BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_021406795.1)
Select a Genome:
|
BAKTA Annotations for GCA_021406795.1
|
Search & Sort all 4358 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3001 | JAEMBP010000038.1 | GCA021406795_00732 | CDS | open | 11271-11783 | _na 170_aa | ompH | Cationic outer membrane protein OmpH |
| 3002 | JAEMBP010000038.1 | GCA021406795_00733 | CDS | open | 11852-14527 | _na 891_aa | bamA | outer membrane protein assembly factor BamA |
| 3003 | JAEMBP010000038.1 | GCA021406795_00734 | CDS | open | 14545-15309 | _na 254_aa | uppS | isoprenyl transferase |
| 3004 | JAEMBP010000038.1 | GCA021406795_00735 | CDS | open | 15387-16094 | _na 235_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 3005 | JAEMBP010000038.1 | GCA021406795_00736 | CDS | open | 16081-17451 | _na 456_aa | DUF6242 domain-containing protein | |
| 3006 | JAEMBP010000038.1 | GCA021406795_00737 | CDS | open | 17668-19167 | _na 499_aa | RagB/SusD domain-containing protein | |
| 3007 | JAEMBP010000038.1 | GCA021406795_00738 | CDS | open | 19198-22338 | _na 1046_aa | Collagen-binding protein | |
| 3008 | JAEMBP010000038.1 | GCA021406795_00721 | gene | open | 490-2070 | prfC | ||
| 3009 | JAEMBP010000038.1 | GCA021406795_00722 | gene | open | 2103-2321 | |||
| 3010 | JAEMBP010000038.1 | GCA021406795_00723 | gene | open | 2372-3079 | |||
| 3011 | JAEMBP010000038.1 | GCA021406795_00724 | gene | open | 3070-3816 | hemD | ||
| 3012 | JAEMBP010000038.1 | GCA021406795_00725 | gene | open | 3813-4226 | rnpA | ||
| 3013 | JAEMBP010000038.1 | GCA021406795_00726 | gene | open | 4232-4462 | yidD | ||
| 3014 | JAEMBP010000038.1 | GCA021406795_00727 | gene | open | 4491-5159 | tatD | ||
| 3015 | JAEMBP010000038.1 | GCA021406795_00728 | gene | open | 5112-5651 | |||
| 3016 | JAEMBP010000038.1 | GCA021406795_00729 | gene | open | 6735-9560 | pqqL | ||
| 3017 | JAEMBP010000038.1 | GCA021406795_00730 | gene | open | 9838-10416 | rbr | ||
| 3018 | JAEMBP010000038.1 | GCA021406795_00731 | gene | open | 10745-11236 | ompH | ||
| 3019 | JAEMBP010000038.1 | GCA021406795_00732 | gene | open | 11271-11783 | ompH | ||
| 3020 | JAEMBP010000038.1 | GCA021406795_00733 | gene | open | 11852-14527 | bamA | ||
| 3021 | JAEMBP010000038.1 | GCA021406795_00734 | gene | open | 14545-15309 | uppS | ||
| 3022 | JAEMBP010000038.1 | GCA021406795_00735 | gene | open | 15387-16094 | |||
| 3023 | JAEMBP010000038.1 | GCA021406795_00736 | gene | open | 16081-17451 | |||
| 3024 | JAEMBP010000038.1 | GCA021406795_00737 | gene | open | 17668-19167 | |||
| 3025 | JAEMBP010000038.1 | GCA021406795_00738 | gene | open | 19198-22338 | |||
| 3026 | JAEMBP010000039.1 | GCA021406795_01972 | CDS | open | 159-1001 | _na 280_aa | cTD-A | Secretion system C-terminal sorting domain-containing protein |
| 3027 | JAEMBP010000039.1 | GCA021406795_01973 | CDS | open | 1255-1836 | _na 193_aa | folE | GTP cyclohydrolase I FolE |
| 3028 | JAEMBP010000039.1 | GCA021406795_01974 | CDS | open | 1840-2346 | _na 168_aa | SPOR domain-containing protein | |
| 3029 | JAEMBP010000039.1 | GCA021406795_01975 | CDS | open | 2408-3163 | _na 251_aa | tpiA | triose-phosphate isomerase |
| 3030 | JAEMBP010000039.1 | GCA021406795_01976 | CDS | open | 3195-4487 | _na 430_aa | mauE | Methylamine utilisation protein MauE domain-containing protein |
| 3031 | JAEMBP010000039.1 | GCA021406795_01977 | CDS | open | 4484-5032 | _na 182_aa | Nucleotide modification associated domain-containing protein | |
| 3032 | JAEMBP010000039.1 | GCA021406795_01978 | CDS | open | 5029-7566 | _na 845_aa | lon | endopeptidase La |
| 3033 | JAEMBP010000039.1 | GCA021406795_01979 | CDS | open | 7772-9319 | _na 515_aa | ahpF | alkyl hydroperoxide reductase subunit F |
| 3034 | JAEMBP010000039.1 | GCA021406795_01980 | CDS | open | 9485-10051 | _na 188_aa | ahpC | alkyl hydroperoxide reductase subunit C |
| 3035 | JAEMBP010000039.1 | GCA021406795_01981 | CDS | open | 10464-11498 | _na 344_aa | cTD-A | Thioredoxin domain-containing protein |
| 3036 | JAEMBP010000039.1 | GCA021406795_01982 | CDS | open | 11601-13400 | _na 599_aa | typA | translational GTPase TypA |
| 3037 | JAEMBP010000039.1 | GCA021406795_01983 | CDS | open | 13607-14551 | _na 314_aa | Lipoprotein | |
| 3038 | JAEMBP010000039.1 | GCA021406795_01984 | CDS | open | 14559-15248 | _na 229_aa | DUF5666 domain-containing protein | |
| 3039 | JAEMBP010000039.1 | GCA021406795_01985 | CDS | open | 15272-15475 | _na 67_aa | hypothetical protein | |
| 3040 | JAEMBP010000039.1 | GCA021406795_01986 | CDS | open | 15472-16377 | _na 301_aa | Lipoprotein | |
| 3041 | JAEMBP010000039.1 | GCA021406795_01987 | CDS | open | 17512-18006 | _na 164_aa | Thioredoxin-like fold domain-containing protein | |
| 3042 | JAEMBP010000039.1 | GCA021406795_01988 | CDS | open | 18268-19311 | _na 347_aa | Endonuclease/exonuclease/phosphatase domain-containing protein | |
| 3043 | JAEMBP010000039.1 | GCA021406795_01989 | CDS | open | 19295-20164 | _na 289_aa | ispH | 4-hydroxy-3-methylbut-2-enyl diphosphate reductase |
| 3044 | JAEMBP010000039.1 | GCA021406795_01990 | CDS | open | 20161-20856 | _na 231_aa | cmk | (d)CMP kinase |
| 3045 | JAEMBP010000039.1 | GCA021406795_01991 | CDS | open | 20886-21926 | _na 346_aa | porQ | type IX secretion system protein PorQ |
| 3046 | JAEMBP010000039.1 | GCA021406795_01992 | CDS | open | 21951-22178 | _na 75_aa | hypothetical protein | |
| 3047 | JAEMBP010000039.1 | GCA021406795_01972 | gene | open | 159-1001 | cTD-A | ||
| 3048 | JAEMBP010000039.1 | GCA021406795_01973 | gene | open | 1255-1836 | folE | ||
| 3049 | JAEMBP010000039.1 | GCA021406795_01974 | gene | open | 1840-2346 | |||
| 3050 | JAEMBP010000039.1 | GCA021406795_01975 | gene | open | 2408-3163 | tpiA | ||
| 3051 | JAEMBP010000039.1 | GCA021406795_01976 | gene | open | 3195-4487 | mauE | ||
| 3052 | JAEMBP010000039.1 | GCA021406795_01977 | gene | open | 4484-5032 | |||
| 3053 | JAEMBP010000039.1 | GCA021406795_01978 | gene | open | 5029-7566 | lon | ||
| 3054 | JAEMBP010000039.1 | GCA021406795_01979 | gene | open | 7772-9319 | ahpF | ||
| 3055 | JAEMBP010000039.1 | GCA021406795_01980 | gene | open | 9485-10051 | ahpC | ||
| 3056 | JAEMBP010000039.1 | GCA021406795_01981 | gene | open | 10464-11498 | cTD-A | ||
| 3057 | JAEMBP010000039.1 | GCA021406795_01982 | gene | open | 11601-13400 | typA | ||
| 3058 | JAEMBP010000039.1 | GCA021406795_01983 | gene | open | 13607-14551 | |||
| 3059 | JAEMBP010000039.1 | GCA021406795_01984 | gene | open | 14559-15248 | |||
| 3060 | JAEMBP010000039.1 | GCA021406795_01985 | gene | open | 15272-15475 | |||
| 3061 | JAEMBP010000039.1 | GCA021406795_01986 | gene | open | 15472-16377 | |||
| 3062 | JAEMBP010000039.1 | GCA021406795_01987 | gene | open | 17512-18006 | |||
| 3063 | JAEMBP010000039.1 | GCA021406795_01988 | gene | open | 18268-19311 | |||
| 3064 | JAEMBP010000039.1 | GCA021406795_01989 | gene | open | 19295-20164 | ispH | ||
| 3065 | JAEMBP010000039.1 | GCA021406795_01990 | gene | open | 20161-20856 | cmk | ||
| 3066 | JAEMBP010000039.1 | GCA021406795_01991 | gene | open | 20886-21926 | porQ | ||
| 3067 | JAEMBP010000039.1 | GCA021406795_01992 | gene | open | 21951-22178 | |||
| 3068 | JAEMBP010000040.1 | regulatory_region | open | 9361-9573 | Cobalamin riboswitch aptamer | |||
| 3069 | JAEMBP010000040.1 | GCA021406795_00661 | CDS | open | 339-2147 | _na 602_aa | dnaX | DNA polymerase III subunit gamma/tau |
| 3070 | JAEMBP010000040.1 | GCA021406795_00662 | CDS | open | 2269-3915 | _na 548_aa | ttdA | Fumarate hydratase class I |
| 3071 | JAEMBP010000040.1 | GCA021406795_00663 | CDS | open | 4211-5152 | _na 313_aa | yrpB | Enoyl-(Acyl-carrier-protein) reductase II |
| 3072 | JAEMBP010000040.1 | GCA021406795_00664 | CDS | open | 5584-8187 | _na 867_aa | btuB | TonB-dependent receptor plug domain-containing protein |
| 3073 | JAEMBP010000040.1 | GCA021406795_00665 | CDS | open | 8938-9240 | _na 100_aa | hypothetical protein | |
| 3074 | JAEMBP010000040.1 | GCA021406795_00666 | CDS | open | 10098-11777 | _na 559_aa | ybjL | putative transporter |
| 3075 | JAEMBP010000040.1 | GCA021406795_00667 | CDS | open | 11870-12385 | _na 171_aa | GyrI-like small molecule binding domain-containing protein | |
| 3076 | JAEMBP010000040.1 | GCA021406795_00668 | CDS | open | 12382-13347 | _na 321_aa | czcD | Heavy metal efflux pump%2C CzcD family |
| 3077 | JAEMBP010000040.1 | GCA021406795_00669 | CDS | open | 13403-14146 | _na 247_aa | hypothetical protein | |
| 3078 | JAEMBP010000040.1 | GCA021406795_00670 | CDS | open | 14130-14579 | _na 149_aa | hypothetical protein | |
| 3079 | JAEMBP010000040.1 | GCA021406795_00671 | CDS | open | 14596-17451 | _na 951_aa | lptD | LPS-assembly protein LptD central domain-containing protein |
| 3080 | JAEMBP010000040.1 | GCA021406795_00672 | CDS | open | 17478-18194 | _na 238_aa | glpG | Rhomboid family protein |
| 3081 | JAEMBP010000040.1 | GCA021406795_00673 | CDS | open | 18178-19092 | _na 304_aa | glpG | Rhomboid family intramembrane serine protease |
| 3082 | JAEMBP010000040.1 | GCA021406795_00674 | CDS | open | 19089-20234 | _na 381_aa | elsH | Endonuclease/exonuclease/phosphatase domain-containing protein |
| 3083 | JAEMBP010000040.1 | GCA021406795_00675 | CDS | open | 20487-21866 | _na 459_aa | tnaA | Beta-eliminating lyase |
| 3084 | JAEMBP010000040.1 | GCA021406795_00661 | gene | open | 339-2147 | dnaX | ||
| 3085 | JAEMBP010000040.1 | GCA021406795_00662 | gene | open | 2269-3915 | ttdA | ||
| 3086 | JAEMBP010000040.1 | GCA021406795_00663 | gene | open | 4211-5152 | yrpB | ||
| 3087 | JAEMBP010000040.1 | GCA021406795_00664 | gene | open | 5584-8187 | btuB | ||
| 3088 | JAEMBP010000040.1 | GCA021406795_00665 | gene | open | 8938-9240 | |||
| 3089 | JAEMBP010000040.1 | GCA021406795_00666 | gene | open | 10098-11777 | ybjL | ||
| 3090 | JAEMBP010000040.1 | GCA021406795_00667 | gene | open | 11870-12385 | |||
| 3091 | JAEMBP010000040.1 | GCA021406795_00668 | gene | open | 12382-13347 | czcD | ||
| 3092 | JAEMBP010000040.1 | GCA021406795_00669 | gene | open | 13403-14146 | |||
| 3093 | JAEMBP010000040.1 | GCA021406795_00670 | gene | open | 14130-14579 | |||
| 3094 | JAEMBP010000040.1 | GCA021406795_00671 | gene | open | 14596-17451 | lptD | ||
| 3095 | JAEMBP010000040.1 | GCA021406795_00672 | gene | open | 17478-18194 | glpG | ||
| 3096 | JAEMBP010000040.1 | GCA021406795_00673 | gene | open | 18178-19092 | glpG | ||
| 3097 | JAEMBP010000040.1 | GCA021406795_00674 | gene | open | 19089-20234 | elsH | ||
| 3098 | JAEMBP010000040.1 | GCA021406795_00675 | gene | open | 20487-21866 | tnaA | ||
| 3099 | JAEMBP010000041.1 | GCA021406795_01357 | CDS | open | 705-1595 | _na 296_aa | dnaG | Zinc finger CHC2-type domain-containing protein |
| 3100 | JAEMBP010000041.1 | GCA021406795_01358 | CDS | open | 1722-2084 | _na 120_aa | Mobilization protein | |
| 3101 | JAEMBP010000041.1 | GCA021406795_01359 | CDS | open | 2074-3015 | _na 313_aa | traI | Conjugal transfer relaxase TraI |
| 3102 | JAEMBP010000041.1 | GCA021406795_01360 | CDS | open | 3041-3763 | _na 240_aa | Viral A-type inclusion protein | |
| 3103 | JAEMBP010000041.1 | GCA021406795_01361 | CDS | open | 3881-4075 | _na 64_aa | Transcriptional regulator | |
| 3104 | JAEMBP010000041.1 | GCA021406795_01362 | CDS | open | 4118-7309 | _na 1063_aa | Tetratricopeptide repeat protein | |
| 3105 | JAEMBP010000041.1 | GCA021406795_01363 | CDS | open | 7512-8954 | _na 480_aa | ATP-binding protein | |
| 3106 | JAEMBP010000041.1 | GCA021406795_01364 | CDS | open | 8958-9470 | _na 170_aa | Polyketide cyclase | |
| 3107 | JAEMBP010000041.1 | GCA021406795_01365 | CDS | open | 9583-10008 | _na 141_aa | DUF304 domain-containing protein | |
| 3108 | JAEMBP010000041.1 | GCA021406795_01366 | CDS | open | 10012-10431 | _na 139_aa | Lipoprotein | |
| 3109 | JAEMBP010000041.1 | GCA021406795_01367 | CDS | open | 10431-11579 | _na 382_aa | bioF | 8-amino-7-oxononanoate synthase |
| 3110 | JAEMBP010000041.1 | GCA021406795_01368 | CDS | open | 11965-12918 | _na 317_aa | ldhA | Glycerate dehydrogenase |
| 3111 | JAEMBP010000041.1 | GCA021406795_01369 | CDS | open | 13159-15039 | _na 626_aa | DUF349 domain-containing protein | |
| 3112 | JAEMBP010000041.1 | GCA021406795_01370 | CDS | open | 15267-15515 | _na 82_aa | transposase family protein | |
| 3113 | JAEMBP010000041.1 | GCA021406795_01371 | CDS | open | 15957-17348 | _na 463_aa | Lipase | |
| 3114 | JAEMBP010000041.1 | GCA021406795_01372 | CDS | open | 17332-18159 | _na 275_aa | tesA | SGNH hydrolase-type esterase domain-containing protein |
| 3115 | JAEMBP010000041.1 | GCA021406795_01373 | CDS | open | 18181-19716 | _na 511_aa | dltB | Alginate O-acetyltransferase%2C putative |
| 3116 | JAEMBP010000041.1 | GCA021406795_01357 | gene | open | 705-1595 | dnaG | ||
| 3117 | JAEMBP010000041.1 | GCA021406795_01358 | gene | open | 1722-2084 | |||
| 3118 | JAEMBP010000041.1 | GCA021406795_01359 | gene | open | 2074-3015 | traI | ||
| 3119 | JAEMBP010000041.1 | GCA021406795_01360 | gene | open | 3041-3763 | |||
| 3120 | JAEMBP010000041.1 | GCA021406795_01361 | gene | open | 3881-4075 | |||
| 3121 | JAEMBP010000041.1 | GCA021406795_01362 | gene | open | 4118-7309 | |||
| 3122 | JAEMBP010000041.1 | GCA021406795_01363 | gene | open | 7512-8954 | |||
| 3123 | JAEMBP010000041.1 | GCA021406795_01364 | gene | open | 8958-9470 | |||
| 3124 | JAEMBP010000041.1 | GCA021406795_01365 | gene | open | 9583-10008 | |||
| 3125 | JAEMBP010000041.1 | GCA021406795_01366 | gene | open | 10012-10431 | |||
| 3126 | JAEMBP010000041.1 | GCA021406795_01367 | gene | open | 10431-11579 | bioF | ||
| 3127 | JAEMBP010000041.1 | GCA021406795_01368 | gene | open | 11965-12918 | ldhA | ||
| 3128 | JAEMBP010000041.1 | GCA021406795_01369 | gene | open | 13159-15039 | |||
| 3129 | JAEMBP010000041.1 | GCA021406795_01370 | gene | open | 15267-15515 | |||
| 3130 | JAEMBP010000041.1 | GCA021406795_01371 | gene | open | 15957-17348 | |||
| 3131 | JAEMBP010000041.1 | GCA021406795_01372 | gene | open | 17332-18159 | tesA | ||
| 3132 | JAEMBP010000041.1 | GCA021406795_01373 | gene | open | 18181-19716 | dltB | ||
| 3133 | JAEMBP010000042.1 | GCA021406795_00401 | CDS | open | 241-1989 | _na 582_aa | manB | Phosphomannomutase |
| 3134 | JAEMBP010000042.1 | GCA021406795_00402 | CDS | open | 2062-2799 | _na 245_aa | recO | DNA repair protein RecO |
| 3135 | JAEMBP010000042.1 | GCA021406795_00403 | CDS | open | 3372-5873 | _na 833_aa | fepA | TonB-dependent receptor%2C putative |
| 3136 | JAEMBP010000042.1 | GCA021406795_00404 | CDS | open | 6180-6539 | _na 119_aa | hypothetical protein | |
| 3137 | JAEMBP010000042.1 | GCA021406795_00405 | CDS | open | 7049-8041 | _na 330_aa | yeiH | UPF0324 membrane protein PG_2004 |
| 3138 | JAEMBP010000042.1 | GCA021406795_00406 | CDS | open | 8192-9529 | _na 445_aa | dgt | Deoxyguanosinetriphosphate triphosphohydrolase |
| 3139 | JAEMBP010000042.1 | GCA021406795_00407 | CDS | open | 9590-10306 | _na 238_aa | dapB | 4-hydroxy-tetrahydrodipicolinate reductase |
| 3140 | JAEMBP010000042.1 | GCA021406795_00408 | CDS | open | 10322-11719 | _na 465_aa | lepB | signal peptidase I |
| 3141 | JAEMBP010000042.1 | GCA021406795_00409 | CDS | open | 11709-12335 | _na 208_aa | lepB | signal peptidase I |
| 3142 | JAEMBP010000042.1 | GCA021406795_00410 | CDS | open | 12356-12994 | _na 212_aa | WbqC-like protein | |
| 3143 | JAEMBP010000042.1 | GCA021406795_00411 | CDS | open | 13052-14026 | _na 324_aa | ispA | Polyprenyl synthetase |
| 3144 | JAEMBP010000042.1 | GCA021406795_00412 | CDS | open | 14135-14296 | _na 53_aa | hypothetical protein | |
| 3145 | JAEMBP010000042.1 | GCA021406795_00413 | CDS | open | 14337-15185 | _na 282_aa | deoC | deoxyribose-phosphate aldolase |
| 3146 | JAEMBP010000042.1 | GCA021406795_00414 | CDS | open | 15193-15543 | _na 116_aa | mazG | NTP pyrophosphohydrolase MazG-like domain-containing protein |
| 3147 | JAEMBP010000042.1 | GCA021406795_00415 | CDS | open | 15548-16000 | _na 150_aa | dtd | D-aminoacyl-tRNA deacylase |
| 3148 | JAEMBP010000042.1 | GCA021406795_00416 | CDS | open | 16007-17809 | _na 600_aa | uvrC | excinuclease ABC subunit UvrC |
| 3149 | JAEMBP010000042.1 | GCA021406795_00417 | CDS | open | 17840-19717 | _na 625_aa | mnmG | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG |
| 3150 | JAEMBP010000042.1 | GCA021406795_00401 | gene | open | 241-1989 | manB | ||
| 3151 | JAEMBP010000042.1 | GCA021406795_00402 | gene | open | 2062-2799 | recO | ||
| 3152 | JAEMBP010000042.1 | GCA021406795_00403 | gene | open | 3372-5873 | fepA | ||
| 3153 | JAEMBP010000042.1 | GCA021406795_00404 | gene | open | 6180-6539 | |||
| 3154 | JAEMBP010000042.1 | GCA021406795_00405 | gene | open | 7049-8041 | yeiH | ||
| 3155 | JAEMBP010000042.1 | GCA021406795_00406 | gene | open | 8192-9529 | dgt | ||
| 3156 | JAEMBP010000042.1 | GCA021406795_00407 | gene | open | 9590-10306 | dapB | ||
| 3157 | JAEMBP010000042.1 | GCA021406795_00408 | gene | open | 10322-11719 | lepB | ||
| 3158 | JAEMBP010000042.1 | GCA021406795_00409 | gene | open | 11709-12335 | lepB | ||
| 3159 | JAEMBP010000042.1 | GCA021406795_00410 | gene | open | 12356-12994 | |||
| 3160 | JAEMBP010000042.1 | GCA021406795_00411 | gene | open | 13052-14026 | ispA | ||
| 3161 | JAEMBP010000042.1 | GCA021406795_00412 | gene | open | 14135-14296 | |||
| 3162 | JAEMBP010000042.1 | GCA021406795_00413 | gene | open | 14337-15185 | deoC | ||
| 3163 | JAEMBP010000042.1 | GCA021406795_00414 | gene | open | 15193-15543 | mazG | ||
| 3164 | JAEMBP010000042.1 | GCA021406795_00415 | gene | open | 15548-16000 | dtd | ||
| 3165 | JAEMBP010000042.1 | GCA021406795_00416 | gene | open | 16007-17809 | uvrC | ||
| 3166 | JAEMBP010000042.1 | GCA021406795_00417 | gene | open | 17840-19717 | mnmG | ||
| 3167 | JAEMBP010000043.1 | GCA021406795_00287 | CDS | open | 392-892 | _na 166_aa | rpoE | RNA polymerase sigma-70 factor%2C ECF subfamily |
| 3168 | JAEMBP010000043.1 | GCA021406795_00288 | CDS | open | 892-1377 | _na 161_aa | rseA | Anti sigma-E protein RseA N-terminal domain-containing protein |
| 3169 | JAEMBP010000043.1 | GCA021406795_00289 | CDS | open | 1433-1885 | _na 150_aa | DUF4252 domain-containing protein | |
| 3170 | JAEMBP010000043.1 | GCA021406795_00290 | CDS | open | 1919-2812 | _na 297_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 3171 | JAEMBP010000043.1 | GCA021406795_00291 | CDS | open | 2826-3683 | _na 285_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 3172 | JAEMBP010000043.1 | GCA021406795_00292 | CDS | open | 3803-6487 | _na 894_aa | Internalin | |
| 3173 | JAEMBP010000043.1 | GCA021406795_00293 | CDS | open | 6541-7008 | _na 155_aa | hupA | Histidinol phosphate aminotransferase |
| 3174 | JAEMBP010000043.1 | GCA021406795_00294 | CDS | open | 7629-8120 | _na 163_aa | dnaQ | Exonuclease |
| 3175 | JAEMBP010000043.1 | GCA021406795_00295 | CDS | open | 8124-8762 | _na 212_aa | marC | UPF0056 inner membrane protein |
| 3176 | JAEMBP010000043.1 | GCA021406795_00296 | CDS | open | 8943-11636 | _na 897_aa | yebA | Transglutaminase-like domain-containing protein |
| 3177 | JAEMBP010000043.1 | GCA021406795_00297 | CDS | open | 11698-13083 | _na 461_aa | radA | DNA repair protein RadA |
| 3178 | JAEMBP010000043.1 | GCA021406795_00298 | CDS | open | 13129-14055 | _na 308_aa | ddaH | Amidinotransferase |
| 3179 | JAEMBP010000043.1 | GCA021406795_00299 | CDS | open | 14528-15190 | _na 220_aa | fsa | fructose-6-phosphate aldolase |
| 3180 | JAEMBP010000043.1 | GCA021406795_00300 | CDS | open | 15187-16485 | _na 432_aa | ybbC | Lipoprotein |
| 3181 | JAEMBP010000043.1 | GCA021406795_00301 | CDS | open | 16564-19029 | _na 821_aa | cTD-A | PKD domain-containing protein |
| 3182 | JAEMBP010000043.1 | GCA021406795_00287 | gene | open | 392-892 | rpoE | ||
| 3183 | JAEMBP010000043.1 | GCA021406795_00288 | gene | open | 892-1377 | rseA | ||
| 3184 | JAEMBP010000043.1 | GCA021406795_00289 | gene | open | 1433-1885 | |||
| 3185 | JAEMBP010000043.1 | GCA021406795_00290 | gene | open | 1919-2812 | |||
| 3186 | JAEMBP010000043.1 | GCA021406795_00291 | gene | open | 2826-3683 | |||
| 3187 | JAEMBP010000043.1 | GCA021406795_00292 | gene | open | 3803-6487 | |||
| 3188 | JAEMBP010000043.1 | GCA021406795_00293 | gene | open | 6541-7008 | hupA | ||
| 3189 | JAEMBP010000043.1 | GCA021406795_00294 | gene | open | 7629-8120 | dnaQ | ||
| 3190 | JAEMBP010000043.1 | GCA021406795_00295 | gene | open | 8124-8762 | marC | ||
| 3191 | JAEMBP010000043.1 | GCA021406795_00296 | gene | open | 8943-11636 | yebA | ||
| 3192 | JAEMBP010000043.1 | GCA021406795_00297 | gene | open | 11698-13083 | radA | ||
| 3193 | JAEMBP010000043.1 | GCA021406795_00298 | gene | open | 13129-14055 | ddaH | ||
| 3194 | JAEMBP010000043.1 | GCA021406795_00299 | gene | open | 14528-15190 | fsa | ||
| 3195 | JAEMBP010000043.1 | GCA021406795_00300 | gene | open | 15187-16485 | ybbC | ||
| 3196 | JAEMBP010000043.1 | GCA021406795_00301 | gene | open | 16564-19029 | cTD-A | ||
| 3197 | JAEMBP010000044.1 | GCA021406795_00184 | CDS | open | 254-736 | _na 160_aa | rplQ | 50S ribosomal protein L17 |
| 3198 | JAEMBP010000044.1 | GCA021406795_00185 | CDS | open | 742-1734 | _na 330_aa | rpoA | DNA-directed RNA polymerase subunit alpha |
| 3199 | JAEMBP010000044.1 | GCA021406795_00186 | CDS | open | 1747-2352 | _na 201_aa | rpsD | 30S ribosomal protein S4 |
| 3200 | JAEMBP010000044.1 | GCA021406795_00187 | CDS | open | 2512-2898 | _na 128_aa | rpsK | 30S ribosomal protein S11 |
| 3201 | JAEMBP010000044.1 | GCA021406795_00188 | CDS | open | 2910-3290 | _na 126_aa | rpsM | 30S ribosomal protein S13 |
| 3202 | JAEMBP010000044.1 | GCA021406795_00189 | CDS | open | 3323-3439 | _na 38_aa | ykgO | type B 50S ribosomal protein L36 |
| 3203 | JAEMBP010000044.1 | GCA021406795_00190 | CDS | open | 3456-3674 | _na 72_aa | infA | translation initiation factor IF-1 |
| 3204 | JAEMBP010000044.1 | GCA021406795_00191 | CDS | open | 3677-4462 | _na 261_aa | map | type I methionyl aminopeptidase |
| 3205 | JAEMBP010000044.1 | GCA021406795_00192 | CDS | open | 4462-5802 | _na 446_aa | secY | preprotein translocase subunit SecY |
| 3206 | JAEMBP010000044.1 | GCA021406795_00193 | CDS | open | 5807-6253 | _na 148_aa | rplO | 50S ribosomal protein L15 |
| 3207 | JAEMBP010000044.1 | GCA021406795_00194 | CDS | open | 6475-6993 | _na 172_aa | rpsE | 30S ribosomal protein S5 |
| 3208 | JAEMBP010000044.1 | GCA021406795_00195 | CDS | open | 6999-7343 | _na 114_aa | rplR | 50S ribosomal protein L18 |
| 3209 | JAEMBP010000044.1 | GCA021406795_00196 | CDS | open | 7362-7913 | _na 183_aa | rplF | 50S ribosomal protein L6 |
| 3210 | JAEMBP010000044.1 | GCA021406795_00197 | CDS | open | 7932-8327 | _na 131_aa | rpsH | 30S ribosomal protein S8 |
| 3211 | JAEMBP010000044.1 | GCA021406795_00198 | CDS | open | 8378-8647 | _na 89_aa | rpsN | 30S ribosomal protein S14 |
| 3212 | JAEMBP010000044.1 | GCA021406795_00199 | CDS | open | 8649-9209 | _na 186_aa | rplE | 50S ribosomal protein L5 |
| 3213 | JAEMBP010000044.1 | GCA021406795_00200 | CDS | open | 9209-9493 | _na 94_aa | rplX | 50S ribosomal protein L24 |
| 3214 | JAEMBP010000044.1 | GCA021406795_00201 | CDS | open | 9552-9917 | _na 121_aa | rplN | 50S ribosomal protein L14 |
| 3215 | JAEMBP010000044.1 | GCA021406795_00202 | CDS | open | 9919-10173 | _na 84_aa | rpsQ | 30S ribosomal protein S17 |
| 3216 | JAEMBP010000044.1 | GCA021406795_00203 | CDS | open | 10187-10381 | _na 64_aa | rpmC | 50S ribosomal protein L29 |
| 3217 | JAEMBP010000044.1 | GCA021406795_00204 | CDS | open | 10387-10821 | _na 144_aa | rplP | 50S ribosomal protein L16 |
| 3218 | JAEMBP010000044.1 | GCA021406795_00205 | CDS | open | 10842-11582 | _na 246_aa | rpsC | 30S ribosomal protein S3 |
| 3219 | JAEMBP010000044.1 | GCA021406795_00206 | CDS | open | 11589-11993 | _na 134_aa | rplV | 50S ribosomal protein L22 |
| 3220 | JAEMBP010000044.1 | GCA021406795_00207 | CDS | open | 12048-12317 | _na 89_aa | rpsS | 30S ribosomal protein S19 |
| 3221 | JAEMBP010000044.1 | GCA021406795_00208 | CDS | open | 12340-13164 | _na 274_aa | rplB | 50S ribosomal protein L2 |
| 3222 | JAEMBP010000044.1 | GCA021406795_00209 | CDS | open | 13171-13464 | _na 97_aa | rplW | 50S ribosomal protein L23 |
| 3223 | JAEMBP010000044.1 | GCA021406795_00210 | CDS | open | 13479-14108 | _na 209_aa | rplD | 50S ribosomal protein L4 |
| 3224 | JAEMBP010000044.1 | GCA021406795_00211 | CDS | open | 14108-14725 | _na 205_aa | rplC | 50S ribosomal protein L3 |
| 3225 | JAEMBP010000044.1 | GCA021406795_00212 | CDS | open | 14748-15053 | _na 101_aa | rpsJ | 30S ribosomal protein S10 |
| 3226 | JAEMBP010000044.1 | GCA021406795_00213 | CDS | open | 15069-17192 | _na 707_aa | fusA | elongation factor G |
| 3227 | JAEMBP010000044.1 | GCA021406795_00214 | CDS | open | 17205-17681 | _na 158_aa | rpsG | 30S ribosomal protein S7 |
| 3228 | JAEMBP010000044.1 | GCA021406795_00215 | CDS | open | 17918-18322 | _na 134_aa | rpsL | 30S ribosomal protein S12 |
| 3229 | JAEMBP010000044.1 | GCA021406795_00216 | CDS | open | 18536-18796 | _na 86_aa | hypothetical protein | |
| 3230 | JAEMBP010000044.1 | GCA021406795_00184 | gene | open | 254-736 | rplQ | ||
| 3231 | JAEMBP010000044.1 | GCA021406795_00185 | gene | open | 742-1734 | rpoA | ||
| 3232 | JAEMBP010000044.1 | GCA021406795_00186 | gene | open | 1747-2352 | rpsD | ||
| 3233 | JAEMBP010000044.1 | GCA021406795_00187 | gene | open | 2512-2898 | rpsK | ||
| 3234 | JAEMBP010000044.1 | GCA021406795_00188 | gene | open | 2910-3290 | rpsM | ||
| 3235 | JAEMBP010000044.1 | GCA021406795_00189 | gene | open | 3323-3439 | ykgO | ||
| 3236 | JAEMBP010000044.1 | GCA021406795_00190 | gene | open | 3456-3674 | infA | ||
| 3237 | JAEMBP010000044.1 | GCA021406795_00191 | gene | open | 3677-4462 | map | ||
| 3238 | JAEMBP010000044.1 | GCA021406795_00192 | gene | open | 4462-5802 | secY | ||
| 3239 | JAEMBP010000044.1 | GCA021406795_00193 | gene | open | 5807-6253 | rplO | ||
| 3240 | JAEMBP010000044.1 | GCA021406795_00194 | gene | open | 6475-6993 | rpsE | ||
| 3241 | JAEMBP010000044.1 | GCA021406795_00195 | gene | open | 6999-7343 | rplR | ||
| 3242 | JAEMBP010000044.1 | GCA021406795_00196 | gene | open | 7362-7913 | rplF | ||
| 3243 | JAEMBP010000044.1 | GCA021406795_00197 | gene | open | 7932-8327 | rpsH | ||
| 3244 | JAEMBP010000044.1 | GCA021406795_00198 | gene | open | 8378-8647 | rpsN | ||
| 3245 | JAEMBP010000044.1 | GCA021406795_00199 | gene | open | 8649-9209 | rplE | ||
| 3246 | JAEMBP010000044.1 | GCA021406795_00200 | gene | open | 9209-9493 | rplX | ||
| 3247 | JAEMBP010000044.1 | GCA021406795_00201 | gene | open | 9552-9917 | rplN | ||
| 3248 | JAEMBP010000044.1 | GCA021406795_00202 | gene | open | 9919-10173 | rpsQ | ||
| 3249 | JAEMBP010000044.1 | GCA021406795_00203 | gene | open | 10187-10381 | rpmC | ||
| 3250 | JAEMBP010000044.1 | GCA021406795_00204 | gene | open | 10387-10821 | rplP | ||
| 3251 | JAEMBP010000044.1 | GCA021406795_00205 | gene | open | 10842-11582 | rpsC | ||
| 3252 | JAEMBP010000044.1 | GCA021406795_00206 | gene | open | 11589-11993 | rplV | ||
| 3253 | JAEMBP010000044.1 | GCA021406795_00207 | gene | open | 12048-12317 | rpsS | ||
| 3254 | JAEMBP010000044.1 | GCA021406795_00208 | gene | open | 12340-13164 | rplB | ||
| 3255 | JAEMBP010000044.1 | GCA021406795_00209 | gene | open | 13171-13464 | rplW | ||
| 3256 | JAEMBP010000044.1 | GCA021406795_00210 | gene | open | 13479-14108 | rplD | ||
| 3257 | JAEMBP010000044.1 | GCA021406795_00211 | gene | open | 14108-14725 | rplC | ||
| 3258 | JAEMBP010000044.1 | GCA021406795_00212 | gene | open | 14748-15053 | rpsJ | ||
| 3259 | JAEMBP010000044.1 | GCA021406795_00213 | gene | open | 15069-17192 | fusA | ||
| 3260 | JAEMBP010000044.1 | GCA021406795_00214 | gene | open | 17205-17681 | rpsG | ||
| 3261 | JAEMBP010000044.1 | GCA021406795_00215 | gene | open | 17918-18322 | rpsL | ||
| 3262 | JAEMBP010000044.1 | GCA021406795_00216 | gene | open | 18536-18796 | |||
| 3263 | JAEMBP010000045.1 | repeat_region | open | 29-3092 | CRISPR array with 47 repeats of length 30%2C consensus sequence GTTTTAATTCCTGTATGGTGCAATTGAAAT and spacer length 35 | |||
| 3264 | JAEMBP010000045.1 | GCA021406795_01719 | CDS | open | 3329-3592 | _na 87_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 3265 | JAEMBP010000045.1 | GCA021406795_01720 | CDS | open | 3592-4608 | _na 338_aa | cas1b | type I-B CRISPR-associated endonuclease Cas1b |
| 3266 | JAEMBP010000045.1 | GCA021406795_01721 | CDS | open | 4605-5114 | _na 169_aa | cas4 | CRISPR-associated protein Cas4 |
| 3267 | JAEMBP010000045.1 | GCA021406795_01722 | CDS | open | 5231-6289 | _na 352_aa | CRISPR-associated protein Cas7 | |
| 3268 | JAEMBP010000045.1 | GCA021406795_01723 | CDS | open | 6310-7605 | _na 431_aa | hypothetical protein | |
| 3269 | JAEMBP010000045.1 | GCA021406795_01724 | CDS | open | 7616-9736 | _na 706_aa | putative CRISPR-associated helicase Cas3 core | |
| 3270 | JAEMBP010000045.1 | GCA021406795_01725 | CDS | open | 9753-10340 | _na 195_aa | CRISPR-associated protein Cas5 | |
| 3271 | JAEMBP010000045.1 | GCA021406795_01726 | CDS | open | 10347-11012 | _na 221_aa | cas6 | CRISPR-associated endoribonuclease Cas6 |
| 3272 | JAEMBP010000045.1 | GCA021406795_01727 | CDS | open | 11084-11395 | _na 103_aa | hypothetical protein | |
| 3273 | JAEMBP010000045.1 | GCA021406795_01728 | CDS | open | 11660-13591 | _na 643_aa | mdoB | Sulfatase N-terminal domain-containing protein |
| 3274 | JAEMBP010000045.1 | GCA021406795_01729 | CDS | open | 13595-16138 | _na 847_aa | yfhO | YfhO family protein |
| 3275 | JAEMBP010000045.1 | GCA021406795_01730 | CDS | open | 16303-17244 | _na 313_aa | fmt | methionyl-tRNA formyltransferase |
| 3276 | JAEMBP010000045.1 | GCA021406795_01732 | CDS | open | 17819-18628 | _na 269_aa | DUF2436 domain-containing protein | |
| 3277 | JAEMBP010000045.1 | GCA021406795_01719 | gene | open | 3329-3592 | cas2 | ||
| 3278 | JAEMBP010000045.1 | GCA021406795_01720 | gene | open | 3592-4608 | cas1b | ||
| 3279 | JAEMBP010000045.1 | GCA021406795_01721 | gene | open | 4605-5114 | cas4 | ||
| 3280 | JAEMBP010000045.1 | GCA021406795_01722 | gene | open | 5231-6289 | |||
| 3281 | JAEMBP010000045.1 | GCA021406795_01723 | gene | open | 6310-7605 | |||
| 3282 | JAEMBP010000045.1 | GCA021406795_01724 | gene | open | 7616-9736 | |||
| 3283 | JAEMBP010000045.1 | GCA021406795_01725 | gene | open | 9753-10340 | |||
| 3284 | JAEMBP010000045.1 | GCA021406795_01726 | gene | open | 10347-11012 | cas6 | ||
| 3285 | JAEMBP010000045.1 | GCA021406795_01727 | gene | open | 11084-11395 | |||
| 3286 | JAEMBP010000045.1 | GCA021406795_01728 | gene | open | 11660-13591 | mdoB | ||
| 3287 | JAEMBP010000045.1 | GCA021406795_01729 | gene | open | 13595-16138 | yfhO | ||
| 3288 | JAEMBP010000045.1 | GCA021406795_01730 | gene | open | 16303-17244 | fmt | ||
| 3289 | JAEMBP010000045.1 | GCA021406795_01732 | gene | open | 17819-18628 | |||
| 3290 | JAEMBP010000045.1 | GCA021406795_01731 | gene | open | 17501-17574 | trnD | ||
| 3291 | JAEMBP010000045.1 | GCA021406795_01731 | tRNA | open | 17501-17574 | trnD | tRNA-Asp(gtc) | |
| 3292 | JAEMBP010000046.1 | GCA021406795_01863 | CDS | open | 495-1760 | _na 421_aa | wecC | UDP-glucose 6-dehydrogenase |
| 3293 | JAEMBP010000046.1 | GCA021406795_01864 | CDS | open | 2094-3176 | _na 360_aa | serC | phosphoserine transaminase |
| 3294 | JAEMBP010000046.1 | GCA021406795_01865 | CDS | open | 3277-4197 | _na 306_aa | serA | D-3-phosphoglycerate dehydrogenase |
| 3295 | JAEMBP010000046.1 | GCA021406795_01866 | CDS | open | 4216-5463 | _na 415_aa | DUF1015 domain-containing protein | |
| 3296 | JAEMBP010000046.1 | GCA021406795_01867 | CDS | open | 5629-6753 | _na 374_aa | Smr domain-containing protein | |
| 3297 | JAEMBP010000046.1 | GCA021406795_01868 | CDS | open | 6777-7232 | _na 151_aa | cYTH | CYTH domain-containing protein |
| 3298 | JAEMBP010000046.1 | GCA021406795_01869 | CDS | open | 7295-9457 | _na 720_aa | dpp11 | Asp/Glu-specific dipeptidyl-peptidase |
| 3299 | JAEMBP010000046.1 | GCA021406795_01870 | CDS | open | 9615-11603 | _na 662_aa | lmbE | Glucosamine-6-phosphate deaminase |
| 3300 | JAEMBP010000046.1 | GCA021406795_01871 | CDS | open | 11711-12193 | _na 160_aa | ftnA | Ferritin |
| 3301 | JAEMBP010000046.1 | GCA021406795_01872 | CDS | open | 12693-13790 | _na 365_aa | gmd | GDP-mannose 4%2C6-dehydratase |
| 3302 | JAEMBP010000046.1 | GCA021406795_01873 | CDS | open | 13783-14856 | _na 357_aa | wcaG | GDP-L-fucose synthase |
| 3303 | JAEMBP010000046.1 | GCA021406795_01874 | CDS | open | 14995-16014 | _na 339_aa | ilvE | branched-chain amino acid aminotransferase |
| 3304 | JAEMBP010000046.1 | GCA021406795_01875 | CDS | open | 16141-17862 | _na 573_aa | cls | phospholipase D |
| 3305 | JAEMBP010000046.1 | GCA021406795_01863 | gene | open | 495-1760 | wecC | ||
| 3306 | JAEMBP010000046.1 | GCA021406795_01864 | gene | open | 2094-3176 | serC | ||
| 3307 | JAEMBP010000046.1 | GCA021406795_01865 | gene | open | 3277-4197 | serA | ||
| 3308 | JAEMBP010000046.1 | GCA021406795_01866 | gene | open | 4216-5463 | |||
| 3309 | JAEMBP010000046.1 | GCA021406795_01867 | gene | open | 5629-6753 | |||
| 3310 | JAEMBP010000046.1 | GCA021406795_01868 | gene | open | 6777-7232 | cYTH | ||
| 3311 | JAEMBP010000046.1 | GCA021406795_01869 | gene | open | 7295-9457 | dpp11 | ||
| 3312 | JAEMBP010000046.1 | GCA021406795_01870 | gene | open | 9615-11603 | lmbE | ||
| 3313 | JAEMBP010000046.1 | GCA021406795_01871 | gene | open | 11711-12193 | ftnA | ||
| 3314 | JAEMBP010000046.1 | GCA021406795_01872 | gene | open | 12693-13790 | gmd | ||
| 3315 | JAEMBP010000046.1 | GCA021406795_01873 | gene | open | 13783-14856 | wcaG | ||
| 3316 | JAEMBP010000046.1 | GCA021406795_01874 | gene | open | 14995-16014 | ilvE | ||
| 3317 | JAEMBP010000046.1 | GCA021406795_01875 | gene | open | 16141-17862 | cls | ||
| 3318 | JAEMBP010000047.1 | GCA021406795_00680 | CDS | open | 504-3593 | _na 1029_aa | Ser/Thr phosphatase family protein | |
| 3319 | JAEMBP010000047.1 | GCA021406795_00681 | CDS | open | 3674-4480 | _na 268_aa | Integrase | |
| 3320 | JAEMBP010000047.1 | GCA021406795_00682 | CDS | open | 5053-6840 | _na 595_aa | sppA | signal peptide peptidase SppA |
| 3321 | JAEMBP010000047.1 | GCA021406795_00683 | CDS | open | 6870-7943 | _na 357_aa | lpxK | tetraacyldisaccharide 4'-kinase |
| 3322 | JAEMBP010000047.1 | GCA021406795_00684 | CDS | open | 7949-8989 | _na 346_aa | thiL | thiamine-phosphate kinase |
| 3323 | JAEMBP010000047.1 | GCA021406795_00685 | CDS | open | 8982-10346 | _na 454_aa | norM | MATE efflux family protein |
| 3324 | JAEMBP010000047.1 | GCA021406795_00686 | CDS | open | 10343-11215 | _na 290_aa | prmA | 50S ribosomal protein L11 methyltransferase |
| 3325 | JAEMBP010000047.1 | GCA021406795_00687 | CDS | open | 11315-11860 | _na 181_aa | yajL | DJ-1 family glyoxalase III |
| 3326 | JAEMBP010000047.1 | GCA021406795_00688 | CDS | open | 11875-12702 | _na 275_aa | tonB | TonB family domain protein |
| 3327 | JAEMBP010000047.1 | GCA021406795_00689 | CDS | open | 12707-13126 | _na 139_aa | exbD | Biopolymer transport protein ExbD%2C putative |
| 3328 | JAEMBP010000047.1 | GCA021406795_00690 | CDS | open | 13123-13857 | _na 244_aa | tolQ | MotA/TolQ/ExbB proton channel family protein |
| 3329 | JAEMBP010000047.1 | GCA021406795_00691 | CDS | open | 13895-14611 | _na 238_aa | pdxJ | pyridoxine 5'-phosphate synthase |
| 3330 | JAEMBP010000047.1 | GCA021406795_00692 | CDS | open | 14689-15555 | _na 288_aa | nadK | NAD kinase |
| 3331 | JAEMBP010000047.1 | GCA021406795_00693 | CDS | open | 15632-16369 | _na 245_aa | lptB | LPS export ABC transporter ATP-binding protein |
| 3332 | JAEMBP010000047.1 | GCA021406795_00694 | CDS | open | 16624-16911 | _na 95_aa | rRM | RNA-binding protein |
| 3333 | JAEMBP010000047.1 | GCA021406795_00680 | gene | open | 504-3593 | |||
| 3334 | JAEMBP010000047.1 | GCA021406795_00681 | gene | open | 3674-4480 | |||
| 3335 | JAEMBP010000047.1 | GCA021406795_00682 | gene | open | 5053-6840 | sppA | ||
| 3336 | JAEMBP010000047.1 | GCA021406795_00683 | gene | open | 6870-7943 | lpxK | ||
| 3337 | JAEMBP010000047.1 | GCA021406795_00684 | gene | open | 7949-8989 | thiL | ||
| 3338 | JAEMBP010000047.1 | GCA021406795_00685 | gene | open | 8982-10346 | norM | ||
| 3339 | JAEMBP010000047.1 | GCA021406795_00686 | gene | open | 10343-11215 | prmA | ||
| 3340 | JAEMBP010000047.1 | GCA021406795_00687 | gene | open | 11315-11860 | yajL | ||
| 3341 | JAEMBP010000047.1 | GCA021406795_00688 | gene | open | 11875-12702 | tonB | ||
| 3342 | JAEMBP010000047.1 | GCA021406795_00689 | gene | open | 12707-13126 | exbD | ||
| 3343 | JAEMBP010000047.1 | GCA021406795_00690 | gene | open | 13123-13857 | tolQ | ||
| 3344 | JAEMBP010000047.1 | GCA021406795_00691 | gene | open | 13895-14611 | pdxJ | ||
| 3345 | JAEMBP010000047.1 | GCA021406795_00692 | gene | open | 14689-15555 | nadK | ||
| 3346 | JAEMBP010000047.1 | GCA021406795_00693 | gene | open | 15632-16369 | lptB | ||
| 3347 | JAEMBP010000047.1 | GCA021406795_00694 | gene | open | 16624-16911 | rRM | ||
| 3348 | JAEMBP010000048.1 | GCA021406795_01648 | CDS | open | 115-1422 | _na 435_aa | IS5 family transposase | |
| 3349 | JAEMBP010000048.1 | GCA021406795_01649 | CDS | open | 1764-2966 | _na 400_aa | bepA | Tetratricopeptide repeat protein |
| 3350 | JAEMBP010000048.1 | GCA021406795_01650 | CDS | open | 3000-5579 | _na 859_aa | gyrA | DNA gyrase subunit A |
| 3351 | JAEMBP010000048.1 | GCA021406795_01651 | CDS | open | 5763-6659 | _na 298_aa | Chromosome segregation protein SMC | |
| 3352 | JAEMBP010000048.1 | GCA021406795_01652 | CDS | open | 6726-7436 | _na 236_aa | DUF3256 domain-containing protein | |
| 3353 | JAEMBP010000048.1 | GCA021406795_01653 | CDS | open | 7501-7959 | _na 152_aa | hupA | Histidinol phosphate aminotransferase |
| 3354 | JAEMBP010000048.1 | GCA021406795_01654 | CDS | open | 8512-9723 | _na 403_aa | Glycosyltransferase RgtA/B/C/D-like domain-containing protein | |
| 3355 | JAEMBP010000048.1 | GCA021406795_01655 | CDS | open | 9751-11208 | _na 485_aa | ftsW | Rod shape-determining protein RodA |
| 3356 | JAEMBP010000048.1 | GCA021406795_01656 | CDS | open | 11198-13063 | _na 621_aa | mrdA | penicillin-binding protein 2 |
| 3357 | JAEMBP010000048.1 | GCA021406795_01657 | CDS | open | 13056-13574 | _na 172_aa | mreD | rod shape-determining protein MreD |
| 3358 | JAEMBP010000048.1 | GCA021406795_01658 | CDS | open | 13574-14461 | _na 295_aa | mreC | rod shape-determining protein MreC |
| 3359 | JAEMBP010000048.1 | GCA021406795_01659 | CDS | open | 14499-15518 | _na 339_aa | mreB | Cell shape-determining protein MreB |
| 3360 | JAEMBP010000048.1 | GCA021406795_01660 | CDS | open | 15621-17138 | _na 505_aa | purH | bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase |
| 3361 | JAEMBP010000048.1 | GCA021406795_01648 | gene | open | 115-1422 | |||
| 3362 | JAEMBP010000048.1 | GCA021406795_01649 | gene | open | 1764-2966 | bepA | ||
| 3363 | JAEMBP010000048.1 | GCA021406795_01650 | gene | open | 3000-5579 | gyrA | ||
| 3364 | JAEMBP010000048.1 | GCA021406795_01651 | gene | open | 5763-6659 | |||
| 3365 | JAEMBP010000048.1 | GCA021406795_01652 | gene | open | 6726-7436 | |||
| 3366 | JAEMBP010000048.1 | GCA021406795_01653 | gene | open | 7501-7959 | hupA | ||
| 3367 | JAEMBP010000048.1 | GCA021406795_01654 | gene | open | 8512-9723 | |||
| 3368 | JAEMBP010000048.1 | GCA021406795_01655 | gene | open | 9751-11208 | ftsW | ||
| 3369 | JAEMBP010000048.1 | GCA021406795_01656 | gene | open | 11198-13063 | mrdA | ||
| 3370 | JAEMBP010000048.1 | GCA021406795_01657 | gene | open | 13056-13574 | mreD | ||
| 3371 | JAEMBP010000048.1 | GCA021406795_01658 | gene | open | 13574-14461 | mreC | ||
| 3372 | JAEMBP010000048.1 | GCA021406795_01659 | gene | open | 14499-15518 | mreB | ||
| 3373 | JAEMBP010000048.1 | GCA021406795_01660 | gene | open | 15621-17138 | purH | ||
| 3374 | JAEMBP010000049.1 | GCA021406795_01899 | CDS | open | 512-3097 | _na 861_aa | lacZ | beta-mannosidase |
| 3375 | JAEMBP010000049.1 | GCA021406795_01900 | CDS | open | 3127-4425 | _na 432_aa | hypothetical protein | |
| 3376 | JAEMBP010000049.1 | GCA021406795_01901 | CDS | open | 5120-5434 | _na 104_aa | trxA | thioredoxin |
| 3377 | JAEMBP010000049.1 | GCA021406795_01902 | CDS | open | 5483-9169 | _na 1228_aa | dnaE | DNA polymerase III subunit alpha |
| 3378 | JAEMBP010000049.1 | GCA021406795_01903 | CDS | open | 9448-9813 | _na 121_aa | rplS | 50S ribosomal protein L19 |
| 3379 | JAEMBP010000049.1 | GCA021406795_01904 | CDS | open | 11046-12326 | _na 426_aa | glyA | Serine hydroxymethyltransferase |
| 3380 | JAEMBP010000049.1 | GCA021406795_01905 | CDS | open | 12483-14816 | _na 777_aa | nahA | Beta-hexosaminidase |
| 3381 | JAEMBP010000049.1 | GCA021406795_01906 | CDS | open | 15484-17538 | _na 684_aa | htpG | molecular chaperone HtpG |
| 3382 | JAEMBP010000049.1 | GCA021406795_01899 | gene | open | 512-3097 | lacZ | ||
| 3383 | JAEMBP010000049.1 | GCA021406795_01900 | gene | open | 3127-4425 | |||
| 3384 | JAEMBP010000049.1 | GCA021406795_01901 | gene | open | 5120-5434 | trxA | ||
| 3385 | JAEMBP010000049.1 | GCA021406795_01902 | gene | open | 5483-9169 | dnaE | ||
| 3386 | JAEMBP010000049.1 | GCA021406795_01903 | gene | open | 9448-9813 | rplS | ||
| 3387 | JAEMBP010000049.1 | GCA021406795_01904 | gene | open | 11046-12326 | glyA | ||
| 3388 | JAEMBP010000049.1 | GCA021406795_01905 | gene | open | 12483-14816 | nahA | ||
| 3389 | JAEMBP010000049.1 | GCA021406795_01906 | gene | open | 15484-17538 | htpG | ||
| 3390 | JAEMBP010000050.1 | GCA021406795_00695 | CDS | open | 612-1010 | _na 132_aa | mobA | MobA protein |
| 3391 | JAEMBP010000050.1 | GCA021406795_00696 | CDS | open | 995-2224 | _na 409_aa | mobB | Conjugal transfer protein MobB |
| 3392 | JAEMBP010000050.1 | GCA021406795_00697 | CDS | open | 2240-4252 | _na 670_aa | virD4 | YWFCY domain-containing protein |
| 3393 | JAEMBP010000050.1 | GCA021406795_00698 | CDS | open | 4318-4761 | _na 147_aa | B box-type domain-containing protein | |
| 3394 | JAEMBP010000050.1 | GCA021406795_00699 | CDS | open | 4818-5063 | _na 81_aa | rteC | RteC domain-containing protein |
| 3395 | JAEMBP010000050.1 | GCA021406795_00700 | CDS | open | 5166-5420 | _na 84_aa | hypothetical protein | |
| 3396 | JAEMBP010000050.1 | GCA021406795_00701 | CDS | open | 5470-5964 | _na 164_aa | Polysaccharide chain length determinant N-terminal domain-containing protein | |
| 3397 | JAEMBP010000050.1 | GCA021406795_00702 | CDS | open | 5966-8149 | _na 727_aa | ABC transporter%2C ATP-binding protein | |
| 3398 | JAEMBP010000050.1 | GCA021406795_00703 | CDS | open | 8306-10591 | _na 761_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 3399 | JAEMBP010000050.1 | GCA021406795_00704 | CDS | open | 10588-11886 | _na 432_aa | Radical SAM domain protein | |
| 3400 | JAEMBP010000050.1 | GCA021406795_00705 | CDS | open | 11951-12145 | _na 64_aa | hypothetical protein | |
| 3401 | JAEMBP010000050.1 | GCA021406795_00706 | CDS | open | 12393-13550 | _na 385_aa | Putative 3-oxoacyl-(Acyl carrier protein) synthase III | |
| 3402 | JAEMBP010000050.1 | GCA021406795_00707 | CDS | open | 13563-14171 | _na 202_aa | tetR | TetR family transcriptional regulator |
| 3403 | JAEMBP010000050.1 | GCA021406795_00708 | CDS | open | 14394-15788 | _na 464_aa | DUF3945 domain-containing protein | |
| 3404 | JAEMBP010000050.1 | GCA021406795_00709 | CDS | open | 15799-16281 | _na 160_aa | hypothetical protein | |
| 3405 | JAEMBP010000050.1 | GCA021406795_00710 | CDS | open | 16672-16923 | _na 83_aa | hypothetical protein | |
| 3406 | JAEMBP010000050.1 | GCA021406795_00711 | CDS | open | 16980-17432 | _na 150_aa | hypothetical protein | |
| 3407 | JAEMBP010000050.1 | GCA021406795_00695 | gene | open | 612-1010 | mobA | ||
| 3408 | JAEMBP010000050.1 | GCA021406795_00696 | gene | open | 995-2224 | mobB | ||
| 3409 | JAEMBP010000050.1 | GCA021406795_00697 | gene | open | 2240-4252 | virD4 | ||
| 3410 | JAEMBP010000050.1 | GCA021406795_00698 | gene | open | 4318-4761 | |||
| 3411 | JAEMBP010000050.1 | GCA021406795_00699 | gene | open | 4818-5063 | rteC | ||
| 3412 | JAEMBP010000050.1 | GCA021406795_00700 | gene | open | 5166-5420 | |||
| 3413 | JAEMBP010000050.1 | GCA021406795_00701 | gene | open | 5470-5964 | |||
| 3414 | JAEMBP010000050.1 | GCA021406795_00702 | gene | open | 5966-8149 | |||
| 3415 | JAEMBP010000050.1 | GCA021406795_00703 | gene | open | 8306-10591 | |||
| 3416 | JAEMBP010000050.1 | GCA021406795_00704 | gene | open | 10588-11886 | |||
| 3417 | JAEMBP010000050.1 | GCA021406795_00705 | gene | open | 11951-12145 | |||
| 3418 | JAEMBP010000050.1 | GCA021406795_00706 | gene | open | 12393-13550 | |||
| 3419 | JAEMBP010000050.1 | GCA021406795_00707 | gene | open | 13563-14171 | tetR | ||
| 3420 | JAEMBP010000050.1 | GCA021406795_00708 | gene | open | 14394-15788 | |||
| 3421 | JAEMBP010000050.1 | GCA021406795_00709 | gene | open | 15799-16281 | |||
| 3422 | JAEMBP010000050.1 | GCA021406795_00710 | gene | open | 16672-16923 | |||
| 3423 | JAEMBP010000050.1 | GCA021406795_00711 | gene | open | 16980-17432 | |||
| 3424 | JAEMBP010000051.1 | GCA021406795_00528 | CDS | open | 121-546 | _na 141_aa | Partial transposase in ISPg1 | |
| 3425 | JAEMBP010000051.1 | GCA021406795_00529 | CDS | open | 983-1591 | _na 202_aa | ruvA | Holliday junction branch migration protein RuvA |
| 3426 | JAEMBP010000051.1 | GCA021406795_00530 | CDS | open | 1631-9130 | _na 2499_aa | sprA | cell surface protein SprA |
| 3427 | JAEMBP010000051.1 | GCA021406795_00531 | CDS | open | 9618-9818 | _na 66_aa | hypothetical protein | |
| 3428 | JAEMBP010000051.1 | GCA021406795_00532 | CDS | open | 9840-10886 | _na 348_aa | nusB | transcription antitermination factor NusB |
| 3429 | JAEMBP010000051.1 | GCA021406795_00533 | CDS | open | 10924-11829 | _na 301_aa | aspD | diaminopimelate dehydrogenase |
| 3430 | JAEMBP010000051.1 | GCA021406795_00534 | CDS | open | 11866-12717 | _na 283_aa | lgt | prolipoprotein diacylglyceryl transferase |
| 3431 | JAEMBP010000051.1 | GCA021406795_00535 | CDS | open | 12748-13959 | _na 403_aa | norV | Flavodoxin |
| 3432 | JAEMBP010000051.1 | GCA021406795_00536 | CDS | open | 13998-14789 | _na 263_aa | nagB | glucosamine-6-phosphate deaminase |
| 3433 | JAEMBP010000051.1 | GCA021406795_00537 | CDS | open | 14794-16143 | _na 449_aa | lpdA | dihydrolipoyl dehydrogenase |
| 3434 | JAEMBP010000051.1 | GCA021406795_00528 | gene | open | 121-546 | |||
| 3435 | JAEMBP010000051.1 | GCA021406795_00529 | gene | open | 983-1591 | ruvA | ||
| 3436 | JAEMBP010000051.1 | GCA021406795_00530 | gene | open | 1631-9130 | sprA | ||
| 3437 | JAEMBP010000051.1 | GCA021406795_00531 | gene | open | 9618-9818 | |||
| 3438 | JAEMBP010000051.1 | GCA021406795_00532 | gene | open | 9840-10886 | nusB | ||
| 3439 | JAEMBP010000051.1 | GCA021406795_00533 | gene | open | 10924-11829 | aspD | ||
| 3440 | JAEMBP010000051.1 | GCA021406795_00534 | gene | open | 11866-12717 | lgt | ||
| 3441 | JAEMBP010000051.1 | GCA021406795_00535 | gene | open | 12748-13959 | norV | ||
| 3442 | JAEMBP010000051.1 | GCA021406795_00536 | gene | open | 13998-14789 | nagB | ||
| 3443 | JAEMBP010000051.1 | GCA021406795_00537 | gene | open | 14794-16143 | lpdA | ||
| 3444 | JAEMBP010000052.1 | GCA021406795_00169 | CDS | open | 296-1090 | _na 264_aa | pgaB | NodB-like y domain-containing protein |
| 3445 | JAEMBP010000052.1 | GCA021406795_00170 | CDS | open | 1078-1788 | _na 236_aa | wcaA | Glycosyltransferase 2-like domain-containing protein |
| 3446 | JAEMBP010000052.1 | GCA021406795_00171 | CDS | open | 1775-2962 | _na 395_aa | DUF2029 domain-containing protein | |
| 3447 | JAEMBP010000052.1 | GCA021406795_00172 | CDS | open | 3004-3633 | _na 209_aa | udk | uridine kinase |
| 3448 | JAEMBP010000052.1 | GCA021406795_00173 | CDS | open | 3682-4869 | _na 395_aa | spt | serine palmitoyltransferase |
| 3449 | JAEMBP010000052.1 | GCA021406795_00174 | CDS | open | 5235-5729 | _na 164_aa | ymdB | O-acetyl-ADP-ribose deacetylase |
| 3450 | JAEMBP010000052.1 | GCA021406795_00175 | CDS | open | 5811-6599 | _na 262_aa | lpxH | UDP-2%2C3-diacylglucosamine hydrolase |
| 3451 | JAEMBP010000052.1 | GCA021406795_00176 | CDS | open | 6628-6945 | _na 105_aa | paaD | Fe-S protein maturation auxiliary factor PG_1777 |
| 3452 | JAEMBP010000052.1 | GCA021406795_00177 | CDS | open | 7031-8182 | _na 383_aa | dnaJ | molecular chaperone DnaJ |
| 3453 | JAEMBP010000052.1 | GCA021406795_00178 | CDS | open | 8225-8809 | _na 194_aa | grpE | Protein GrpE |
| 3454 | JAEMBP010000052.1 | GCA021406795_00179 | CDS | open | 9156-12524 | _na 1122_aa | mfd | transcription-repair coupling factor |
| 3455 | JAEMBP010000052.1 | GCA021406795_00180 | CDS | open | 12501-13838 | _na 445_aa | lpxE | Lipid A 1-phosphatase |
| 3456 | JAEMBP010000052.1 | GCA021406795_00181 | CDS | open | 13900-14574 | _na 224_aa | nth | endonuclease III |
| 3457 | JAEMBP010000052.1 | GCA021406795_00182 | CDS | open | 14593-15615 | _na 340_aa | pheS | phenylalanine--tRNA ligase subunit alpha |
| 3458 | JAEMBP010000052.1 | GCA021406795_00183 | CDS | open | 15737-16333 | _na 198_aa | Lipoprotein | |
| 3459 | JAEMBP010000052.1 | GCA021406795_00169 | gene | open | 296-1090 | pgaB | ||
| 3460 | JAEMBP010000052.1 | GCA021406795_00170 | gene | open | 1078-1788 | wcaA | ||
| 3461 | JAEMBP010000052.1 | GCA021406795_00171 | gene | open | 1775-2962 | |||
| 3462 | JAEMBP010000052.1 | GCA021406795_00172 | gene | open | 3004-3633 | udk | ||
| 3463 | JAEMBP010000052.1 | GCA021406795_00173 | gene | open | 3682-4869 | spt | ||
| 3464 | JAEMBP010000052.1 | GCA021406795_00174 | gene | open | 5235-5729 | ymdB | ||
| 3465 | JAEMBP010000052.1 | GCA021406795_00175 | gene | open | 5811-6599 | lpxH | ||
| 3466 | JAEMBP010000052.1 | GCA021406795_00176 | gene | open | 6628-6945 | paaD | ||
| 3467 | JAEMBP010000052.1 | GCA021406795_00177 | gene | open | 7031-8182 | dnaJ | ||
| 3468 | JAEMBP010000052.1 | GCA021406795_00178 | gene | open | 8225-8809 | grpE | ||
| 3469 | JAEMBP010000052.1 | GCA021406795_00179 | gene | open | 9156-12524 | mfd | ||
| 3470 | JAEMBP010000052.1 | GCA021406795_00180 | gene | open | 12501-13838 | lpxE | ||
| 3471 | JAEMBP010000052.1 | GCA021406795_00181 | gene | open | 13900-14574 | nth | ||
| 3472 | JAEMBP010000052.1 | GCA021406795_00182 | gene | open | 14593-15615 | pheS | ||
| 3473 | JAEMBP010000052.1 | GCA021406795_00183 | gene | open | 15737-16333 | |||
| 3474 | JAEMBP010000053.1 | GCA021406795_00418 | CDS | open | 903-1250 | _na 115_aa | rplT | 50S ribosomal protein L20 |
| 3475 | JAEMBP010000053.1 | GCA021406795_00419 | CDS | open | 1363-1560 | _na 65_aa | rpmI | 50S ribosomal protein L35 |
| 3476 | JAEMBP010000053.1 | GCA021406795_00420 | CDS | open | 1638-2243 | _na 201_aa | infC | translation initiation factor IF-3 |
| 3477 | JAEMBP010000053.1 | GCA021406795_00421 | CDS | open | 2348-4309 | _na 653_aa | thrS | threonine--tRNA ligase |
| 3478 | JAEMBP010000053.1 | GCA021406795_00422 | CDS | open | 4690-5070 | _na 126_aa | transposase family protein | |
| 3479 | JAEMBP010000053.1 | GCA021406795_00423 | CDS | open | 5679-5795 | _na 38_aa | hypothetical protein | |
| 3480 | JAEMBP010000053.1 | GCA021406795_00424 | CDS | open | 5852-6760 | _na 302_aa | yfcH | TIGR01777 family protein |
| 3481 | JAEMBP010000053.1 | GCA021406795_00425 | CDS | open | 6920-7186 | _na 88_aa | HTH cro/C1-type domain-containing protein | |
| 3482 | JAEMBP010000053.1 | GCA021406795_00426 | CDS | open | 7304-7825 | _na 173_aa | HXXEE domain-containing protein | |
| 3483 | JAEMBP010000053.1 | GCA021406795_00427 | CDS | open | 7848-8480 | _na 210_aa | alkC | DNA alkylation repair enzyme |
| 3484 | JAEMBP010000053.1 | GCA021406795_00428 | CDS | open | 8484-9020 | _na 178_aa | dfsB | ClbS/DfsB family four-helix bundle protein |
| 3485 | JAEMBP010000053.1 | GCA021406795_00429 | CDS | open | 8952-9491 | _na 179_aa | hypothetical protein | |
| 3486 | JAEMBP010000053.1 | GCA021406795_00430 | CDS | open | 9508-10500 | _na 330_aa | Nitroreductase domain-containing protein | |
| 3487 | JAEMBP010000053.1 | GCA021406795_00431 | CDS | open | 10659-12938 | _na 759_aa | dAP2 | Prolyl oligopeptidase family protein |
| 3488 | JAEMBP010000053.1 | GCA021406795_00432 | CDS | open | 13244-13984 | _na 246_aa | Putative auto-transporter adhesin head GIN domain-containing protein | |
| 3489 | JAEMBP010000053.1 | GCA021406795_00433 | CDS | open | 14015-16465 | _na 816_aa | cirA | TonB-dependent receptor |
| 3490 | JAEMBP010000053.1 | GCA021406795_00418 | gene | open | 903-1250 | rplT | ||
| 3491 | JAEMBP010000053.1 | GCA021406795_00419 | gene | open | 1363-1560 | rpmI | ||
| 3492 | JAEMBP010000053.1 | GCA021406795_00420 | gene | open | 1638-2243 | infC | ||
| 3493 | JAEMBP010000053.1 | GCA021406795_00421 | gene | open | 2348-4309 | thrS | ||
| 3494 | JAEMBP010000053.1 | GCA021406795_00422 | gene | open | 4690-5070 | |||
| 3495 | JAEMBP010000053.1 | GCA021406795_00423 | gene | open | 5679-5795 | |||
| 3496 | JAEMBP010000053.1 | GCA021406795_00424 | gene | open | 5852-6760 | yfcH | ||
| 3497 | JAEMBP010000053.1 | GCA021406795_00425 | gene | open | 6920-7186 | |||
| 3498 | JAEMBP010000053.1 | GCA021406795_00426 | gene | open | 7304-7825 | |||
| 3499 | JAEMBP010000053.1 | GCA021406795_00427 | gene | open | 7848-8480 | alkC | ||
| 3500 | JAEMBP010000053.1 | GCA021406795_00428 | gene | open | 8484-9020 | dfsB |

