HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_021406725.1)

Select a Genome:
BAKTA Annotations for GCA_021406725.1
Genome Selected: Porphyromonas gingivalis
ContigsBases CDSrRNA tmRNAtRNA
116 2424555 2091 7 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4314 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 4314 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 JAEMBO010000051.1 GCA021406725_02026 gene open 7882-8397
3502 JAEMBO010000051.1 GCA021406725_02027 gene open 8438-8833
3503 JAEMBO010000051.1 GCA021406725_02028 gene open 9066-9638 sTE14
3504 JAEMBO010000051.1 GCA021406725_02029 gene open 9635-10279
3505 JAEMBO010000051.1 GCA021406725_02030 gene open 10518-10736
3506 JAEMBO010000051.1 GCA021406725_02031 gene open 10741-10995
3507 JAEMBO010000051.1 GCA021406725_02032 gene open 11020-12261
3508 JAEMBO010000051.1 GCA021406725_02033 gene open 12303-12731
3509 JAEMBO010000051.1 GCA021406725_02034 gene open 12738-13040
3510 JAEMBO010000051.1 GCA021406725_02035 gene open 13053-13334
3511 JAEMBO010000051.1 GCA021406725_02036 gene open 13357-13584
3512 JAEMBO010000051.1 GCA021406725_02037 gene open 13597-14118
3513 JAEMBO010000051.1 GCA021406725_02038 gene open 14125-14484
3514 JAEMBO010000051.1 GCA021406725_02039 gene open 14843-15301
3515 JAEMBO010000051.1 GCA021406725_02040 gene open 15342-16619
3516 JAEMBO010000051.1 GCA021406725_02041 gene open 16930-17014 trnS
3517 JAEMBO010000051.1 GCA021406725_02041 tRNA open 16930-17014 trnS tRNA-Ser(tga)
3518 JAEMBO010000052.1 repeat_region open 15658-16876 CRISPR array with 19 repeats of length 30%2C consensus sequence ATTTCAATTGCACCATACAGGAATTAAAAC and spacer length 35
3519 JAEMBO010000052.1 GCA021406725_00773 CDS open 112-921 _na     269_aa DUF2436 domain-containing protein
3520 JAEMBO010000052.1 GCA021406725_00775 CDS open 1496-2437 _na     313_aa fmt methionyl-tRNA formyltransferase
3521 JAEMBO010000052.1 GCA021406725_00776 CDS open 2602-5145 _na     847_aa yfhO YfhO family protein
3522 JAEMBO010000052.1 GCA021406725_00777 CDS open 5149-7080 _na     643_aa mdoB Sulfatase N-terminal domain-containing protein
3523 JAEMBO010000052.1 GCA021406725_00778 CDS open 7728-8393 _na     221_aa cas6 CRISPR-associated endoribonuclease Cas6
3524 JAEMBO010000052.1 GCA021406725_00779 CDS open 8400-8987 _na     195_aa CRISPR-associated protein Cas5
3525 JAEMBO010000052.1 GCA021406725_00780 CDS open 9004-11124 _na     706_aa putative CRISPR-associated helicase Cas3 core
3526 JAEMBO010000052.1 GCA021406725_00781 CDS open 11135-12430 _na     431_aa hypothetical protein
3527 JAEMBO010000052.1 GCA021406725_00782 CDS open 12451-13509 _na     352_aa CRISPR-associated protein Cas7
3528 JAEMBO010000052.1 GCA021406725_00783 CDS open 13626-14135 _na     169_aa cas4 CRISPR-associated protein Cas4
3529 JAEMBO010000052.1 GCA021406725_00784 CDS open 14132-15148 _na     338_aa cas1b type I-B CRISPR-associated endonuclease Cas1b
3530 JAEMBO010000052.1 GCA021406725_00785 CDS open 15148-15411 _na     87_aa cas2 CRISPR-associated endonuclease Cas2
3531 JAEMBO010000052.1 GCA021406725_00773 gene open 112-921
3532 JAEMBO010000052.1 GCA021406725_00775 gene open 1496-2437 fmt
3533 JAEMBO010000052.1 GCA021406725_00776 gene open 2602-5145 yfhO
3534 JAEMBO010000052.1 GCA021406725_00777 gene open 5149-7080 mdoB
3535 JAEMBO010000052.1 GCA021406725_00778 gene open 7728-8393 cas6
3536 JAEMBO010000052.1 GCA021406725_00779 gene open 8400-8987
3537 JAEMBO010000052.1 GCA021406725_00780 gene open 9004-11124
3538 JAEMBO010000052.1 GCA021406725_00781 gene open 11135-12430
3539 JAEMBO010000052.1 GCA021406725_00782 gene open 12451-13509
3540 JAEMBO010000052.1 GCA021406725_00783 gene open 13626-14135 cas4
3541 JAEMBO010000052.1 GCA021406725_00784 gene open 14132-15148 cas1b
3542 JAEMBO010000052.1 GCA021406725_00785 gene open 15148-15411 cas2
3543 JAEMBO010000052.1 GCA021406725_00774 gene open 1166-1239 trnD
3544 JAEMBO010000052.1 GCA021406725_00774 tRNA open 1166-1239 trnD tRNA-Asp(gtc)
3545 JAEMBO010000053.1 GCA021406725_00385 CDS open 392-3217 _na     941_aa pqqL Peptidase M16
3546 JAEMBO010000053.1 GCA021406725_00386 CDS open 3495-4073 _na     192_aa rbr rubrerythrin
3547 JAEMBO010000053.1 GCA021406725_00387 CDS open 4402-4893 _na     163_aa ompH Cationic outer membrane protein OmpH
3548 JAEMBO010000053.1 GCA021406725_00388 CDS open 4928-5440 _na     170_aa ompH Cationic outer membrane protein OmpH
3549 JAEMBO010000053.1 GCA021406725_00389 CDS open 5509-8184 _na     891_aa bamA outer membrane protein assembly factor BamA
3550 JAEMBO010000053.1 GCA021406725_00390 CDS open 8202-8966 _na     254_aa uppS isoprenyl transferase
3551 JAEMBO010000053.1 GCA021406725_00391 CDS open 9044-9751 _na     235_aa Outer membrane protein beta-barrel domain-containing protein
3552 JAEMBO010000053.1 GCA021406725_00392 CDS open 9738-11108 _na     456_aa DUF6242 domain-containing protein
3553 JAEMBO010000053.1 GCA021406725_00393 CDS open 11325-12824 _na     499_aa RagB/SusD domain-containing protein
3554 JAEMBO010000053.1 GCA021406725_00394 CDS open 12855-15995 _na     1046_aa Collagen-binding protein
3555 JAEMBO010000053.1 GCA021406725_00385 gene open 392-3217 pqqL
3556 JAEMBO010000053.1 GCA021406725_00386 gene open 3495-4073 rbr
3557 JAEMBO010000053.1 GCA021406725_00387 gene open 4402-4893 ompH
3558 JAEMBO010000053.1 GCA021406725_00388 gene open 4928-5440 ompH
3559 JAEMBO010000053.1 GCA021406725_00389 gene open 5509-8184 bamA
3560 JAEMBO010000053.1 GCA021406725_00390 gene open 8202-8966 uppS
3561 JAEMBO010000053.1 GCA021406725_00391 gene open 9044-9751
3562 JAEMBO010000053.1 GCA021406725_00392 gene open 9738-11108
3563 JAEMBO010000053.1 GCA021406725_00393 gene open 11325-12824
3564 JAEMBO010000053.1 GCA021406725_00394 gene open 12855-15995
3565 JAEMBO010000054.1 GCA021406725_01944 CDS open 108-734 _na     208_aa hypothetical protein
3566 JAEMBO010000054.1 GCA021406725_01945 CDS open 1160-2353 _na     397_aa Virulence-associated protein E-like domain-containing protein
3567 JAEMBO010000054.1 GCA021406725_01946 CDS open 2380-2736 _na     118_aa alpA Helix-turn-helix domain-containing protein
3568 JAEMBO010000054.1 GCA021406725_01947 CDS open 3035-3709 _na     224_aa sduA Shedu protein SduA C-terminal domain-containing protein
3569 JAEMBO010000054.1 GCA021406725_01948 CDS open 3709-3843 _na     44_aa hypothetical protein
3570 JAEMBO010000054.1 GCA021406725_01949 CDS open 3863-4291 _na     142_aa tnpC Mobilizable transposon%2C TnpC family protein
3571 JAEMBO010000054.1 GCA021406725_01950 CDS open 4273-4569 _na     98_aa hypothetical protein
3572 JAEMBO010000054.1 GCA021406725_01951 CDS open 4590-5522 _na     310_aa Site-specific recombinase%2C phage integrase family
3573 JAEMBO010000054.1 GCA021406725_01952 CDS open 5535-5852 _na     105_aa xerD Tyrosine recombinase XerD
3574 JAEMBO010000054.1 GCA021406725_01953 CDS open 5865-6419 _na     184_aa ORF5
3575 JAEMBO010000054.1 GCA021406725_01954 CDS open 6630-8552 _na     640_aa dnaK molecular chaperone DnaK
3576 JAEMBO010000054.1 GCA021406725_01955 CDS open 9135-10682 _na     515_aa DUF4301 domain-containing protein
3577 JAEMBO010000054.1 GCA021406725_01956 CDS open 10731-12518 _na     595_aa pepP Peptidase%2C M24 family
3578 JAEMBO010000054.1 GCA021406725_01957 CDS open 12527-13066 _na     179_aa paaY Putative acetyltransferase
3579 JAEMBO010000054.1 GCA021406725_01958 CDS open 13079-14092 _na     337_aa tPR TPR domain protein
3580 JAEMBO010000054.1 GCA021406725_01959 CDS open 14120-14770 _na     216_aa rnh1 Ribonuclease H
3581 JAEMBO010000054.1 GCA021406725_01960 CDS open 14785-15957 _na     390_aa ATP-grasp domain-containing protein
3582 JAEMBO010000054.1 GCA021406725_01944 gene open 108-734
3583 JAEMBO010000054.1 GCA021406725_01945 gene open 1160-2353
3584 JAEMBO010000054.1 GCA021406725_01946 gene open 2380-2736 alpA
3585 JAEMBO010000054.1 GCA021406725_01947 gene open 3035-3709 sduA
3586 JAEMBO010000054.1 GCA021406725_01948 gene open 3709-3843
3587 JAEMBO010000054.1 GCA021406725_01949 gene open 3863-4291 tnpC
3588 JAEMBO010000054.1 GCA021406725_01950 gene open 4273-4569
3589 JAEMBO010000054.1 GCA021406725_01951 gene open 4590-5522
3590 JAEMBO010000054.1 GCA021406725_01952 gene open 5535-5852 xerD
3591 JAEMBO010000054.1 GCA021406725_01953 gene open 5865-6419
3592 JAEMBO010000054.1 GCA021406725_01954 gene open 6630-8552 dnaK
3593 JAEMBO010000054.1 GCA021406725_01955 gene open 9135-10682
3594 JAEMBO010000054.1 GCA021406725_01956 gene open 10731-12518 pepP
3595 JAEMBO010000054.1 GCA021406725_01957 gene open 12527-13066 paaY
3596 JAEMBO010000054.1 GCA021406725_01958 gene open 13079-14092 tPR
3597 JAEMBO010000054.1 GCA021406725_01959 gene open 14120-14770 rnh1
3598 JAEMBO010000054.1 GCA021406725_01960 gene open 14785-15957
3599 JAEMBO010000055.1 GCA021406725_01345 CDS open 81-1388 _na     435_aa IS5 family transposase
3600 JAEMBO010000055.1 GCA021406725_01346 CDS open 1521-3809 _na     762_aa spoT Guanosine-3'%2C5'-bis(Diphosphate) 3'-pyrophosphohydrolase
3601 JAEMBO010000055.1 GCA021406725_01347 CDS open 4060-4605 _na     181_aa porG 2-oxoglutarate oxidoreductase%2C gamma subunit
3602 JAEMBO010000055.1 GCA021406725_01348 CDS open 4634-5398 _na     254_aa porB 2-oxoglutarate oxidoreductase%2C beta subunit
3603 JAEMBO010000055.1 GCA021406725_01349 CDS open 5415-5594 _na     59_aa hypothetical protein
3604 JAEMBO010000055.1 GCA021406725_01350 CDS open 5615-6697 _na     360_aa porA 2-ketoisovalerate ferredoxin oxidoreductase
3605 JAEMBO010000055.1 GCA021406725_01351 CDS open 6716-6943 _na     75_aa nuoI Ferredoxin%2C 4Fe-4S
3606 JAEMBO010000055.1 GCA021406725_01352 CDS open 7175-9196 _na     673_aa dnaG DNA primase
3607 JAEMBO010000055.1 GCA021406725_01353 CDS open 9238-10002 _na     254_aa kdsB 3-deoxy-manno-octulosonate cytidylyltransferase
3608 JAEMBO010000055.1 GCA021406725_01354 CDS open 9999-10520 _na     173_aa mdaB NAD(P)H dehydrogenase%2C quinone family%2C putative
3609 JAEMBO010000055.1 GCA021406725_01355 CDS open 10789-11604 _na     271_aa ccmC Cytochrome c assembly protein domain-containing protein
3610 JAEMBO010000055.1 GCA021406725_01356 CDS open 11597-11737 _na     46_aa hypothetical protein
3611 JAEMBO010000055.1 GCA021406725_01357 CDS open 11769-12893 _na     374_aa ResB-like domain-containing protein
3612 JAEMBO010000055.1 GCA021406725_01358 CDS open 12964-14460 _na     498_aa nrfA ammonia-forming cytochrome c nitrite reductase
3613 JAEMBO010000055.1 GCA021406725_01359 CDS open 14482-15093 _na     203_aa nrfH cytochrome c nitrite reductase small subunit
3614 JAEMBO010000055.1 GCA021406725_01345 gene open 81-1388
3615 JAEMBO010000055.1 GCA021406725_01346 gene open 1521-3809 spoT
3616 JAEMBO010000055.1 GCA021406725_01347 gene open 4060-4605 porG
3617 JAEMBO010000055.1 GCA021406725_01348 gene open 4634-5398 porB
3618 JAEMBO010000055.1 GCA021406725_01349 gene open 5415-5594
3619 JAEMBO010000055.1 GCA021406725_01350 gene open 5615-6697 porA
3620 JAEMBO010000055.1 GCA021406725_01351 gene open 6716-6943 nuoI
3621 JAEMBO010000055.1 GCA021406725_01352 gene open 7175-9196 dnaG
3622 JAEMBO010000055.1 GCA021406725_01353 gene open 9238-10002 kdsB
3623 JAEMBO010000055.1 GCA021406725_01354 gene open 9999-10520 mdaB
3624 JAEMBO010000055.1 GCA021406725_01355 gene open 10789-11604 ccmC
3625 JAEMBO010000055.1 GCA021406725_01356 gene open 11597-11737
3626 JAEMBO010000055.1 GCA021406725_01357 gene open 11769-12893
3627 JAEMBO010000055.1 GCA021406725_01358 gene open 12964-14460 nrfA
3628 JAEMBO010000055.1 GCA021406725_01359 gene open 14482-15093 nrfH
3629 JAEMBO010000055.1 GCA021406725_01360 gene open 15661-15733 trnK
3630 JAEMBO010000055.1 GCA021406725_01360 tRNA open 15661-15733 trnK tRNA-Lys(ttt)
3631 JAEMBO010000056.1 GCA021406725_01025 CDS open 693-3278 _na     861_aa lacZ beta-mannosidase
3632 JAEMBO010000056.1 GCA021406725_01026 CDS open 3308-4606 _na     432_aa hypothetical protein
3633 JAEMBO010000056.1 GCA021406725_01027 CDS open 5301-5615 _na     104_aa trxA thioredoxin
3634 JAEMBO010000056.1 GCA021406725_01028 CDS open 5664-9350 _na     1228_aa dnaE DNA polymerase III subunit alpha
3635 JAEMBO010000056.1 GCA021406725_01029 CDS open 9629-9994 _na     121_aa rplS 50S ribosomal protein L19
3636 JAEMBO010000056.1 GCA021406725_01030 CDS open 11227-12507 _na     426_aa glyA Serine hydroxymethyltransferase
3637 JAEMBO010000056.1 GCA021406725_01031 CDS open 12664-14997 _na     777_aa nahA Beta-hexosaminidase
3638 JAEMBO010000056.1 GCA021406725_01025 gene open 693-3278 lacZ
3639 JAEMBO010000056.1 GCA021406725_01026 gene open 3308-4606
3640 JAEMBO010000056.1 GCA021406725_01027 gene open 5301-5615 trxA
3641 JAEMBO010000056.1 GCA021406725_01028 gene open 5664-9350 dnaE
3642 JAEMBO010000056.1 GCA021406725_01029 gene open 9629-9994 rplS
3643 JAEMBO010000056.1 GCA021406725_01030 gene open 11227-12507 glyA
3644 JAEMBO010000056.1 GCA021406725_01031 gene open 12664-14997 nahA
3645 JAEMBO010000057.1 GCA021406725_00828 CDS open 86-463 _na     125_aa traF Conjugative transposon protein TraF
3646 JAEMBO010000057.1 GCA021406725_00829 CDS open 460-2946 _na     828_aa traC Conjugal transfer ATP-binding protein TraC
3647 JAEMBO010000057.1 GCA021406725_00830 CDS open 2979-3608 _na     209_aa Conjugal transfer protein
3648 JAEMBO010000057.1 GCA021406725_00831 CDS open 3611-4684 _na     357_aa traJ conjugative transposon protein TraJ
3649 JAEMBO010000057.1 GCA021406725_00832 CDS open 4704-5327 _na     207_aa traK conjugative transposon protein TraK
3650 JAEMBO010000057.1 GCA021406725_00833 CDS open 5348-5608 _na     86_aa traQ TraQ conjugal transfer family protein
3651 JAEMBO010000057.1 GCA021406725_00834 CDS open 5592-6101 _na     169_aa rrrD Lysozyme
3652 JAEMBO010000057.1 GCA021406725_00835 CDS open 6216-7115 _na     299_aa Anti-bacteriophage protein A/HamA C-terminal domain-containing protein
3653 JAEMBO010000057.1 GCA021406725_00836 CDS open 7118-9667 _na     849_aa Helicase conserved C-terminal domain-containing protein
3654 JAEMBO010000057.1 GCA021406725_00837 CDS open 9691-10785 _na     364_aa PIN domain-containing protein
3655 JAEMBO010000057.1 GCA021406725_00838 CDS open 11154-11408 _na     84_aa hypothetical protein
3656 JAEMBO010000057.1 GCA021406725_00839 CDS open 11435-12700 _na     421_aa PcfJ-like protein
3657 JAEMBO010000057.1 GCA021406725_00840 CDS open 12717-13247 _na     176_aa Antirestriction protein
3658 JAEMBO010000057.1 GCA021406725_00841 CDS open 13269-13685 _na     138_aa PcfK-like protein
3659 JAEMBO010000057.1 GCA021406725_00842 CDS open 13703-13909 _na     68_aa hypothetical protein
3660 JAEMBO010000057.1 GCA021406725_00843 CDS open 13921-14292 _na     123_aa DUF4942 domain-containing protein
3661 JAEMBO010000057.1 GCA021406725_00844 CDS open 14289-14585 _na     98_aa Intein
3662 JAEMBO010000057.1 GCA021406725_00845 CDS open 14597-14815 _na     72_aa Transposase
3663 JAEMBO010000057.1 GCA021406725_00846 CDS open 14828-15037 _na     69_aa Trasnmembrane protein found in conjugate transposon
3664 JAEMBO010000057.1 GCA021406725_00828 gene open 86-463 traF
3665 JAEMBO010000057.1 GCA021406725_00829 gene open 460-2946 traC
3666 JAEMBO010000057.1 GCA021406725_00830 gene open 2979-3608
3667 JAEMBO010000057.1 GCA021406725_00831 gene open 3611-4684 traJ
3668 JAEMBO010000057.1 GCA021406725_00832 gene open 4704-5327 traK
3669 JAEMBO010000057.1 GCA021406725_00833 gene open 5348-5608 traQ
3670 JAEMBO010000057.1 GCA021406725_00834 gene open 5592-6101 rrrD
3671 JAEMBO010000057.1 GCA021406725_00835 gene open 6216-7115
3672 JAEMBO010000057.1 GCA021406725_00836 gene open 7118-9667
3673 JAEMBO010000057.1 GCA021406725_00837 gene open 9691-10785
3674 JAEMBO010000057.1 GCA021406725_00838 gene open 11154-11408
3675 JAEMBO010000057.1 GCA021406725_00839 gene open 11435-12700
3676 JAEMBO010000057.1 GCA021406725_00840 gene open 12717-13247
3677 JAEMBO010000057.1 GCA021406725_00841 gene open 13269-13685
3678 JAEMBO010000057.1 GCA021406725_00842 gene open 13703-13909
3679 JAEMBO010000057.1 GCA021406725_00843 gene open 13921-14292
3680 JAEMBO010000057.1 GCA021406725_00844 gene open 14289-14585
3681 JAEMBO010000057.1 GCA021406725_00845 gene open 14597-14815
3682 JAEMBO010000057.1 GCA021406725_00846 gene open 14828-15037
3683 JAEMBO010000058.1 GCA021406725_02101 gene open 13289-13458 Bacteroidales-1
3684 JAEMBO010000058.1 GCA021406725_02101 ncRNA open 13289-13458 Bacteroidales-1 6S-Bacteroidales RNA suggested
3685 JAEMBO010000058.1 GCA021406725_02088 CDS open 271-657 _na     128_aa hypothetical protein
3686 JAEMBO010000058.1 GCA021406725_02089 CDS open 694-1563 _na     289_aa ATPase domain-containing protein
3687 JAEMBO010000058.1 GCA021406725_02090 CDS open 1684-1866 _na     60_aa hypothetical protein
3688 JAEMBO010000058.1 GCA021406725_02091 CDS open 2156-2632 _na     158_aa DUF6078 domain-containing protein
3689 JAEMBO010000058.1 GCA021406725_02092 CDS open 2644-3945 _na     433_aa bioA adenosylmethionine--8-amino-7-oxononanoate transaminase
3690 JAEMBO010000058.1 GCA021406725_02093 CDS open 3935-4927 _na     330_aa bioB biotin synthase BioB
3691 JAEMBO010000058.1 GCA021406725_02094 CDS open 5106-6638 _na     510_aa Symporter
3692 JAEMBO010000058.1 GCA021406725_02095 CDS open 6664-7755 _na     363_aa DUF4831 domain-containing protein
3693 JAEMBO010000058.1 GCA021406725_02096 CDS open 8838-9821 _na     327_aa trpS tryptophan--tRNA ligase
3694 JAEMBO010000058.1 GCA021406725_02097 CDS open 9876-10295 _na     139_aa DUF3127 domain-containing protein
3695 JAEMBO010000058.1 GCA021406725_02098 CDS open 10295-10768 _na     157_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
3696 JAEMBO010000058.1 GCA021406725_02099 CDS open 10830-11888 _na     352_aa msrB bifunctional methionine sulfoxide reductase B/A protein
3697 JAEMBO010000058.1 GCA021406725_02100 CDS open 11945-13129 _na     394_aa Transglutaminase-like domain-containing protein
3698 JAEMBO010000058.1 GCA021406725_02102 CDS open 13536-14444 _na     302_aa fieF Cation efflux family protein
3699 JAEMBO010000058.1 GCA021406725_02103 CDS open 14487-14840 _na     117_aa folB dihydroneopterin aldolase
3700 JAEMBO010000058.1 GCA021406725_02088 gene open 271-657
3701 JAEMBO010000058.1 GCA021406725_02089 gene open 694-1563
3702 JAEMBO010000058.1 GCA021406725_02090 gene open 1684-1866
3703 JAEMBO010000058.1 GCA021406725_02091 gene open 2156-2632
3704 JAEMBO010000058.1 GCA021406725_02092 gene open 2644-3945 bioA
3705 JAEMBO010000058.1 GCA021406725_02093 gene open 3935-4927 bioB
3706 JAEMBO010000058.1 GCA021406725_02094 gene open 5106-6638
3707 JAEMBO010000058.1 GCA021406725_02095 gene open 6664-7755
3708 JAEMBO010000058.1 GCA021406725_02096 gene open 8838-9821 trpS
3709 JAEMBO010000058.1 GCA021406725_02097 gene open 9876-10295
3710 JAEMBO010000058.1 GCA021406725_02098 gene open 10295-10768 rlmH
3711 JAEMBO010000058.1 GCA021406725_02099 gene open 10830-11888 msrB
3712 JAEMBO010000058.1 GCA021406725_02100 gene open 11945-13129
3713 JAEMBO010000058.1 GCA021406725_02102 gene open 13536-14444 fieF
3714 JAEMBO010000058.1 GCA021406725_02103 gene open 14487-14840 folB
3715 JAEMBO010000059.1 GCA021406725_01261 CDS open 495-3317 _na     940_aa cTD-A Peptidase S1 domain-containing protein
3716 JAEMBO010000059.1 GCA021406725_01262 CDS open 3449-3661 _na     70_aa hypothetical protein
3717 JAEMBO010000059.1 GCA021406725_01263 CDS open 3844-4362 _na     172_aa DNA-binding protein%2C histone-like family
3718 JAEMBO010000059.1 GCA021406725_01264 CDS open 5161-6339 _na     392_aa MBL fold metallo-hydrolase
3719 JAEMBO010000059.1 GCA021406725_01265 CDS open 6507-6890 _na     127_aa hypothetical protein
3720 JAEMBO010000059.1 GCA021406725_01266 CDS open 6868-7182 _na     104_aa hypothetical protein
3721 JAEMBO010000059.1 GCA021406725_01267 CDS open 7715-8536 _na     273_aa xapA purine nucleoside phosphorylase I%2C inosine and guanosine-specific
3722 JAEMBO010000059.1 GCA021406725_01268 CDS open 8556-9830 _na     424_aa ssnA 5-methylthioadenosine/S-adenosylhomocysteine deaminase
3723 JAEMBO010000059.1 GCA021406725_01269 CDS open 9905-11260 _na     451_aa argE dipeptidase
3724 JAEMBO010000059.1 GCA021406725_01270 CDS open 11477-13153 _na     558_aa ybjL putative transporter
3725 JAEMBO010000059.1 GCA021406725_01271 CDS open 13295-13798 _na     167_aa Histidinol phosphate aminotransferase
3726 JAEMBO010000059.1 GCA021406725_01272 CDS open 14334-14900 _na     188_aa efp elongation factor P
3727 JAEMBO010000059.1 GCA021406725_01261 gene open 495-3317 cTD-A
3728 JAEMBO010000059.1 GCA021406725_01262 gene open 3449-3661
3729 JAEMBO010000059.1 GCA021406725_01263 gene open 3844-4362
3730 JAEMBO010000059.1 GCA021406725_01264 gene open 5161-6339
3731 JAEMBO010000059.1 GCA021406725_01265 gene open 6507-6890
3732 JAEMBO010000059.1 GCA021406725_01266 gene open 6868-7182
3733 JAEMBO010000059.1 GCA021406725_01267 gene open 7715-8536 xapA
3734 JAEMBO010000059.1 GCA021406725_01268 gene open 8556-9830 ssnA
3735 JAEMBO010000059.1 GCA021406725_01269 gene open 9905-11260 argE
3736 JAEMBO010000059.1 GCA021406725_01270 gene open 11477-13153 ybjL
3737 JAEMBO010000059.1 GCA021406725_01271 gene open 13295-13798
3738 JAEMBO010000059.1 GCA021406725_01272 gene open 14334-14900 efp
3739 JAEMBO010000060.1 regulatory_region open 4192-4251 SAM-II riboswitch aptamer (SAM-II long loop)
3740 JAEMBO010000060.1 regulatory_region open 9358-9471 TPP riboswitch aptamer (THI element)
3741 JAEMBO010000060.1 GCA021406725_02001 CDS open 273-752 _na     159_aa hypothetical protein
3742 JAEMBO010000060.1 GCA021406725_02002 CDS open 1027-1212 _na     61_aa Lipocalin-like domain-containing protein
3743 JAEMBO010000060.1 GCA021406725_02003 CDS open 1980-2522 _na     180_aa hypothetical protein
3744 JAEMBO010000060.1 GCA021406725_02004 CDS open 2618-3097 _na     159_aa Immunity protein 26 of polymorphic toxin system
3745 JAEMBO010000060.1 GCA021406725_02005 CDS open 3218-3916 _na     232_aa hypothetical protein
3746 JAEMBO010000060.1 GCA021406725_02006 CDS open 4340-5629 _na     429_aa metK methionine adenosyltransferase
3747 JAEMBO010000060.1 GCA021406725_02007 CDS open 5757-6434 _na     225_aa thiN thiamine diphosphokinase
3748 JAEMBO010000060.1 GCA021406725_02008 CDS open 6431-7039 _na     202_aa pnuC nicotinamide riboside transporter PnuC
3749 JAEMBO010000060.1 GCA021406725_02009 CDS open 7044-9281 _na     745_aa cirA TonB-dependent receptor
3750 JAEMBO010000060.1 GCA021406725_02010 CDS open 9504-10451 _na     315_aa rsgA ribosome small subunit-dependent GTPase A
3751 JAEMBO010000060.1 GCA021406725_02011 CDS open 10536-11096 _na     186_aa frr ribosome recycling factor
3752 JAEMBO010000060.1 GCA021406725_02012 CDS open 11133-11852 _na     239_aa pyrH UMP kinase
3753 JAEMBO010000060.1 GCA021406725_02013 CDS open 11935-13926 _na     663_aa DUF6819 domain-containing protein
3754 JAEMBO010000060.1 GCA021406725_02001 gene open 273-752
3755 JAEMBO010000060.1 GCA021406725_02002 gene open 1027-1212
3756 JAEMBO010000060.1 GCA021406725_02003 gene open 1980-2522
3757 JAEMBO010000060.1 GCA021406725_02004 gene open 2618-3097
3758 JAEMBO010000060.1 GCA021406725_02005 gene open 3218-3916
3759 JAEMBO010000060.1 GCA021406725_02006 gene open 4340-5629 metK
3760 JAEMBO010000060.1 GCA021406725_02007 gene open 5757-6434 thiN
3761 JAEMBO010000060.1 GCA021406725_02008 gene open 6431-7039 pnuC
3762 JAEMBO010000060.1 GCA021406725_02009 gene open 7044-9281 cirA
3763 JAEMBO010000060.1 GCA021406725_02010 gene open 9504-10451 rsgA
3764 JAEMBO010000060.1 GCA021406725_02011 gene open 10536-11096 frr
3765 JAEMBO010000060.1 GCA021406725_02012 gene open 11133-11852 pyrH
3766 JAEMBO010000060.1 GCA021406725_02013 gene open 11935-13926
3767 JAEMBO010000061.1 GCA021406725_02104 CDS open 135-1268 _na     377_aa ISAs1 family transposase
3768 JAEMBO010000061.1 GCA021406725_02105 CDS open 1385-1624 _na     79_aa hypothetical protein
3769 JAEMBO010000061.1 GCA021406725_02106 CDS open 1796-2176 _na     126_aa ridA Putative YjgF-like protein
3770 JAEMBO010000061.1 GCA021406725_02107 CDS open 2202-2951 _na     249_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
3771 JAEMBO010000061.1 GCA021406725_02108 CDS open 2948-4603 _na     551_aa recN DNA repair protein RecN
3772 JAEMBO010000061.1 GCA021406725_02109 CDS open 4618-5526 _na     302_aa DUF4835 domain-containing protein
3773 JAEMBO010000061.1 GCA021406725_02110 CDS open 5523-6737 _na     404_aa coaBC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
3774 JAEMBO010000061.1 GCA021406725_02111 CDS open 6763-7542 _na     259_aa dnaQ DNA polymerase III subunit epsilon
3775 JAEMBO010000061.1 GCA021406725_02112 CDS open 7555-8688 _na     377_aa dnaN DNA polymerase III subunit beta
3776 JAEMBO010000061.1 GCA021406725_02113 CDS open 8893-9177 _na     94_aa hypothetical protein
3777 JAEMBO010000061.1 GCA021406725_02114 CDS open 9049-9606 _na     185_aa fAU1 5-formyltetrahydrofolate cyclo-ligase
3778 JAEMBO010000061.1 GCA021406725_02115 CDS open 9566-11197 _na     543_aa ctpA Carboxyl-terminal protease
3779 JAEMBO010000061.1 GCA021406725_02116 CDS open 11205-11654 _na     149_aa comEB Cytidine/deoxycytidylate deaminase family protein
3780 JAEMBO010000061.1 GCA021406725_02117 CDS open 11741-12094 _na     117_aa DUF2023 domain-containing protein
3781 JAEMBO010000061.1 GCA021406725_02118 CDS open 12259-12756 _na     165_aa fldA flavodoxin
3782 JAEMBO010000061.1 GCA021406725_02119 CDS open 12895-14055 _na     386_aa Glycerate 2-kinase
3783 JAEMBO010000061.1 GCA021406725_02104 gene open 135-1268
3784 JAEMBO010000061.1 GCA021406725_02105 gene open 1385-1624
3785 JAEMBO010000061.1 GCA021406725_02106 gene open 1796-2176 ridA
3786 JAEMBO010000061.1 GCA021406725_02107 gene open 2202-2951 rlmB
3787 JAEMBO010000061.1 GCA021406725_02108 gene open 2948-4603 recN
3788 JAEMBO010000061.1 GCA021406725_02109 gene open 4618-5526
3789 JAEMBO010000061.1 GCA021406725_02110 gene open 5523-6737 coaBC
3790 JAEMBO010000061.1 GCA021406725_02111 gene open 6763-7542 dnaQ
3791 JAEMBO010000061.1 GCA021406725_02112 gene open 7555-8688 dnaN
3792 JAEMBO010000061.1 GCA021406725_02113 gene open 8893-9177
3793 JAEMBO010000061.1 GCA021406725_02114 gene open 9049-9606 fAU1
3794 JAEMBO010000061.1 GCA021406725_02115 gene open 9566-11197 ctpA
3795 JAEMBO010000061.1 GCA021406725_02116 gene open 11205-11654 comEB
3796 JAEMBO010000061.1 GCA021406725_02117 gene open 11741-12094
3797 JAEMBO010000061.1 GCA021406725_02118 gene open 12259-12756 fldA
3798 JAEMBO010000061.1 GCA021406725_02119 gene open 12895-14055
3799 JAEMBO010000062.1 GCA021406725_00371 CDS open 477-686 _na     69_aa copZ HMA domain-containing protein
3800 JAEMBO010000062.1 GCA021406725_00372 CDS open 722-2929 _na     735_aa zntA Cation-transporting ATPase
3801 JAEMBO010000062.1 GCA021406725_00373 CDS open 2937-3440 _na     167_aa wzb Phosphotyrosine protein phosphatase
3802 JAEMBO010000062.1 GCA021406725_00374 CDS open 3431-4765 _na     444_aa norM DNA-damage-inducible protein F
3803 JAEMBO010000062.1 GCA021406725_00375 CDS open 4921-6036 _na     371_aa trxA Thioredoxin domain-containing protein
3804 JAEMBO010000062.1 GCA021406725_00376 CDS open 6240-8825 _na     861_aa ftsK FtsK/SpoIIIE family protein
3805 JAEMBO010000062.1 GCA021406725_00377 CDS open 8839-9486 _na     215_aa lolA Outer membrane lipoprotein carrier protein LolA
3806 JAEMBO010000062.1 GCA021406725_00378 CDS open 9552-9977 _na     141_aa Lipocalin-like domain-containing protein
3807 JAEMBO010000062.1 GCA021406725_00379 CDS open 10111-11265 _na     384_aa galK galactokinase
3808 JAEMBO010000062.1 GCA021406725_00380 CDS open 11315-12382 _na     355_aa galM Aldose 1-epimerase
3809 JAEMBO010000062.1 GCA021406725_00381 CDS open 12589-13218 _na     209_aa Outer membrane protein beta-barrel domain-containing protein
3810 JAEMBO010000062.1 GCA021406725_00382 CDS open 13437-13694 _na     85_aa Partial transposase in ISPg4
3811 JAEMBO010000062.1 GCA021406725_00371 gene open 477-686 copZ
3812 JAEMBO010000062.1 GCA021406725_00372 gene open 722-2929 zntA
3813 JAEMBO010000062.1 GCA021406725_00373 gene open 2937-3440 wzb
3814 JAEMBO010000062.1 GCA021406725_00374 gene open 3431-4765 norM
3815 JAEMBO010000062.1 GCA021406725_00375 gene open 4921-6036 trxA
3816 JAEMBO010000062.1 GCA021406725_00376 gene open 6240-8825 ftsK
3817 JAEMBO010000062.1 GCA021406725_00377 gene open 8839-9486 lolA
3818 JAEMBO010000062.1 GCA021406725_00378 gene open 9552-9977
3819 JAEMBO010000062.1 GCA021406725_00379 gene open 10111-11265 galK
3820 JAEMBO010000062.1 GCA021406725_00380 gene open 11315-12382 galM
3821 JAEMBO010000062.1 GCA021406725_00381 gene open 12589-13218
3822 JAEMBO010000062.1 GCA021406725_00382 gene open 13437-13694
3823 JAEMBO010000063.1 GCA021406725_00761 CDS open 103-609 _na     168_aa hypothetical protein
3824 JAEMBO010000063.1 GCA021406725_00762 CDS open 1070-1384 _na     104_aa pntA proton-translocating NAD(P)(+) transhydrogenase
3825 JAEMBO010000063.1 GCA021406725_00763 CDS open 1498-2655 _na     385_aa pntA proton-translocating NAD(P)(+) transhydrogenase
3826 JAEMBO010000063.1 GCA021406725_00764 CDS open 3034-3453 _na     139_aa mscL large-conductance mechanosensitive channel protein MscL
3827 JAEMBO010000063.1 GCA021406725_00765 CDS open 4400-6556 _na     718_aa patZN Acetyltransferase
3828 JAEMBO010000063.1 GCA021406725_00766 CDS open 6599-7909 _na     436_aa aspB Aminotransferase class I/classII large domain-containing protein
3829 JAEMBO010000063.1 GCA021406725_00767 CDS open 8038-9147 _na     369_aa cTD-A Cleaved adhesin domain-containing protein
3830 JAEMBO010000063.1 GCA021406725_00768 CDS open 9368-9676 _na     102_aa DUF4286 domain-containing protein
3831 JAEMBO010000063.1 GCA021406725_00769 CDS open 9684-10253 _na     189_aa ruvC crossover junction endodeoxyribonuclease RuvC
3832 JAEMBO010000063.1 GCA021406725_00770 CDS open 10301-11635 _na     444_aa ylaK PhoH family protein
3833 JAEMBO010000063.1 GCA021406725_00771 CDS open 11792-13459 _na     555_aa fhs formate--tetrahydrofolate ligase
3834 JAEMBO010000063.1 GCA021406725_00772 CDS open 13703-14008 _na     101_aa hypothetical protein
3835 JAEMBO010000063.1 GCA021406725_00761 gene open 103-609
3836 JAEMBO010000063.1 GCA021406725_00762 gene open 1070-1384 pntA
3837 JAEMBO010000063.1 GCA021406725_00763 gene open 1498-2655 pntA
3838 JAEMBO010000063.1 GCA021406725_00764 gene open 3034-3453 mscL
3839 JAEMBO010000063.1 GCA021406725_00765 gene open 4400-6556 patZN
3840 JAEMBO010000063.1 GCA021406725_00766 gene open 6599-7909 aspB
3841 JAEMBO010000063.1 GCA021406725_00767 gene open 8038-9147 cTD-A
3842 JAEMBO010000063.1 GCA021406725_00768 gene open 9368-9676
3843 JAEMBO010000063.1 GCA021406725_00769 gene open 9684-10253 ruvC
3844 JAEMBO010000063.1 GCA021406725_00770 gene open 10301-11635 ylaK
3845 JAEMBO010000063.1 GCA021406725_00771 gene open 11792-13459 fhs
3846 JAEMBO010000063.1 GCA021406725_00772 gene open 13703-14008
3847 JAEMBO010000064.1 GCA021406725_00001 CDS open 183-410 _na     75_aa hypothetical protein
3848 JAEMBO010000064.1 GCA021406725_00002 CDS open 496-1152 _na     218_aa pASTA PASTA domain-containing protein
3849 JAEMBO010000064.1 GCA021406725_00003 CDS open 1166-2287 _na     373_aa rluA Pseudouridine synthase
3850 JAEMBO010000064.1 GCA021406725_00004 CDS open 2351-3346 _na     331_aa ddl D-alanine--D-alanine ligase
3851 JAEMBO010000064.1 GCA021406725_00005 CDS open 3371-4531 _na     386_aa plsC Phospholipid/glycerol acyltransferase domain-containing protein
3852 JAEMBO010000064.1 GCA021406725_00006 CDS open 4780-5169 _na     129_aa PEGA domain-containing protein
3853 JAEMBO010000064.1 GCA021406725_00007 CDS open 5234-5860 _na     208_aa yigB Haloacid dehalogenase
3854 JAEMBO010000064.1 GCA021406725_00008 CDS open 5945-7975 _na     676_aa dpp5 Dipeptidyl-peptidase 5
3855 JAEMBO010000064.1 GCA021406725_00009 CDS open 8278-8430 _na     50_aa hypothetical protein
3856 JAEMBO010000064.1 GCA021406725_00010 CDS open 8666-9274 _na     202_aa nlpC C40 family peptidase
3857 JAEMBO010000064.1 GCA021406725_00011 CDS open 9506-10195 _na     229_aa ompR DNA-binding response regulator
3858 JAEMBO010000064.1 GCA021406725_00012 CDS open 10192-11475 _na     427_aa baeS histidine kinase
3859 JAEMBO010000064.1 GCA021406725_00013 CDS open 11598-12035 _na     145_aa Putative beta-lactamase-inhibitor-like PepSY-like domain-containing protein
3860 JAEMBO010000064.1 GCA021406725_00014 CDS open 12536-13000 _na     154_aa hypothetical protein
3861 JAEMBO010000064.1 GCA021406725_00001 gene open 183-410
3862 JAEMBO010000064.1 GCA021406725_00002 gene open 496-1152 pASTA
3863 JAEMBO010000064.1 GCA021406725_00003 gene open 1166-2287 rluA
3864 JAEMBO010000064.1 GCA021406725_00004 gene open 2351-3346 ddl
3865 JAEMBO010000064.1 GCA021406725_00005 gene open 3371-4531 plsC
3866 JAEMBO010000064.1 GCA021406725_00006 gene open 4780-5169
3867 JAEMBO010000064.1 GCA021406725_00007 gene open 5234-5860 yigB
3868 JAEMBO010000064.1 GCA021406725_00008 gene open 5945-7975 dpp5
3869 JAEMBO010000064.1 GCA021406725_00009 gene open 8278-8430
3870 JAEMBO010000064.1 GCA021406725_00010 gene open 8666-9274 nlpC
3871 JAEMBO010000064.1 GCA021406725_00011 gene open 9506-10195 ompR
3872 JAEMBO010000064.1 GCA021406725_00012 gene open 10192-11475 baeS
3873 JAEMBO010000064.1 GCA021406725_00013 gene open 11598-12035
3874 JAEMBO010000064.1 GCA021406725_00014 gene open 12536-13000
3875 JAEMBO010000065.1 GCA021406725_01827 CDS open 57-353 _na     98_aa hypothetical protein
3876 JAEMBO010000065.1 GCA021406725_01828 CDS open 560-1063 _na     167_aa bcp thioredoxin-dependent thiol peroxidase
3877 JAEMBO010000065.1 GCA021406725_01829 CDS open 1084-2106 _na     340_aa recA recombinase RecA
3878 JAEMBO010000065.1 GCA021406725_01830 CDS open 2216-3145 _na     309_aa BioF2-like acetyltransferase domain-containing protein
3879 JAEMBO010000065.1 GCA021406725_01831 CDS open 3142-4503 _na     453_aa DUF7033 domain-containing protein
3880 JAEMBO010000065.1 GCA021406725_01832 CDS open 4500-5750 _na     416_aa rfaB Glycosyltransferase
3881 JAEMBO010000065.1 GCA021406725_01833 CDS open 5766-6866 _na     366_aa aroGA Chorismate mutase
3882 JAEMBO010000065.1 GCA021406725_01834 CDS open 6863-7627 _na     254_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
3883 JAEMBO010000065.1 GCA021406725_01835 CDS open 7893-8084 _na     63_aa hypothetical protein
3884 JAEMBO010000065.1 GCA021406725_01836 CDS open 8127-9323 _na     398_aa pepP Peptidase M24
3885 JAEMBO010000065.1 GCA021406725_01837 CDS open 9359-11050 _na     563_aa phoA Alkaline phosphatase%2C putative
3886 JAEMBO010000065.1 GCA021406725_01838 CDS open 11158-11382 _na     74_aa hypothetical protein
3887 JAEMBO010000065.1 GCA021406725_01827 gene open 57-353
3888 JAEMBO010000065.1 GCA021406725_01828 gene open 560-1063 bcp
3889 JAEMBO010000065.1 GCA021406725_01829 gene open 1084-2106 recA
3890 JAEMBO010000065.1 GCA021406725_01830 gene open 2216-3145
3891 JAEMBO010000065.1 GCA021406725_01831 gene open 3142-4503
3892 JAEMBO010000065.1 GCA021406725_01832 gene open 4500-5750 rfaB
3893 JAEMBO010000065.1 GCA021406725_01833 gene open 5766-6866 aroGA
3894 JAEMBO010000065.1 GCA021406725_01834 gene open 6863-7627 folK
3895 JAEMBO010000065.1 GCA021406725_01835 gene open 7893-8084
3896 JAEMBO010000065.1 GCA021406725_01836 gene open 8127-9323 pepP
3897 JAEMBO010000065.1 GCA021406725_01837 gene open 9359-11050 phoA
3898 JAEMBO010000065.1 GCA021406725_01838 gene open 11158-11382
3899 JAEMBO010000066.1 GCA021406725_01249 gene open 1-1058 rrl
3900 JAEMBO010000066.1 GCA021406725_01250 gene open 1151-1261 rrf
3901 JAEMBO010000066.1 GCA021406725_01249 rRNA open 1-1058 rrl 23S ribosomal RNA
3902 JAEMBO010000066.1 GCA021406725_01250 rRNA open 1151-1261 rrf 5S ribosomal RNA
3903 JAEMBO010000066.1 GCA021406725_01251 CDS open 1704-1877 _na     57_aa hypothetical protein
3904 JAEMBO010000066.1 GCA021406725_01252 CDS open 2325-3692 _na     455_aa tolC Outer membrane efflux protein
3905 JAEMBO010000066.1 GCA021406725_01253 CDS open 3689-4795 _na     368_aa acrA Membrane fusion efflux protein
3906 JAEMBO010000066.1 GCA021406725_01254 CDS open 4865-6127 _na     420_aa salY Putative ABC transporter ATP-binding protein
3907 JAEMBO010000066.1 GCA021406725_01255 CDS open 6150-7424 _na     424_aa salY ABC transporter%2C permease protein%2C putative
3908 JAEMBO010000066.1 GCA021406725_01256 CDS open 7449-8108 _na     219_aa lolD ABC transporter%2C ATP-binding protein
3909 JAEMBO010000066.1 GCA021406725_01257 CDS open 8127-8534 _na     135_aa DUF6249 domain-containing protein
3910 JAEMBO010000066.1 GCA021406725_01258 CDS open 9017-9541 _na     174_aa rpoE RNA polymerase sigma-70 factor%2C ECF subfamily
3911 JAEMBO010000066.1 GCA021406725_01259 CDS open 9538-9930 _na     130_aa DUF3333 domain-containing protein
3912 JAEMBO010000066.1 GCA021406725_01260 CDS open 10127-10381 _na     84_aa Transposase
3913 JAEMBO010000066.1 GCA021406725_01251 gene open 1704-1877
3914 JAEMBO010000066.1 GCA021406725_01252 gene open 2325-3692 tolC
3915 JAEMBO010000066.1 GCA021406725_01253 gene open 3689-4795 acrA
3916 JAEMBO010000066.1 GCA021406725_01254 gene open 4865-6127 salY
3917 JAEMBO010000066.1 GCA021406725_01255 gene open 6150-7424 salY
3918 JAEMBO010000066.1 GCA021406725_01256 gene open 7449-8108 lolD
3919 JAEMBO010000066.1 GCA021406725_01257 gene open 8127-8534
3920 JAEMBO010000066.1 GCA021406725_01258 gene open 9017-9541 rpoE
3921 JAEMBO010000066.1 GCA021406725_01259 gene open 9538-9930
3922 JAEMBO010000066.1 GCA021406725_01260 gene open 10127-10381
3923 JAEMBO010000067.1 GCA021406725_01853 CDS open 320-574 _na     84_aa hypothetical protein
3924 JAEMBO010000067.1 GCA021406725_01854 CDS open 1404-2273 _na     289_aa dinD DNA damage-inducible protein D
3925 JAEMBO010000067.1 GCA021406725_01855 CDS open 2364-3242 _na     292_aa Guanylate cyclase domain-containing protein
3926 JAEMBO010000067.1 GCA021406725_01856 CDS open 3205-3678 _na     157_aa Histidinol phosphate phosphatase
3927 JAEMBO010000067.1 GCA021406725_01857 CDS open 3915-4202 _na     95_aa helix-turn-helix domain-containing protein
3928 JAEMBO010000067.1 GCA021406725_01858 CDS open 4308-4508 _na     66_aa hypothetical protein
3929 JAEMBO010000067.1 GCA021406725_01859 CDS open 4501-5682 _na     393_aa AAA domain-containing protein
3930 JAEMBO010000067.1 GCA021406725_01860 CDS open 5871-9452 _na     1193_aa nifJ pyruvate:ferredoxin (flavodoxin) oxidoreductase
3931 JAEMBO010000067.1 GCA021406725_01853 gene open 320-574
3932 JAEMBO010000067.1 GCA021406725_01854 gene open 1404-2273 dinD
3933 JAEMBO010000067.1 GCA021406725_01855 gene open 2364-3242
3934 JAEMBO010000067.1 GCA021406725_01856 gene open 3205-3678
3935 JAEMBO010000067.1 GCA021406725_01857 gene open 3915-4202
3936 JAEMBO010000067.1 GCA021406725_01858 gene open 4308-4508
3937 JAEMBO010000067.1 GCA021406725_01859 gene open 4501-5682
3938 JAEMBO010000067.1 GCA021406725_01860 gene open 5871-9452 nifJ
3939 JAEMBO010000068.1 GCA021406725_01991 CDS open 314-7813 _na     2499_aa sprA cell surface protein SprA
3940 JAEMBO010000068.1 GCA021406725_01992 CDS open 7853-8461 _na     202_aa ruvA Holliday junction branch migration protein RuvA
3941 JAEMBO010000068.1 GCA021406725_01993 CDS open 8898-9323 _na     141_aa Partial transposase in ISPg1
3942 JAEMBO010000068.1 GCA021406725_01991 gene open 314-7813 sprA
3943 JAEMBO010000068.1 GCA021406725_01992 gene open 7853-8461 ruvA
3944 JAEMBO010000068.1 GCA021406725_01993 gene open 8898-9323
3945 JAEMBO010000069.1 GCA021406725_00191 CDS open 58-504 _na     148_aa hypothetical protein
3946 JAEMBO010000069.1 GCA021406725_00192 CDS open 551-1243 _na     230_aa Succinate dehydrogenase/fumarate reductase cytochrome b subunit
3947 JAEMBO010000069.1 GCA021406725_00193 CDS open 1274-3217 _na     647_aa sdhA Succinate dehydrogenase
3948 JAEMBO010000069.1 GCA021406725_00194 CDS open 3246-4001 _na     251_aa sdhB Fumarate reductase%2C iron-sulfur protein
3949 JAEMBO010000069.1 GCA021406725_00195 CDS open 4235-4639 _na     134_aa mce methylmalonyl-CoA epimerase
3950 JAEMBO010000069.1 GCA021406725_00196 CDS open 4738-6291 _na     517_aa mmdA Methylmalonyl-CoA decarboxylase%2C alpha subunit
3951 JAEMBO010000069.1 GCA021406725_00197 CDS open 6316-7257 _na     313_aa oadG LTD domain-containing protein
3952 JAEMBO010000069.1 GCA021406725_00198 CDS open 7254-7490 _na     78_aa hypothetical protein
3953 JAEMBO010000069.1 GCA021406725_00199 CDS open 7528-7962 _na     144_aa pccA Methylmalonyl-CoA decarboxylase%2C gamma subunit
3954 JAEMBO010000069.1 GCA021406725_00200 CDS open 7967-9118 _na     383_aa oadB Methylmalonyl-CoA decarboxylase%2C beta subunit
3955 JAEMBO010000069.1 GCA021406725_00191 gene open 58-504
3956 JAEMBO010000069.1 GCA021406725_00192 gene open 551-1243
3957 JAEMBO010000069.1 GCA021406725_00193 gene open 1274-3217 sdhA
3958 JAEMBO010000069.1 GCA021406725_00194 gene open 3246-4001 sdhB
3959 JAEMBO010000069.1 GCA021406725_00195 gene open 4235-4639 mce
3960 JAEMBO010000069.1 GCA021406725_00196 gene open 4738-6291 mmdA
3961 JAEMBO010000069.1 GCA021406725_00197 gene open 6316-7257 oadG
3962 JAEMBO010000069.1 GCA021406725_00198 gene open 7254-7490
3963 JAEMBO010000069.1 GCA021406725_00199 gene open 7528-7962 pccA
3964 JAEMBO010000069.1 GCA021406725_00200 gene open 7967-9118 oadB
3965 JAEMBO010000070.1 GCA021406725_01917 CDS open 406-2214 _na     602_aa Glutamine amidotransferase%2C class II/dipeptidase
3966 JAEMBO010000070.1 GCA021406725_01918 CDS open 2207-4171 _na     654_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
3967 JAEMBO010000070.1 GCA021406725_01919 CDS open 4229-5014 _na     261_aa mazG nucleoside triphosphate pyrophosphohydrolase
3968 JAEMBO010000070.1 GCA021406725_01920 CDS open 5032-7080 _na     682_aa dsbD Thiol:disulfide interchange protein dsbD%2C putative
3969 JAEMBO010000070.1 GCA021406725_01921 CDS open 7116-8090 _na     324_aa rluA Pseudouridine synthase
3970 JAEMBO010000070.1 GCA021406725_01922 CDS open 8110-8472 _na     120_aa Lipoprotein
3971 JAEMBO010000070.1 GCA021406725_01923 CDS open 8493-8846 _na     117_aa Septum formation initiator
3972 JAEMBO010000070.1 GCA021406725_01917 gene open 406-2214
3973 JAEMBO010000070.1 GCA021406725_01918 gene open 2207-4171 gyrB
3974 JAEMBO010000070.1 GCA021406725_01919 gene open 4229-5014 mazG
3975 JAEMBO010000070.1 GCA021406725_01920 gene open 5032-7080 dsbD
3976 JAEMBO010000070.1 GCA021406725_01921 gene open 7116-8090 rluA
3977 JAEMBO010000070.1 GCA021406725_01922 gene open 8110-8472
3978 JAEMBO010000070.1 GCA021406725_01923 gene open 8493-8846
3979 JAEMBO010000071.1 GCA021406725_00542 CDS open 178-2325 _na     715_aa scpA methylmalonyl-CoA mutase
3980 JAEMBO010000071.1 GCA021406725_00543 CDS open 2354-4210 _na     618_aa mutA methylmalonyl-CoA mutase small subunit
3981 JAEMBO010000071.1 GCA021406725_00544 CDS open 4484-5983 _na     499_aa T9SS C-terminal target domain-containing protein
3982 JAEMBO010000071.1 GCA021406725_00545 CDS open 6908-7375 _na     155_aa hupA Histidinol phosphate aminotransferase
3983 JAEMBO010000071.1 GCA021406725_00546 CDS open 7437-7883 _na     148_aa hypothetical protein
3984 JAEMBO010000071.1 GCA021406725_00547 CDS open 7903-8343 _na     146_aa hypothetical protein
3985 JAEMBO010000071.1 GCA021406725_00548 CDS open 8515-9009 _na     164_aa M15 family metallopeptidase
3986 JAEMBO010000071.1 GCA021406725_00542 gene open 178-2325 scpA
3987 JAEMBO010000071.1 GCA021406725_00543 gene open 2354-4210 mutA
3988 JAEMBO010000071.1 GCA021406725_00544 gene open 4484-5983
3989 JAEMBO010000071.1 GCA021406725_00545 gene open 6908-7375 hupA
3990 JAEMBO010000071.1 GCA021406725_00546 gene open 7437-7883
3991 JAEMBO010000071.1 GCA021406725_00547 gene open 7903-8343
3992 JAEMBO010000071.1 GCA021406725_00548 gene open 8515-9009
3993 JAEMBO010000072.1 GCA021406725_00754 CDS open 295-1815 _na     506_aa cobH Precorrin-3B C(17)-methyltransferase
3994 JAEMBO010000072.1 GCA021406725_00755 CDS open 1808-3049 _na     413_aa cobL Precorrin-6Y C5%2C15-methyltransferase%2C decarboxylating
3995 JAEMBO010000072.1 GCA021406725_00756 CDS open 3046-3207 _na     53_aa DNA-binding protein
3996 JAEMBO010000072.1 GCA021406725_00757 CDS open 3299-3910 _na     203_aa GIY-YIG nuclease family protein
3997 JAEMBO010000072.1 GCA021406725_00758 CDS open 3915-5759 _na     614_aa cobM precorrin-4 C(11)-methyltransferase
3998 JAEMBO010000072.1 GCA021406725_00759 CDS open 5756-7564 _na     602_aa cbiD cobalt-precorrin-5B (C(1))-methyltransferase CbiD
3999 JAEMBO010000072.1 GCA021406725_00760 CDS open 7659-8444 _na     261_aa focA putative formate/nitrite transporter
4000 JAEMBO010000072.1 GCA021406725_00754 gene open 295-1815 cobH