BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_021406705.1)
Select a Genome:
|
BAKTA Annotations for GCA_021406705.1
|
Search & Sort all 4269 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | JAEMBM010000043.1 | GCA021406705_01630 | CDS | open | 9465-9773 | _na 102_aa | DUF3853 domain-containing protein | |
| 3502 | JAEMBM010000043.1 | GCA021406705_01631 | CDS | open | 10127-10228 | _na 33_aa | Transcriptional regulator | |
| 3503 | JAEMBM010000043.1 | GCA021406705_01632 | CDS | open | 10291-12489 | _na 732_aa | NERD domain-containing protein | |
| 3504 | JAEMBM010000043.1 | GCA021406705_01633 | CDS | open | 12540-12659 | _na 39_aa | hypothetical protein | |
| 3505 | JAEMBM010000043.1 | GCA021406705_01634 | CDS | open | 13327-13668 | _na 113_aa | rodZ | HTH cro/C1-type domain-containing protein |
| 3506 | JAEMBM010000043.1 | GCA021406705_01635 | CDS | open | 13671-14060 | _na 129_aa | Conserved domain protein | |
| 3507 | JAEMBM010000043.1 | GCA021406705_01636 | CDS | open | 14057-16105 | _na 682_aa | Topoisomerase | |
| 3508 | JAEMBM010000043.1 | GCA021406705_01622 | gene | open | 1306-2664 | |||
| 3509 | JAEMBM010000043.1 | GCA021406705_01623 | gene | open | 2677-3945 | yhcG | ||
| 3510 | JAEMBM010000043.1 | GCA021406705_01624 | gene | open | 4022-5134 | |||
| 3511 | JAEMBM010000043.1 | GCA021406705_01625 | gene | open | 5272-5931 | |||
| 3512 | JAEMBM010000043.1 | GCA021406705_01626 | gene | open | 5953-6879 | |||
| 3513 | JAEMBM010000043.1 | GCA021406705_01627 | gene | open | 6876-7223 | mobC | ||
| 3514 | JAEMBM010000043.1 | GCA021406705_01628 | gene | open | 7346-8236 | |||
| 3515 | JAEMBM010000043.1 | GCA021406705_01629 | gene | open | 8419-9468 | |||
| 3516 | JAEMBM010000043.1 | GCA021406705_01630 | gene | open | 9465-9773 | |||
| 3517 | JAEMBM010000043.1 | GCA021406705_01631 | gene | open | 10127-10228 | |||
| 3518 | JAEMBM010000043.1 | GCA021406705_01632 | gene | open | 10291-12489 | |||
| 3519 | JAEMBM010000043.1 | GCA021406705_01633 | gene | open | 12540-12659 | |||
| 3520 | JAEMBM010000043.1 | GCA021406705_01634 | gene | open | 13327-13668 | rodZ | ||
| 3521 | JAEMBM010000043.1 | GCA021406705_01635 | gene | open | 13671-14060 | |||
| 3522 | JAEMBM010000043.1 | GCA021406705_01636 | gene | open | 14057-16105 | |||
| 3523 | JAEMBM010000044.1 | GCA021406705_01386 | CDS | open | 282-1481 | _na 399_aa | lipid A deacylase | |
| 3524 | JAEMBM010000044.1 | GCA021406705_01387 | CDS | open | 1478-2458 | _na 326_aa | hflC | Band 7/Mec-2 family protein |
| 3525 | JAEMBM010000044.1 | GCA021406705_01388 | CDS | open | 2486-2950 | _na 154_aa | ybbJ | Membrane protein%2C putative |
| 3526 | JAEMBM010000044.1 | GCA021406705_01389 | CDS | open | 3432-3605 | _na 57_aa | hypothetical protein | |
| 3527 | JAEMBM010000044.1 | GCA021406705_01390 | CDS | open | 3669-3854 | _na 61_aa | hypothetical protein | |
| 3528 | JAEMBM010000044.1 | GCA021406705_01391 | CDS | open | 3918-4343 | _na 141_aa | lexA | Translesion error-prone DNA polymerase V autoproteolytic subunit |
| 3529 | JAEMBM010000044.1 | GCA021406705_01392 | CDS | open | 4351-5649 | _na 432_aa | Putative SOS mutagenesis and repair UmuC-like protein | |
| 3530 | JAEMBM010000044.1 | GCA021406705_01393 | CDS | open | 6330-7880 | _na 516_aa | lldP | L-lactate permease |
| 3531 | JAEMBM010000044.1 | GCA021406705_01394 | CDS | open | 8206-8667 | _na 153_aa | Cell division protein | |
| 3532 | JAEMBM010000044.1 | GCA021406705_01395 | CDS | open | 8667-9683 | _na 338_aa | murB | UDP-N-acetylmuramate dehydrogenase |
| 3533 | JAEMBM010000044.1 | GCA021406705_01396 | CDS | open | 9710-11188 | _na 492_aa | lipB | MBL fold metallo-hydrolase |
| 3534 | JAEMBM010000044.1 | GCA021406705_01397 | CDS | open | 11673-12794 | _na 373_aa | rfaB | Glycosyl transferase family 1 domain-containing protein |
| 3535 | JAEMBM010000044.1 | GCA021406705_01398 | CDS | open | 12791-14062 | _na 423_aa | rfaB | Glycosyl transferase%2C group 1 family protein |
| 3536 | JAEMBM010000044.1 | GCA021406705_01399 | CDS | open | 14199-14663 | _na 154_aa | queF | preQ(1) synthase |
| 3537 | JAEMBM010000044.1 | GCA021406705_01400 | CDS | open | 14691-15572 | _na 293_aa | lCB5 | DAGKc domain-containing protein |
| 3538 | JAEMBM010000044.1 | GCA021406705_01401 | CDS | open | 15588-15839 | _na 83_aa | hypothetical protein | |
| 3539 | JAEMBM010000044.1 | GCA021406705_01386 | gene | open | 282-1481 | |||
| 3540 | JAEMBM010000044.1 | GCA021406705_01387 | gene | open | 1478-2458 | hflC | ||
| 3541 | JAEMBM010000044.1 | GCA021406705_01388 | gene | open | 2486-2950 | ybbJ | ||
| 3542 | JAEMBM010000044.1 | GCA021406705_01389 | gene | open | 3432-3605 | |||
| 3543 | JAEMBM010000044.1 | GCA021406705_01390 | gene | open | 3669-3854 | |||
| 3544 | JAEMBM010000044.1 | GCA021406705_01391 | gene | open | 3918-4343 | lexA | ||
| 3545 | JAEMBM010000044.1 | GCA021406705_01392 | gene | open | 4351-5649 | |||
| 3546 | JAEMBM010000044.1 | GCA021406705_01393 | gene | open | 6330-7880 | lldP | ||
| 3547 | JAEMBM010000044.1 | GCA021406705_01394 | gene | open | 8206-8667 | |||
| 3548 | JAEMBM010000044.1 | GCA021406705_01395 | gene | open | 8667-9683 | murB | ||
| 3549 | JAEMBM010000044.1 | GCA021406705_01396 | gene | open | 9710-11188 | lipB | ||
| 3550 | JAEMBM010000044.1 | GCA021406705_01397 | gene | open | 11673-12794 | rfaB | ||
| 3551 | JAEMBM010000044.1 | GCA021406705_01398 | gene | open | 12791-14062 | rfaB | ||
| 3552 | JAEMBM010000044.1 | GCA021406705_01399 | gene | open | 14199-14663 | queF | ||
| 3553 | JAEMBM010000044.1 | GCA021406705_01400 | gene | open | 14691-15572 | lCB5 | ||
| 3554 | JAEMBM010000044.1 | GCA021406705_01401 | gene | open | 15588-15839 | |||
| 3555 | JAEMBM010000045.1 | regulatory_region | open | 3810-3869 | SAM-II riboswitch aptamer (SAM-II long loop) | |||
| 3556 | JAEMBM010000045.1 | regulatory_region | open | 8977-9090 | TPP riboswitch aptamer (THI element) | |||
| 3557 | JAEMBM010000045.1 | GCA021406705_00061 | CDS | open | 591-1106 | _na 171_aa | hypothetical protein | |
| 3558 | JAEMBM010000045.1 | GCA021406705_00062 | CDS | open | 1212-1340 | _na 42_aa | hypothetical protein | |
| 3559 | JAEMBM010000045.1 | GCA021406705_00063 | CDS | open | 1651-2229 | _na 192_aa | hypothetical protein | |
| 3560 | JAEMBM010000045.1 | GCA021406705_00064 | CDS | open | 2234-2449 | _na 71_aa | Immunity protein 26 of polymorphic toxin system | |
| 3561 | JAEMBM010000045.1 | GCA021406705_00065 | CDS | open | 2834-3532 | _na 232_aa | hypothetical protein | |
| 3562 | JAEMBM010000045.1 | GCA021406705_00066 | CDS | open | 3958-5247 | _na 429_aa | metK | methionine adenosyltransferase |
| 3563 | JAEMBM010000045.1 | GCA021406705_00067 | CDS | open | 5376-6053 | _na 225_aa | thiN | thiamine diphosphokinase |
| 3564 | JAEMBM010000045.1 | GCA021406705_00068 | CDS | open | 6050-6658 | _na 202_aa | pnuC | nicotinamide riboside transporter PnuC |
| 3565 | JAEMBM010000045.1 | GCA021406705_00069 | CDS | open | 6663-8900 | _na 745_aa | cirA | TonB-dependent receptor |
| 3566 | JAEMBM010000045.1 | GCA021406705_00070 | CDS | open | 9123-10070 | _na 315_aa | rsgA | ribosome small subunit-dependent GTPase A |
| 3567 | JAEMBM010000045.1 | GCA021406705_00071 | CDS | open | 10155-10715 | _na 186_aa | frr | ribosome recycling factor |
| 3568 | JAEMBM010000045.1 | GCA021406705_00072 | CDS | open | 10752-11471 | _na 239_aa | pyrH | UMP kinase |
| 3569 | JAEMBM010000045.1 | GCA021406705_00073 | CDS | open | 11554-13545 | _na 663_aa | DUF6819 domain-containing protein | |
| 3570 | JAEMBM010000045.1 | GCA021406705_00074 | CDS | open | 13756-14061 | _na 101_aa | hypothetical protein | |
| 3571 | JAEMBM010000045.1 | GCA021406705_00061 | gene | open | 591-1106 | |||
| 3572 | JAEMBM010000045.1 | GCA021406705_00062 | gene | open | 1212-1340 | |||
| 3573 | JAEMBM010000045.1 | GCA021406705_00063 | gene | open | 1651-2229 | |||
| 3574 | JAEMBM010000045.1 | GCA021406705_00064 | gene | open | 2234-2449 | |||
| 3575 | JAEMBM010000045.1 | GCA021406705_00065 | gene | open | 2834-3532 | |||
| 3576 | JAEMBM010000045.1 | GCA021406705_00066 | gene | open | 3958-5247 | metK | ||
| 3577 | JAEMBM010000045.1 | GCA021406705_00067 | gene | open | 5376-6053 | thiN | ||
| 3578 | JAEMBM010000045.1 | GCA021406705_00068 | gene | open | 6050-6658 | pnuC | ||
| 3579 | JAEMBM010000045.1 | GCA021406705_00069 | gene | open | 6663-8900 | cirA | ||
| 3580 | JAEMBM010000045.1 | GCA021406705_00070 | gene | open | 9123-10070 | rsgA | ||
| 3581 | JAEMBM010000045.1 | GCA021406705_00071 | gene | open | 10155-10715 | frr | ||
| 3582 | JAEMBM010000045.1 | GCA021406705_00072 | gene | open | 10752-11471 | pyrH | ||
| 3583 | JAEMBM010000045.1 | GCA021406705_00073 | gene | open | 11554-13545 | |||
| 3584 | JAEMBM010000045.1 | GCA021406705_00074 | gene | open | 13756-14061 | |||
| 3585 | JAEMBM010000046.1 | GCA021406705_00154 | CDS | open | 270-527 | _na 85_aa | rpmE2 | type B 50S ribosomal protein L31 |
| 3586 | JAEMBM010000046.1 | GCA021406705_00155 | CDS | open | 744-2240 | _na 498_aa | degQ | HtrA protein |
| 3587 | JAEMBM010000046.1 | GCA021406705_00156 | CDS | open | 2430-3293 | _na 287_aa | rpoD | RNA polymerase sigma-70 factor |
| 3588 | JAEMBM010000046.1 | GCA021406705_00157 | CDS | open | 3390-3743 | _na 117_aa | rpsF | 30S ribosomal protein S6 |
| 3589 | JAEMBM010000046.1 | GCA021406705_00158 | CDS | open | 3747-4019 | _na 90_aa | rpsR | 30S ribosomal protein S18 |
| 3590 | JAEMBM010000046.1 | GCA021406705_00159 | CDS | open | 4044-4583 | _na 179_aa | rplI | 50S ribosomal protein L9 |
| 3591 | JAEMBM010000046.1 | GCA021406705_00160 | CDS | open | 4859-6814 | _na 651_aa | lptF | YjgP/YjgQ family permease |
| 3592 | JAEMBM010000046.1 | GCA021406705_00161 | CDS | open | 6814-8034 | _na 406_aa | ribBA | bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II |
| 3593 | JAEMBM010000046.1 | GCA021406705_00162 | CDS | open | 8841-9881 | _na 346_aa | porQ | type IX secretion system protein PorQ |
| 3594 | JAEMBM010000046.1 | GCA021406705_00163 | CDS | open | 9911-10606 | _na 231_aa | cmk | (d)CMP kinase |
| 3595 | JAEMBM010000046.1 | GCA021406705_00164 | CDS | open | 10603-11472 | _na 289_aa | ispH | 4-hydroxy-3-methylbut-2-enyl diphosphate reductase |
| 3596 | JAEMBM010000046.1 | GCA021406705_00165 | CDS | open | 11456-12499 | _na 347_aa | Endonuclease/exonuclease/phosphatase domain-containing protein | |
| 3597 | JAEMBM010000046.1 | GCA021406705_00166 | CDS | open | 12761-13255 | _na 164_aa | Thioredoxin-like fold domain-containing protein | |
| 3598 | JAEMBM010000046.1 | GCA021406705_00154 | gene | open | 270-527 | rpmE2 | ||
| 3599 | JAEMBM010000046.1 | GCA021406705_00155 | gene | open | 744-2240 | degQ | ||
| 3600 | JAEMBM010000046.1 | GCA021406705_00156 | gene | open | 2430-3293 | rpoD | ||
| 3601 | JAEMBM010000046.1 | GCA021406705_00157 | gene | open | 3390-3743 | rpsF | ||
| 3602 | JAEMBM010000046.1 | GCA021406705_00158 | gene | open | 3747-4019 | rpsR | ||
| 3603 | JAEMBM010000046.1 | GCA021406705_00159 | gene | open | 4044-4583 | rplI | ||
| 3604 | JAEMBM010000046.1 | GCA021406705_00160 | gene | open | 4859-6814 | lptF | ||
| 3605 | JAEMBM010000046.1 | GCA021406705_00161 | gene | open | 6814-8034 | ribBA | ||
| 3606 | JAEMBM010000046.1 | GCA021406705_00162 | gene | open | 8841-9881 | porQ | ||
| 3607 | JAEMBM010000046.1 | GCA021406705_00163 | gene | open | 9911-10606 | cmk | ||
| 3608 | JAEMBM010000046.1 | GCA021406705_00164 | gene | open | 10603-11472 | ispH | ||
| 3609 | JAEMBM010000046.1 | GCA021406705_00165 | gene | open | 11456-12499 | |||
| 3610 | JAEMBM010000046.1 | GCA021406705_00166 | gene | open | 12761-13255 | |||
| 3611 | JAEMBM010000047.1 | GCA021406705_00217 | CDS | open | 302-787 | _na 161_aa | ubiG | bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG |
| 3612 | JAEMBM010000047.1 | GCA021406705_00218 | CDS | open | 1099-1455 | _na 118_aa | alpA | Helix-turn-helix domain-containing protein |
| 3613 | JAEMBM010000047.1 | GCA021406705_00219 | CDS | open | 1484-2494 | _na 336_aa | vapE | VapE domain-containing protein |
| 3614 | JAEMBM010000047.1 | GCA021406705_00220 | CDS | open | 2443-2676 | _na 77_aa | Virulence-associated protein E | |
| 3615 | JAEMBM010000047.1 | GCA021406705_00221 | CDS | open | 2904-3794 | _na 296_aa | dnaG | Zinc finger CHC2-type domain-containing protein |
| 3616 | JAEMBM010000047.1 | GCA021406705_00222 | CDS | open | 4005-4283 | _na 92_aa | mobC | MobC family plasmid mobilization relaxosome protein |
| 3617 | JAEMBM010000047.1 | GCA021406705_00223 | CDS | open | 4273-5214 | _na 313_aa | traI | Conjugal transfer relaxase TraI |
| 3618 | JAEMBM010000047.1 | GCA021406705_00224 | CDS | open | 5240-5962 | _na 240_aa | Viral A-type inclusion protein | |
| 3619 | JAEMBM010000047.1 | GCA021406705_00225 | CDS | open | 6080-6295 | _na 71_aa | Transcriptional regulator | |
| 3620 | JAEMBM010000047.1 | GCA021406705_00226 | CDS | open | 6366-7580 | _na 404_aa | SIR2-like domain-containing protein | |
| 3621 | JAEMBM010000047.1 | GCA021406705_00227 | CDS | open | 7570-9447 | _na 625_aa | ATP-binding protein | |
| 3622 | JAEMBM010000047.1 | GCA021406705_00228 | CDS | open | 9732-10778 | _na 348_aa | Restriction endonuclease type IV Mrr domain-containing protein | |
| 3623 | JAEMBM010000047.1 | GCA021406705_00229 | CDS | open | 10837-12201 | _na 454_aa | Divergent AAA domain protein | |
| 3624 | JAEMBM010000047.1 | GCA021406705_00230 | CDS | open | 13200-13436 | _na 78_aa | transposase | |
| 3625 | JAEMBM010000047.1 | GCA021406705_00217 | gene | open | 302-787 | ubiG | ||
| 3626 | JAEMBM010000047.1 | GCA021406705_00218 | gene | open | 1099-1455 | alpA | ||
| 3627 | JAEMBM010000047.1 | GCA021406705_00219 | gene | open | 1484-2494 | vapE | ||
| 3628 | JAEMBM010000047.1 | GCA021406705_00220 | gene | open | 2443-2676 | |||
| 3629 | JAEMBM010000047.1 | GCA021406705_00221 | gene | open | 2904-3794 | dnaG | ||
| 3630 | JAEMBM010000047.1 | GCA021406705_00222 | gene | open | 4005-4283 | mobC | ||
| 3631 | JAEMBM010000047.1 | GCA021406705_00223 | gene | open | 4273-5214 | traI | ||
| 3632 | JAEMBM010000047.1 | GCA021406705_00224 | gene | open | 5240-5962 | |||
| 3633 | JAEMBM010000047.1 | GCA021406705_00225 | gene | open | 6080-6295 | |||
| 3634 | JAEMBM010000047.1 | GCA021406705_00226 | gene | open | 6366-7580 | |||
| 3635 | JAEMBM010000047.1 | GCA021406705_00227 | gene | open | 7570-9447 | |||
| 3636 | JAEMBM010000047.1 | GCA021406705_00228 | gene | open | 9732-10778 | |||
| 3637 | JAEMBM010000047.1 | GCA021406705_00229 | gene | open | 10837-12201 | |||
| 3638 | JAEMBM010000047.1 | GCA021406705_00230 | gene | open | 13200-13436 | |||
| 3639 | JAEMBM010000048.1 | GCA021406705_00932 | CDS | open | 753-1352 | _na 199_aa | acrR | Transcriptional regulator%2C tetR family |
| 3640 | JAEMBM010000048.1 | GCA021406705_00933 | CDS | open | 1393-3798 | _na 801_aa | mMPL | SSD domain-containing protein |
| 3641 | JAEMBM010000048.1 | GCA021406705_00934 | CDS | open | 3876-4667 | _na 263_aa | Outer membrane lipoprotein-sorting protein | |
| 3642 | JAEMBM010000048.1 | GCA021406705_00935 | CDS | open | 4671-5948 | _na 425_aa | Porin | |
| 3643 | JAEMBM010000048.1 | GCA021406705_00936 | CDS | open | 5988-7742 | _na 584_aa | mdlB | ABC transporter ATP-binding protein |
| 3644 | JAEMBM010000048.1 | GCA021406705_00937 | CDS | open | 7789-9495 | _na 568_aa | mdlB | ABC transporter%2C ATP-binding protein%2C putative |
| 3645 | JAEMBM010000048.1 | GCA021406705_00938 | CDS | open | 9668-9778 | _na 36_aa | hypothetical protein | |
| 3646 | JAEMBM010000048.1 | GCA021406705_00939 | CDS | open | 10230-11939 | _na 569_aa | ctpA | Carboxyl-terminal processing protease |
| 3647 | JAEMBM010000048.1 | GCA021406705_00940 | CDS | open | 12253-13296 | _na 347_aa | tnp | ISAs1 family ISPg6 transposase |
| 3648 | JAEMBM010000048.1 | GCA021406705_00932 | gene | open | 753-1352 | acrR | ||
| 3649 | JAEMBM010000048.1 | GCA021406705_00933 | gene | open | 1393-3798 | mMPL | ||
| 3650 | JAEMBM010000048.1 | GCA021406705_00934 | gene | open | 3876-4667 | |||
| 3651 | JAEMBM010000048.1 | GCA021406705_00935 | gene | open | 4671-5948 | |||
| 3652 | JAEMBM010000048.1 | GCA021406705_00936 | gene | open | 5988-7742 | mdlB | ||
| 3653 | JAEMBM010000048.1 | GCA021406705_00937 | gene | open | 7789-9495 | mdlB | ||
| 3654 | JAEMBM010000048.1 | GCA021406705_00938 | gene | open | 9668-9778 | |||
| 3655 | JAEMBM010000048.1 | GCA021406705_00939 | gene | open | 10230-11939 | ctpA | ||
| 3656 | JAEMBM010000048.1 | GCA021406705_00940 | gene | open | 12253-13296 | tnp | ||
| 3657 | JAEMBM010000049.1 | GCA021406705_00143 | CDS | open | 823-2364 | _na 513_aa | yifB | Magnesium chelatase%2C subunit D/I family |
| 3658 | JAEMBM010000049.1 | GCA021406705_00144 | CDS | open | 2390-3412 | _na 340_aa | bcp | Alkyl hydroperoxide reductase subunit C/ Thiol specific antioxidant domain-containing protein |
| 3659 | JAEMBM010000049.1 | GCA021406705_00145 | CDS | open | 3427-4008 | _na 193_aa | purN | Phosphoribosylglycinamide formyltransferase |
| 3660 | JAEMBM010000049.1 | GCA021406705_00146 | CDS | open | 4177-4413 | _na 78_aa | acpP | acyl carrier protein |
| 3661 | JAEMBM010000049.1 | GCA021406705_00147 | CDS | open | 4423-5679 | _na 418_aa | fabF | beta-ketoacyl-ACP synthase II |
| 3662 | JAEMBM010000049.1 | GCA021406705_00148 | CDS | open | 5691-6473 | _na 260_aa | rnc | ribonuclease III |
| 3663 | JAEMBM010000049.1 | GCA021406705_00149 | CDS | open | 6600-9545 | _na 981_aa | secDF | protein translocase subunit SecDF |
| 3664 | JAEMBM010000049.1 | GCA021406705_00150 | CDS | open | 9783-10337 | _na 184_aa | rimI | N-acetyltransferase domain-containing protein |
| 3665 | JAEMBM010000049.1 | GCA021406705_00151 | CDS | open | 10285-10914 | _na 209_aa | znuC | ABC transporter%2C ATP-binding protein |
| 3666 | JAEMBM010000049.1 | GCA021406705_00152 | CDS | open | 10904-11851 | _na 315_aa | znuA | putative zinc ABC transporter zinc-binding protein |
| 3667 | JAEMBM010000049.1 | GCA021406705_00153 | CDS | open | 11967-12236 | _na 89_aa | rpsO | 30S ribosomal protein S15 |
| 3668 | JAEMBM010000049.1 | GCA021406705_00143 | gene | open | 823-2364 | yifB | ||
| 3669 | JAEMBM010000049.1 | GCA021406705_00144 | gene | open | 2390-3412 | bcp | ||
| 3670 | JAEMBM010000049.1 | GCA021406705_00145 | gene | open | 3427-4008 | purN | ||
| 3671 | JAEMBM010000049.1 | GCA021406705_00146 | gene | open | 4177-4413 | acpP | ||
| 3672 | JAEMBM010000049.1 | GCA021406705_00147 | gene | open | 4423-5679 | fabF | ||
| 3673 | JAEMBM010000049.1 | GCA021406705_00148 | gene | open | 5691-6473 | rnc | ||
| 3674 | JAEMBM010000049.1 | GCA021406705_00149 | gene | open | 6600-9545 | secDF | ||
| 3675 | JAEMBM010000049.1 | GCA021406705_00150 | gene | open | 9783-10337 | rimI | ||
| 3676 | JAEMBM010000049.1 | GCA021406705_00151 | gene | open | 10285-10914 | znuC | ||
| 3677 | JAEMBM010000049.1 | GCA021406705_00152 | gene | open | 10904-11851 | znuA | ||
| 3678 | JAEMBM010000049.1 | GCA021406705_00153 | gene | open | 11967-12236 | rpsO | ||
| 3679 | JAEMBM010000050.1 | regulatory_region | open | 9965-10076 | TPP riboswitch aptamer (THI element) | |||
| 3680 | JAEMBM010000050.1 | GCA021406705_00167 | CDS | open | 1159-1434 | _na 91_aa | hypothetical protein | |
| 3681 | JAEMBM010000050.1 | GCA021406705_00169 | CDS | open | 2385-2945 | _na 186_aa | Lipoprotein | |
| 3682 | JAEMBM010000050.1 | GCA021406705_00170 | CDS | open | 3146-3823 | _na 225_aa | porT | Outer membrane protein beta-barrel domain-containing protein |
| 3683 | JAEMBM010000050.1 | GCA021406705_00171 | CDS | open | 3940-5052 | _na 370_aa | thiH | 2-iminoacetate synthase ThiH |
| 3684 | JAEMBM010000050.1 | GCA021406705_00172 | CDS | open | 5065-5838 | _na 257_aa | thiG | Thiazole synthase |
| 3685 | JAEMBM010000050.1 | GCA021406705_00173 | CDS | open | 5903-7846 | _na 647_aa | thiE | thiamine phosphate synthase |
| 3686 | JAEMBM010000050.1 | GCA021406705_00174 | CDS | open | 7843-9672 | _na 609_aa | thiC | phosphomethylpyrimidine synthase ThiC |
| 3687 | JAEMBM010000050.1 | GCA021406705_00175 | CDS | open | 9676-9876 | _na 66_aa | thiS | sulfur carrier protein ThiS |
| 3688 | JAEMBM010000050.1 | GCA021406705_00176 | CDS | open | 10244-11014 | _na 256_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 3689 | JAEMBM010000050.1 | GCA021406705_00177 | CDS | open | 11274-11582 | _na 102_aa | Lipoprotein | |
| 3690 | JAEMBM010000050.1 | GCA021406705_00178 | CDS | open | 11618-12265 | _na 215_aa | Secretion system C-terminal sorting domain-containing protein | |
| 3691 | JAEMBM010000050.1 | GCA021406705_00179 | CDS | open | 12372-12542 | _na 56_aa | hypothetical protein | |
| 3692 | JAEMBM010000050.1 | GCA021406705_00180 | CDS | open | 12594-12764 | _na 56_aa | hypothetical protein | |
| 3693 | JAEMBM010000050.1 | GCA021406705_00181 | CDS | open | 12777-13157 | _na 126_aa | tnp | IS3 family ISPg5 transposase ORF A |
| 3694 | JAEMBM010000050.1 | GCA021406705_00167 | gene | open | 1159-1434 | |||
| 3695 | JAEMBM010000050.1 | GCA021406705_00169 | gene | open | 2385-2945 | |||
| 3696 | JAEMBM010000050.1 | GCA021406705_00170 | gene | open | 3146-3823 | porT | ||
| 3697 | JAEMBM010000050.1 | GCA021406705_00171 | gene | open | 3940-5052 | thiH | ||
| 3698 | JAEMBM010000050.1 | GCA021406705_00172 | gene | open | 5065-5838 | thiG | ||
| 3699 | JAEMBM010000050.1 | GCA021406705_00173 | gene | open | 5903-7846 | thiE | ||
| 3700 | JAEMBM010000050.1 | GCA021406705_00174 | gene | open | 7843-9672 | thiC | ||
| 3701 | JAEMBM010000050.1 | GCA021406705_00175 | gene | open | 9676-9876 | thiS | ||
| 3702 | JAEMBM010000050.1 | GCA021406705_00176 | gene | open | 10244-11014 | |||
| 3703 | JAEMBM010000050.1 | GCA021406705_00177 | gene | open | 11274-11582 | |||
| 3704 | JAEMBM010000050.1 | GCA021406705_00178 | gene | open | 11618-12265 | |||
| 3705 | JAEMBM010000050.1 | GCA021406705_00179 | gene | open | 12372-12542 | |||
| 3706 | JAEMBM010000050.1 | GCA021406705_00180 | gene | open | 12594-12764 | |||
| 3707 | JAEMBM010000050.1 | GCA021406705_00181 | gene | open | 12777-13157 | tnp | ||
| 3708 | JAEMBM010000050.1 | GCA021406705_00168 | gene | open | 2088-2161 | trnM | ||
| 3709 | JAEMBM010000050.1 | GCA021406705_00168 | tRNA | open | 2088-2161 | trnM | tRNA-Met(cat) | |
| 3710 | JAEMBM010000051.1 | GCA021406705_00051 | CDS | open | 325-1992 | _na 555_aa | fhs | formate--tetrahydrofolate ligase |
| 3711 | JAEMBM010000051.1 | GCA021406705_00052 | CDS | open | 2149-3483 | _na 444_aa | ylaK | PhoH family protein |
| 3712 | JAEMBM010000051.1 | GCA021406705_00053 | CDS | open | 3531-4100 | _na 189_aa | ruvC | crossover junction endodeoxyribonuclease RuvC |
| 3713 | JAEMBM010000051.1 | GCA021406705_00054 | CDS | open | 4108-4668 | _na 186_aa | DUF4286 domain-containing protein | |
| 3714 | JAEMBM010000051.1 | GCA021406705_00055 | CDS | open | 4770-6080 | _na 436_aa | aspB | Aminotransferase class I/classII large domain-containing protein |
| 3715 | JAEMBM010000051.1 | GCA021406705_00056 | CDS | open | 6123-8279 | _na 718_aa | patZN | Acetyltransferase |
| 3716 | JAEMBM010000051.1 | GCA021406705_00057 | CDS | open | 9231-9650 | _na 139_aa | mscL | large-conductance mechanosensitive channel protein MscL |
| 3717 | JAEMBM010000051.1 | GCA021406705_00058 | CDS | open | 10029-11186 | _na 385_aa | pntA | proton-translocating NAD(P)(+) transhydrogenase |
| 3718 | JAEMBM010000051.1 | GCA021406705_00059 | CDS | open | 11296-11610 | _na 104_aa | pntA | proton-translocating NAD(P)(+) transhydrogenase |
| 3719 | JAEMBM010000051.1 | GCA021406705_00060 | CDS | open | 12071-12577 | _na 168_aa | hypothetical protein | |
| 3720 | JAEMBM010000051.1 | GCA021406705_00051 | gene | open | 325-1992 | fhs | ||
| 3721 | JAEMBM010000051.1 | GCA021406705_00052 | gene | open | 2149-3483 | ylaK | ||
| 3722 | JAEMBM010000051.1 | GCA021406705_00053 | gene | open | 3531-4100 | ruvC | ||
| 3723 | JAEMBM010000051.1 | GCA021406705_00054 | gene | open | 4108-4668 | |||
| 3724 | JAEMBM010000051.1 | GCA021406705_00055 | gene | open | 4770-6080 | aspB | ||
| 3725 | JAEMBM010000051.1 | GCA021406705_00056 | gene | open | 6123-8279 | patZN | ||
| 3726 | JAEMBM010000051.1 | GCA021406705_00057 | gene | open | 9231-9650 | mscL | ||
| 3727 | JAEMBM010000051.1 | GCA021406705_00058 | gene | open | 10029-11186 | pntA | ||
| 3728 | JAEMBM010000051.1 | GCA021406705_00059 | gene | open | 11296-11610 | pntA | ||
| 3729 | JAEMBM010000051.1 | GCA021406705_00060 | gene | open | 12071-12577 | |||
| 3730 | JAEMBM010000052.1 | GCA021406705_01795 | CDS | open | 315-653 | _na 112_aa | hypothetical protein | |
| 3731 | JAEMBM010000052.1 | GCA021406705_01796 | CDS | open | 681-1706 | _na 341_aa | hypothetical protein | |
| 3732 | JAEMBM010000052.1 | GCA021406705_01797 | CDS | open | 1932-2780 | _na 282_aa | lipA | lipoyl synthase |
| 3733 | JAEMBM010000052.1 | GCA021406705_01798 | CDS | open | 2884-5055 | _na 723_aa | dAP2 | Dipeptidyl aminopeptidase IV |
| 3734 | JAEMBM010000052.1 | GCA021406705_01799 | CDS | open | 5095-5556 | _na 153_aa | smpB | SsrA-binding protein SmpB |
| 3735 | JAEMBM010000052.1 | GCA021406705_01800 | CDS | open | 5589-6671 | _na 360_aa | lptF | YjgP/YjgQ family permease |
| 3736 | JAEMBM010000052.1 | GCA021406705_01801 | CDS | open | 6688-7818 | _na 376_aa | tgt | tRNA guanosine(34) transglycosylase Tgt |
| 3737 | JAEMBM010000052.1 | GCA021406705_01802 | CDS | open | 8008-8283 | _na 91_aa | traJ | Conjugative transposon TraJ C-terminal domain-containing protein |
| 3738 | JAEMBM010000052.1 | GCA021406705_01803 | CDS | open | 8611-9096 | _na 161_aa | luxS | S-ribosylhomocysteine lyase |
| 3739 | JAEMBM010000052.1 | GCA021406705_01804 | CDS | open | 9115-9801 | _na 228_aa | mtnN | 5'-methylthioadenosine/adenosylhomocysteine nucleosidase |
| 3740 | JAEMBM010000052.1 | GCA021406705_01805 | CDS | open | 10203-11597 | _na 464_aa | cTD-A | T9SS C-terminal target domain-containing protein |
| 3741 | JAEMBM010000052.1 | GCA021406705_01795 | gene | open | 315-653 | |||
| 3742 | JAEMBM010000052.1 | GCA021406705_01796 | gene | open | 681-1706 | |||
| 3743 | JAEMBM010000052.1 | GCA021406705_01797 | gene | open | 1932-2780 | lipA | ||
| 3744 | JAEMBM010000052.1 | GCA021406705_01798 | gene | open | 2884-5055 | dAP2 | ||
| 3745 | JAEMBM010000052.1 | GCA021406705_01799 | gene | open | 5095-5556 | smpB | ||
| 3746 | JAEMBM010000052.1 | GCA021406705_01800 | gene | open | 5589-6671 | lptF | ||
| 3747 | JAEMBM010000052.1 | GCA021406705_01801 | gene | open | 6688-7818 | tgt | ||
| 3748 | JAEMBM010000052.1 | GCA021406705_01802 | gene | open | 8008-8283 | traJ | ||
| 3749 | JAEMBM010000052.1 | GCA021406705_01803 | gene | open | 8611-9096 | luxS | ||
| 3750 | JAEMBM010000052.1 | GCA021406705_01804 | gene | open | 9115-9801 | mtnN | ||
| 3751 | JAEMBM010000052.1 | GCA021406705_01805 | gene | open | 10203-11597 | cTD-A | ||
| 3752 | JAEMBM010000053.1 | GCA021406705_00342 | CDS | open | 37-528 | _na 163_aa | site-specific integrase | |
| 3753 | JAEMBM010000053.1 | GCA021406705_00343 | CDS | open | 1106-2053 | _na 315_aa | hypothetical protein | |
| 3754 | JAEMBM010000053.1 | GCA021406705_00344 | CDS | open | 2056-2544 | _na 162_aa | TRAP transporter%2C DctQ-like membrane protein | |
| 3755 | JAEMBM010000053.1 | GCA021406705_00345 | CDS | open | 2541-3578 | _na 345_aa | Nucleoid-associated protein | |
| 3756 | JAEMBM010000053.1 | GCA021406705_00346 | CDS | open | 3627-4358 | _na 243_aa | Transcriptional regulator | |
| 3757 | JAEMBM010000053.1 | GCA021406705_00347 | CDS | open | 4343-4561 | _na 72_aa | Nucleotidyl transferase AbiEii/AbiGii toxin family protein | |
| 3758 | JAEMBM010000053.1 | GCA021406705_00348 | CDS | open | 4561-5175 | _na 204_aa | DNA alkylation repair enzyme | |
| 3759 | JAEMBM010000053.1 | GCA021406705_00349 | CDS | open | 5189-5782 | _na 197_aa | DJ-1/PfpI family protein | |
| 3760 | JAEMBM010000053.1 | GCA021406705_00350 | CDS | open | 5812-6210 | _na 132_aa | Polyketide cyclase | |
| 3761 | JAEMBM010000053.1 | GCA021406705_00351 | CDS | open | 6248-6757 | _na 169_aa | HXXEE domain-containing protein | |
| 3762 | JAEMBM010000053.1 | GCA021406705_00352 | CDS | open | 6791-7639 | _na 282_aa | araC | AraC family transcriptional regulator |
| 3763 | JAEMBM010000053.1 | GCA021406705_00353 | CDS | open | 7736-9088 | _na 450_aa | norM | Multidrug export protein MepA |
| 3764 | JAEMBM010000053.1 | GCA021406705_00354 | CDS | open | 9106-9357 | _na 83_aa | Ribosome biogenesis protein | |
| 3765 | JAEMBM010000053.1 | GCA021406705_00355 | CDS | open | 9380-9706 | _na 108_aa | rteC | RteC protein |
| 3766 | JAEMBM010000053.1 | GCA021406705_00356 | CDS | open | 9795-10211 | _na 138_aa | mobA | MobA protein |
| 3767 | JAEMBM010000053.1 | GCA021406705_00357 | CDS | open | 10954-11382 | _na 142_aa | DUF3408 domain-containing protein | |
| 3768 | JAEMBM010000053.1 | GCA021406705_00342 | gene | open | 37-528 | |||
| 3769 | JAEMBM010000053.1 | GCA021406705_00343 | gene | open | 1106-2053 | |||
| 3770 | JAEMBM010000053.1 | GCA021406705_00344 | gene | open | 2056-2544 | |||
| 3771 | JAEMBM010000053.1 | GCA021406705_00345 | gene | open | 2541-3578 | |||
| 3772 | JAEMBM010000053.1 | GCA021406705_00346 | gene | open | 3627-4358 | |||
| 3773 | JAEMBM010000053.1 | GCA021406705_00347 | gene | open | 4343-4561 | |||
| 3774 | JAEMBM010000053.1 | GCA021406705_00348 | gene | open | 4561-5175 | |||
| 3775 | JAEMBM010000053.1 | GCA021406705_00349 | gene | open | 5189-5782 | |||
| 3776 | JAEMBM010000053.1 | GCA021406705_00350 | gene | open | 5812-6210 | |||
| 3777 | JAEMBM010000053.1 | GCA021406705_00351 | gene | open | 6248-6757 | |||
| 3778 | JAEMBM010000053.1 | GCA021406705_00352 | gene | open | 6791-7639 | araC | ||
| 3779 | JAEMBM010000053.1 | GCA021406705_00353 | gene | open | 7736-9088 | norM | ||
| 3780 | JAEMBM010000053.1 | GCA021406705_00354 | gene | open | 9106-9357 | |||
| 3781 | JAEMBM010000053.1 | GCA021406705_00355 | gene | open | 9380-9706 | rteC | ||
| 3782 | JAEMBM010000053.1 | GCA021406705_00356 | gene | open | 9795-10211 | mobA | ||
| 3783 | JAEMBM010000053.1 | GCA021406705_00357 | gene | open | 10954-11382 | |||
| 3784 | JAEMBM010000054.1 | GCA021406705_00192 | gene | open | 10888-10998 | rrf | ||
| 3785 | JAEMBM010000054.1 | GCA021406705_00193 | gene | open | 11091-12002 | rrl | ||
| 3786 | JAEMBM010000054.1 | regulatory_region | open | 9988-10246 | Cobalamin riboswitch aptamer | |||
| 3787 | JAEMBM010000054.1 | GCA021406705_00192 | rRNA | open | 10888-10998 | rrf | 5S ribosomal RNA | |
| 3788 | JAEMBM010000054.1 | GCA021406705_00193 | rRNA | open | 11091-12002 | rrl | 23S ribosomal RNA | |
| 3789 | JAEMBM010000054.1 | GCA021406705_00182 | CDS | open | 353-1588 | _na 411_aa | lolE | Membrane protein%2C putative |
| 3790 | JAEMBM010000054.1 | GCA021406705_00183 | CDS | open | 1601-3610 | _na 669_aa | ligA | NAD-dependent DNA ligase LigA |
| 3791 | JAEMBM010000054.1 | GCA021406705_00184 | CDS | open | 3598-4125 | _na 175_aa | rimL | Acetyltransferase%2C GNAT family |
| 3792 | JAEMBM010000054.1 | GCA021406705_00185 | CDS | open | 4132-4755 | _na 207_aa | recR | recombination mediator RecR |
| 3793 | JAEMBM010000054.1 | GCA021406705_00186 | CDS | open | 4752-6266 | _na 504_aa | cafA | Ribonuclease%2C Rne/Rng family |
| 3794 | JAEMBM010000054.1 | GCA021406705_00187 | CDS | open | 6464-6556 | _na 30_aa | AURKAIP1/COX24 domain-containing protein | |
| 3795 | JAEMBM010000054.1 | GCA021406705_00188 | CDS | open | 6587-6865 | _na 92_aa | hupA | DNA-binding protein HU |
| 3796 | JAEMBM010000054.1 | GCA021406705_00189 | CDS | open | 6977-7468 | _na 163_aa | nrdG | anaerobic ribonucleoside-triphosphate reductase activating protein |
| 3797 | JAEMBM010000054.1 | GCA021406705_00190 | CDS | open | 7501-9897 | _na 798_aa | nrdD | anaerobic ribonucleoside triphosphate reductase |
| 3798 | JAEMBM010000054.1 | GCA021406705_00191 | CDS | open | 10069-10335 | _na 88_aa | hypothetical protein | |
| 3799 | JAEMBM010000054.1 | GCA021406705_00182 | gene | open | 353-1588 | lolE | ||
| 3800 | JAEMBM010000054.1 | GCA021406705_00183 | gene | open | 1601-3610 | ligA | ||
| 3801 | JAEMBM010000054.1 | GCA021406705_00184 | gene | open | 3598-4125 | rimL | ||
| 3802 | JAEMBM010000054.1 | GCA021406705_00185 | gene | open | 4132-4755 | recR | ||
| 3803 | JAEMBM010000054.1 | GCA021406705_00186 | gene | open | 4752-6266 | cafA | ||
| 3804 | JAEMBM010000054.1 | GCA021406705_00187 | gene | open | 6464-6556 | |||
| 3805 | JAEMBM010000054.1 | GCA021406705_00188 | gene | open | 6587-6865 | hupA | ||
| 3806 | JAEMBM010000054.1 | GCA021406705_00189 | gene | open | 6977-7468 | nrdG | ||
| 3807 | JAEMBM010000054.1 | GCA021406705_00190 | gene | open | 7501-9897 | nrdD | ||
| 3808 | JAEMBM010000054.1 | GCA021406705_00191 | gene | open | 10069-10335 | |||
| 3809 | JAEMBM010000055.1 | GCA021406705_01402 | CDS | open | 449-1687 | _na 412_aa | ATP-grasp domain-containing protein | |
| 3810 | JAEMBM010000055.1 | GCA021406705_01403 | CDS | open | 1636-2286 | _na 216_aa | rnh1 | Ribonuclease H |
| 3811 | JAEMBM010000055.1 | GCA021406705_01404 | CDS | open | 2314-3327 | _na 337_aa | TPR domain protein | |
| 3812 | JAEMBM010000055.1 | GCA021406705_01405 | CDS | open | 3340-3879 | _na 179_aa | paaY | Putative acetyltransferase |
| 3813 | JAEMBM010000055.1 | GCA021406705_01406 | CDS | open | 3888-5675 | _na 595_aa | pepP | Peptidase%2C M24 family |
| 3814 | JAEMBM010000055.1 | GCA021406705_01407 | CDS | open | 5724-7271 | _na 515_aa | DUF4301 domain-containing protein | |
| 3815 | JAEMBM010000055.1 | GCA021406705_01408 | CDS | open | 7854-9776 | _na 640_aa | dnaK | molecular chaperone DnaK |
| 3816 | JAEMBM010000055.1 | GCA021406705_01409 | CDS | open | 10098-10367 | _na 89_aa | hypothetical protein | |
| 3817 | JAEMBM010000055.1 | GCA021406705_01402 | gene | open | 449-1687 | |||
| 3818 | JAEMBM010000055.1 | GCA021406705_01403 | gene | open | 1636-2286 | rnh1 | ||
| 3819 | JAEMBM010000055.1 | GCA021406705_01404 | gene | open | 2314-3327 | |||
| 3820 | JAEMBM010000055.1 | GCA021406705_01405 | gene | open | 3340-3879 | paaY | ||
| 3821 | JAEMBM010000055.1 | GCA021406705_01406 | gene | open | 3888-5675 | pepP | ||
| 3822 | JAEMBM010000055.1 | GCA021406705_01407 | gene | open | 5724-7271 | |||
| 3823 | JAEMBM010000055.1 | GCA021406705_01408 | gene | open | 7854-9776 | dnaK | ||
| 3824 | JAEMBM010000055.1 | GCA021406705_01409 | gene | open | 10098-10367 | |||
| 3825 | JAEMBM010000056.1 | GCA021406705_00206 | CDS | open | 638-1222 | _na 194_aa | grpE | Protein GrpE |
| 3826 | JAEMBM010000056.1 | GCA021406705_00207 | CDS | open | 1266-2417 | _na 383_aa | dnaJ | molecular chaperone DnaJ |
| 3827 | JAEMBM010000056.1 | GCA021406705_00208 | CDS | open | 2503-2820 | _na 105_aa | paaD | Fe-S protein maturation auxiliary factor PG_1777 |
| 3828 | JAEMBM010000056.1 | GCA021406705_00209 | CDS | open | 2807-3637 | _na 276_aa | lpxH | UDP-2%2C3-diacylglucosamine hydrolase |
| 3829 | JAEMBM010000056.1 | GCA021406705_00210 | CDS | open | 3719-4213 | _na 164_aa | ymdB | O-acetyl-ADP-ribose deacetylase |
| 3830 | JAEMBM010000056.1 | GCA021406705_00211 | CDS | open | 4580-5767 | _na 395_aa | spt | serine palmitoyltransferase |
| 3831 | JAEMBM010000056.1 | GCA021406705_00212 | CDS | open | 5777-6445 | _na 222_aa | udk | uridine kinase |
| 3832 | JAEMBM010000056.1 | GCA021406705_00213 | CDS | open | 6487-7674 | _na 395_aa | DUF2029 domain-containing protein | |
| 3833 | JAEMBM010000056.1 | GCA021406705_00214 | CDS | open | 7661-8371 | _na 236_aa | wcaA | Glycosyltransferase 2-like domain-containing protein |
| 3834 | JAEMBM010000056.1 | GCA021406705_00215 | CDS | open | 8359-9153 | _na 264_aa | pgaB | NodB-like y domain-containing protein |
| 3835 | JAEMBM010000056.1 | GCA021406705_00216 | CDS | open | 10027-10242 | _na 71_aa | hypothetical protein | |
| 3836 | JAEMBM010000056.1 | GCA021406705_00206 | gene | open | 638-1222 | grpE | ||
| 3837 | JAEMBM010000056.1 | GCA021406705_00207 | gene | open | 1266-2417 | dnaJ | ||
| 3838 | JAEMBM010000056.1 | GCA021406705_00208 | gene | open | 2503-2820 | paaD | ||
| 3839 | JAEMBM010000056.1 | GCA021406705_00209 | gene | open | 2807-3637 | lpxH | ||
| 3840 | JAEMBM010000056.1 | GCA021406705_00210 | gene | open | 3719-4213 | ymdB | ||
| 3841 | JAEMBM010000056.1 | GCA021406705_00211 | gene | open | 4580-5767 | spt | ||
| 3842 | JAEMBM010000056.1 | GCA021406705_00212 | gene | open | 5777-6445 | udk | ||
| 3843 | JAEMBM010000056.1 | GCA021406705_00213 | gene | open | 6487-7674 | |||
| 3844 | JAEMBM010000056.1 | GCA021406705_00214 | gene | open | 7661-8371 | wcaA | ||
| 3845 | JAEMBM010000056.1 | GCA021406705_00215 | gene | open | 8359-9153 | pgaB | ||
| 3846 | JAEMBM010000056.1 | GCA021406705_00216 | gene | open | 10027-10242 | |||
| 3847 | JAEMBM010000057.1 | GCA021406705_00880 | CDS | open | 4-384 | _na 126_aa | tnp | IS3 family ISPg5 transposase ORF A |
| 3848 | JAEMBM010000057.1 | GCA021406705_00881 | CDS | open | 552-3215 | _na 887_aa | Helicase C-terminal domain-containing protein | |
| 3849 | JAEMBM010000057.1 | GCA021406705_00882 | CDS | open | 3296-3943 | _na 215_aa | Serine/threonine protein phosphatase | |
| 3850 | JAEMBM010000057.1 | GCA021406705_00883 | CDS | open | 3909-4763 | _na 284_aa | Nucleotidyltransferase | |
| 3851 | JAEMBM010000057.1 | GCA021406705_00884 | CDS | open | 4741-5805 | _na 354_aa | Transcriptional regulator%2C AbiEi antitoxin%2C Type IV TA system | |
| 3852 | JAEMBM010000057.1 | GCA021406705_00885 | CDS | open | 5883-6194 | _na 103_aa | Excisionase | |
| 3853 | JAEMBM010000057.1 | GCA021406705_00886 | CDS | open | 6182-8233 | _na 683_aa | Topoisomerase | |
| 3854 | JAEMBM010000057.1 | GCA021406705_00887 | CDS | open | 8247-8618 | _na 123_aa | Helix-turn-helix domain-containing protein | |
| 3855 | JAEMBM010000057.1 | GCA021406705_00888 | CDS | open | 8605-9057 | _na 150_aa | hypothetical protein | |
| 3856 | JAEMBM010000057.1 | GCA021406705_00880 | gene | open | 4-384 | tnp | ||
| 3857 | JAEMBM010000057.1 | GCA021406705_00881 | gene | open | 552-3215 | |||
| 3858 | JAEMBM010000057.1 | GCA021406705_00882 | gene | open | 3296-3943 | |||
| 3859 | JAEMBM010000057.1 | GCA021406705_00883 | gene | open | 3909-4763 | |||
| 3860 | JAEMBM010000057.1 | GCA021406705_00884 | gene | open | 4741-5805 | |||
| 3861 | JAEMBM010000057.1 | GCA021406705_00885 | gene | open | 5883-6194 | |||
| 3862 | JAEMBM010000057.1 | GCA021406705_00886 | gene | open | 6182-8233 | |||
| 3863 | JAEMBM010000057.1 | GCA021406705_00887 | gene | open | 8247-8618 | |||
| 3864 | JAEMBM010000057.1 | GCA021406705_00888 | gene | open | 8605-9057 | |||
| 3865 | JAEMBM010000058.1 | GCA021406705_01785 | CDS | open | 88-765 | _na 225_aa | site-specific integrase | |
| 3866 | JAEMBM010000058.1 | GCA021406705_01786 | CDS | open | 772-1134 | _na 120_aa | Lipoprotein | |
| 3867 | JAEMBM010000058.1 | GCA021406705_01787 | CDS | open | 1257-2162 | _na 301_aa | DUF6268 domain-containing protein | |
| 3868 | JAEMBM010000058.1 | GCA021406705_01788 | CDS | open | 2203-3330 | _na 375_aa | Beta-lactamase | |
| 3869 | JAEMBM010000058.1 | GCA021406705_01789 | CDS | open | 3341-4348 | _na 335_aa | Signal transduction histidine kinase internal region domain-containing protein | |
| 3870 | JAEMBM010000058.1 | GCA021406705_01790 | CDS | open | 4406-5464 | _na 352_aa | Two-component system sensor histidine kinase | |
| 3871 | JAEMBM010000058.1 | GCA021406705_01791 | CDS | open | 5449-6159 | _na 236_aa | DNA-binding response regulator | |
| 3872 | JAEMBM010000058.1 | GCA021406705_01792 | CDS | open | 6331-6801 | _na 156_aa | rteC | RteC protein |
| 3873 | JAEMBM010000058.1 | GCA021406705_01793 | CDS | open | 6890-7306 | _na 138_aa | mobA | MobA protein |
| 3874 | JAEMBM010000058.1 | GCA021406705_01794 | CDS | open | 8049-8477 | _na 142_aa | DUF3408 domain-containing protein | |
| 3875 | JAEMBM010000058.1 | GCA021406705_01785 | gene | open | 88-765 | |||
| 3876 | JAEMBM010000058.1 | GCA021406705_01786 | gene | open | 772-1134 | |||
| 3877 | JAEMBM010000058.1 | GCA021406705_01787 | gene | open | 1257-2162 | |||
| 3878 | JAEMBM010000058.1 | GCA021406705_01788 | gene | open | 2203-3330 | |||
| 3879 | JAEMBM010000058.1 | GCA021406705_01789 | gene | open | 3341-4348 | |||
| 3880 | JAEMBM010000058.1 | GCA021406705_01790 | gene | open | 4406-5464 | |||
| 3881 | JAEMBM010000058.1 | GCA021406705_01791 | gene | open | 5449-6159 | |||
| 3882 | JAEMBM010000058.1 | GCA021406705_01792 | gene | open | 6331-6801 | rteC | ||
| 3883 | JAEMBM010000058.1 | GCA021406705_01793 | gene | open | 6890-7306 | mobA | ||
| 3884 | JAEMBM010000058.1 | GCA021406705_01794 | gene | open | 8049-8477 | |||
| 3885 | JAEMBM010000059.1 | GCA021406705_01361 | CDS | open | 86-376 | _na 96_aa | transposase | |
| 3886 | JAEMBM010000059.1 | GCA021406705_01362 | CDS | open | 792-2915 | _na 707_aa | recQ | ATP-dependent DNA helicase RecQ |
| 3887 | JAEMBM010000059.1 | GCA021406705_01363 | CDS | open | 3494-4357 | _na 287_aa | glgA | starch synthase |
| 3888 | JAEMBM010000059.1 | GCA021406705_01364 | CDS | open | 4493-5827 | _na 444_aa | DUF4270 domain-containing protein | |
| 3889 | JAEMBM010000059.1 | GCA021406705_01365 | CDS | open | 5933-7165 | _na 410_aa | nupG | Nucleoside permease NupG |
| 3890 | JAEMBM010000059.1 | GCA021406705_01361 | gene | open | 86-376 | |||
| 3891 | JAEMBM010000059.1 | GCA021406705_01362 | gene | open | 792-2915 | recQ | ||
| 3892 | JAEMBM010000059.1 | GCA021406705_01363 | gene | open | 3494-4357 | glgA | ||
| 3893 | JAEMBM010000059.1 | GCA021406705_01364 | gene | open | 4493-5827 | |||
| 3894 | JAEMBM010000059.1 | GCA021406705_01365 | gene | open | 5933-7165 | nupG | ||
| 3895 | JAEMBM010000060.1 | GCA021406705_00273 | gene | open | 7748-7858 | rrf | ||
| 3896 | JAEMBM010000060.1 | GCA021406705_00274 | gene | open | 7951-8862 | rrl | ||
| 3897 | JAEMBM010000060.1 | GCA021406705_00273 | rRNA | open | 7748-7858 | rrf | 5S ribosomal RNA | |
| 3898 | JAEMBM010000060.1 | GCA021406705_00274 | rRNA | open | 7951-8862 | rrl | 23S ribosomal RNA | |
| 3899 | JAEMBM010000060.1 | GCA021406705_00266 | CDS | open | 510-917 | _na 135_aa | DUF6249 domain-containing protein | |
| 3900 | JAEMBM010000060.1 | GCA021406705_00267 | CDS | open | 936-1595 | _na 219_aa | lolD | ABC transporter%2C ATP-binding protein |
| 3901 | JAEMBM010000060.1 | GCA021406705_00268 | CDS | open | 1620-2894 | _na 424_aa | salY | ABC transporter%2C permease protein%2C putative |
| 3902 | JAEMBM010000060.1 | GCA021406705_00269 | CDS | open | 2917-4179 | _na 420_aa | salY | Putative ABC transporter ATP-binding protein |
| 3903 | JAEMBM010000060.1 | GCA021406705_00270 | CDS | open | 4249-5355 | _na 368_aa | acrA | Membrane fusion efflux protein |
| 3904 | JAEMBM010000060.1 | GCA021406705_00271 | CDS | open | 5352-6719 | _na 455_aa | tolC | Outer membrane efflux protein |
| 3905 | JAEMBM010000060.1 | GCA021406705_00272 | CDS | open | 7191-7364 | _na 57_aa | hypothetical protein | |
| 3906 | JAEMBM010000060.1 | GCA021406705_00266 | gene | open | 510-917 | |||
| 3907 | JAEMBM010000060.1 | GCA021406705_00267 | gene | open | 936-1595 | lolD | ||
| 3908 | JAEMBM010000060.1 | GCA021406705_00268 | gene | open | 1620-2894 | salY | ||
| 3909 | JAEMBM010000060.1 | GCA021406705_00269 | gene | open | 2917-4179 | salY | ||
| 3910 | JAEMBM010000060.1 | GCA021406705_00270 | gene | open | 4249-5355 | acrA | ||
| 3911 | JAEMBM010000060.1 | GCA021406705_00271 | gene | open | 5352-6719 | tolC | ||
| 3912 | JAEMBM010000060.1 | GCA021406705_00272 | gene | open | 7191-7364 | |||
| 3913 | JAEMBM010000061.1 | GCA021406705_00492 | CDS | open | 275-937 | _na 220_aa | Lipoprotein | |
| 3914 | JAEMBM010000061.1 | GCA021406705_00493 | CDS | open | 1524-1961 | _na 145_aa | Secretion system C-terminal sorting domain-containing protein | |
| 3915 | JAEMBM010000061.1 | GCA021406705_00494 | CDS | open | 1996-2259 | _na 87_aa | SpvB/TcaC N-terminal domain-containing protein | |
| 3916 | JAEMBM010000061.1 | GCA021406705_00495 | CDS | open | 2508-3185 | _na 225_aa | Lipoprotein | |
| 3917 | JAEMBM010000061.1 | GCA021406705_00496 | CDS | open | 3289-4653 | _na 454_aa | RHS repeat-associated core domain-containing protein | |
| 3918 | JAEMBM010000061.1 | GCA021406705_00497 | CDS | open | 4658-5107 | _na 149_aa | Lipoprotein | |
| 3919 | JAEMBM010000061.1 | GCA021406705_00498 | CDS | open | 5204-5704 | _na 166_aa | hypothetical protein | |
| 3920 | JAEMBM010000061.1 | GCA021406705_00499 | CDS | open | 5719-6195 | _na 158_aa | Lipoprotein | |
| 3921 | JAEMBM010000061.1 | GCA021406705_00500 | CDS | open | 6243-6428 | _na 61_aa | hypothetical protein | |
| 3922 | JAEMBM010000061.1 | GCA021406705_00501 | CDS | open | 6435-7640 | _na 401_aa | RHS repeat-associated core domain-containing protein | |
| 3923 | JAEMBM010000061.1 | GCA021406705_00502 | CDS | open | 7657-8256 | _na 199_aa | DUF4252 domain-containing protein | |
| 3924 | JAEMBM010000061.1 | GCA021406705_00503 | CDS | open | 8286-8588 | _na 100_aa | Imm40 family immunity protein | |
| 3925 | JAEMBM010000061.1 | GCA021406705_00492 | gene | open | 275-937 | |||
| 3926 | JAEMBM010000061.1 | GCA021406705_00493 | gene | open | 1524-1961 | |||
| 3927 | JAEMBM010000061.1 | GCA021406705_00494 | gene | open | 1996-2259 | |||
| 3928 | JAEMBM010000061.1 | GCA021406705_00495 | gene | open | 2508-3185 | |||
| 3929 | JAEMBM010000061.1 | GCA021406705_00496 | gene | open | 3289-4653 | |||
| 3930 | JAEMBM010000061.1 | GCA021406705_00497 | gene | open | 4658-5107 | |||
| 3931 | JAEMBM010000061.1 | GCA021406705_00498 | gene | open | 5204-5704 | |||
| 3932 | JAEMBM010000061.1 | GCA021406705_00499 | gene | open | 5719-6195 | |||
| 3933 | JAEMBM010000061.1 | GCA021406705_00500 | gene | open | 6243-6428 | |||
| 3934 | JAEMBM010000061.1 | GCA021406705_00501 | gene | open | 6435-7640 | |||
| 3935 | JAEMBM010000061.1 | GCA021406705_00502 | gene | open | 7657-8256 | |||
| 3936 | JAEMBM010000061.1 | GCA021406705_00503 | gene | open | 8286-8588 | |||
| 3937 | JAEMBM010000062.1 | GCA021406705_02038 | CDS | open | 7-162 | _na 51_aa | hypothetical protein | |
| 3938 | JAEMBM010000062.1 | GCA021406705_02039 | CDS | open | 407-1360 | _na 317_aa | ldhA | Glycerate dehydrogenase |
| 3939 | JAEMBM010000062.1 | GCA021406705_02040 | CDS | open | 1600-3480 | _na 626_aa | DUF349 domain-containing protein | |
| 3940 | JAEMBM010000062.1 | GCA021406705_02041 | CDS | open | 3740-3964 | _na 74_aa | Partial transposase in ISPg2 | |
| 3941 | JAEMBM010000062.1 | GCA021406705_02042 | CDS | open | 4386-5777 | _na 463_aa | Lipase | |
| 3942 | JAEMBM010000062.1 | GCA021406705_02043 | CDS | open | 5758-6588 | _na 276_aa | tesA | SGNH hydrolase-type esterase domain-containing protein |
| 3943 | JAEMBM010000062.1 | GCA021406705_02044 | CDS | open | 6610-8145 | _na 511_aa | dltB | Alginate O-acetyltransferase%2C putative |
| 3944 | JAEMBM010000062.1 | GCA021406705_02038 | gene | open | 7-162 | |||
| 3945 | JAEMBM010000062.1 | GCA021406705_02039 | gene | open | 407-1360 | ldhA | ||
| 3946 | JAEMBM010000062.1 | GCA021406705_02040 | gene | open | 1600-3480 | |||
| 3947 | JAEMBM010000062.1 | GCA021406705_02041 | gene | open | 3740-3964 | |||
| 3948 | JAEMBM010000062.1 | GCA021406705_02042 | gene | open | 4386-5777 | |||
| 3949 | JAEMBM010000062.1 | GCA021406705_02043 | gene | open | 5758-6588 | tesA | ||
| 3950 | JAEMBM010000062.1 | GCA021406705_02044 | gene | open | 6610-8145 | dltB | ||
| 3951 | JAEMBM010000063.1 | GCA021406705_00201 | CDS | open | 635-3094 | _na 819_aa | pheT | phenylalanine--tRNA ligase subunit beta |
| 3952 | JAEMBM010000063.1 | GCA021406705_00202 | CDS | open | 3137-3865 | _na 242_aa | tACO1 | YebC/PmpR family DNA-binding transcriptional regulator |
| 3953 | JAEMBM010000063.1 | GCA021406705_00203 | CDS | open | 4167-6842 | _na 891_aa | mutS | DNA mismatch repair protein MutS |
| 3954 | JAEMBM010000063.1 | GCA021406705_00204 | CDS | open | 7245-7364 | _na 39_aa | hypothetical protein | |
| 3955 | JAEMBM010000063.1 | GCA021406705_00205 | CDS | open | 7869-8084 | _na 71_aa | hypothetical protein | |
| 3956 | JAEMBM010000063.1 | GCA021406705_00201 | gene | open | 635-3094 | pheT | ||
| 3957 | JAEMBM010000063.1 | GCA021406705_00202 | gene | open | 3137-3865 | tACO1 | ||
| 3958 | JAEMBM010000063.1 | GCA021406705_00203 | gene | open | 4167-6842 | mutS | ||
| 3959 | JAEMBM010000063.1 | GCA021406705_00204 | gene | open | 7245-7364 | |||
| 3960 | JAEMBM010000063.1 | GCA021406705_00205 | gene | open | 7869-8084 | |||
| 3961 | JAEMBM010000064.1 | repeat_region | open | 7084-7911 | CRISPR array with 13 repeats of length 30%2C consensus sequence GTTTTAATTCCTGTATGGTGCAATTGAAAT and spacer length 35 | |||
| 3962 | JAEMBM010000064.1 | GCA021406705_00923 | CDS | open | 4-384 | _na 126_aa | tnp | IS3 family ISPg5 transposase ORF A |
| 3963 | JAEMBM010000064.1 | GCA021406705_00924 | CDS | open | 612-971 | _na 119_aa | hypothetical protein | |
| 3964 | JAEMBM010000064.1 | GCA021406705_00925 | CDS | open | 1278-3779 | _na 833_aa | fepA | TonB-dependent receptor%2C putative |
| 3965 | JAEMBM010000064.1 | GCA021406705_00926 | CDS | open | 4349-5086 | _na 245_aa | recO | DNA repair protein RecO |
| 3966 | JAEMBM010000064.1 | GCA021406705_00927 | CDS | open | 5159-6907 | _na 582_aa | manB | Phosphomannomutase |
| 3967 | JAEMBM010000064.1 | GCA021406705_00923 | gene | open | 4-384 | tnp | ||
| 3968 | JAEMBM010000064.1 | GCA021406705_00924 | gene | open | 612-971 | |||
| 3969 | JAEMBM010000064.1 | GCA021406705_00925 | gene | open | 1278-3779 | fepA | ||
| 3970 | JAEMBM010000064.1 | GCA021406705_00926 | gene | open | 4349-5086 | recO | ||
| 3971 | JAEMBM010000064.1 | GCA021406705_00927 | gene | open | 5159-6907 | manB | ||
| 3972 | JAEMBM010000065.1 | GCA021406705_00194 | CDS | open | 511-1920 | _na 469_aa | asnS | asparagine--tRNA ligase |
| 3973 | JAEMBM010000065.1 | GCA021406705_00195 | CDS | open | 1952-3271 | _na 439_aa | pseudouridine synthase | |
| 3974 | JAEMBM010000065.1 | GCA021406705_00196 | CDS | open | 3373-4716 | _na 447_aa | purB | adenylosuccinate lyase |
| 3975 | JAEMBM010000065.1 | GCA021406705_00197 | CDS | open | 4851-5414 | _na 187_aa | pduO | Corrinoid adenosyltransferase |
| 3976 | JAEMBM010000065.1 | GCA021406705_00198 | CDS | open | 5437-6087 | _na 216_aa | SAM-dependent methyltransferase | |
| 3977 | JAEMBM010000065.1 | GCA021406705_00199 | CDS | open | 6112-7299 | _na 395_aa | uraA | Uracil permease |
| 3978 | JAEMBM010000065.1 | GCA021406705_00200 | CDS | open | 7542-7832 | _na 96_aa | transposase | |
| 3979 | JAEMBM010000065.1 | GCA021406705_00194 | gene | open | 511-1920 | asnS | ||
| 3980 | JAEMBM010000065.1 | GCA021406705_00195 | gene | open | 1952-3271 | |||
| 3981 | JAEMBM010000065.1 | GCA021406705_00196 | gene | open | 3373-4716 | purB | ||
| 3982 | JAEMBM010000065.1 | GCA021406705_00197 | gene | open | 4851-5414 | pduO | ||
| 3983 | JAEMBM010000065.1 | GCA021406705_00198 | gene | open | 5437-6087 | |||
| 3984 | JAEMBM010000065.1 | GCA021406705_00199 | gene | open | 6112-7299 | uraA | ||
| 3985 | JAEMBM010000065.1 | GCA021406705_00200 | gene | open | 7542-7832 | |||
| 3986 | JAEMBM010000066.1 | GCA021406705_00589 | CDS | open | 90-437 | _na 115_aa | DUF1661 domain-containing protein | |
| 3987 | JAEMBM010000066.1 | GCA021406705_00590 | CDS | open | 692-1054 | _na 120_aa | putative partial hemagglutinin-related protein | |
| 3988 | JAEMBM010000066.1 | GCA021406705_00591 | CDS | open | 1054-1266 | _na 70_aa | putative partial hemagglutinin-related protein | |
| 3989 | JAEMBM010000066.1 | GCA021406705_00592 | CDS | open | 1457-3064 | _na 535_aa | pckA | phosphoenolpyruvate carboxykinase (ATP) |
| 3990 | JAEMBM010000066.1 | GCA021406705_00593 | CDS | open | 3361-4617 | _na 418_aa | pgk | Phosphoglycerate kinase |
| 3991 | JAEMBM010000066.1 | GCA021406705_00594 | CDS | open | 4736-6208 | _na 490_aa | DUF5687 domain-containing protein | |
| 3992 | JAEMBM010000066.1 | GCA021406705_00595 | CDS | open | 6243-6944 | _na 233_aa | Putative ATP-binding component of ABC transporter protein | |
| 3993 | JAEMBM010000066.1 | GCA021406705_00596 | CDS | open | 7155-7301 | _na 48_aa | hypothetical protein | |
| 3994 | JAEMBM010000066.1 | GCA021406705_00597 | CDS | open | 7383-7676 | _na 97_aa | hypothetical protein | |
| 3995 | JAEMBM010000066.1 | GCA021406705_00589 | gene | open | 90-437 | |||
| 3996 | JAEMBM010000066.1 | GCA021406705_00590 | gene | open | 692-1054 | |||
| 3997 | JAEMBM010000066.1 | GCA021406705_00591 | gene | open | 1054-1266 | |||
| 3998 | JAEMBM010000066.1 | GCA021406705_00592 | gene | open | 1457-3064 | pckA | ||
| 3999 | JAEMBM010000066.1 | GCA021406705_00593 | gene | open | 3361-4617 | pgk | ||
| 4000 | JAEMBM010000066.1 | GCA021406705_00594 | gene | open | 4736-6208 |

