM010000032.1 | GCA021406705_02109 | gene | open | 2773-3489 | pdxJ | ||
| 3103 | JAEMBM010000032.1 | GCA021406705_02110 | gene | open | 3567-4433 | nadK | ||
| 3104 | JAEMBM010000032.1 | GCA021406705_02111 | gene | open | 4510-5247 | lptB | ||
| 3105 | JAEMBM010000032.1 | GCA021406705_02112 | gene | open | 5502-5789 | rRM | ||
| 3106 | JAEMBM010000032.1 | GCA021406705_02113 | gene | open | 6770-7351 | folE | ||
| 3107 | JAEMBM010000032.1 | GCA021406705_02114 | gene | open | 7355-7861 | |||
| 3108 | JAEMBM010000032.1 | GCA021406705_02115 | gene | open | 7923-8678 | tpiA | ||
| 3109 | JAEMBM010000032.1 | GCA021406705_02116 | gene | open | 8710-10002 | mauE | ||
| 3110 | JAEMBM010000032.1 | GCA021406705_02117 | gene | open | 9999-10547 | |||
| 3111 | JAEMBM010000032.1 | GCA021406705_02118 | gene | open | 10544-13081 | lon | ||
| 3112 | JAEMBM010000032.1 | GCA021406705_02119 | gene | open | 13288-14835 | ahpF | ||
| 3113 | JAEMBM010000032.1 | GCA021406705_02120 | gene | open | 15001-15567 | ahpC | ||
| 3114 | JAEMBM010000032.1 | GCA021406705_02121 | gene | open | 15581-15799 | |||
| 3115 | JAEMBM010000032.1 | GCA021406705_02122 | gene | open | 15971-17005 | cTD-A | ||
| 3116 | JAEMBM010000032.1 | GCA021406705_02123 | gene | open | 17108-18907 | typA | ||
| 3117 | JAEMBM010000032.1 | GCA021406705_02124 | gene | open | 19114-20040 | |||
| 3118 | JAEMBM010000032.1 | GCA021406705_02125 | gene | open | 20048-20743 | |||
| 3119 | JAEMBM010000032.1 | GCA021406705_02126 | gene | open | 20767-20970 | |||
| 3120 | JAEMBM010000032.1 | GCA021406705_02127 | gene | open | 20967-21872 | |||
| 3121 | JAEMBM010000032.1 | GCA021406705_02128 | gene | open | 22018-22410 | |||
| 3122 | JAEMBM010000033.1 | GCA021406705_01811 | CDS | open | 66-296 | _na 76_aa | hypothetical protein | |
| 3123 | JAEMBM010000033.1 | GCA021406705_01812 | CDS | open | 723-953 | _na 76_aa | hypothetical protein | |
| 3124 | JAEMBM010000033.1 | GCA021406705_01813 | CDS | open | 975-1196 | _na 73_aa | hypothetical protein | |
| 3125 | JAEMBM010000033.1 | GCA021406705_01814 | CDS | open | 1353-1823 | _na 156_aa | hypothetical protein | |
| 3126 | JAEMBM010000033.1 | GCA021406705_01815 | CDS | open | 2145-2414 | _na 89_aa | hypothetical protein | |
| 3127 | JAEMBM010000033.1 | GCA021406705_01816 | CDS | open | 2655-3239 | _na 194_aa | hypothetical protein | |
| 3128 | JAEMBM010000033.1 | GCA021406705_01817 | CDS | open | 3369-3749 | _na 126_aa | hypothetical protein | |
| 3129 | JAEMBM010000033.1 | GCA021406705_01818 | CDS | open | 3740-5833 | _na 697_aa | topA | DNA topoisomerase |
| 3130 | JAEMBM010000033.1 | GCA021406705_01819 | CDS | open | 5922-7331 | _na 469_aa | DUF3945 domain-containing protein | |
| 3131 | JAEMBM010000033.1 | GCA021406705_01820 | CDS | open | 7512-7634 | _na 40_aa | hypothetical protein | |
| 3132 | JAEMBM010000033.1 | GCA021406705_01821 | CDS | open | 7618-10293 | _na 891_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 3133 | JAEMBM010000033.1 | GCA021406705_01822 | CDS | open | 10310-11026 | _na 238_aa | GLPGLI family protein | |
| 3134 | JAEMBM010000033.1 | GCA021406705_01823 | CDS | open | 11124-11336 | _na 70_aa | hypothetical protein | |
| 3135 | JAEMBM010000033.1 | GCA021406705_01824 | CDS | open | 11378-11656 | _na 92_aa | hypothetical protein | |
| 3136 | JAEMBM010000033.1 | GCA021406705_01825 | CDS | open | 11653-13662 | _na 669_aa | mobC | Conjugal transfer protein MobC |
| 3137 | JAEMBM010000033.1 | GCA021406705_01826 | CDS | open | 13664-14944 | _na 426_aa | MobA/VirD2-like nuclease domain-containing protein | |
| 3138 | JAEMBM010000033.1 | GCA021406705_01827 | CDS | open | 14929-15330 | _na 133_aa | mobA | MobA protein |
| 3139 | JAEMBM010000033.1 | GCA021406705_01828 | CDS | open | 15961-16770 | _na 269_aa | traA | Conjugative transposon protein TraA |
| 3140 | JAEMBM010000033.1 | GCA021406705_01829 | CDS | open | 16757-17143 | _na 128_aa | traC | Conjugative transposon protein TraC |
| 3141 | JAEMBM010000033.1 | GCA021406705_01830 | CDS | open | 17148-17852 | _na 234_aa | Conjugal transfer protein | |
| 3142 | JAEMBM010000033.1 | GCA021406705_01831 | CDS | open | 18059-18343 | _na 94_aa | traE | Conjugative transposon protein TraE |
| 3143 | JAEMBM010000033.1 | GCA021406705_01832 | CDS | open | 18347-18682 | _na 111_aa | traF | Conjugative transposon protein TraF |
| 3144 | JAEMBM010000033.1 | GCA021406705_01833 | CDS | open | 18679-21204 | _na 841_aa | traG | TraG family conjugative transposon ATPase |
| 3145 | JAEMBM010000033.1 | GCA021406705_01834 | CDS | open | 21232-21861 | _na 209_aa | Conjugal transfer protein | |
| 3146 | JAEMBM010000033.1 | GCA021406705_01811 | gene | open | 66-296 | |||
| 3147 | JAEMBM010000033.1 | GCA021406705_01812 | gene | open | 723-953 | |||
| 3148 | JAEMBM010000033.1 | GCA021406705_01813 | gene | open | 975-1196 | |||
| 3149 | JAEMBM010000033.1 | GCA021406705_01814 | gene | open | 1353-1823 | |||
| 3150 | JAEMBM010000033.1 | GCA021406705_01815 | gene | open | 2145-2414 | |||
| 3151 | JAEMBM010000033.1 | GCA021406705_01816 | gene | open | 2655-3239 | |||
| 3152 | JAEMBM010000033.1 | GCA021406705_01817 | gene | open | 3369-3749 | |||
| 3153 | JAEMBM010000033.1 | GCA021406705_01818 | gene | open | 3740-5833 | topA | ||
| 3154 | JAEMBM010000033.1 | GCA021406705_01819 | gene | open | 5922-7331 | |||
| 3155 | JAEMBM010000033.1 | GCA021406705_01820 | gene | open | 7512-7634 | |||
| 3156 | JAEMBM010000033.1 | GCA021406705_01821 | gene | open | 7618-10293 | |||
| 3157 | JAEMBM010000033.1 | GCA021406705_01822 | gene | open | 10310-11026 | |||
| 3158 | JAEMBM010000033.1 | GCA021406705_01823 | gene | open | 11124-11336 | |||
| 3159 | JAEMBM010000033.1 | GCA021406705_01824 | gene | open | 11378-11656 | |||
| 3160 | JAEMBM010000033.1 | GCA021406705_01825 | gene | open | 11653-13662 | mobC | ||
| 3161 | JAEMBM010000033.1 | GCA021406705_01826 | gene | open | 13664-14944 | |||
| 3162 | JAEMBM010000033.1 | GCA021406705_01827 | gene | open | 14929-15330 | mobA | ||
| 3163 | JAEMBM010000033.1 | GCA021406705_01828 | gene | open | 15961-16770 | traA | ||
| 3164 | JAEMBM010000033.1 | GCA021406705_01829 | gene | open | 16757-17143 | traC | ||
| 3165 | JAEMBM010000033.1 | GCA021406705_01830 | gene | open | 17148-17852 | |||
| 3166 | JAEMBM010000033.1 | GCA021406705_01831 | gene | open | 18059-18343 | traE | ||
| 3167 | JAEMBM010000033.1 | GCA021406705_01832 | gene | open | 18347-18682 | traF | ||
| 3168 | JAEMBM010000033.1 | GCA021406705_01833 | gene | open | 18679-21204 | traG | ||
| 3169 | JAEMBM010000033.1 | GCA021406705_01834 | gene | open | 21232-21861 | |||
| 3170 | JAEMBM010000034.1 | GCA021406705_00231 | CDS | open | 153-1376 | _na 407_aa | rsmD | THUMP-like domain-containing protein |
| 3171 | JAEMBM010000034.1 | GCA021406705_00234 | CDS | open | 1712-2536 | _na 274_aa | murQ | N-acetylmuramic acid 6-phosphate etherase |
| 3172 | JAEMBM010000034.1 | GCA021406705_00235 | CDS | open | 2529-3380 | _na 283_aa | badF | BadF/BadG/BcrA/BcrD ATPase family protein |
| 3173 | JAEMBM010000034.1 | GCA021406705_00236 | CDS | open | 3377-4837 | _na 486_aa | putP | Sodium:solute symporter family protein |
| 3174 | JAEMBM010000034.1 | GCA021406705_00237 | CDS | open | 5184-5642 | _na 152_aa | DNA-binding protein histone-like family | |
| 3175 | JAEMBM010000034.1 | GCA021406705_00238 | CDS | open | 5711-7030 | _na 439_aa | rarA | ATPase%2C AAA family |
| 3176 | JAEMBM010000034.1 | GCA021406705_00239 | CDS | open | 7056-7823 | _na 255_aa | trmN6 | tRNA1(Val) (adenine(37)-N6)-methyltransferase |
| 3177 | JAEMBM010000034.1 | GCA021406705_00240 | CDS | open | 7787-9244 | _na 485_aa | rpoN | RNA polymerase factor sigma-54 |
| 3178 | JAEMBM010000034.1 | GCA021406705_00241 | CDS | open | 9238-10542 | _na 434_aa | murF | UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase |
| 3179 | JAEMBM010000034.1 | GCA021406705_00242 | CDS | open | 10739-11026 | _na 95_aa | traJ | Homologues of TraJ from Bacteroides conjugative transposon |
| 3180 | JAEMBM010000034.1 | GCA021406705_00243 | CDS | open | 11370-11726 | _na 118_aa | panD | aspartate 1-decarboxylase |
| 3181 | JAEMBM010000034.1 | GCA021406705_00244 | CDS | open | 11803-13140 | _na 445_aa | ffh | signal recognition particle protein |
| 3182 | JAEMBM010000034.1 | GCA021406705_00245 | CDS | open | 13261-14151 | _na 296_aa | folD | bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD |
| 3183 | JAEMBM010000034.1 | GCA021406705_00246 | CDS | open | 14444-15790 | _na 448_aa | norM | Multidrug-efflux transporter |
| 3184 | JAEMBM010000034.1 | GCA021406705_00247 | CDS | open | 16247-18838 | _na 863_aa | clpB | ATP-dependent chaperone ClpB |
| 3185 | JAEMBM010000034.1 | GCA021406705_00248 | CDS | open | 19057-19617 | _na 186_aa | fldA | Flavodoxin-like domain-containing protein |
| 3186 | JAEMBM010000034.1 | GCA021406705_00249 | CDS | open | 20457-20879 | _na 140_aa | dynamin family protein | |
| 3187 | JAEMBM010000034.1 | GCA021406705_00250 | CDS | open | 21111-21326 | _na 71_aa | hypothetical protein | |
| 3188 | JAEMBM010000034.1 | GCA021406705_00231 | gene | open | 153-1376 | rsmD | ||
| 3189 | JAEMBM010000034.1 | GCA021406705_00234 | gene | open | 1712-2536 | murQ | ||
| 3190 | JAEMBM010000034.1 | GCA021406705_00235 | gene | open | 2529-3380 | badF | ||
| 3191 | JAEMBM010000034.1 | GCA021406705_00236 | gene | open | 3377-4837 | putP | ||
| 3192 | JAEMBM010000034.1 | GCA021406705_00237 | gene | open | 5184-5642 | |||
| 3193 | JAEMBM010000034.1 | GCA021406705_00238 | gene | open | 5711-7030 | rarA | ||
| 3194 | JAEMBM010000034.1 | GCA021406705_00239 | gene | open | 7056-7823 | trmN6 | ||
| 3195 | JAEMBM010000034.1 | GCA021406705_00240 | gene | open | 7787-9244 | rpoN | ||
| 3196 | JAEMBM010000034.1 | GCA021406705_00241 | gene | open | 9238-10542 | murF | ||
| 3197 | JAEMBM010000034.1 | GCA021406705_00242 | gene | open | 10739-11026 | traJ | ||
| 3198 | JAEMBM010000034.1 | GCA021406705_00243 | gene | open | 11370-11726 | panD | ||
| 3199 | JAEMBM010000034.1 | GCA021406705_00244 | gene | open | 11803-13140 | ffh | ||
| 3200 | JAEMBM010000034.1 | GCA021406705_00245 | gene | open | 13261-14151 | folD | ||
| 3201 | JAEMBM010000034.1 | GCA021406705_00246 | gene | open | 14444-15790 | norM | ||
| 3202 | JAEMBM010000034.1 | GCA021406705_00247 | gene | open | 16247-18838 | clpB | ||
| 3203 | JAEMBM010000034.1 | GCA021406705_00248 | gene | open | 19057-19617 | fldA | ||
| 3204 | JAEMBM010000034.1 | GCA021406705_00249 | gene | open | 20457-20879 | |||
| 3205 | JAEMBM010000034.1 | GCA021406705_00250 | gene | open | 21111-21326 | |||
| 3206 | JAEMBM010000034.1 | GCA021406705_00232 | gene | open | 1436-1509 | trnR | ||
| 3207 | JAEMBM010000034.1 | GCA021406705_00233 | gene | open | 1544-1617 | trnR | ||
| 3208 | JAEMBM010000034.1 | GCA021406705_00232 | tRNA | open | 1436-1509 | trnR | tRNA-Arg(acg) | |
| 3209 | JAEMBM010000034.1 | GCA021406705_00233 | tRNA | open | 1544-1617 | trnR | tRNA-Arg(acg) | |
| 3210 | JAEMBM010000035.1 | GCA021406705_01562 | CDS | open | 655-996 | _na 113_aa | rodZ | HTH cro/C1-type domain-containing protein |
| 3211 | JAEMBM010000035.1 | GCA021406705_01563 | CDS | open | 999-1388 | _na 129_aa | Conserved domain protein | |
| 3212 | JAEMBM010000035.1 | GCA021406705_01564 | CDS | open | 1385-3433 | _na 682_aa | Topoisomerase | |
| 3213 | JAEMBM010000035.1 | GCA021406705_01565 | CDS | open | 3430-3624 | _na 64_aa | Helix-turn-helix domain-containing protein | |
| 3214 | JAEMBM010000035.1 | GCA021406705_01566 | CDS | open | 3681-5006 | _na 441_aa | ATPase | |
| 3215 | JAEMBM010000035.1 | GCA021406705_01567 | CDS | open | 5461-6900 | _na 479_aa | AAA family ATPase | |
| 3216 | JAEMBM010000035.1 | GCA021406705_01568 | CDS | open | 6967-8085 | _na 372_aa | menF | isochorismate synthase |
| 3217 | JAEMBM010000035.1 | GCA021406705_01569 | CDS | open | 8082-9818 | _na 578_aa | menD | 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase |
| 3218 | JAEMBM010000035.1 | GCA021406705_01570 | CDS | open | 9837-10661 | _na 274_aa | menB | 1%2C4-dihydroxy-2-naphthoyl-CoA synthase |
| 3219 | JAEMBM010000035.1 | GCA021406705_01571 | CDS | open | 10661-11731 | _na 356_aa | rspA | L-Ala-D/L-Glu epimerase |
| 3220 | JAEMBM010000035.1 | GCA021406705_01572 | CDS | open | 11753-12835 | _na 360_aa | menE | O-succinylbenzoic acid--CoA ligase |
| 3221 | JAEMBM010000035.1 | GCA021406705_01573 | CDS | open | 13291-13959 | _na 222_aa | yigB | HAD-superfamily hydrolase%2C subfamily IA%2C variant 1 family protein |
| 3222 | JAEMBM010000035.1 | GCA021406705_01574 | CDS | open | 14082-14285 | _na 67_aa | hypothetical protein | |
| 3223 | JAEMBM010000035.1 | GCA021406705_01575 | CDS | open | 14266-14520 | _na 84_aa | hypothetical protein | |
| 3224 | JAEMBM010000035.1 | GCA021406705_01576 | CDS | open | 14517-14918 | _na 133_aa | hypothetical protein | |
| 3225 | JAEMBM010000035.1 | GCA021406705_01577 | CDS | open | 15023-15916 | _na 297_aa | ygiQ | Radical SAM domain protein |
| 3226 | JAEMBM010000035.1 | GCA021406705_01578 | CDS | open | 15962-16948 | _na 328_aa | wcaG | NAD dependent protein |
| 3227 | JAEMBM010000035.1 | GCA021406705_01579 | CDS | open | 16965-17915 | _na 316_aa | ispH | LytB-related protein |
| 3228 | JAEMBM010000035.1 | GCA021406705_01580 | CDS | open | 17931-18581 | _na 216_aa | AfsA-related hotdog domain-containing protein | |
| 3229 | JAEMBM010000035.1 | GCA021406705_01581 | CDS | open | 18713-18847 | _na 44_aa | hypothetical protein | |
| 3230 | JAEMBM010000035.1 | GCA021406705_01582 | CDS | open | 19089-19688 | _na 199_aa | acrR | Transcriptional regulator%2C tetR family |
| 3231 | JAEMBM010000035.1 | GCA021406705_01583 | CDS | open | 19751-20995 | _na 414_aa | helicase C-terminal domain-containing protein | |
| 3232 | JAEMBM010000035.1 | GCA021406705_01562 | gene | open | 655-996 | rodZ | ||
| 3233 | JAEMBM010000035.1 | GCA021406705_01563 | gene | open | 999-1388 | |||
| 3234 | JAEMBM010000035.1 | GCA021406705_01564 | gene | open | 1385-3433 | |||
| 3235 | JAEMBM010000035.1 | GCA021406705_01565 | gene | open | 3430-3624 | |||
| 3236 | JAEMBM010000035.1 | GCA021406705_01566 | gene | open | 3681-5006 | |||
| 3237 | JAEMBM010000035.1 | GCA021406705_01567 | gene | open | 5461-6900 | |||
| 3238 | JAEMBM010000035.1 | GCA021406705_01568 | gene | open | 6967-8085 | menF | ||
| 3239 | JAEMBM010000035.1 | GCA021406705_01569 | gene | open | 8082-9818 | menD | ||
| 3240 | JAEMBM010000035.1 | GCA021406705_01570 | gene | open | 9837-10661 | menB | ||
| 3241 | JAEMBM010000035.1 | GCA021406705_01571 | gene | open | 10661-11731 | rspA | ||
| 3242 | JAEMBM010000035.1 | GCA021406705_01572 | gene | open | 11753-12835 | menE | ||
| 3243 | JAEMBM010000035.1 | GCA021406705_01573 | gene | open | 13291-13959 | yigB | ||
| 3244 | JAEMBM010000035.1 | GCA021406705_01574 | gene | open | 14082-14285 | |||
| 3245 | JAEMBM010000035.1 | GCA021406705_01575 | gene | open | 14266-14520 | |||
| 3246 | JAEMBM010000035.1 | GCA021406705_01576 | gene | open | 14517-14918 | |||
| 3247 | JAEMBM010000035.1 | GCA021406705_01577 | gene | open | 15023-15916 | ygiQ | ||
| 3248 | JAEMBM010000035.1 | GCA021406705_01578 | gene | open | 15962-16948 | wcaG | ||
| 3249 | JAEMBM010000035.1 | GCA021406705_01579 | gene | open | 16965-17915 | ispH | ||
| 3250 | JAEMBM010000035.1 | GCA021406705_01580 | gene | open | 17931-18581 | |||
| 3251 | JAEMBM010000035.1 | GCA021406705_01581 | gene | open | 18713-18847 | |||
| 3252 | JAEMBM010000035.1 | GCA021406705_01582 | gene | open | 19089-19688 | acrR | ||
| 3253 | JAEMBM010000035.1 | GCA021406705_01583 | gene | open | 19751-20995 | |||
| 3254 | JAEMBM010000036.1 | GCA021406705_00251 | CDS | open | 689-2410 | _na 573_aa | cls | phospholipase D |
| 3255 | JAEMBM010000036.1 | GCA021406705_00252 | CDS | open | 2538-3557 | _na 339_aa | ilvE | branched-chain amino acid aminotransferase |
| 3256 | JAEMBM010000036.1 | GCA021406705_00253 | CDS | open | 3696-4769 | _na 357_aa | wcaG | GDP-L-fucose synthase |
| 3257 | JAEMBM010000036.1 | GCA021406705_00254 | CDS | open | 4762-5859 | _na 365_aa | gmd | GDP-mannose 4%2C6-dehydratase |
| 3258 | JAEMBM010000036.1 | GCA021406705_00255 | CDS | open | 6360-6842 | _na 160_aa | ftnA | Ferritin |
| 3259 | JAEMBM010000036.1 | GCA021406705_00256 | CDS | open | 6950-8938 | _na 662_aa | lmbE | Glucosamine-6-phosphate deaminase |
| 3260 | JAEMBM010000036.1 | GCA021406705_00257 | CDS | open | 9096-11258 | _na 720_aa | dpp11 | Asp/Glu-specific dipeptidyl-peptidase |
| 3261 | JAEMBM010000036.1 | GCA021406705_00258 | CDS | open | 11321-11776 | _na 151_aa | cYTH | CYTH domain-containing protein |
| 3262 | JAEMBM010000036.1 | GCA021406705_00259 | CDS | open | 11800-12924 | _na 374_aa | Smr domain-containing protein | |
| 3263 | JAEMBM010000036.1 | GCA021406705_00260 | CDS | open | 13090-14337 | _na 415_aa | DUF1015 domain-containing protein | |
| 3264 | JAEMBM010000036.1 | GCA021406705_00261 | CDS | open | 14356-15276 | _na 306_aa | serA | D-3-phosphoglycerate dehydrogenase |
| 3265 | JAEMBM010000036.1 | GCA021406705_00262 | CDS | open | 15377-16459 | _na 360_aa | serC | phosphoserine transaminase |
| 3266 | JAEMBM010000036.1 | GCA021406705_00263 | CDS | open | 16795-18060 | _na 421_aa | wecC | UDP-glucose 6-dehydrogenase |
| 3267 | JAEMBM010000036.1 | GCA021406705_00264 | CDS | open | 18363-18869 | _na 168_aa | Histidinol phosphate aminotransferase | |
| 3268 | JAEMBM010000036.1 | GCA021406705_00265 | CDS | open | 19403-19969 | _na 188_aa | efp | elongation factor P |
| 3269 | JAEMBM010000036.1 | GCA021406705_00251 | gene | open | 689-2410 | cls | ||
| 3270 | JAEMBM010000036.1 | GCA021406705_00252 | gene | open | 2538-3557 | ilvE | ||
| 3271 | JAEMBM010000036.1 | GCA021406705_00253 | gene | open | 3696-4769 | wcaG | ||
| 3272 | JAEMBM010000036.1 | GCA021406705_00254 | gene | open | 4762-5859 | gmd | ||
| 3273 | JAEMBM010000036.1 | GCA021406705_00255 | gene | open | 6360-6842 | ftnA | ||
| 3274 | JAEMBM010000036.1 | GCA021406705_00256 | gene | open | 6950-8938 | lmbE | ||
| 3275 | JAEMBM010000036.1 | GCA021406705_00257 | gene | open | 9096-11258 | dpp11 | ||
| 3276 | JAEMBM010000036.1 | GCA021406705_00258 | gene | open | 11321-11776 | cYTH | ||
| 3277 | JAEMBM010000036.1 | GCA021406705_00259 | gene | open | 11800-12924 | |||
| 3278 | JAEMBM010000036.1 | GCA021406705_00260 | gene | open | 13090-14337 | |||
| 3279 | JAEMBM010000036.1 | GCA021406705_00261 | gene | open | 14356-15276 | serA | ||
| 3280 | JAEMBM010000036.1 | GCA021406705_00262 | gene | open | 15377-16459 | serC | ||
| 3281 | JAEMBM010000036.1 | GCA021406705_00263 | gene | open | 16795-18060 | wecC | ||
| 3282 | JAEMBM010000036.1 | GCA021406705_00264 | gene | open | 18363-18869 | |||
| 3283 | JAEMBM010000036.1 | GCA021406705_00265 | gene | open | 19403-19969 | efp | ||
| 3284 | JAEMBM010000037.1 | GCA021406705_00889 | CDS | open | 4-384 | _na 126_aa | tnp | IS3 family ISPg5 transposase ORF A |
| 3285 | JAEMBM010000037.1 | GCA021406705_00890 | CDS | open | 407-688 | _na 93_aa | hypothetical protein | |
| 3286 | JAEMBM010000037.1 | GCA021406705_00891 | CDS | open | 902-1306 | _na 134_aa | rpsL | 30S ribosomal protein S12 |
| 3287 | JAEMBM010000037.1 | GCA021406705_00892 | CDS | open | 1543-2019 | _na 158_aa | rpsG | 30S ribosomal protein S7 |
| 3288 | JAEMBM010000037.1 | GCA021406705_00893 | CDS | open | 2032-4155 | _na 707_aa | fusA | elongation factor G |
| 3289 | JAEMBM010000037.1 | GCA021406705_00894 | CDS | open | 4171-4476 | _na 101_aa | rpsJ | 30S ribosomal protein S10 |
| 3290 | JAEMBM010000037.1 | GCA021406705_00895 | CDS | open | 4499-5116 | _na 205_aa | rplC | 50S ribosomal protein L3 |
| 3291 | JAEMBM010000037.1 | GCA021406705_00896 | CDS | open | 5116-5745 | _na 209_aa | rplD | 50S ribosomal protein L4 |
| 3292 | JAEMBM010000037.1 | GCA021406705_00897 | CDS | open | 5760-6053 | _na 97_aa | rplW | 50S ribosomal protein L23 |
| 3293 | JAEMBM010000037.1 | GCA021406705_00898 | CDS | open | 6060-6884 | _na 274_aa | rplB | 50S ribosomal protein L2 |
| 3294 | JAEMBM010000037.1 | GCA021406705_00899 | CDS | open | 6907-7176 | _na 89_aa | rpsS | 30S ribosomal protein S19 |
| 3295 | JAEMBM010000037.1 | GCA021406705_00900 | CDS | open | 7231-7635 | _na 134_aa | rplV | 50S ribosomal protein L22 |
| 3296 | JAEMBM010000037.1 | GCA021406705_00901 | CDS | open | 7642-8382 | _na 246_aa | rpsC | 30S ribosomal protein S3 |
| 3297 | JAEMBM010000037.1 | GCA021406705_00902 | CDS | open | 8403-8837 | _na 144_aa | rplP | 50S ribosomal protein L16 |
| 3298 | JAEMBM010000037.1 | GCA021406705_00903 | CDS | open | 8843-9037 | _na 64_aa | rpmC | 50S ribosomal protein L29 |
| 3299 | JAEMBM010000037.1 | GCA021406705_00904 | CDS | open | 9051-9305 | _na 84_aa | rpsQ | 30S ribosomal protein S17 |
| 3300 | JAEMBM010000037.1 | GCA021406705_00905 | CDS | open | 9307-9672 | _na 121_aa | rplN | 50S ribosomal protein L14 |
| 3301 | JAEMBM010000037.1 | GCA021406705_00906 | CDS | open | 9731-10015 | _na 94_aa | rplX | 50S ribosomal protein L24 |
| 3302 | JAEMBM010000037.1 | GCA021406705_00907 | CDS | open | 10015-10575 | _na 186_aa | rplE | 50S ribosomal protein L5 |
| 3303 | JAEMBM010000037.1 | GCA021406705_00908 | CDS | open | 10577-10846 | _na 89_aa | rpsN | 30S ribosomal protein S14 |
| 3304 | JAEMBM010000037.1 | GCA021406705_00909 | CDS | open | 10897-11292 | _na 131_aa | rpsH | 30S ribosomal protein S8 |
| 3305 | JAEMBM010000037.1 | GCA021406705_00910 | CDS | open | 11311-11862 | _na 183_aa | rplF | 50S ribosomal protein L6 |
| 3306 | JAEMBM010000037.1 | GCA021406705_00911 | CDS | open | 11881-12225 | _na 114_aa | rplR | 50S ribosomal protein L18 |
| 3307 | JAEMBM010000037.1 | GCA021406705_00912 | CDS | open | 12231-12749 | _na 172_aa | rpsE | 30S ribosomal protein S5 |
| 3308 | JAEMBM010000037.1 | GCA021406705_00913 | CDS | open | 12971-13417 | _na 148_aa | rplO | 50S ribosomal protein L15 |
| 3309 | JAEMBM010000037.1 | GCA021406705_00914 | CDS | open | 13422-14762 | _na 446_aa | secY | preprotein translocase subunit SecY |
| 3310 | JAEMBM010000037.1 | GCA021406705_00915 | CDS | open | 14762-15547 | _na 261_aa | map | type I methionyl aminopeptidase |
| 3311 | JAEMBM010000037.1 | GCA021406705_00916 | CDS | open | 15550-15768 | _na 72_aa | infA | translation initiation factor IF-1 |
| 3312 | JAEMBM010000037.1 | GCA021406705_00917 | CDS | open | 15785-15901 | _na 38_aa | ykgO | type B 50S ribosomal protein L36 |
| 3313 | JAEMBM010000037.1 | GCA021406705_00918 | CDS | open | 15934-16314 | _na 126_aa | rpsM | 30S ribosomal protein S13 |
| 3314 | JAEMBM010000037.1 | GCA021406705_00919 | CDS | open | 16326-16712 | _na 128_aa | rpsK | 30S ribosomal protein S11 |
| 3315 | JAEMBM010000037.1 | GCA021406705_00920 | CDS | open | 16872-17477 | _na 201_aa | rpsD | 30S ribosomal protein S4 |
| 3316 | JAEMBM010000037.1 | GCA021406705_00921 | CDS | open | 17490-18482 | _na 330_aa | rpoA | DNA-directed RNA polymerase subunit alpha |
| 3317 | JAEMBM010000037.1 | GCA021406705_00922 | CDS | open | 18488-18970 | _na 160_aa | rplQ | 50S ribosomal protein L17 |
| 3318 | JAEMBM010000037.1 | GCA021406705_00889 | gene | open | 4-384 | tnp | ||
| 3319 | JAEMBM010000037.1 | GCA021406705_00890 | gene | open | 407-688 | |||
| 3320 | JAEMBM010000037.1 | GCA021406705_00891 | gene | open | 902-1306 | rpsL | ||
| 3321 | JAEMBM010000037.1 | GCA021406705_00892 | gene | open | 1543-2019 | rpsG | ||
| 3322 | JAEMBM010000037.1 | GCA021406705_00893 | gene | open | 2032-4155 | fusA | ||
| 3323 | JAEMBM010000037.1 | GCA021406705_00894 | gene | open | 4171-4476 | rpsJ | ||
| 3324 | JAEMBM010000037.1 | GCA021406705_00895 | gene | open | 4499-5116 | rplC | ||
| 3325 | JAEMBM010000037.1 | GCA021406705_00896 | gene | open | 5116-5745 | rplD | ||
| 3326 | JAEMBM010000037.1 | GCA021406705_00897 | gene | open | 5760-6053 | rplW | ||
| 3327 | JAEMBM010000037.1 | GCA021406705_00898 | gene | open | 6060-6884 | rplB | ||
| 3328 | JAEMBM010000037.1 | GCA021406705_00899 | gene | open | 6907-7176 | rpsS | ||
| 3329 | JAEMBM010000037.1 | GCA021406705_00900 | gene | open | 7231-7635 | rplV | ||
| 3330 | JAEMBM010000037.1 | GCA021406705_00901 | gene | open | 7642-8382 | rpsC | ||
| 3331 | JAEMBM010000037.1 | GCA021406705_00902 | gene | open | 8403-8837 | rplP | ||
| 3332 | JAEMBM010000037.1 | GCA021406705_00903 | gene | open | 8843-9037 | rpmC | ||
| 3333 | JAEMBM010000037.1 | GCA021406705_00904 | gene | open | 9051-9305 | rpsQ | ||
| 3334 | JAEMBM010000037.1 | GCA021406705_00905 | gene | open | 9307-9672 | rplN | ||
| 3335 | JAEMBM010000037.1 | GCA021406705_00906 | gene | open | 9731-10015 | rplX | ||
| 3336 | JAEMBM010000037.1 | GCA021406705_00907 | gene | open | 10015-10575 | rplE | ||
| 3337 | JAEMBM010000037.1 | GCA021406705_00908 | gene | open | 10577-10846 | rpsN | ||
| 3338 | JAEMBM010000037.1 | GCA021406705_00909 | gene | open | 10897-11292 | rpsH | ||
| 3339 | JAEMBM010000037.1 | GCA021406705_00910 | gene | open | 11311-11862 | rplF | ||
| 3340 | JAEMBM010000037.1 | GCA021406705_00911 | gene | open | 11881-12225 | rplR | ||
| 3341 | JAEMBM010000037.1 | GCA021406705_00912 | gene | open | 12231-12749 | rpsE | ||
| 3342 | JAEMBM010000037.1 | GCA021406705_00913 | gene | open | 12971-13417 | rplO | ||
| 3343 | JAEMBM010000037.1 | GCA021406705_00914 | gene | open | 13422-14762 | secY | ||
| 3344 | JAEMBM010000037.1 | GCA021406705_00915 | gene | open | 14762-15547 | map | ||
| 3345 | JAEMBM010000037.1 | GCA021406705_00916 | gene | open | 15550-15768 | infA | ||
| 3346 | JAEMBM010000037.1 | GCA021406705_00917 | gene | open | 15785-15901 | ykgO | ||
| 3347 | JAEMBM010000037.1 | GCA021406705_00918 | gene | open | 15934-16314 | rpsM | ||
| 3348 | JAEMBM010000037.1 | GCA021406705_00919 | gene | open | 16326-16712 | rpsK | ||
| 3349 | JAEMBM010000037.1 | GCA021406705_00920 | gene | open | 16872-17477 | rpsD | ||
| 3350 | JAEMBM010000037.1 | GCA021406705_00921 | gene | open | 17490-18482 | rpoA | ||
| 3351 | JAEMBM010000037.1 | GCA021406705_00922 | gene | open | 18488-18970 | rplQ | ||
| 3352 | JAEMBM010000038.1 | GCA021406705_01586 | CDS | open | 123-689 | _na 188_aa | efp | elongation factor P |
| 3353 | JAEMBM010000038.1 | GCA021406705_01587 | CDS | open | 1223-1726 | _na 167_aa | Histidinol phosphate aminotransferase | |
| 3354 | JAEMBM010000038.1 | GCA021406705_01588 | CDS | open | 1868-3544 | _na 558_aa | ybjL | putative transporter |
| 3355 | JAEMBM010000038.1 | GCA021406705_01589 | CDS | open | 3761-5116 | _na 451_aa | argE | dipeptidase |
| 3356 | JAEMBM010000038.1 | GCA021406705_01590 | CDS | open | 5191-6465 | _na 424_aa | ssnA | 5-methylthioadenosine/S-adenosylhomocysteine deaminase |
| 3357 | JAEMBM010000038.1 | GCA021406705_01591 | CDS | open | 6485-7306 | _na 273_aa | xapA | purine nucleoside phosphorylase I%2C inosine and guanosine-specific |
| 3358 | JAEMBM010000038.1 | GCA021406705_01592 | CDS | open | 7839-8513 | _na 224_aa | DUF3137 domain-containing protein | |
| 3359 | JAEMBM010000038.1 | GCA021406705_01593 | CDS | open | 8810-12037 | _na 1075_aa | p-loop domain protein%2C KAP family | |
| 3360 | JAEMBM010000038.1 | GCA021406705_01594 | CDS | open | 13151-13879 | _na 242_aa | GIY-YIG catalytic domain protein | |
| 3361 | JAEMBM010000038.1 | GCA021406705_01595 | CDS | open | 14039-14458 | _na 139_aa | hypothetical protein | |
| 3362 | JAEMBM010000038.1 | GCA021406705_01596 | CDS | open | 14612-15130 | _na 172_aa | DNA-binding protein%2C histone-like family | |
| 3363 | JAEMBM010000038.1 | GCA021406705_01597 | CDS | open | 15313-15525 | _na 70_aa | hypothetical protein | |
| 3364 | JAEMBM010000038.1 | GCA021406705_01598 | CDS | open | 15657-18479 | _na 940_aa | cTD-A | Peptidase S1 domain-containing protein |
| 3365 | JAEMBM010000038.1 | GCA021406705_01586 | gene | open | 123-689 | efp | ||
| 3366 | JAEMBM010000038.1 | GCA021406705_01587 | gene | open | 1223-1726 | |||
| 3367 | JAEMBM010000038.1 | GCA021406705_01588 | gene | open | 1868-3544 | ybjL | ||
| 3368 | JAEMBM010000038.1 | GCA021406705_01589 | gene | open | 3761-5116 | argE | ||
| 3369 | JAEMBM010000038.1 | GCA021406705_01590 | gene | open | 5191-6465 | ssnA | ||
| 3370 | JAEMBM010000038.1 | GCA021406705_01591 | gene | open | 6485-7306 | xapA | ||
| 3371 | JAEMBM010000038.1 | GCA021406705_01592 | gene | open | 7839-8513 | |||
| 3372 | JAEMBM010000038.1 | GCA021406705_01593 | gene | open | 8810-12037 | |||
| 3373 | JAEMBM010000038.1 | GCA021406705_01594 | gene | open | 13151-13879 | |||
| 3374 | JAEMBM010000038.1 | GCA021406705_01595 | gene | open | 14039-14458 | |||
| 3375 | JAEMBM010000038.1 | GCA021406705_01596 | gene | open | 14612-15130 | |||
| 3376 | JAEMBM010000038.1 | GCA021406705_01597 | gene | open | 15313-15525 | |||
| 3377 | JAEMBM010000038.1 | GCA021406705_01598 | gene | open | 15657-18479 | cTD-A | ||
| 3378 | JAEMBM010000039.1 | GCA021406705_01606 | CDS | open | 819-1214 | _na 131_aa | hypothetical protein | |
| 3379 | JAEMBM010000039.1 | GCA021406705_01607 | CDS | open | 1665-2924 | _na 419_aa | site-specific integrase | |
| 3380 | JAEMBM010000039.1 | GCA021406705_01608 | CDS | open | 2977-3462 | _na 161_aa | DUF1896 domain-containing protein | |
| 3381 | JAEMBM010000039.1 | GCA021406705_01609 | CDS | open | 4125-4394 | _na 89_aa | Helix-turn-helix domain-containing protein | |
| 3382 | JAEMBM010000039.1 | GCA021406705_01610 | CDS | open | 4398-4709 | _na 103_aa | Helix-turn-helix domain-containing protein | |
| 3383 | JAEMBM010000039.1 | GCA021406705_01611 | CDS | open | 5056-5475 | _na 139_aa | mobA | MobA protein |
| 3384 | JAEMBM010000039.1 | GCA021406705_01612 | CDS | open | 5417-6109 | _na 230_aa | Restriction endonuclease subunit S | |
| 3385 | JAEMBM010000039.1 | GCA021406705_01613 | CDS | open | 6276-7268 | _na 330_aa | xerA | site-specific tyrosine recombinase/integron integrase |
| 3386 | JAEMBM010000039.1 | GCA021406705_01614 | CDS | open | 7345-7887 | _na 180_aa | Type I restriction modification DNA specificity domain-containing protein | |
| 3387 | JAEMBM010000039.1 | GCA021406705_01615 | CDS | open | 7811-9079 | _na 422_aa | restriction endonuclease subunit S | |
| 3388 | JAEMBM010000039.1 | GCA021406705_01616 | CDS | open | 9091-9846 | _na 251_aa | Abortive infection protein-like C-terminal domain-containing protein | |
| 3389 | JAEMBM010000039.1 | GCA021406705_01617 | CDS | open | 9873-11027 | _na 384_aa | yhcG | YhcG PDDEXK nuclease domain-containing protein |
| 3390 | JAEMBM010000039.1 | GCA021406705_01618 | CDS | open | 11036-12679 | _na 547_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 3391 | JAEMBM010000039.1 | GCA021406705_01619 | CDS | open | 12684-15872 | _na 1062_aa | type I site-specific deoxyribonuclease | |
| 3392 | JAEMBM010000039.1 | GCA021406705_01620 | CDS | open | 15879-16076 | _na 65_aa | HTH cro/C1-type domain-containing protein | |
| 3393 | JAEMBM010000039.1 | GCA021406705_01621 | CDS | open | 16383-18323 | _na 646_aa | SNF2-related protein | |
| 3394 | JAEMBM010000039.1 | GCA021406705_01606 | gene | open | 819-1214 | |||
| 3395 | JAEMBM010000039.1 | GCA021406705_01607 | gene | open | 1665-2924 | |||
| 3396 | JAEMBM010000039.1 | GCA021406705_01608 | gene | open | 2977-3462 | |||
| 3397 | JAEMBM010000039.1 | GCA021406705_01609 | gene | open | 4125-4394 | |||
| 3398 | JAEMBM010000039.1 | GCA021406705_01610 | gene | open | 4398-4709 | |||
| 3399 | JAEMBM010000039.1 | GCA021406705_01611 | gene | open | 5056-5475 | mobA | ||
| 3400 | JAEMBM010000039.1 | GCA021406705_01612 | gene | open | 5417-6109 | |||
| 3401 | JAEMBM010000039.1 | GCA021406705_01613 | gene | open | 6276-7268 | xerA | ||
| 3402 | JAEMBM010000039.1 | GCA021406705_01614 | gene | open | 7345-7887 | |||
| 3403 | JAEMBM010000039.1 | GCA021406705_01615 | gene | open | 7811-9079 | |||
| 3404 | JAEMBM010000039.1 | GCA021406705_01616 | gene | open | 9091-9846 | |||
| 3405 | JAEMBM010000039.1 | GCA021406705_01617 | gene | open | 9873-11027 | yhcG | ||
| 3406 | JAEMBM010000039.1 | GCA021406705_01618 | gene | open | 11036-12679 | |||
| 3407 | JAEMBM010000039.1 | GCA021406705_01619 | gene | open | 12684-15872 | |||
| 3408 | JAEMBM010000039.1 | GCA021406705_01620 | gene | open | 15879-16076 | |||
| 3409 | JAEMBM010000039.1 | GCA021406705_01621 | gene | open | 16383-18323 | |||
| 3410 | JAEMBM010000040.1 | GCA021406705_01347 | CDS | open | 86-376 | _na 96_aa | transposase | |
| 3411 | JAEMBM010000040.1 | GCA021406705_01348 | CDS | open | 483-974 | _na 163_aa | dnaQ | Exonuclease |
| 3412 | JAEMBM010000040.1 | GCA021406705_01349 | CDS | open | 978-1616 | _na 212_aa | marC | UPF0056 inner membrane protein |
| 3413 | JAEMBM010000040.1 | GCA021406705_01350 | CDS | open | 1798-4491 | _na 897_aa | yebA | Transglutaminase-like domain-containing protein |
| 3414 | JAEMBM010000040.1 | GCA021406705_01351 | CDS | open | 4553-5938 | _na 461_aa | radA | DNA repair protein RadA |
| 3415 | JAEMBM010000040.1 | GCA021406705_01352 | CDS | open | 5984-6910 | _na 308_aa | ddaH | Amidinotransferase |
| 3416 | JAEMBM010000040.1 | GCA021406705_01353 | CDS | open | 7389-8051 | _na 220_aa | fsa | fructose-6-phosphate aldolase |
| 3417 | JAEMBM010000040.1 | GCA021406705_01354 | CDS | open | 8048-9346 | _na 432_aa | ybbC | Lipoprotein |
| 3418 | JAEMBM010000040.1 | GCA021406705_01355 | CDS | open | 9425-11890 | _na 821_aa | cTD-A | PKD domain-containing protein |
| 3419 | JAEMBM010000040.1 | GCA021406705_01356 | CDS | open | 12850-13473 | _na 207_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 3420 | JAEMBM010000040.1 | GCA021406705_01357 | CDS | open | 13490-13624 | _na 44_aa | hypothetical protein | |
| 3421 | JAEMBM010000040.1 | GCA021406705_01358 | CDS | open | 13690-15291 | _na 533_aa | ctpA | Carboxyl-terminal processing protease |
| 3422 | JAEMBM010000040.1 | GCA021406705_01359 | CDS | open | 15363-16883 | _na 506_aa | Right-handed parallel beta-helix repeat-containing protein | |
| 3423 | JAEMBM010000040.1 | GCA021406705_01360 | CDS | open | 16917-17585 | _na 222_aa | ung | uracil-DNA glycosylase |
| 3424 | JAEMBM010000040.1 | GCA021406705_01347 | gene | open | 86-376 | |||
| 3425 | JAEMBM010000040.1 | GCA021406705_01348 | gene | open | 483-974 | dnaQ | ||
| 3426 | JAEMBM010000040.1 | GCA021406705_01349 | gene | open | 978-1616 | marC | ||
| 3427 | JAEMBM010000040.1 | GCA021406705_01350 | gene | open | 1798-4491 | yebA | ||
| 3428 | JAEMBM010000040.1 | GCA021406705_01351 | gene | open | 4553-5938 | radA | ||
| 3429 | JAEMBM010000040.1 | GCA021406705_01352 | gene | open | 5984-6910 | ddaH | ||
| 3430 | JAEMBM010000040.1 | GCA021406705_01353 | gene | open | 7389-8051 | fsa | ||
| 3431 | JAEMBM010000040.1 | GCA021406705_01354 | gene | open | 8048-9346 | ybbC | ||
| 3432 | JAEMBM010000040.1 | GCA021406705_01355 | gene | open | 9425-11890 | cTD-A | ||
| 3433 | JAEMBM010000040.1 | GCA021406705_01356 | gene | open | 12850-13473 | |||
| 3434 | JAEMBM010000040.1 | GCA021406705_01357 | gene | open | 13490-13624 | |||
| 3435 | JAEMBM010000040.1 | GCA021406705_01358 | gene | open | 13690-15291 | ctpA | ||
| 3436 | JAEMBM010000040.1 | GCA021406705_01359 | gene | open | 15363-16883 | |||
| 3437 | JAEMBM010000040.1 | GCA021406705_01360 | gene | open | 16917-17585 | ung | ||
| 3438 | JAEMBM010000041.1 | GCA021406705_00815 | CDS | open | 226-2202 | _na 658_aa | gDB1 | Putative 4-alpha-glucanotransferase |
| 3439 | JAEMBM010000041.1 | GCA021406705_00816 | CDS | open | 2199-3461 | _na 420_aa | rfaB | Glycosyl transferase%2C group 1 family protein |
| 3440 | JAEMBM010000041.1 | GCA021406705_00817 | CDS | open | 3458-4744 | _na 428_aa | Glycoside hydrolase family 57 N-terminal domain-containing protein | |
| 3441 | JAEMBM010000041.1 | GCA021406705_00818 | CDS | open | 4741-5217 | _na 158_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 3442 | JAEMBM010000041.1 | GCA021406705_00819 | CDS | open | 5307-5471 | _na 54_aa | hypothetical protein | |
| 3443 | JAEMBM010000041.1 | GCA021406705_00820 | CDS | open | 5847-6236 | _na 129_aa | hinT | HIT family protein |
| 3444 | JAEMBM010000041.1 | GCA021406705_00821 | CDS | open | 6251-6721 | _na 156_aa | greA | transcription elongation factor GreA |
| 3445 | JAEMBM010000041.1 | GCA021406705_00822 | CDS | open | 7206-7808 | _na 200_aa | tsaC | L-threonylcarbamoyladenylate synthase |
| 3446 | JAEMBM010000041.1 | GCA021406705_00823 | CDS | open | 7815-8519 | _na 234_aa | comEA | Competence protein ComEA helix-hairpin-helix repeat region |
| 3447 | JAEMBM010000041.1 | GCA021406705_00824 | CDS | open | 8549-9208 | _na 219_aa | lolD | Lipoprotein-releasing system ATP-binding protein LolD |
| 3448 | JAEMBM010000041.1 | GCA021406705_00825 | CDS | open | 9205-9954 | _na 249_aa | tcdA | HesA/MoeB/ThiF family protein |
| 3449 | JAEMBM010000041.1 | GCA021406705_00826 | CDS | open | 9951-11045 | _na 364_aa | mltG | Endolytic murein transglycosylase |
| 3450 | JAEMBM010000041.1 | GCA021406705_00827 | CDS | open | 12114-13118 | _na 334_aa | Type II DNA modification methyltransferase | |
| 3451 | JAEMBM010000041.1 | GCA021406705_00828 | CDS | open | 13128-17081 | _na 1317_aa | Eco57I restriction-modification methylase domain-containing protein | |
| 3452 | JAEMBM010000041.1 | GCA021406705_00815 | gene | open | 226-2202 | gDB1 | ||
| 3453 | JAEMBM010000041.1 | GCA021406705_00816 | gene | open | 2199-3461 | rfaB | ||
| 3454 | JAEMBM010000041.1 | GCA021406705_00817 | gene | open | 3458-4744 | |||
| 3455 | JAEMBM010000041.1 | GCA021406705_00818 | gene | open | 4741-5217 | |||
| 3456 | JAEMBM010000041.1 | GCA021406705_00819 | gene | open | 5307-5471 | |||
| 3457 | JAEMBM010000041.1 | GCA021406705_00820 | gene | open | 5847-6236 | hinT | ||
| 3458 | JAEMBM010000041.1 | GCA021406705_00821 | gene | open | 6251-6721 | greA | ||
| 3459 | JAEMBM010000041.1 | GCA021406705_00822 | gene | open | 7206-7808 | tsaC | ||
| 3460 | JAEMBM010000041.1 | GCA021406705_00823 | gene | open | 7815-8519 | comEA | ||
| 3461 | JAEMBM010000041.1 | GCA021406705_00824 | gene | open | 8549-9208 | lolD | ||
| 3462 | JAEMBM010000041.1 | GCA021406705_00825 | gene | open | 9205-9954 | tcdA | ||
| 3463 | JAEMBM010000041.1 | GCA021406705_00826 | gene | open | 9951-11045 | mltG | ||
| 3464 | JAEMBM010000041.1 | GCA021406705_00827 | gene | open | 12114-13118 | |||
| 3465 | JAEMBM010000041.1 | GCA021406705_00828 | gene | open | 13128-17081 | |||
| 3466 | JAEMBM010000042.1 | repeat_region | open | 32-2053 | CRISPR array with 31 repeats of length 30%2C consensus sequence GTTTTAATTCCTGTATGGTGCAATTGAAAT and spacer length 36 | |||
| 3467 | JAEMBM010000042.1 | GCA021406705_01231 | CDS | open | 2289-2552 | _na 87_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 3468 | JAEMBM010000042.1 | GCA021406705_01232 | CDS | open | 2552-3568 | _na 338_aa | cas1b | type I-B CRISPR-associated endonuclease Cas1b |
| 3469 | JAEMBM010000042.1 | GCA021406705_01233 | CDS | open | 3565-4074 | _na 169_aa | cas4 | CRISPR-associated protein Cas4 |
| 3470 | JAEMBM010000042.1 | GCA021406705_01234 | CDS | open | 4192-5250 | _na 352_aa | CRISPR-associated protein Cas7 | |
| 3471 | JAEMBM010000042.1 | GCA021406705_01235 | CDS | open | 5271-6566 | _na 431_aa | hypothetical protein | |
| 3472 | JAEMBM010000042.1 | GCA021406705_01236 | CDS | open | 6577-8697 | _na 706_aa | putative CRISPR-associated helicase Cas3 core | |
| 3473 | JAEMBM010000042.1 | GCA021406705_01237 | CDS | open | 8714-9301 | _na 195_aa | CRISPR-associated protein Cas5 | |
| 3474 | JAEMBM010000042.1 | GCA021406705_01238 | CDS | open | 9308-9973 | _na 221_aa | cas6 | CRISPR-associated endoribonuclease Cas6 |
| 3475 | JAEMBM010000042.1 | GCA021406705_01239 | CDS | open | 10622-12553 | _na 643_aa | mdoB | Sulfatase N-terminal domain-containing protein |
| 3476 | JAEMBM010000042.1 | GCA021406705_01240 | CDS | open | 12557-15100 | _na 847_aa | yfhO | YfhO family protein |
| 3477 | JAEMBM010000042.1 | GCA021406705_01241 | CDS | open | 15266-16207 | _na 313_aa | fmt | methionyl-tRNA formyltransferase |
| 3478 | JAEMBM010000042.1 | GCA021406705_01243 | CDS | open | 16784-17089 | _na 101_aa | hypothetical protein | |
| 3479 | JAEMBM010000042.1 | GCA021406705_01231 | gene | open | 2289-2552 | cas2 | ||
| 3480 | JAEMBM010000042.1 | GCA021406705_01232 | gene | open | 2552-3568 | cas1b | ||
| 3481 | JAEMBM010000042.1 | GCA021406705_01233 | gene | open | 3565-4074 | cas4 | ||
| 3482 | JAEMBM010000042.1 | GCA021406705_01234 | gene | open | 4192-5250 | |||
| 3483 | JAEMBM010000042.1 | GCA021406705_01235 | gene | open | 5271-6566 | |||
| 3484 | JAEMBM010000042.1 | GCA021406705_01236 | gene | open | 6577-8697 | |||
| 3485 | JAEMBM010000042.1 | GCA021406705_01237 | gene | open | 8714-9301 | |||
| 3486 | JAEMBM010000042.1 | GCA021406705_01238 | gene | open | 9308-9973 | cas6 | ||
| 3487 | JAEMBM010000042.1 | GCA021406705_01239 | gene | open | 10622-12553 | mdoB | ||
| 3488 | JAEMBM010000042.1 | GCA021406705_01240 | gene | open | 12557-15100 | yfhO | ||
| 3489 | JAEMBM010000042.1 | GCA021406705_01241 | gene | open | 15266-16207 | fmt | ||
| 3490 | JAEMBM010000042.1 | GCA021406705_01243 | gene | open | 16784-17089 | |||
| 3491 | JAEMBM010000042.1 | GCA021406705_01242 | gene | open | 16464-16537 | trnD | ||
| 3492 | JAEMBM010000042.1 | GCA021406705_01242 | tRNA | open | 16464-16537 | trnD | tRNA-Asp(gtc) | |
| 3493 | JAEMBM010000043.1 | GCA021406705_01622 | CDS | open | 1306-2664 | _na 452_aa | Tyr recombinase domain-containing protein | |
| 3494 | JAEMBM010000043.1 | GCA021406705_01623 | CDS | open | 2677-3945 | _na 422_aa | yhcG | YhcG PDDEXK nuclease domain-containing protein |
| 3495 | JAEMBM010000043.1 | GCA021406705_01624 | CDS | open | 4022-5134 | _na 370_aa | Metallo-beta-lactamase domain-containing protein | |
| 3496 | JAEMBM010000043.1 | GCA021406705_01625 | CDS | open | 5272-5931 | _na 219_aa | Mobilization protein | |
| 3497 | JAEMBM010000043.1 | GCA021406705_01626 | CDS | open | 5953-6879 | _na 308_aa | MobA/VirD2-like nuclease domain-containing protein | |
| 3498 | JAEMBM010000043.1 | GCA021406705_01627 | CDS | open | 6876-7223 | _na 115_aa | mobC | Plasmid mobilization relaxosome protein MobC |
| 3499 | JAEMBM010000043.1 | GCA021406705_01628 | CDS | open | 7346-8236 | _na 296_aa | Mobilization protein | |
| 3500 | JAEMBM010000043.1 | GCA021406705_01629 | CDS | open | 8419-9468 | _na 349_aa | Mobilization protein |

