HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_021406745.1)

Select a Genome:
BAKTA Annotations for GCA_021406745.1
Genome Selected: Porphyromonas gingivalis
ContigsBases CDSrRNA tmRNAtRNA
89 2282399 1950 3 1 46
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4021 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 4021 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 JAEMBK010000034.1 GCA021406745_01340 gene open 11462-12136 rsmG
3002 JAEMBK010000034.1 GCA021406745_01341 gene open 12133-12777 gloB
3003 JAEMBK010000034.1 GCA021406745_01342 gene open 12782-15649 gcvP
3004 JAEMBK010000034.1 GCA021406745_01343 gene open 15855-17186
3005 JAEMBK010000034.1 GCA021406745_01344 gene open 17203-18618 recD
3006 JAEMBK010000034.1 GCA021406745_01345 gene open 18750-19382
3007 JAEMBK010000034.1 GCA021406745_01346 gene open 19463-20215
3008 JAEMBK010000034.1 GCA021406745_01347 gene open 20252-20791 rsmD
3009 JAEMBK010000034.1 GCA021406745_01348 gene open 20758-20889
3010 JAEMBK010000034.1 GCA021406745_01349 gene open 21641-23440 rpsA
3011 JAEMBK010000034.1 GCA021406745_01334 gene open 4785-4859 trnR
3012 JAEMBK010000034.1 GCA021406745_01334 tRNA open 4785-4859 trnR tRNA-Arg(cct)
3013 JAEMBK010000035.1 GCA021406745_00344 CDS open 241-1053 _na     270_aa bamD Outer membrane lipoprotein BamD-like domain-containing protein
3014 JAEMBK010000035.1 GCA021406745_00345 CDS open 1195-1527 _na     110_aa RNA polymerase Rpb6
3015 JAEMBK010000035.1 GCA021406745_00346 CDS open 1557-2015 _na     152_aa DUF4293 domain-containing protein
3016 JAEMBK010000035.1 GCA021406745_00347 CDS open 2049-2234 _na     61_aa hypothetical protein
3017 JAEMBK010000035.1 GCA021406745_00348 CDS open 2291-2602 _na     103_aa DUF3467 domain-containing protein
3018 JAEMBK010000035.1 GCA021406745_00349 CDS open 2606-3739 _na     377_aa pdxB 4-phosphoerythronate dehydrogenase PdxB
3019 JAEMBK010000035.1 GCA021406745_00350 CDS open 3749-4474 _na     241_aa yqjQ Oxidoreductase%2C short chain dehydrogenase/reductase family
3020 JAEMBK010000035.1 GCA021406745_00351 CDS open 4733-4900 _na     55_aa hypothetical protein
3021 JAEMBK010000035.1 GCA021406745_00352 CDS open 5482-6981 _na     499_aa mltF putative exported transglycosylase protein
3022 JAEMBK010000035.1 GCA021406745_00353 CDS open 7007-8878 _na     623_aa abc-f ribosomal protection-like ABC-F family protein
3023 JAEMBK010000035.1 GCA021406745_00354 CDS open 8925-9590 _na     221_aa ppiB peptidylprolyl isomerase
3024 JAEMBK010000035.1 GCA021406745_00355 CDS open 10192-12300 _na     702_aa Peptidase M3A/M3B catalytic domain-containing protein
3025 JAEMBK010000035.1 GCA021406745_00356 CDS open 12506-13825 _na     439_aa gdhA NADP-specific glutamate dehydrogenase
3026 JAEMBK010000035.1 GCA021406745_00357 CDS open 14176-14277 _na     33_aa hypothetical protein
3027 JAEMBK010000035.1 GCA021406745_00358 CDS open 14533-15528 _na     331_aa wcaG Epimerase/reductase%2C putative
3028 JAEMBK010000035.1 GCA021406745_00359 CDS open 15548-15637 _na     29_aa hypothetical protein
3029 JAEMBK010000035.1 GCA021406745_00360 CDS open 15805-16515 _na     236_aa rIC Hemerythrin-like domain-containing protein
3030 JAEMBK010000035.1 GCA021406745_00361 CDS open 16512-17111 _na     199_aa citB Transcriptional regulator%2C LuxR family
3031 JAEMBK010000035.1 GCA021406745_00362 CDS open 17129-17812 _na     227_aa rluA Putative ribosomal large subunit pseudouridine synthase D
3032 JAEMBK010000035.1 GCA021406745_00363 CDS open 17856-18602 _na     248_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
3033 JAEMBK010000035.1 GCA021406745_00364 CDS open 18686-19321 _na     211_aa acrR Putative transcriptional regulator
3034 JAEMBK010000035.1 GCA021406745_00366 CDS open 19897-21684 _na     595_aa lepA translation elongation factor 4
3035 JAEMBK010000035.1 GCA021406745_00367 CDS open 21719-23305 _na     528_aa dnaB replicative DNA helicase
3036 JAEMBK010000035.1 GCA021406745_00344 gene open 241-1053 bamD
3037 JAEMBK010000035.1 GCA021406745_00345 gene open 1195-1527
3038 JAEMBK010000035.1 GCA021406745_00346 gene open 1557-2015
3039 JAEMBK010000035.1 GCA021406745_00347 gene open 2049-2234
3040 JAEMBK010000035.1 GCA021406745_00348 gene open 2291-2602
3041 JAEMBK010000035.1 GCA021406745_00349 gene open 2606-3739 pdxB
3042 JAEMBK010000035.1 GCA021406745_00350 gene open 3749-4474 yqjQ
3043 JAEMBK010000035.1 GCA021406745_00351 gene open 4733-4900
3044 JAEMBK010000035.1 GCA021406745_00352 gene open 5482-6981 mltF
3045 JAEMBK010000035.1 GCA021406745_00353 gene open 7007-8878 abc-f
3046 JAEMBK010000035.1 GCA021406745_00354 gene open 8925-9590 ppiB
3047 JAEMBK010000035.1 GCA021406745_00355 gene open 10192-12300
3048 JAEMBK010000035.1 GCA021406745_00356 gene open 12506-13825 gdhA
3049 JAEMBK010000035.1 GCA021406745_00357 gene open 14176-14277
3050 JAEMBK010000035.1 GCA021406745_00358 gene open 14533-15528 wcaG
3051 JAEMBK010000035.1 GCA021406745_00359 gene open 15548-15637
3052 JAEMBK010000035.1 GCA021406745_00360 gene open 15805-16515 rIC
3053 JAEMBK010000035.1 GCA021406745_00361 gene open 16512-17111 citB
3054 JAEMBK010000035.1 GCA021406745_00362 gene open 17129-17812 rluA
3055 JAEMBK010000035.1 GCA021406745_00363 gene open 17856-18602 fabG
3056 JAEMBK010000035.1 GCA021406745_00364 gene open 18686-19321 acrR
3057 JAEMBK010000035.1 GCA021406745_00366 gene open 19897-21684 lepA
3058 JAEMBK010000035.1 GCA021406745_00367 gene open 21719-23305 dnaB
3059 JAEMBK010000035.1 GCA021406745_00365 gene open 19548-19618 trnQ
3060 JAEMBK010000035.1 GCA021406745_00365 tRNA open 19548-19618 trnQ tRNA-Gln(ctg)
3061 JAEMBK010000036.1 GCA021406745_00254 CDS open 649-1284 _na     211_aa DUF4294 domain-containing protein
3062 JAEMBK010000036.1 GCA021406745_00255 CDS open 1328-1747 _na     139_aa START-like domain-containing protein
3063 JAEMBK010000036.1 GCA021406745_00256 CDS open 1774-4287 _na     837_aa priA primosomal protein N'
3064 JAEMBK010000036.1 GCA021406745_00257 CDS open 4321-5793 _na     490_aa gltA NADPH-dependent glutamate synthase
3065 JAEMBK010000036.1 GCA021406745_00258 CDS open 5816-6607 _na     263_aa mcr1 Ferredoxin-NADP reductase
3066 JAEMBK010000036.1 GCA021406745_00259 CDS open 6808-7485 _na     225_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
3067 JAEMBK010000036.1 GCA021406745_00260 CDS open 7517-8428 _na     303_aa Ion transporter
3068 JAEMBK010000036.1 GCA021406745_00261 CDS open 8497-8718 _na     73_aa hypothetical protein
3069 JAEMBK010000036.1 GCA021406745_00262 CDS open 8715-9164 _na     149_aa ampD N-acetylmuramoyl-L-alanine amidase
3070 JAEMBK010000036.1 GCA021406745_00263 CDS open 9304-9780 _na     158_aa DNA-binding protein%2C histone-like family
3071 JAEMBK010000036.1 GCA021406745_00264 CDS open 10141-10875 _na     244_aa porT Outer membrane protein beta-barrel domain-containing protein
3072 JAEMBK010000036.1 GCA021406745_00265 CDS open 11230-11493 _na     87_aa hypothetical protein
3073 JAEMBK010000036.1 GCA021406745_00266 CDS open 11617-12711 _na     364_aa yqfO Nif3-like dinuclear metal center hexameric protein
3074 JAEMBK010000036.1 GCA021406745_00267 CDS open 12729-13484 _na     251_aa dR0291 C4-type zinc ribbon domain-containing protein
3075 JAEMBK010000036.1 GCA021406745_00268 CDS open 13748-15112 _na     454_aa tilS tRNA(Ile)-lysidine synthase
3076 JAEMBK010000036.1 GCA021406745_00269 CDS open 15107-17392 _na     761_aa recD Helicase%2C putative
3077 JAEMBK010000036.1 GCA021406745_00270 CDS open 17483-17863 _na     126_aa hypothetical protein
3078 JAEMBK010000036.1 GCA021406745_00271 CDS open 17876-18253 _na     125_aa Phage holin family protein
3079 JAEMBK010000036.1 GCA021406745_00272 CDS open 18509-18784 _na     91_aa ytxH YtxH domain-containing protein
3080 JAEMBK010000036.1 GCA021406745_00273 CDS open 19012-19905 _na     297_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
3081 JAEMBK010000036.1 GCA021406745_00274 CDS open 19934-20587 _na     217_aa bioD dethiobiotin synthase
3082 JAEMBK010000036.1 GCA021406745_00275 CDS open 20693-21364 _na     223_aa ompA Lipoprotein PG3
3083 JAEMBK010000036.1 GCA021406745_00276 CDS open 21430-22410 _na     326_aa pyrD Putative dihydroorotate dehydrogenase
3084 JAEMBK010000036.1 GCA021406745_00254 gene open 649-1284
3085 JAEMBK010000036.1 GCA021406745_00255 gene open 1328-1747
3086 JAEMBK010000036.1 GCA021406745_00256 gene open 1774-4287 priA
3087 JAEMBK010000036.1 GCA021406745_00257 gene open 4321-5793 gltA
3088 JAEMBK010000036.1 GCA021406745_00258 gene open 5816-6607 mcr1
3089 JAEMBK010000036.1 GCA021406745_00259 gene open 6808-7485 trmD
3090 JAEMBK010000036.1 GCA021406745_00260 gene open 7517-8428
3091 JAEMBK010000036.1 GCA021406745_00261 gene open 8497-8718
3092 JAEMBK010000036.1 GCA021406745_00262 gene open 8715-9164 ampD
3093 JAEMBK010000036.1 GCA021406745_00263 gene open 9304-9780
3094 JAEMBK010000036.1 GCA021406745_00264 gene open 10141-10875 porT
3095 JAEMBK010000036.1 GCA021406745_00265 gene open 11230-11493
3096 JAEMBK010000036.1 GCA021406745_00266 gene open 11617-12711 yqfO
3097 JAEMBK010000036.1 GCA021406745_00267 gene open 12729-13484 dR0291
3098 JAEMBK010000036.1 GCA021406745_00268 gene open 13748-15112 tilS
3099 JAEMBK010000036.1 GCA021406745_00269 gene open 15107-17392 recD
3100 JAEMBK010000036.1 GCA021406745_00270 gene open 17483-17863
3101 JAEMBK010000036.1 GCA021406745_00271 gene open 17876-18253
3102 JAEMBK010000036.1 GCA021406745_00272 gene open 18509-18784 ytxH
3103 JAEMBK010000036.1 GCA021406745_00273 gene open 19012-19905 dapA
3104 JAEMBK010000036.1 GCA021406745_00274 gene open 19934-20587 bioD
3105 JAEMBK010000036.1 GCA021406745_00275 gene open 20693-21364 ompA
3106 JAEMBK010000036.1 GCA021406745_00276 gene open 21430-22410 pyrD
3107 JAEMBK010000036.1 GCA021406745_00277 gene open 22941-23013 trnK
3108 JAEMBK010000036.1 GCA021406745_00277 tRNA open 22941-23013 trnK tRNA-Lys(ctt)
3109 JAEMBK010000037.1 GCA021406745_00885 CDS open 487-2208 _na     573_aa cls phospholipase D
3110 JAEMBK010000037.1 GCA021406745_00886 CDS open 2337-3356 _na     339_aa ilvE branched-chain amino acid aminotransferase
3111 JAEMBK010000037.1 GCA021406745_00887 CDS open 3495-4568 _na     357_aa wcaG GDP-L-fucose synthase
3112 JAEMBK010000037.1 GCA021406745_00888 CDS open 4561-5658 _na     365_aa gmd GDP-mannose 4%2C6-dehydratase
3113 JAEMBK010000037.1 GCA021406745_00889 CDS open 6499-7812 _na     437_aa ATP-binding protein
3114 JAEMBK010000037.1 GCA021406745_00890 CDS open 7782-8348 _na     188_aa rloB RloB family protein
3115 JAEMBK010000037.1 GCA021406745_00891 CDS open 8889-9371 _na     160_aa ftnA Ferritin
3116 JAEMBK010000037.1 GCA021406745_00892 CDS open 9479-11467 _na     662_aa lmbE Glucosamine-6-phosphate deaminase
3117 JAEMBK010000037.1 GCA021406745_00893 CDS open 11625-13787 _na     720_aa dpp11 Asp/Glu-specific dipeptidyl-peptidase
3118 JAEMBK010000037.1 GCA021406745_00894 CDS open 13850-14305 _na     151_aa cYTH CYTH domain-containing protein
3119 JAEMBK010000037.1 GCA021406745_00895 CDS open 14329-15453 _na     374_aa Smr domain-containing protein
3120 JAEMBK010000037.1 GCA021406745_00896 CDS open 15619-16866 _na     415_aa DUF1015 domain-containing protein
3121 JAEMBK010000037.1 GCA021406745_00897 CDS open 16885-17805 _na     306_aa serA D-3-phosphoglycerate dehydrogenase
3122 JAEMBK010000037.1 GCA021406745_00898 CDS open 17906-18988 _na     360_aa serC phosphoserine transaminase
3123 JAEMBK010000037.1 GCA021406745_00899 CDS open 19322-20587 _na     421_aa wecC UDP-glucose 6-dehydrogenase
3124 JAEMBK010000037.1 GCA021406745_00900 CDS open 20890-21396 _na     168_aa Histidinol phosphate aminotransferase
3125 JAEMBK010000037.1 GCA021406745_00901 CDS open 21932-22369 _na     145_aa efp elongation factor P
3126 JAEMBK010000037.1 GCA021406745_00885 gene open 487-2208 cls
3127 JAEMBK010000037.1 GCA021406745_00886 gene open 2337-3356 ilvE
3128 JAEMBK010000037.1 GCA021406745_00887 gene open 3495-4568 wcaG
3129 JAEMBK010000037.1 GCA021406745_00888 gene open 4561-5658 gmd
3130 JAEMBK010000037.1 GCA021406745_00889 gene open 6499-7812
3131 JAEMBK010000037.1 GCA021406745_00890 gene open 7782-8348 rloB
3132 JAEMBK010000037.1 GCA021406745_00891 gene open 8889-9371 ftnA
3133 JAEMBK010000037.1 GCA021406745_00892 gene open 9479-11467 lmbE
3134 JAEMBK010000037.1 GCA021406745_00893 gene open 11625-13787 dpp11
3135 JAEMBK010000037.1 GCA021406745_00894 gene open 13850-14305 cYTH
3136 JAEMBK010000037.1 GCA021406745_00895 gene open 14329-15453
3137 JAEMBK010000037.1 GCA021406745_00896 gene open 15619-16866
3138 JAEMBK010000037.1 GCA021406745_00897 gene open 16885-17805 serA
3139 JAEMBK010000037.1 GCA021406745_00898 gene open 17906-18988 serC
3140 JAEMBK010000037.1 GCA021406745_00899 gene open 19322-20587 wecC
3141 JAEMBK010000037.1 GCA021406745_00900 gene open 20890-21396
3142 JAEMBK010000037.1 GCA021406745_00901 gene open 21932-22369 efp
3143 JAEMBK010000038.1 GCA021406745_01620 CDS open 166-825 _na     219_aa Partial transposase in ISPg1
3144 JAEMBK010000038.1 GCA021406745_01621 CDS open 888-1313 _na     141_aa Partial transposase in ISPg1
3145 JAEMBK010000038.1 GCA021406745_01622 CDS open 1749-2357 _na     202_aa ruvA Holliday junction branch migration protein RuvA
3146 JAEMBK010000038.1 GCA021406745_01623 CDS open 2397-9896 _na     2499_aa sprA cell surface protein SprA
3147 JAEMBK010000038.1 GCA021406745_01624 CDS open 10292-10492 _na     66_aa hypothetical protein
3148 JAEMBK010000038.1 GCA021406745_01625 CDS open 10514-11560 _na     348_aa nusB transcription antitermination factor NusB
3149 JAEMBK010000038.1 GCA021406745_01626 CDS open 11598-12503 _na     301_aa aspD diaminopimelate dehydrogenase
3150 JAEMBK010000038.1 GCA021406745_01627 CDS open 12540-13391 _na     283_aa lgt prolipoprotein diacylglyceryl transferase
3151 JAEMBK010000038.1 GCA021406745_01628 CDS open 13422-14633 _na     403_aa norV Flavodoxin
3152 JAEMBK010000038.1 GCA021406745_01629 CDS open 14672-15463 _na     263_aa nagB glucosamine-6-phosphate deaminase
3153 JAEMBK010000038.1 GCA021406745_01630 CDS open 15468-16817 _na     449_aa lpdA dihydrolipoyl dehydrogenase
3154 JAEMBK010000038.1 GCA021406745_01631 CDS open 17209-17385 _na     58_aa hypothetical protein
3155 JAEMBK010000038.1 GCA021406745_01632 CDS open 17521-18972 _na     483_aa pcnB PolyA polymerase family protein
3156 JAEMBK010000038.1 GCA021406745_01633 CDS open 18957-20516 _na     519_aa NAD(P)/FAD-dependent oxidoreductase
3157 JAEMBK010000038.1 GCA021406745_01620 gene open 166-825
3158 JAEMBK010000038.1 GCA021406745_01621 gene open 888-1313
3159 JAEMBK010000038.1 GCA021406745_01622 gene open 1749-2357 ruvA
3160 JAEMBK010000038.1 GCA021406745_01623 gene open 2397-9896 sprA
3161 JAEMBK010000038.1 GCA021406745_01624 gene open 10292-10492
3162 JAEMBK010000038.1 GCA021406745_01625 gene open 10514-11560 nusB
3163 JAEMBK010000038.1 GCA021406745_01626 gene open 11598-12503 aspD
3164 JAEMBK010000038.1 GCA021406745_01627 gene open 12540-13391 lgt
3165 JAEMBK010000038.1 GCA021406745_01628 gene open 13422-14633 norV
3166 JAEMBK010000038.1 GCA021406745_01629 gene open 14672-15463 nagB
3167 JAEMBK010000038.1 GCA021406745_01630 gene open 15468-16817 lpdA
3168 JAEMBK010000038.1 GCA021406745_01631 gene open 17209-17385
3169 JAEMBK010000038.1 GCA021406745_01632 gene open 17521-18972 pcnB
3170 JAEMBK010000038.1 GCA021406745_01633 gene open 18957-20516
3171 JAEMBK010000038.1 GCA021406745_01634 gene open 20582-20654 trnG
3172 JAEMBK010000038.1 GCA021406745_01634 tRNA open 20582-20654 trnG tRNA-Gly(ccc)
3173 JAEMBK010000039.1 GCA021406745_00703 gene open 7933-8102 Bacteroidales-1
3174 JAEMBK010000039.1 GCA021406745_00703 ncRNA open 7933-8102 Bacteroidales-1 6S-Bacteroidales RNA suggested
3175 JAEMBK010000039.1 GCA021406745_00699 CDS open 290-4810 _na     1506_aa tamB DUF490 domain-containing protein
3176 JAEMBK010000039.1 GCA021406745_00700 CDS open 5221-6480 _na     419_aa plug Type 9 secretion system plug protein N-terminal domain-containing protein
3177 JAEMBK010000039.1 GCA021406745_00701 CDS open 6551-6904 _na     117_aa folB dihydroneopterin aldolase
3178 JAEMBK010000039.1 GCA021406745_00702 CDS open 6947-7855 _na     302_aa fieF Cation efflux family protein
3179 JAEMBK010000039.1 GCA021406745_00704 CDS open 8262-9446 _na     394_aa Transglutaminase-like domain-containing protein
3180 JAEMBK010000039.1 GCA021406745_00705 CDS open 9503-10561 _na     352_aa msrB bifunctional methionine sulfoxide reductase B/A protein
3181 JAEMBK010000039.1 GCA021406745_00706 CDS open 10623-11096 _na     157_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
3182 JAEMBK010000039.1 GCA021406745_00707 CDS open 11096-11515 _na     139_aa DUF3127 domain-containing protein
3183 JAEMBK010000039.1 GCA021406745_00708 CDS open 11570-12553 _na     327_aa trpS tryptophan--tRNA ligase
3184 JAEMBK010000039.1 GCA021406745_00709 CDS open 13636-14727 _na     363_aa DUF4831 domain-containing protein
3185 JAEMBK010000039.1 GCA021406745_00710 CDS open 14753-16285 _na     510_aa Symporter
3186 JAEMBK010000039.1 GCA021406745_00711 CDS open 16464-17456 _na     330_aa bioB biotin synthase BioB
3187 JAEMBK010000039.1 GCA021406745_00712 CDS open 17446-18747 _na     433_aa bioA adenosylmethionine--8-amino-7-oxononanoate transaminase
3188 JAEMBK010000039.1 GCA021406745_00713 CDS open 18759-19235 _na     158_aa DUF6078 domain-containing protein
3189 JAEMBK010000039.1 GCA021406745_00714 CDS open 19525-20697 _na     390_aa arAAA ATPase domain-containing protein
3190 JAEMBK010000039.1 GCA021406745_00699 gene open 290-4810 tamB
3191 JAEMBK010000039.1 GCA021406745_00700 gene open 5221-6480 plug
3192 JAEMBK010000039.1 GCA021406745_00701 gene open 6551-6904 folB
3193 JAEMBK010000039.1 GCA021406745_00702 gene open 6947-7855 fieF
3194 JAEMBK010000039.1 GCA021406745_00704 gene open 8262-9446
3195 JAEMBK010000039.1 GCA021406745_00705 gene open 9503-10561 msrB
3196 JAEMBK010000039.1 GCA021406745_00706 gene open 10623-11096 rlmH
3197 JAEMBK010000039.1 GCA021406745_00707 gene open 11096-11515
3198 JAEMBK010000039.1 GCA021406745_00708 gene open 11570-12553 trpS
3199 JAEMBK010000039.1 GCA021406745_00709 gene open 13636-14727
3200 JAEMBK010000039.1 GCA021406745_00710 gene open 14753-16285
3201 JAEMBK010000039.1 GCA021406745_00711 gene open 16464-17456 bioB
3202 JAEMBK010000039.1 GCA021406745_00712 gene open 17446-18747 bioA
3203 JAEMBK010000039.1 GCA021406745_00713 gene open 18759-19235
3204 JAEMBK010000039.1 GCA021406745_00714 gene open 19525-20697 arAAA
3205 JAEMBK010000040.1 GCA021406745_00732 CDS open 385-2262 _na     625_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
3206 JAEMBK010000040.1 GCA021406745_00733 CDS open 2293-4095 _na     600_aa uvrC excinuclease ABC subunit UvrC
3207 JAEMBK010000040.1 GCA021406745_00734 CDS open 4102-4554 _na     150_aa dtd D-aminoacyl-tRNA deacylase
3208 JAEMBK010000040.1 GCA021406745_00735 CDS open 4559-4909 _na     116_aa mazG NTP pyrophosphohydrolase MazG-like domain-containing protein
3209 JAEMBK010000040.1 GCA021406745_00736 CDS open 4917-5765 _na     282_aa deoC deoxyribose-phosphate aldolase
3210 JAEMBK010000040.1 GCA021406745_00737 CDS open 5806-5967 _na     53_aa hypothetical protein
3211 JAEMBK010000040.1 GCA021406745_00738 CDS open 6076-7050 _na     324_aa ispA Polyprenyl synthetase
3212 JAEMBK010000040.1 GCA021406745_00739 CDS open 7108-7746 _na     212_aa WbqC-like protein
3213 JAEMBK010000040.1 GCA021406745_00740 CDS open 7767-8393 _na     208_aa lepB signal peptidase I
3214 JAEMBK010000040.1 GCA021406745_00741 CDS open 8383-9780 _na     465_aa lepB signal peptidase I
3215 JAEMBK010000040.1 GCA021406745_00742 CDS open 9796-10512 _na     238_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
3216 JAEMBK010000040.1 GCA021406745_00743 CDS open 10573-11910 _na     445_aa dgt Deoxyguanosinetriphosphate triphosphohydrolase
3217 JAEMBK010000040.1 GCA021406745_00744 CDS open 12060-13064 _na     334_aa yeiH UPF0324 membrane protein PG_2004
3218 JAEMBK010000040.1 GCA021406745_00745 CDS open 13576-13935 _na     119_aa hypothetical protein
3219 JAEMBK010000040.1 GCA021406745_00746 CDS open 14242-16743 _na     833_aa fepA TonB-dependent receptor%2C putative
3220 JAEMBK010000040.1 GCA021406745_00747 CDS open 17316-18053 _na     245_aa recO DNA repair protein RecO
3221 JAEMBK010000040.1 GCA021406745_00748 CDS open 18126-19874 _na     582_aa manB Phosphomannomutase
3222 JAEMBK010000040.1 GCA021406745_00732 gene open 385-2262 mnmG
3223 JAEMBK010000040.1 GCA021406745_00733 gene open 2293-4095 uvrC
3224 JAEMBK010000040.1 GCA021406745_00734 gene open 4102-4554 dtd
3225 JAEMBK010000040.1 GCA021406745_00735 gene open 4559-4909 mazG
3226 JAEMBK010000040.1 GCA021406745_00736 gene open 4917-5765 deoC
3227 JAEMBK010000040.1 GCA021406745_00737 gene open 5806-5967
3228 JAEMBK010000040.1 GCA021406745_00738 gene open 6076-7050 ispA
3229 JAEMBK010000040.1 GCA021406745_00739 gene open 7108-7746
3230 JAEMBK010000040.1 GCA021406745_00740 gene open 7767-8393 lepB
3231 JAEMBK010000040.1 GCA021406745_00741 gene open 8383-9780 lepB
3232 JAEMBK010000040.1 GCA021406745_00742 gene open 9796-10512 dapB
3233 JAEMBK010000040.1 GCA021406745_00743 gene open 10573-11910 dgt
3234 JAEMBK010000040.1 GCA021406745_00744 gene open 12060-13064 yeiH
3235 JAEMBK010000040.1 GCA021406745_00745 gene open 13576-13935
3236 JAEMBK010000040.1 GCA021406745_00746 gene open 14242-16743 fepA
3237 JAEMBK010000040.1 GCA021406745_00747 gene open 17316-18053 recO
3238 JAEMBK010000040.1 GCA021406745_00748 gene open 18126-19874 manB
3239 JAEMBK010000041.1 GCA021406745_01178 CDS open 705-1595 _na     296_aa dnaG Zinc finger CHC2-type domain-containing protein
3240 JAEMBK010000041.1 GCA021406745_01179 CDS open 1722-2084 _na     120_aa Mobilization protein
3241 JAEMBK010000041.1 GCA021406745_01180 CDS open 2074-3015 _na     313_aa traI Conjugal transfer relaxase TraI
3242 JAEMBK010000041.1 GCA021406745_01181 CDS open 3041-3763 _na     240_aa Viral A-type inclusion protein
3243 JAEMBK010000041.1 GCA021406745_01182 CDS open 3881-4075 _na     64_aa Transcriptional regulator
3244 JAEMBK010000041.1 GCA021406745_01183 CDS open 4118-7309 _na     1063_aa Tetratricopeptide repeat protein
3245 JAEMBK010000041.1 GCA021406745_01184 CDS open 7512-8942 _na     476_aa ATP-binding protein
3246 JAEMBK010000041.1 GCA021406745_01185 CDS open 8946-9458 _na     170_aa Polyketide cyclase
3247 JAEMBK010000041.1 GCA021406745_01186 CDS open 9571-9996 _na     141_aa DUF304 domain-containing protein
3248 JAEMBK010000041.1 GCA021406745_01187 CDS open 10000-10419 _na     139_aa Lipoprotein
3249 JAEMBK010000041.1 GCA021406745_01188 CDS open 10419-11567 _na     382_aa bioF 8-amino-7-oxononanoate synthase
3250 JAEMBK010000041.1 GCA021406745_01189 CDS open 11953-12906 _na     317_aa ldhA Glycerate dehydrogenase
3251 JAEMBK010000041.1 GCA021406745_01190 CDS open 13147-15027 _na     626_aa DUF349 domain-containing protein
3252 JAEMBK010000041.1 GCA021406745_01191 CDS open 15255-15503 _na     82_aa transposase family protein
3253 JAEMBK010000041.1 GCA021406745_01192 CDS open 15945-17336 _na     463_aa Lipase
3254 JAEMBK010000041.1 GCA021406745_01193 CDS open 17320-18147 _na     275_aa tesA SGNH hydrolase-type esterase domain-containing protein
3255 JAEMBK010000041.1 GCA021406745_01194 CDS open 18169-19704 _na     511_aa dltB Alginate O-acetyltransferase%2C putative
3256 JAEMBK010000041.1 GCA021406745_01178 gene open 705-1595 dnaG
3257 JAEMBK010000041.1 GCA021406745_01179 gene open 1722-2084
3258 JAEMBK010000041.1 GCA021406745_01180 gene open 2074-3015 traI
3259 JAEMBK010000041.1 GCA021406745_01181 gene open 3041-3763
3260 JAEMBK010000041.1 GCA021406745_01182 gene open 3881-4075
3261 JAEMBK010000041.1 GCA021406745_01183 gene open 4118-7309
3262 JAEMBK010000041.1 GCA021406745_01184 gene open 7512-8942
3263 JAEMBK010000041.1 GCA021406745_01185 gene open 8946-9458
3264 JAEMBK010000041.1 GCA021406745_01186 gene open 9571-9996
3265 JAEMBK010000041.1 GCA021406745_01187 gene open 10000-10419
3266 JAEMBK010000041.1 GCA021406745_01188 gene open 10419-11567 bioF
3267 JAEMBK010000041.1 GCA021406745_01189 gene open 11953-12906 ldhA
3268 JAEMBK010000041.1 GCA021406745_01190 gene open 13147-15027
3269 JAEMBK010000041.1 GCA021406745_01191 gene open 15255-15503
3270 JAEMBK010000041.1 GCA021406745_01192 gene open 15945-17336
3271 JAEMBK010000041.1 GCA021406745_01193 gene open 17320-18147 tesA
3272 JAEMBK010000041.1 GCA021406745_01194 gene open 18169-19704 dltB
3273 JAEMBK010000042.1 GCA021406745_00368 CDS open 122-385 _na     87_aa hypothetical protein
3274 JAEMBK010000042.1 GCA021406745_00369 CDS open 599-1003 _na     134_aa rpsL 30S ribosomal protein S12
3275 JAEMBK010000042.1 GCA021406745_00370 CDS open 1240-1716 _na     158_aa rpsG 30S ribosomal protein S7
3276 JAEMBK010000042.1 GCA021406745_00371 CDS open 1729-3852 _na     707_aa fusA elongation factor G
3277 JAEMBK010000042.1 GCA021406745_00372 CDS open 3868-4173 _na     101_aa rpsJ 30S ribosomal protein S10
3278 JAEMBK010000042.1 GCA021406745_00373 CDS open 4196-4813 _na     205_aa rplC 50S ribosomal protein L3
3279 JAEMBK010000042.1 GCA021406745_00374 CDS open 4813-5442 _na     209_aa rplD 50S ribosomal protein L4
3280 JAEMBK010000042.1 GCA021406745_00375 CDS open 5457-5750 _na     97_aa rplW 50S ribosomal protein L23
3281 JAEMBK010000042.1 GCA021406745_00376 CDS open 5757-6581 _na     274_aa rplB 50S ribosomal protein L2
3282 JAEMBK010000042.1 GCA021406745_00377 CDS open 6604-6873 _na     89_aa rpsS 30S ribosomal protein S19
3283 JAEMBK010000042.1 GCA021406745_00378 CDS open 6928-7332 _na     134_aa rplV 50S ribosomal protein L22
3284 JAEMBK010000042.1 GCA021406745_00379 CDS open 7339-8079 _na     246_aa rpsC 30S ribosomal protein S3
3285 JAEMBK010000042.1 GCA021406745_00380 CDS open 8100-8534 _na     144_aa rplP 50S ribosomal protein L16
3286 JAEMBK010000042.1 GCA021406745_00381 CDS open 8540-8734 _na     64_aa rpmC 50S ribosomal protein L29
3287 JAEMBK010000042.1 GCA021406745_00382 CDS open 8748-9002 _na     84_aa rpsQ 30S ribosomal protein S17
3288 JAEMBK010000042.1 GCA021406745_00383 CDS open 9004-9369 _na     121_aa rplN 50S ribosomal protein L14
3289 JAEMBK010000042.1 GCA021406745_00384 CDS open 9428-9712 _na     94_aa rplX 50S ribosomal protein L24
3290 JAEMBK010000042.1 GCA021406745_00385 CDS open 9712-10272 _na     186_aa rplE 50S ribosomal protein L5
3291 JAEMBK010000042.1 GCA021406745_00386 CDS open 10274-10543 _na     89_aa rpsN 30S ribosomal protein S14
3292 JAEMBK010000042.1 GCA021406745_00387 CDS open 10594-10989 _na     131_aa rpsH 30S ribosomal protein S8
3293 JAEMBK010000042.1 GCA021406745_00388 CDS open 11008-11559 _na     183_aa rplF 50S ribosomal protein L6
3294 JAEMBK010000042.1 GCA021406745_00389 CDS open 11578-11922 _na     114_aa rplR 50S ribosomal protein L18
3295 JAEMBK010000042.1 GCA021406745_00390 CDS open 11928-12446 _na     172_aa rpsE 30S ribosomal protein S5
3296 JAEMBK010000042.1 GCA021406745_00391 CDS open 12668-13114 _na     148_aa rplO 50S ribosomal protein L15
3297 JAEMBK010000042.1 GCA021406745_00392 CDS open 13119-14459 _na     446_aa secY preprotein translocase subunit SecY
3298 JAEMBK010000042.1 GCA021406745_00393 CDS open 14459-15244 _na     261_aa map type I methionyl aminopeptidase
3299 JAEMBK010000042.1 GCA021406745_00394 CDS open 15247-15465 _na     72_aa infA translation initiation factor IF-1
3300 JAEMBK010000042.1 GCA021406745_00395 CDS open 15482-15598 _na     38_aa ykgO type B 50S ribosomal protein L36
3301 JAEMBK010000042.1 GCA021406745_00396 CDS open 15631-16011 _na     126_aa rpsM 30S ribosomal protein S13
3302 JAEMBK010000042.1 GCA021406745_00397 CDS open 16023-16409 _na     128_aa rpsK 30S ribosomal protein S11
3303 JAEMBK010000042.1 GCA021406745_00398 CDS open 16569-17174 _na     201_aa rpsD 30S ribosomal protein S4
3304 JAEMBK010000042.1 GCA021406745_00399 CDS open 17187-18179 _na     330_aa rpoA DNA-directed RNA polymerase subunit alpha
3305 JAEMBK010000042.1 GCA021406745_00400 CDS open 18185-18667 _na     160_aa rplQ 50S ribosomal protein L17
3306 JAEMBK010000042.1 GCA021406745_00368 gene open 122-385
3307 JAEMBK010000042.1 GCA021406745_00369 gene open 599-1003 rpsL
3308 JAEMBK010000042.1 GCA021406745_00370 gene open 1240-1716 rpsG
3309 JAEMBK010000042.1 GCA021406745_00371 gene open 1729-3852 fusA
3310 JAEMBK010000042.1 GCA021406745_00372 gene open 3868-4173 rpsJ
3311 JAEMBK010000042.1 GCA021406745_00373 gene open 4196-4813 rplC
3312 JAEMBK010000042.1 GCA021406745_00374 gene open 4813-5442 rplD
3313 JAEMBK010000042.1 GCA021406745_00375 gene open 5457-5750 rplW
3314 JAEMBK010000042.1 GCA021406745_00376 gene open 5757-6581 rplB
3315 JAEMBK010000042.1 GCA021406745_00377 gene open 6604-6873 rpsS
3316 JAEMBK010000042.1 GCA021406745_00378 gene open 6928-7332 rplV
3317 JAEMBK010000042.1 GCA021406745_00379 gene open 7339-8079 rpsC
3318 JAEMBK010000042.1 GCA021406745_00380 gene open 8100-8534 rplP
3319 JAEMBK010000042.1 GCA021406745_00381 gene open 8540-8734 rpmC
3320 JAEMBK010000042.1 GCA021406745_00382 gene open 8748-9002 rpsQ
3321 JAEMBK010000042.1 GCA021406745_00383 gene open 9004-9369 rplN
3322 JAEMBK010000042.1 GCA021406745_00384 gene open 9428-9712 rplX
3323 JAEMBK010000042.1 GCA021406745_00385 gene open 9712-10272 rplE
3324 JAEMBK010000042.1 GCA021406745_00386 gene open 10274-10543 rpsN
3325 JAEMBK010000042.1 GCA021406745_00387 gene open 10594-10989 rpsH
3326 JAEMBK010000042.1 GCA021406745_00388 gene open 11008-11559 rplF
3327 JAEMBK010000042.1 GCA021406745_00389 gene open 11578-11922 rplR
3328 JAEMBK010000042.1 GCA021406745_00390 gene open 11928-12446 rpsE
3329 JAEMBK010000042.1 GCA021406745_00391 gene open 12668-13114 rplO
3330 JAEMBK010000042.1 GCA021406745_00392 gene open 13119-14459 secY
3331 JAEMBK010000042.1 GCA021406745_00393 gene open 14459-15244 map
3332 JAEMBK010000042.1 GCA021406745_00394 gene open 15247-15465 infA
3333 JAEMBK010000042.1 GCA021406745_00395 gene open 15482-15598 ykgO
3334 JAEMBK010000042.1 GCA021406745_00396 gene open 15631-16011 rpsM
3335 JAEMBK010000042.1 GCA021406745_00397 gene open 16023-16409 rpsK
3336 JAEMBK010000042.1 GCA021406745_00398 gene open 16569-17174 rpsD
3337 JAEMBK010000042.1 GCA021406745_00399 gene open 17187-18179 rpoA
3338 JAEMBK010000042.1 GCA021406745_00400 gene open 18185-18667 rplQ
3339 JAEMBK010000043.1 repeat_region open 184-3385 CRISPR array with 49 repeats of length 30%2C consensus sequence GTTTTAATTCCTGTATGGTGCAATTGAAAT and spacer length 35
3340 JAEMBK010000043.1 repeat_region open 3542-3776 CRISPR array with 4 repeats of length 30%2C consensus sequence GTTTTAATTCCTGTATGGTGCAATTGAAAT and spacer length 35
3341 JAEMBK010000043.1 GCA021406745_00833 CDS open 4013-4276 _na     87_aa cas2 CRISPR-associated endonuclease Cas2
3342 JAEMBK010000043.1 GCA021406745_00834 CDS open 4276-5292 _na     338_aa cas1b type I-B CRISPR-associated endonuclease Cas1b
3343 JAEMBK010000043.1 GCA021406745_00835 CDS open 5289-5798 _na     169_aa cas4 CRISPR-associated protein Cas4
3344 JAEMBK010000043.1 GCA021406745_00836 CDS open 5915-6973 _na     352_aa CRISPR-associated protein Cas7
3345 JAEMBK010000043.1 GCA021406745_00837 CDS open 6994-8289 _na     431_aa hypothetical protein
3346 JAEMBK010000043.1 GCA021406745_00838 CDS open 8300-10420 _na     706_aa putative CRISPR-associated helicase Cas3 core
3347 JAEMBK010000043.1 GCA021406745_00839 CDS open 10437-11024 _na     195_aa CRISPR-associated protein Cas5
3348 JAEMBK010000043.1 GCA021406745_00840 CDS open 11031-11696 _na     221_aa cas6 CRISPR-associated endoribonuclease Cas6
3349 JAEMBK010000043.1 GCA021406745_00841 CDS open 12344-14275 _na     643_aa mdoB Sulfatase N-terminal domain-containing protein
3350 JAEMBK010000043.1 GCA021406745_00842 CDS open 14279-16822 _na     847_aa yfhO YfhO family protein
3351 JAEMBK010000043.1 GCA021406745_00843 CDS open 16987-17928 _na     313_aa fmt methionyl-tRNA formyltransferase
3352 JAEMBK010000043.1 GCA021406745_00845 CDS open 18503-18739 _na     78_aa hypothetical protein
3353 JAEMBK010000043.1 GCA021406745_00833 gene open 4013-4276 cas2
3354 JAEMBK010000043.1 GCA021406745_00834 gene open 4276-5292 cas1b
3355 JAEMBK010000043.1 GCA021406745_00835 gene open 5289-5798 cas4
3356 JAEMBK010000043.1 GCA021406745_00836 gene open 5915-6973
3357 JAEMBK010000043.1 GCA021406745_00837 gene open 6994-8289
3358 JAEMBK010000043.1 GCA021406745_00838 gene open 8300-10420
3359 JAEMBK010000043.1 GCA021406745_00839 gene open 10437-11024
3360 JAEMBK010000043.1 GCA021406745_00840 gene open 11031-11696 cas6
3361 JAEMBK010000043.1 GCA021406745_00841 gene open 12344-14275 mdoB
3362 JAEMBK010000043.1 GCA021406745_00842 gene open 14279-16822 yfhO
3363 JAEMBK010000043.1 GCA021406745_00843 gene open 16987-17928 fmt
3364 JAEMBK010000043.1 GCA021406745_00845 gene open 18503-18739
3365 JAEMBK010000043.1 GCA021406745_00844 gene open 18185-18258 trnD
3366 JAEMBK010000043.1 GCA021406745_00844 tRNA open 18185-18258 trnD tRNA-Asp(gtc)
3367 JAEMBK010000044.1 regulatory_region open 17333-17591 Cobalamin riboswitch aptamer
3368 JAEMBK010000044.1 GCA021406745_00010 CDS open 1156-3798 _na     880_aa alaS alanine--tRNA ligase
3369 JAEMBK010000044.1 GCA021406745_00011 CDS open 3813-4874 _na     353_aa aroB 3-dehydroquinate synthase
3370 JAEMBK010000044.1 GCA021406745_00013 CDS open 5120-5851 _na     243_aa alkD DNA alkylation repair protein
3371 JAEMBK010000044.1 GCA021406745_00014 CDS open 5866-6651 _na     261_aa plsC 1-acyl-sn-glycerol-3-phosphate acyltransferase
3372 JAEMBK010000044.1 GCA021406745_00015 CDS open 6657-6923 _na     88_aa DUF3784 domain-containing protein
3373 JAEMBK010000044.1 GCA021406745_00016 CDS open 7368-7532 _na     54_aa hypothetical protein
3374 JAEMBK010000044.1 GCA021406745_00017 CDS open 7698-8933 _na     411_aa lolE Membrane protein%2C putative
3375 JAEMBK010000044.1 GCA021406745_00018 CDS open 8946-10955 _na     669_aa ligA NAD-dependent DNA ligase LigA
3376 JAEMBK010000044.1 GCA021406745_00019 CDS open 10943-11470 _na     175_aa rimL Acetyltransferase%2C GNAT family
3377 JAEMBK010000044.1 GCA021406745_00020 CDS open 11477-12100 _na     207_aa recR recombination mediator RecR
3378 JAEMBK010000044.1 GCA021406745_00021 CDS open 12097-13611 _na     504_aa cafA Ribonuclease%2C Rne/Rng family
3379 JAEMBK010000044.1 GCA021406745_00022 CDS open 13809-13901 _na     30_aa AURKAIP1/COX24 domain-containing protein
3380 JAEMBK010000044.1 GCA021406745_00023 CDS open 13932-14210 _na     92_aa hupA DNA-binding protein HU
3381 JAEMBK010000044.1 GCA021406745_00024 CDS open 14322-14813 _na     163_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
3382 JAEMBK010000044.1 GCA021406745_00025 CDS open 14846-17242 _na     798_aa nrdD anaerobic ribonucleoside triphosphate reductase
3383 JAEMBK010000044.1 GCA021406745_00026 CDS open 17677-17913 _na     78_aa transposase
3384 JAEMBK010000044.1 GCA021406745_00010 gene open 1156-3798 alaS
3385 JAEMBK010000044.1 GCA021406745_00011 gene open 3813-4874 aroB
3386 JAEMBK010000044.1 GCA021406745_00013 gene open 5120-5851 alkD
3387 JAEMBK010000044.1 GCA021406745_00014 gene open 5866-6651 plsC
3388 JAEMBK010000044.1 GCA021406745_00015 gene open 6657-6923
3389 JAEMBK010000044.1 GCA021406745_00016 gene open 7368-7532
3390 JAEMBK010000044.1 GCA021406745_00017 gene open 7698-8933 lolE
3391 JAEMBK010000044.1 GCA021406745_00018 gene open 8946-10955 ligA
3392 JAEMBK010000044.1 GCA021406745_00019 gene open 10943-11470 rimL
3393 JAEMBK010000044.1 GCA021406745_00020 gene open 11477-12100 recR
3394 JAEMBK010000044.1 GCA021406745_00021 gene open 12097-13611 cafA
3395 JAEMBK010000044.1 GCA021406745_00022 gene open 13809-13901
3396 JAEMBK010000044.1 GCA021406745_00023 gene open 13932-14210 hupA
3397 JAEMBK010000044.1 GCA021406745_00024 gene open 14322-14813 nrdG
3398 JAEMBK010000044.1 GCA021406745_00025 gene open 14846-17242 nrdD
3399 JAEMBK010000044.1 GCA021406745_00026 gene open 17677-17913
3400 JAEMBK010000044.1 GCA021406745_00012 gene open 4910-4984 trnP
3401 JAEMBK010000044.1 GCA021406745_00012 tRNA open 4910-4984 trnP tRNA-Pro(ggg)
3402 JAEMBK010000045.1 GCA021406745_00902 CDS open 734-2251 _na     505_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
3403 JAEMBK010000045.1 GCA021406745_00903 CDS open 2354-3373 _na     339_aa mreB Cell shape-determining protein MreB
3404 JAEMBK010000045.1 GCA021406745_00904 CDS open 3411-4298 _na     295_aa mreC rod shape-determining protein MreC
3405 JAEMBK010000045.1 GCA021406745_00905 CDS open 4298-4816 _na     172_aa mreD rod shape-determining protein MreD
3406 JAEMBK010000045.1 GCA021406745_00906 CDS open 4809-6674 _na     621_aa mrdA penicillin-binding protein 2
3407 JAEMBK010000045.1 GCA021406745_00907 CDS open 6664-8121 _na     485_aa ftsW Rod shape-determining protein RodA
3408 JAEMBK010000045.1 GCA021406745_00908 CDS open 8149-9360 _na     403_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
3409 JAEMBK010000045.1 GCA021406745_00909 CDS open 9614-10072 _na     152_aa hupA Histidinol phosphate aminotransferase
3410 JAEMBK010000045.1 GCA021406745_00910 CDS open 10137-10847 _na     236_aa DUF3256 domain-containing protein
3411 JAEMBK010000045.1 GCA021406745_00911 CDS open 10914-11810 _na     298_aa Chromosome segregation protein SMC
3412 JAEMBK010000045.1 GCA021406745_00912 CDS open 11994-14573 _na     859_aa gyrA DNA gyrase subunit A
3413 JAEMBK010000045.1 GCA021406745_00913 CDS open 14607-15809 _na     400_aa bepA Tetratricopeptide repeat protein
3414 JAEMBK010000045.1 GCA021406745_00914 CDS open 16150-17457 _na     435_aa IS5 family transposase
3415 JAEMBK010000045.1 GCA021406745_00902 gene open 734-2251 purH
3416 JAEMBK010000045.1 GCA021406745_00903 gene open 2354-3373 mreB
3417 JAEMBK010000045.1 GCA021406745_00904 gene open 3411-4298 mreC
3418 JAEMBK010000045.1 GCA021406745_00905 gene open 4298-4816 mreD
3419 JAEMBK010000045.1 GCA021406745_00906 gene open 4809-6674 mrdA
3420 JAEMBK010000045.1 GCA021406745_00907 gene open 6664-8121 ftsW
3421 JAEMBK010000045.1 GCA021406745_00908 gene open 8149-9360
3422 JAEMBK010000045.1 GCA021406745_00909 gene open 9614-10072 hupA
3423 JAEMBK010000045.1 GCA021406745_00910 gene open 10137-10847
3424 JAEMBK010000045.1 GCA021406745_00911 gene open 10914-11810
3425 JAEMBK010000045.1 GCA021406745_00912 gene open 11994-14573 gyrA
3426 JAEMBK010000045.1 GCA021406745_00913 gene open 14607-15809 bepA
3427 JAEMBK010000045.1 GCA021406745_00914 gene open 16150-17457
3428 JAEMBK010000046.1 GCA021406745_00031 CDS open 507-1058 _na     183_aa yceD DNA-binding protein
3429 JAEMBK010000046.1 GCA021406745_00032 CDS open 1065-1250 _na     61_aa rpmF 50S ribosomal protein L32
3430 JAEMBK010000046.1 GCA021406745_00033 CDS open 1430-2437 _na     335_aa fabH Beta-ketoacyl-[acyl-carrier-protein] synthase III
3431 JAEMBK010000046.1 GCA021406745_00034 CDS open 2516-3415 _na     299_aa era GTPase Era
3432 JAEMBK010000046.1 GCA021406745_00035 CDS open 3483-4796 _na     437_aa der ribosome biogenesis GTPase Der
3433 JAEMBK010000046.1 GCA021406745_00036 CDS open 4847-8146 _na     1099_aa DUF2723 domain-containing protein
3434 JAEMBK010000046.1 GCA021406745_00037 CDS open 8147-8794 _na     215_aa pgaB Polysaccharide deacetylase
3435 JAEMBK010000046.1 GCA021406745_00038 CDS open 8820-9506 _na     228_aa mnmC MnmC-like methyltransferase domain-containing protein
3436 JAEMBK010000046.1 GCA021406745_00039 CDS open 9705-10286 _na     193_aa xpt xanthine phosphoribosyltransferase
3437 JAEMBK010000046.1 GCA021406745_00040 CDS open 10323-11660 _na     445_aa uraA Xanthine/uracil permease family protein
3438 JAEMBK010000046.1 GCA021406745_00041 CDS open 11821-12492 _na     223_aa porT Outer membrane protein beta-barrel domain-containing protein
3439 JAEMBK010000046.1 GCA021406745_00042 CDS open 12552-14057 _na     501_aa sleL LysM domain-containing protein
3440 JAEMBK010000046.1 GCA021406745_00043 CDS open 14579-15241 _na     220_aa Lipoprotein
3441 JAEMBK010000046.1 GCA021406745_00044 CDS open 15249-16616 _na     455_aa Peptidase C10 family protein
3442 JAEMBK010000046.1 GCA021406745_00031 gene open 507-1058 yceD
3443 JAEMBK010000046.1 GCA021406745_00032 gene open 1065-1250 rpmF
3444 JAEMBK010000046.1 GCA021406745_00033 gene open 1430-2437 fabH
3445 JAEMBK010000046.1 GCA021406745_00034 gene open 2516-3415 era
3446 JAEMBK010000046.1 GCA021406745_00035 gene open 3483-4796 der
3447 JAEMBK010000046.1 GCA021406745_00036 gene open 4847-8146
3448 JAEMBK010000046.1 GCA021406745_00037 gene open 8147-8794 pgaB
3449 JAEMBK010000046.1 GCA021406745_00038 gene open 8820-9506 mnmC
3450 JAEMBK010000046.1 GCA021406745_00039 gene open 9705-10286 xpt
3451 JAEMBK010000046.1 GCA021406745_00040 gene open 10323-11660 uraA
3452 JAEMBK010000046.1 GCA021406745_00041 gene open 11821-12492 porT
3453 JAEMBK010000046.1 GCA021406745_00042 gene open 12552-14057 sleL
3454 JAEMBK010000046.1 GCA021406745_00043 gene open 14579-15241
3455 JAEMBK010000046.1 GCA021406745_00044 gene open 15249-16616
3456 JAEMBK010000047.1 GCA021406745_01990 CDS open 366-1160 _na     264_aa pgaB NodB-like y domain-containing protein
3457 JAEMBK010000047.1 GCA021406745_01991 CDS open 1148-1858 _na     236_aa wcaA Glycosyltransferase 2-like domain-containing protein
3458 JAEMBK010000047.1 GCA021406745_01992 CDS open 1845-3032 _na     395_aa DUF2029 domain-containing protein
3459 JAEMBK010000047.1 GCA021406745_01993 CDS open 3074-3742 _na     222_aa udk uridine kinase
3460 JAEMBK010000047.1 GCA021406745_01994 CDS open 3752-4939 _na     395_aa spt serine palmitoyltransferase
3461 JAEMBK010000047.1 GCA021406745_01995 CDS open 5213-5707 _na     164_aa ymdB O-acetyl-ADP-ribose deacetylase
3462 JAEMBK010000047.1 GCA021406745_01996 CDS open 5790-6620 _na     276_aa lpxH UDP-2%2C3-diacylglucosamine hydrolase
3463 JAEMBK010000047.1 GCA021406745_01997 CDS open 6607-6924 _na     105_aa paaD Fe-S protein maturation auxiliary factor PG_1777
3464 JAEMBK010000047.1 GCA021406745_01998 CDS open 7010-8161 _na     383_aa dnaJ molecular chaperone DnaJ
3465 JAEMBK010000047.1 GCA021406745_01999 CDS open 8204-8788 _na     194_aa grpE Protein GrpE
3466 JAEMBK010000047.1 GCA021406745_02000 CDS open 9135-12503 _na     1122_aa mfd transcription-repair coupling factor
3467 JAEMBK010000047.1 GCA021406745_02001 CDS open 12480-13817 _na     445_aa lpxE Lipid A 1-phosphatase
3468 JAEMBK010000047.1 GCA021406745_02002 CDS open 13879-14553 _na     224_aa nth endonuclease III
3469 JAEMBK010000047.1 GCA021406745_02003 CDS open 14572-15594 _na     340_aa pheS phenylalanine--tRNA ligase subunit alpha
3470 JAEMBK010000047.1 GCA021406745_02004 CDS open 15716-16312 _na     198_aa Lipoprotein
3471 JAEMBK010000047.1 GCA021406745_01990 gene open 366-1160 pgaB
3472 JAEMBK010000047.1 GCA021406745_01991 gene open 1148-1858 wcaA
3473 JAEMBK010000047.1 GCA021406745_01992 gene open 1845-3032
3474 JAEMBK010000047.1 GCA021406745_01993 gene open 3074-3742 udk
3475 JAEMBK010000047.1 GCA021406745_01994 gene open 3752-4939 spt
3476 JAEMBK010000047.1 GCA021406745_01995 gene open 5213-5707 ymdB
3477 JAEMBK010000047.1 GCA021406745_01996 gene open 5790-6620 lpxH
3478 JAEMBK010000047.1 GCA021406745_01997 gene open 6607-6924 paaD
3479 JAEMBK010000047.1 GCA021406745_01998 gene open 7010-8161 dnaJ
3480 JAEMBK010000047.1 GCA021406745_01999 gene open 8204-8788 grpE
3481 JAEMBK010000047.1 GCA021406745_02000 gene open 9135-12503 mfd
3482 JAEMBK010000047.1 GCA021406745_02001 gene open 12480-13817 lpxE
3483 JAEMBK010000047.1 GCA021406745_02002 gene open 13879-14553 nth
3484 JAEMBK010000047.1 GCA021406745_02003 gene open 14572-15594 pheS
3485 JAEMBK010000047.1 GCA021406745_02004 gene open 15716-16312
3486 JAEMBK010000048.1 GCA021406745_01643 CDS open 727-1812 _na     361_aa Site-specific integrase
3487 JAEMBK010000048.1 GCA021406745_01644 CDS open 2394-2969 _na     191_aa Glycoside hydrolase family 15
3488 JAEMBK010000048.1 GCA021406745_01645 CDS open 2976-5150 _na     724_aa Rad50/SbcC-type AAA domain-containing protein
3489 JAEMBK010000048.1 GCA021406745_01646 CDS open 5147-5380 _na     77_aa hypothetical protein
3490 JAEMBK010000048.1 GCA021406745_01647 CDS open 5387-7657 _na     756_aa DNA repair helicase
3491 JAEMBK010000048.1 GCA021406745_01648 CDS open 7658-8764 _na     368_aa cysH Phosphoadenosine phosphosulfate reductase
3492 JAEMBK010000048.1 GCA021406745_01649 CDS open 8761-11970 _na     1069_aa ATP-binding protein
3493 JAEMBK010000048.1 GCA021406745_01650 CDS open 11967-12824 _na     285_aa DUF4007 domain-containing protein
3494 JAEMBK010000048.1 GCA021406745_01651 CDS open 12840-14090 _na     416_aa ATP-binding protein
3495 JAEMBK010000048.1 GCA021406745_01652 CDS open 14687-15112 _na     141_aa DUF3408 domain-containing protein
3496 JAEMBK010000048.1 GCA021406745_01653 CDS open 15783-16052 _na     89_aa hypothetical protein
3497 JAEMBK010000048.1 GCA021406745_01654 CDS open 15997-16206 _na     69_aa mobC Mobilization protein MobC
3498 JAEMBK010000048.1 GCA021406745_01643 gene open 727-1812
3499 JAEMBK010000048.1 GCA021406745_01644 gene open 2394-2969
3500 JAEMBK010000048.1 GCA021406745_01645 gene open 2976-5150