BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_021406795.1)
Select a Genome:
|
BAKTA Annotations for GCA_021406795.1
|
Search & Sort all 4358 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 4001 | JAEMBP010000075.1 | GCA021406795_00717 | CDS | open | 6835-7044 | _na 69_aa | Trasnmembrane protein found in conjugate transposon | |
| 4002 | JAEMBP010000075.1 | GCA021406795_00718 | CDS | open | 7057-7275 | _na 72_aa | Transposase | |
| 4003 | JAEMBP010000075.1 | GCA021406795_00719 | CDS | open | 7287-7583 | _na 98_aa | Intein | |
| 4004 | JAEMBP010000075.1 | GCA021406795_00720 | CDS | open | 7580-7951 | _na 123_aa | DUF4942 domain-containing protein | |
| 4005 | JAEMBP010000075.1 | GCA021406795_00712 | gene | open | 282-743 | |||
| 4006 | JAEMBP010000075.1 | GCA021406795_00713 | gene | open | 743-1759 | murB | ||
| 4007 | JAEMBP010000075.1 | GCA021406795_00714 | gene | open | 1786-3264 | lipB | ||
| 4008 | JAEMBP010000075.1 | GCA021406795_00715 | gene | open | 3749-4870 | rfaB | ||
| 4009 | JAEMBP010000075.1 | GCA021406795_00716 | gene | open | 4867-6138 | rfaB | ||
| 4010 | JAEMBP010000075.1 | GCA021406795_00717 | gene | open | 6835-7044 | |||
| 4011 | JAEMBP010000075.1 | GCA021406795_00718 | gene | open | 7057-7275 | |||
| 4012 | JAEMBP010000075.1 | GCA021406795_00719 | gene | open | 7287-7583 | |||
| 4013 | JAEMBP010000075.1 | GCA021406795_00720 | gene | open | 7580-7951 | |||
| 4014 | JAEMBP010000076.1 | GCA021406795_00765 | CDS | open | 204-734 | _na 176_aa | Antirestriction protein | |
| 4015 | JAEMBP010000076.1 | GCA021406795_00766 | CDS | open | 751-2025 | _na 424_aa | PcfJ-like protein | |
| 4016 | JAEMBP010000076.1 | GCA021406795_00767 | CDS | open | 2052-2306 | _na 84_aa | hypothetical protein | |
| 4017 | JAEMBP010000076.1 | GCA021406795_00768 | CDS | open | 2311-2541 | _na 76_aa | Helicase | |
| 4018 | JAEMBP010000076.1 | GCA021406795_00769 | CDS | open | 2684-4123 | _na 479_aa | Caspase domain protein | |
| 4019 | JAEMBP010000076.1 | GCA021406795_00770 | CDS | open | 4120-4998 | _na 292_aa | HEPN domain-containing protein | |
| 4020 | JAEMBP010000076.1 | GCA021406795_00771 | CDS | open | 5114-5623 | _na 169_aa | Lysozyme | |
| 4021 | JAEMBP010000076.1 | GCA021406795_00772 | CDS | open | 5607-6068 | _na 153_aa | DUF3872 domain-containing protein | |
| 4022 | JAEMBP010000076.1 | GCA021406795_00773 | CDS | open | 6089-6943 | _na 284_aa | Zinc finger CHC2-type domain-containing protein | |
| 4023 | JAEMBP010000076.1 | GCA021406795_00774 | CDS | open | 6943-7527 | _na 194_aa | traO | Conjugative transposon protein TraO |
| 4024 | JAEMBP010000076.1 | GCA021406795_00775 | CDS | open | 7529-7930 | _na 133_aa | traN | Conjugative transposon TraN protein |
| 4025 | JAEMBP010000076.1 | GCA021406795_00765 | gene | open | 204-734 | |||
| 4026 | JAEMBP010000076.1 | GCA021406795_00766 | gene | open | 751-2025 | |||
| 4027 | JAEMBP010000076.1 | GCA021406795_00767 | gene | open | 2052-2306 | |||
| 4028 | JAEMBP010000076.1 | GCA021406795_00768 | gene | open | 2311-2541 | |||
| 4029 | JAEMBP010000076.1 | GCA021406795_00769 | gene | open | 2684-4123 | |||
| 4030 | JAEMBP010000076.1 | GCA021406795_00770 | gene | open | 4120-4998 | |||
| 4031 | JAEMBP010000076.1 | GCA021406795_00771 | gene | open | 5114-5623 | |||
| 4032 | JAEMBP010000076.1 | GCA021406795_00772 | gene | open | 5607-6068 | |||
| 4033 | JAEMBP010000076.1 | GCA021406795_00773 | gene | open | 6089-6943 | |||
| 4034 | JAEMBP010000076.1 | GCA021406795_00774 | gene | open | 6943-7527 | traO | ||
| 4035 | JAEMBP010000076.1 | GCA021406795_00775 | gene | open | 7529-7930 | traN | ||
| 4036 | JAEMBP010000077.1 | GCA021406795_01907 | CDS | open | 404-1951 | _na 515_aa | DUF4301 domain-containing protein | |
| 4037 | JAEMBP010000077.1 | GCA021406795_01908 | CDS | open | 2000-3787 | _na 595_aa | pepP | Peptidase%2C M24 family |
| 4038 | JAEMBP010000077.1 | GCA021406795_01909 | CDS | open | 3796-4335 | _na 179_aa | paaY | Putative acetyltransferase |
| 4039 | JAEMBP010000077.1 | GCA021406795_01910 | CDS | open | 4348-5361 | _na 337_aa | tPR | TPR domain protein |
| 4040 | JAEMBP010000077.1 | GCA021406795_01911 | CDS | open | 5389-6039 | _na 216_aa | rnh1 | Ribonuclease H |
| 4041 | JAEMBP010000077.1 | GCA021406795_01912 | CDS | open | 5988-7226 | _na 412_aa | ATP-grasp domain-containing protein | |
| 4042 | JAEMBP010000077.1 | GCA021406795_01907 | gene | open | 404-1951 | |||
| 4043 | JAEMBP010000077.1 | GCA021406795_01908 | gene | open | 2000-3787 | pepP | ||
| 4044 | JAEMBP010000077.1 | GCA021406795_01909 | gene | open | 3796-4335 | paaY | ||
| 4045 | JAEMBP010000077.1 | GCA021406795_01910 | gene | open | 4348-5361 | tPR | ||
| 4046 | JAEMBP010000077.1 | GCA021406795_01911 | gene | open | 5389-6039 | rnh1 | ||
| 4047 | JAEMBP010000077.1 | GCA021406795_01912 | gene | open | 5988-7226 | |||
| 4048 | JAEMBP010000078.1 | GCA021406795_01733 | CDS | open | 1152-1394 | _na 80_aa | hypothetical protein | |
| 4049 | JAEMBP010000078.1 | GCA021406795_01734 | CDS | open | 2121-2741 | _na 206_aa | hypothetical protein | |
| 4050 | JAEMBP010000078.1 | GCA021406795_01735 | CDS | open | 3215-3325 | _na 36_aa | hypothetical protein | |
| 4051 | JAEMBP010000078.1 | GCA021406795_01736 | CDS | open | 4598-4735 | _na 45_aa | hypothetical protein | |
| 4052 | JAEMBP010000078.1 | GCA021406795_01737 | CDS | open | 5130-5432 | _na 100_aa | hypothetical protein | |
| 4053 | JAEMBP010000078.1 | GCA021406795_01738 | CDS | open | 5448-5870 | _na 140_aa | hypothetical protein | |
| 4054 | JAEMBP010000078.1 | GCA021406795_01739 | CDS | open | 6130-7236 | _na 368_aa | hypothetical protein | |
| 4055 | JAEMBP010000078.1 | GCA021406795_01733 | gene | open | 1152-1394 | |||
| 4056 | JAEMBP010000078.1 | GCA021406795_01734 | gene | open | 2121-2741 | |||
| 4057 | JAEMBP010000078.1 | GCA021406795_01735 | gene | open | 3215-3325 | |||
| 4058 | JAEMBP010000078.1 | GCA021406795_01736 | gene | open | 4598-4735 | |||
| 4059 | JAEMBP010000078.1 | GCA021406795_01737 | gene | open | 5130-5432 | |||
| 4060 | JAEMBP010000078.1 | GCA021406795_01738 | gene | open | 5448-5870 | |||
| 4061 | JAEMBP010000078.1 | GCA021406795_01739 | gene | open | 6130-7236 | |||
| 4062 | JAEMBP010000079.1 | GCA021406795_01853 | CDS | open | 102-644 | _na 180_aa | vapE | VapE domain-containing protein |
| 4063 | JAEMBP010000079.1 | GCA021406795_01854 | CDS | open | 671-1027 | _na 118_aa | alpA | Helix-turn-helix domain-containing protein |
| 4064 | JAEMBP010000079.1 | GCA021406795_01855 | CDS | open | 1326-2000 | _na 224_aa | sduA | Shedu protein SduA C-terminal domain-containing protein |
| 4065 | JAEMBP010000079.1 | GCA021406795_01856 | CDS | open | 2000-2134 | _na 44_aa | hypothetical protein | |
| 4066 | JAEMBP010000079.1 | GCA021406795_01857 | CDS | open | 2154-2582 | _na 142_aa | tnpC | Mobilizable transposon%2C TnpC family protein |
| 4067 | JAEMBP010000079.1 | GCA021406795_01858 | CDS | open | 2564-2860 | _na 98_aa | hypothetical protein | |
| 4068 | JAEMBP010000079.1 | GCA021406795_01859 | CDS | open | 2881-3813 | _na 310_aa | Site-specific recombinase%2C phage integrase family | |
| 4069 | JAEMBP010000079.1 | GCA021406795_01860 | CDS | open | 3826-4143 | _na 105_aa | xerD | Tyrosine recombinase XerD |
| 4070 | JAEMBP010000079.1 | GCA021406795_01861 | CDS | open | 4156-4710 | _na 184_aa | ORF5 | |
| 4071 | JAEMBP010000079.1 | GCA021406795_01862 | CDS | open | 4921-6843 | _na 640_aa | dnaK | molecular chaperone DnaK |
| 4072 | JAEMBP010000079.1 | GCA021406795_01853 | gene | open | 102-644 | vapE | ||
| 4073 | JAEMBP010000079.1 | GCA021406795_01854 | gene | open | 671-1027 | alpA | ||
| 4074 | JAEMBP010000079.1 | GCA021406795_01855 | gene | open | 1326-2000 | sduA | ||
| 4075 | JAEMBP010000079.1 | GCA021406795_01856 | gene | open | 2000-2134 | |||
| 4076 | JAEMBP010000079.1 | GCA021406795_01857 | gene | open | 2154-2582 | tnpC | ||
| 4077 | JAEMBP010000079.1 | GCA021406795_01858 | gene | open | 2564-2860 | |||
| 4078 | JAEMBP010000079.1 | GCA021406795_01859 | gene | open | 2881-3813 | |||
| 4079 | JAEMBP010000079.1 | GCA021406795_01860 | gene | open | 3826-4143 | xerD | ||
| 4080 | JAEMBP010000079.1 | GCA021406795_01861 | gene | open | 4156-4710 | |||
| 4081 | JAEMBP010000079.1 | GCA021406795_01862 | gene | open | 4921-6843 | dnaK | ||
| 4082 | JAEMBP010000080.1 | GCA021406795_01893 | CDS | open | 202-345 | _na 47_aa | hypothetical protein | |
| 4083 | JAEMBP010000080.1 | GCA021406795_01894 | CDS | open | 370-1425 | _na 351_aa | Glycosyltransferase%2C group 1 family protein | |
| 4084 | JAEMBP010000080.1 | GCA021406795_01895 | CDS | open | 1435-2640 | _na 401_aa | epsG | EpsG family protein |
| 4085 | JAEMBP010000080.1 | GCA021406795_01896 | CDS | open | 2610-3596 | _na 328_aa | Glycosyltransferase 2-like domain-containing protein | |
| 4086 | JAEMBP010000080.1 | GCA021406795_01897 | CDS | open | 3882-5072 | _na 396_aa | wecC | UDP-N-acetyl-D-mannosamine dehydrogenase |
| 4087 | JAEMBP010000080.1 | GCA021406795_01898 | CDS | open | 5334-6410 | _na 358_aa | Glycosyl transferase group 4 family protein | |
| 4088 | JAEMBP010000080.1 | GCA021406795_01893 | gene | open | 202-345 | |||
| 4089 | JAEMBP010000080.1 | GCA021406795_01894 | gene | open | 370-1425 | |||
| 4090 | JAEMBP010000080.1 | GCA021406795_01895 | gene | open | 1435-2640 | epsG | ||
| 4091 | JAEMBP010000080.1 | GCA021406795_01896 | gene | open | 2610-3596 | |||
| 4092 | JAEMBP010000080.1 | GCA021406795_01897 | gene | open | 3882-5072 | wecC | ||
| 4093 | JAEMBP010000080.1 | GCA021406795_01898 | gene | open | 5334-6410 | |||
| 4094 | JAEMBP010000081.1 | GCA021406795_00776 | CDS | open | 695-1261 | _na 188_aa | rpoE | RNA polymerase sigma factor |
| 4095 | JAEMBP010000081.1 | GCA021406795_00777 | CDS | open | 1309-1719 | _na 136_aa | hypothetical protein | |
| 4096 | JAEMBP010000081.1 | GCA021406795_00778 | CDS | open | 1692-2222 | _na 176_aa | Periplasmic heavy metal sensor | |
| 4097 | JAEMBP010000081.1 | GCA021406795_00779 | CDS | open | 2297-2845 | _na 182_aa | slpA | Peptidyl-prolyl cis-trans isomerase |
| 4098 | JAEMBP010000081.1 | GCA021406795_00780 | CDS | open | 2995-4101 | _na 368_aa | aroC | chorismate synthase |
| 4099 | JAEMBP010000081.1 | GCA021406795_00782 | CDS | open | 4473-6131 | _na 552_aa | pepD | Dipeptidase |
| 4100 | JAEMBP010000081.1 | GCA021406795_00776 | gene | open | 695-1261 | rpoE | ||
| 4101 | JAEMBP010000081.1 | GCA021406795_00777 | gene | open | 1309-1719 | |||
| 4102 | JAEMBP010000081.1 | GCA021406795_00778 | gene | open | 1692-2222 | |||
| 4103 | JAEMBP010000081.1 | GCA021406795_00779 | gene | open | 2297-2845 | slpA | ||
| 4104 | JAEMBP010000081.1 | GCA021406795_00780 | gene | open | 2995-4101 | aroC | ||
| 4105 | JAEMBP010000081.1 | GCA021406795_00782 | gene | open | 4473-6131 | pepD | ||
| 4106 | JAEMBP010000081.1 | GCA021406795_00781 | gene | open | 4326-4400 | trnR | ||
| 4107 | JAEMBP010000081.1 | GCA021406795_00781 | tRNA | open | 4326-4400 | trnR | tRNA-Arg(cct) | |
| 4108 | JAEMBP010000082.1 | GCA021406795_01790 | CDS | open | 983-1345 | _na 120_aa | hypothetical protein | |
| 4109 | JAEMBP010000082.1 | GCA021406795_01791 | CDS | open | 1407-1931 | _na 174_aa | hypothetical protein | |
| 4110 | JAEMBP010000082.1 | GCA021406795_01792 | CDS | open | 2131-3363 | _na 410_aa | nupG | Nucleoside permease NupG |
| 4111 | JAEMBP010000082.1 | GCA021406795_01793 | CDS | open | 3469-4803 | _na 444_aa | DUF4270 domain-containing protein | |
| 4112 | JAEMBP010000082.1 | GCA021406795_01794 | CDS | open | 4939-5754 | _na 271_aa | glgA | starch synthase |
| 4113 | JAEMBP010000082.1 | GCA021406795_01795 | CDS | open | 6297-6698 | _na 133_aa | integrase core domain-containing protein | |
| 4114 | JAEMBP010000082.1 | GCA021406795_01790 | gene | open | 983-1345 | |||
| 4115 | JAEMBP010000082.1 | GCA021406795_01791 | gene | open | 1407-1931 | |||
| 4116 | JAEMBP010000082.1 | GCA021406795_01792 | gene | open | 2131-3363 | nupG | ||
| 4117 | JAEMBP010000082.1 | GCA021406795_01793 | gene | open | 3469-4803 | |||
| 4118 | JAEMBP010000082.1 | GCA021406795_01794 | gene | open | 4939-5754 | glgA | ||
| 4119 | JAEMBP010000082.1 | GCA021406795_01795 | gene | open | 6297-6698 | |||
| 4120 | JAEMBP010000083.1 | GCA021406795_01079 | CDS | open | 604-765 | _na 53_aa | hypothetical protein | |
| 4121 | JAEMBP010000083.1 | GCA021406795_01080 | CDS | open | 871-2670 | _na 599_aa | rpsA | 30S ribosomal protein S1 |
| 4122 | JAEMBP010000083.1 | GCA021406795_01081 | CDS | open | 3266-3721 | _na 151_aa | Bacterial Pleckstrin-like y domain-containing protein | |
| 4123 | JAEMBP010000083.1 | GCA021406795_01082 | CDS | open | 3729-3914 | _na 61_aa | FeoB-associated Cys-rich membrane protein | |
| 4124 | JAEMBP010000083.1 | GCA021406795_01083 | CDS | open | 3934-6468 | _na 844_aa | feoB | ferrous iron transport protein B |
| 4125 | JAEMBP010000083.1 | GCA021406795_01079 | gene | open | 604-765 | |||
| 4126 | JAEMBP010000083.1 | GCA021406795_01080 | gene | open | 871-2670 | rpsA | ||
| 4127 | JAEMBP010000083.1 | GCA021406795_01081 | gene | open | 3266-3721 | |||
| 4128 | JAEMBP010000083.1 | GCA021406795_01082 | gene | open | 3729-3914 | |||
| 4129 | JAEMBP010000083.1 | GCA021406795_01083 | gene | open | 3934-6468 | feoB | ||
| 4130 | JAEMBP010000084.1 | GCA021406795_01993 | CDS | open | 35-211 | _na 58_aa | hypothetical protein | |
| 4131 | JAEMBP010000084.1 | GCA021406795_01994 | CDS | open | 357-1556 | _na 399_aa | lipid A deacylase | |
| 4132 | JAEMBP010000084.1 | GCA021406795_01995 | CDS | open | 1553-2533 | _na 326_aa | hflC | Band 7/Mec-2 family protein |
| 4133 | JAEMBP010000084.1 | GCA021406795_01996 | CDS | open | 2561-3025 | _na 154_aa | ybbJ | Membrane protein%2C putative |
| 4134 | JAEMBP010000084.1 | GCA021406795_01997 | CDS | open | 3509-3682 | _na 57_aa | hypothetical protein | |
| 4135 | JAEMBP010000084.1 | GCA021406795_01998 | CDS | open | 3746-3931 | _na 61_aa | hypothetical protein | |
| 4136 | JAEMBP010000084.1 | GCA021406795_01999 | CDS | open | 3995-4420 | _na 141_aa | lexA | Translesion error-prone DNA polymerase V autoproteolytic subunit |
| 4137 | JAEMBP010000084.1 | GCA021406795_02000 | CDS | open | 4428-5726 | _na 432_aa | dinP | UmuC protein |
| 4138 | JAEMBP010000084.1 | GCA021406795_01993 | gene | open | 35-211 | |||
| 4139 | JAEMBP010000084.1 | GCA021406795_01994 | gene | open | 357-1556 | |||
| 4140 | JAEMBP010000084.1 | GCA021406795_01995 | gene | open | 1553-2533 | hflC | ||
| 4141 | JAEMBP010000084.1 | GCA021406795_01996 | gene | open | 2561-3025 | ybbJ | ||
| 4142 | JAEMBP010000084.1 | GCA021406795_01997 | gene | open | 3509-3682 | |||
| 4143 | JAEMBP010000084.1 | GCA021406795_01998 | gene | open | 3746-3931 | |||
| 4144 | JAEMBP010000084.1 | GCA021406795_01999 | gene | open | 3995-4420 | lexA | ||
| 4145 | JAEMBP010000084.1 | GCA021406795_02000 | gene | open | 4428-5726 | dinP | ||
| 4146 | JAEMBP010000085.1 | GCA021406795_01074 | CDS | open | 259-1890 | _na 543_aa | pruA | L-glutamate gamma-semialdehyde dehydrogenase |
| 4147 | JAEMBP010000085.1 | GCA021406795_01075 | CDS | open | 1967-2896 | _na 309_aa | ctlX | citrulline utilization hydrolase CtlX |
| 4148 | JAEMBP010000085.1 | GCA021406795_01076 | CDS | open | 2903-4132 | _na 409_aa | rocD | ornithine--oxo-acid transaminase |
| 4149 | JAEMBP010000085.1 | GCA021406795_01077 | CDS | open | 4582-5148 | _na 188_aa | efp | elongation factor P |
| 4150 | JAEMBP010000085.1 | GCA021406795_01074 | gene | open | 259-1890 | pruA | ||
| 4151 | JAEMBP010000085.1 | GCA021406795_01075 | gene | open | 1967-2896 | ctlX | ||
| 4152 | JAEMBP010000085.1 | GCA021406795_01076 | gene | open | 2903-4132 | rocD | ||
| 4153 | JAEMBP010000085.1 | GCA021406795_01077 | gene | open | 4582-5148 | efp | ||
| 4154 | JAEMBP010000086.1 | GCA021406795_01754 | CDS | open | 372-1148 | _na 258_aa | hypothetical protein | |
| 4155 | JAEMBP010000086.1 | GCA021406795_01755 | CDS | open | 1335-1676 | _na 113_aa | hypothetical protein | |
| 4156 | JAEMBP010000086.1 | GCA021406795_01756 | CDS | open | 1848-2465 | _na 205_aa | hypothetical protein | |
| 4157 | JAEMBP010000086.1 | GCA021406795_01757 | CDS | open | 2682-2849 | _na 55_aa | hypothetical protein | |
| 4158 | JAEMBP010000086.1 | GCA021406795_01758 | CDS | open | 3114-4133 | _na 339_aa | eis | GNAT family N-acetyltransferase |
| 4159 | JAEMBP010000086.1 | GCA021406795_01759 | CDS | open | 4114-5043 | _na 309_aa | Phosphatidylglycerol lysyltransferase C-terminal domain-containing protein | |
| 4160 | JAEMBP010000086.1 | GCA021406795_01760 | CDS | open | 5649-5879 | _na 76_aa | hypothetical protein | |
| 4161 | JAEMBP010000086.1 | GCA021406795_01754 | gene | open | 372-1148 | |||
| 4162 | JAEMBP010000086.1 | GCA021406795_01755 | gene | open | 1335-1676 | |||
| 4163 | JAEMBP010000086.1 | GCA021406795_01756 | gene | open | 1848-2465 | |||
| 4164 | JAEMBP010000086.1 | GCA021406795_01757 | gene | open | 2682-2849 | |||
| 4165 | JAEMBP010000086.1 | GCA021406795_01758 | gene | open | 3114-4133 | eis | ||
| 4166 | JAEMBP010000086.1 | GCA021406795_01759 | gene | open | 4114-5043 | |||
| 4167 | JAEMBP010000086.1 | GCA021406795_01760 | gene | open | 5649-5879 | |||
| 4168 | JAEMBP010000087.1 | GCA021406795_01922 | CDS | open | 394-927 | _na 177_aa | phoE | phosphoglycerate mutase (2%2C3-diphosphoglycerate-dependent) |
| 4169 | JAEMBP010000087.1 | GCA021406795_01923 | CDS | open | 956-1480 | _na 174_aa | hypothetical protein | |
| 4170 | JAEMBP010000087.1 | GCA021406795_01924 | CDS | open | 1489-1998 | _na 169_aa | ybaK | Cys-tRNA(Pro) deacylase |
| 4171 | JAEMBP010000087.1 | GCA021406795_01925 | CDS | open | 2032-4584 | _na 850_aa | DUF5117 domain-containing protein | |
| 4172 | JAEMBP010000087.1 | GCA021406795_01922 | gene | open | 394-927 | phoE | ||
| 4173 | JAEMBP010000087.1 | GCA021406795_01923 | gene | open | 956-1480 | |||
| 4174 | JAEMBP010000087.1 | GCA021406795_01924 | gene | open | 1489-1998 | ybaK | ||
| 4175 | JAEMBP010000087.1 | GCA021406795_01925 | gene | open | 2032-4584 | |||
| 4176 | JAEMBP010000088.1 | GCA021406795_01914 | CDS | open | 170-2782 | _na 870_aa | Leucine Rich repeat-containing domain protein | |
| 4177 | JAEMBP010000088.1 | GCA021406795_01915 | CDS | open | 2775-3221 | _na 148_aa | SMODS and SLOG-associating 2TM effector domain-containing protein | |
| 4178 | JAEMBP010000088.1 | GCA021406795_01916 | CDS | open | 3234-3404 | _na 56_aa | Glycerate kinase | |
| 4179 | JAEMBP010000088.1 | GCA021406795_01917 | CDS | open | 3533-4717 | _na 394_aa | AAA family ATPase | |
| 4180 | JAEMBP010000088.1 | GCA021406795_01914 | gene | open | 170-2782 | |||
| 4181 | JAEMBP010000088.1 | GCA021406795_01915 | gene | open | 2775-3221 | |||
| 4182 | JAEMBP010000088.1 | GCA021406795_01916 | gene | open | 3234-3404 | |||
| 4183 | JAEMBP010000088.1 | GCA021406795_01917 | gene | open | 3533-4717 | |||
| 4184 | JAEMBP010000089.1 | GCA021406795_00521 | CDS | open | 189-1040 | _na 283_aa | hypothetical protein | |
| 4185 | JAEMBP010000089.1 | GCA021406795_00522 | CDS | open | 1024-1611 | _na 195_aa | hypothetical protein | |
| 4186 | JAEMBP010000089.1 | GCA021406795_00523 | CDS | open | 2315-2524 | _na 69_aa | Trasnmembrane protein found in conjugate transposon | |
| 4187 | JAEMBP010000089.1 | GCA021406795_00524 | CDS | open | 2537-2755 | _na 72_aa | Transposase | |
| 4188 | JAEMBP010000089.1 | GCA021406795_00525 | CDS | open | 2768-3184 | _na 138_aa | PcfK-like protein | |
| 4189 | JAEMBP010000089.1 | GCA021406795_00526 | CDS | open | 3206-3736 | _na 176_aa | Antirestriction protein | |
| 4190 | JAEMBP010000089.1 | GCA021406795_00527 | CDS | open | 4608-4805 | _na 65_aa | hypothetical protein | |
| 4191 | JAEMBP010000089.1 | GCA021406795_00521 | gene | open | 189-1040 | |||
| 4192 | JAEMBP010000089.1 | GCA021406795_00522 | gene | open | 1024-1611 | |||
| 4193 | JAEMBP010000089.1 | GCA021406795_00523 | gene | open | 2315-2524 | |||
| 4194 | JAEMBP010000089.1 | GCA021406795_00524 | gene | open | 2537-2755 | |||
| 4195 | JAEMBP010000089.1 | GCA021406795_00525 | gene | open | 2768-3184 | |||
| 4196 | JAEMBP010000089.1 | GCA021406795_00526 | gene | open | 3206-3736 | |||
| 4197 | JAEMBP010000089.1 | GCA021406795_00527 | gene | open | 4608-4805 | |||
| 4198 | JAEMBP010000090.1 | GCA021406795_01199 | CDS | open | 10-924 | _na 304_aa | hagB | Hemagglutinin protein HagB |
| 4199 | JAEMBP010000090.1 | GCA021406795_01200 | CDS | open | 1291-3297 | _na 668_aa | DNA-binding protein | |
| 4200 | JAEMBP010000090.1 | GCA021406795_01201 | CDS | open | 3327-3917 | _na 196_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 4201 | JAEMBP010000090.1 | GCA021406795_01199 | gene | open | 10-924 | hagB | ||
| 4202 | JAEMBP010000090.1 | GCA021406795_01200 | gene | open | 1291-3297 | |||
| 4203 | JAEMBP010000090.1 | GCA021406795_01201 | gene | open | 3327-3917 | |||
| 4204 | JAEMBP010000091.1 | GCA021406795_01761 | CDS | open | 112-414 | _na 100_aa | Helix-turn-helix domain-containing protein | |
| 4205 | JAEMBP010000091.1 | GCA021406795_01762 | CDS | open | 452-730 | _na 92_aa | Helix-turn-helix domain-containing protein | |
| 4206 | JAEMBP010000091.1 | GCA021406795_01763 | CDS | open | 952-1305 | _na 117_aa | Helix-turn-helix domain-containing protein | |
| 4207 | JAEMBP010000091.1 | GCA021406795_01764 | CDS | open | 1289-1609 | _na 106_aa | Helix-turn-helix domain-containing protein | |
| 4208 | JAEMBP010000091.1 | GCA021406795_01765 | CDS | open | 1698-4733 | _na 1011_aa | Helicase protein | |
| 4209 | JAEMBP010000091.1 | GCA021406795_01761 | gene | open | 112-414 | |||
| 4210 | JAEMBP010000091.1 | GCA021406795_01762 | gene | open | 452-730 | |||
| 4211 | JAEMBP010000091.1 | GCA021406795_01763 | gene | open | 952-1305 | |||
| 4212 | JAEMBP010000091.1 | GCA021406795_01764 | gene | open | 1289-1609 | |||
| 4213 | JAEMBP010000091.1 | GCA021406795_01765 | gene | open | 1698-4733 | |||
| 4214 | JAEMBP010000092.1 | GCA021406795_00783 | CDS | open | 186-440 | _na 84_aa | hypothetical protein | |
| 4215 | JAEMBP010000092.1 | GCA021406795_00784 | CDS | open | 858-1166 | _na 102_aa | hypothetical protein | |
| 4216 | JAEMBP010000092.1 | GCA021406795_00785 | CDS | open | 1321-2523 | _na 400_aa | Secreted protein | |
| 4217 | JAEMBP010000092.1 | GCA021406795_00786 | CDS | open | 2627-4291 | _na 554_aa | Transporter | |
| 4218 | JAEMBP010000092.1 | GCA021406795_00783 | gene | open | 186-440 | |||
| 4219 | JAEMBP010000092.1 | GCA021406795_00784 | gene | open | 858-1166 | |||
| 4220 | JAEMBP010000092.1 | GCA021406795_00785 | gene | open | 1321-2523 | |||
| 4221 | JAEMBP010000092.1 | GCA021406795_00786 | gene | open | 2627-4291 | |||
| 4222 | JAEMBP010000093.1 | GCA021406795_01819 | CDS | open | 238-453 | _na 71_aa | hypothetical protein | |
| 4223 | JAEMBP010000093.1 | GCA021406795_01820 | CDS | open | 550-1266 | _na 238_aa | GLPGLI family protein | |
| 4224 | JAEMBP010000093.1 | GCA021406795_01821 | CDS | open | 1283-3958 | _na 891_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 4225 | JAEMBP010000093.1 | GCA021406795_01822 | CDS | open | 3942-4037 | _na 31_aa | hypothetical protein | |
| 4226 | JAEMBP010000093.1 | GCA021406795_01819 | gene | open | 238-453 | |||
| 4227 | JAEMBP010000093.1 | GCA021406795_01820 | gene | open | 550-1266 | |||
| 4228 | JAEMBP010000093.1 | GCA021406795_01821 | gene | open | 1283-3958 | |||
| 4229 | JAEMBP010000093.1 | GCA021406795_01822 | gene | open | 3942-4037 | |||
| 4230 | JAEMBP010000094.1 | GCA021406795_00676 | gene | open | 1-713 | rrs | ||
| 4231 | JAEMBP010000094.1 | GCA021406795_00679 | gene | open | 1467-4039 | rrl | ||
| 4232 | JAEMBP010000094.1 | GCA021406795_00676 | rRNA | open | 1-713 | rrs | 16S ribosomal RNA | |
| 4233 | JAEMBP010000094.1 | GCA021406795_00679 | rRNA | open | 1467-4039 | rrl | 23S ribosomal RNA | |
| 4234 | JAEMBP010000094.1 | GCA021406795_00677 | gene | open | 1207-1280 | trnI | ||
| 4235 | JAEMBP010000094.1 | GCA021406795_00678 | gene | open | 1282-1355 | trnA | ||
| 4236 | JAEMBP010000094.1 | GCA021406795_00677 | tRNA | open | 1207-1280 | trnI | tRNA-Ile(gat) | |
| 4237 | JAEMBP010000094.1 | GCA021406795_00678 | tRNA | open | 1282-1355 | trnA | tRNA-Ala(tgc) | |
| 4238 | JAEMBP010000095.1 | GCA021406795_01230 | CDS | open | 66-968 | _na 300_aa | hypothetical protein | |
| 4239 | JAEMBP010000095.1 | GCA021406795_01231 | CDS | open | 1235-2260 | _na 341_aa | Lipoprotein | |
| 4240 | JAEMBP010000095.1 | GCA021406795_01232 | CDS | open | 2272-2907 | _na 211_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 4241 | JAEMBP010000095.1 | GCA021406795_01233 | CDS | open | 3057-3971 | _na 304_aa | hagB | Hemagglutinin protein HagB |
| 4242 | JAEMBP010000095.1 | GCA021406795_01230 | gene | open | 66-968 | |||
| 4243 | JAEMBP010000095.1 | GCA021406795_01231 | gene | open | 1235-2260 | |||
| 4244 | JAEMBP010000095.1 | GCA021406795_01232 | gene | open | 2272-2907 | |||
| 4245 | JAEMBP010000095.1 | GCA021406795_01233 | gene | open | 3057-3971 | hagB | ||
| 4246 | JAEMBP010000096.1 | GCA021406795_00763 | CDS | open | 439-1131 | _na 230_aa | radC | DNA repair protein RadC |
| 4247 | JAEMBP010000096.1 | GCA021406795_00764 | CDS | open | 1367-3007 | _na 546_aa | hcp | hydroxylamine reductase |
| 4248 | JAEMBP010000096.1 | GCA021406795_00763 | gene | open | 439-1131 | radC | ||
| 4249 | JAEMBP010000096.1 | GCA021406795_00764 | gene | open | 1367-3007 | hcp | ||
| 4250 | JAEMBP010000096.1 | GCA021406795_00762 | gene | open | 190-263 | trnI | ||
| 4251 | JAEMBP010000096.1 | GCA021406795_00762 | tRNA | open | 190-263 | trnI | tRNA-Ile2(cat) | |
| 4252 | JAEMBP010000097.1 | GCA021406795_01886 | CDS | open | 226-3006 | _na 926_aa | cirA | Outer membrane protein beta-barrel domain-containing protein |
| 4253 | JAEMBP010000097.1 | GCA021406795_01886 | gene | open | 226-3006 | cirA | ||
| 4254 | JAEMBP010000098.1 | GCA021406795_00560 | CDS | open | 69-524 | _na 151_aa | hypothetical protein | |
| 4255 | JAEMBP010000098.1 | GCA021406795_00561 | CDS | open | 912-1460 | _na 182_aa | hypothetical protein | |
| 4256 | JAEMBP010000098.1 | GCA021406795_00562 | CDS | open | 1806-2471 | _na 221_aa | hypothetical protein | |
| 4257 | JAEMBP010000098.1 | GCA021406795_00563 | CDS | open | 2857-3288 | _na 143_aa | DUF1896 domain-containing protein | |
| 4258 | JAEMBP010000098.1 | GCA021406795_00560 | gene | open | 69-524 | |||
| 4259 | JAEMBP010000098.1 | GCA021406795_00561 | gene | open | 912-1460 | |||
| 4260 | JAEMBP010000098.1 | GCA021406795_00562 | gene | open | 1806-2471 | |||
| 4261 | JAEMBP010000098.1 | GCA021406795_00563 | gene | open | 2857-3288 | |||
| 4262 | JAEMBP010000099.1 | GCA021406795_01766 | CDS | open | 112-414 | _na 100_aa | Helix-turn-helix domain-containing protein | |
| 4263 | JAEMBP010000099.1 | GCA021406795_01767 | CDS | open | 452-730 | _na 92_aa | Helix-turn-helix domain-containing protein | |
| 4264 | JAEMBP010000099.1 | GCA021406795_01768 | CDS | open | 952-1305 | _na 117_aa | Helix-turn-helix domain-containing protein | |
| 4265 | JAEMBP010000099.1 | GCA021406795_01769 | CDS | open | 1289-1609 | _na 106_aa | Helix-turn-helix domain-containing protein | |
| 4266 | JAEMBP010000099.1 | GCA021406795_01770 | CDS | open | 1698-3311 | _na 537_aa | Helicase C-terminal domain-containing protein | |
| 4267 | JAEMBP010000099.1 | GCA021406795_01766 | gene | open | 112-414 | |||
| 4268 | JAEMBP010000099.1 | GCA021406795_01767 | gene | open | 452-730 | |||
| 4269 | JAEMBP010000099.1 | GCA021406795_01768 | gene | open | 952-1305 | |||
| 4270 | JAEMBP010000099.1 | GCA021406795_01769 | gene | open | 1289-1609 | |||
| 4271 | JAEMBP010000099.1 | GCA021406795_01770 | gene | open | 1698-3311 | |||
| 4272 | JAEMBP010000100.1 | GCA021406795_01740 | CDS | open | 255-839 | _na 194_aa | traO | Conjugative transposon protein TraO |
| 4273 | JAEMBP010000100.1 | GCA021406795_01741 | CDS | open | 841-1761 | _na 306_aa | traN | conjugative transposon protein TraN |
| 4274 | JAEMBP010000100.1 | GCA021406795_01742 | CDS | open | 1800-3161 | _na 453_aa | traM | conjugative transposon protein TraM |
| 4275 | JAEMBP010000100.1 | GCA021406795_01740 | gene | open | 255-839 | traO | ||
| 4276 | JAEMBP010000100.1 | GCA021406795_01741 | gene | open | 841-1761 | traN | ||
| 4277 | JAEMBP010000100.1 | GCA021406795_01742 | gene | open | 1800-3161 | traM | ||
| 4278 | JAEMBP010000101.1 | GCA021406795_01887 | CDS | open | 170-475 | _na 101_aa | DUF1661 domain-containing protein | |
| 4279 | JAEMBP010000101.1 | GCA021406795_01888 | CDS | open | 456-566 | _na 36_aa | hypothetical protein | |
| 4280 | JAEMBP010000101.1 | GCA021406795_01891 | CDS | open | 1707-2591 | _na 294_aa | DUF3078 domain-containing protein | |
| 4281 | JAEMBP010000101.1 | GCA021406795_01892 | CDS | open | 2907-3134 | _na 75_aa | traJ | Conjugative transposon TraJ C-terminal domain-containing protein |
| 4282 | JAEMBP010000101.1 | GCA021406795_01887 | gene | open | 170-475 | |||
| 4283 | JAEMBP010000101.1 | GCA021406795_01888 | gene | open | 456-566 | |||
| 4284 | JAEMBP010000101.1 | GCA021406795_01891 | gene | open | 1707-2591 | |||
| 4285 | JAEMBP010000101.1 | GCA021406795_01892 | gene | open | 2907-3134 | traJ | ||
| 4286 | JAEMBP010000101.1 | GCA021406795_01889 | gene | open | 1437-1511 | trnV | ||
| 4287 | JAEMBP010000101.1 | GCA021406795_01890 | gene | open | 1554-1628 | trnV | ||
| 4288 | JAEMBP010000101.1 | GCA021406795_01889 | tRNA | open | 1437-1511 | trnV | tRNA-Val(tac) | |
| 4289 | JAEMBP010000101.1 | GCA021406795_01890 | tRNA | open | 1554-1628 | trnV | tRNA-Val(tac) | |
| 4290 | JAEMBP010000102.1 | GCA021406795_01785 | CDS | open | 155-1516 | _na 453_aa | traM | conjugative transposon protein TraM |
| 4291 | JAEMBP010000102.1 | GCA021406795_01786 | CDS | open | 1554-2474 | _na 306_aa | traN | conjugative transposon protein TraN |
| 4292 | JAEMBP010000102.1 | GCA021406795_01787 | CDS | open | 2476-3060 | _na 194_aa | traO | Conjugative transposon protein TraO |
| 4293 | JAEMBP010000102.1 | GCA021406795_01785 | gene | open | 155-1516 | traM | ||
| 4294 | JAEMBP010000102.1 | GCA021406795_01786 | gene | open | 1554-2474 | traN | ||
| 4295 | JAEMBP010000102.1 | GCA021406795_01787 | gene | open | 2476-3060 | traO | ||
| 4296 | JAEMBP010000103.1 | GCA021406795_01913 | CDS | open | 250-2277 | _na 675_aa | topA | DNA topoisomerase |
| 4297 | JAEMBP010000103.1 | GCA021406795_01913 | gene | open | 250-2277 | topA | ||
| 4298 | JAEMBP010000104.1 | GCA021406795_00491 | CDS | open | 50-481 | _na 143_aa | DUF1896 domain-containing protein | |
| 4299 | JAEMBP010000104.1 | GCA021406795_00492 | CDS | open | 825-1271 | _na 148_aa | DNA methylase | |
| 4300 | JAEMBP010000104.1 | GCA021406795_00493 | CDS | open | 2139-2381 | _na 80_aa | hypothetical protein | |
| 4301 | JAEMBP010000104.1 | GCA021406795_00491 | gene | open | 50-481 | |||
| 4302 | JAEMBP010000104.1 | GCA021406795_00492 | gene | open | 825-1271 | |||
| 4303 | JAEMBP010000104.1 | GCA021406795_00493 | gene | open | 2139-2381 | |||
| 4304 | JAEMBP010000105.1 | GCA021406795_01926 | CDS | open | 192-476 | _na 94_aa | hypothetical protein | |
| 4305 | JAEMBP010000105.1 | GCA021406795_01927 | CDS | open | 811-2187 | _na 458_aa | tig | trigger factor |
| 4306 | JAEMBP010000105.1 | GCA021406795_01926 | gene | open | 192-476 | |||
| 4307 | JAEMBP010000105.1 | GCA021406795_01927 | gene | open | 811-2187 | tig | ||
| 4308 | JAEMBP010000106.1 | GCA021406795_01945 | CDS | open | 750-1670 | _na 306_aa | corA | Transporter |
| 4309 | JAEMBP010000106.1 | GCA021406795_01946 | CDS | open | 1675-2421 | _na 248_aa | cutC | PF03932 family protein CutC |
| 4310 | JAEMBP010000106.1 | GCA021406795_01945 | gene | open | 750-1670 | corA | ||
| 4311 | JAEMBP010000106.1 | GCA021406795_01946 | gene | open | 1675-2421 | cutC | ||
| 4312 | JAEMBP010000107.1 | GCA021406795_01788 | CDS | open | 25-363 | _na 112_aa | hypothetical protein | |
| 4313 | JAEMBP010000107.1 | GCA021406795_01789 | CDS | open | 1132-1692 | _na 186_aa | hypothetical protein | |
| 4314 | JAEMBP010000107.1 | GCA021406795_01788 | gene | open | 25-363 | |||
| 4315 | JAEMBP010000107.1 | GCA021406795_01789 | gene | open | 1132-1692 | |||
| 4316 | JAEMBP010000108.1 | GCA021406795_01185 | CDS | open | 480-2030 | _na 516_aa | lldP | L-lactate permease |
| 4317 | JAEMBP010000108.1 | GCA021406795_01185 | gene | open | 480-2030 | lldP | ||
| 4318 | JAEMBP010000109.1 | GCA021406795_01072 | CDS | open | 962-1636 | _na 224_aa | hypothetical protein | |
| 4319 | JAEMBP010000109.1 | GCA021406795_01073 | CDS | open | 1664-2002 | _na 112_aa | hypothetical protein | |
| 4320 | JAEMBP010000109.1 | GCA021406795_01072 | gene | open | 962-1636 | |||
| 4321 | JAEMBP010000109.1 | GCA021406795_01073 | gene | open | 1664-2002 | |||
| 4322 | JAEMBP010000110.1 | GCA021406795_01918 | CDS | open | 397-732 | _na 111_aa | hypothetical protein | |
| 4323 | JAEMBP010000110.1 | GCA021406795_01919 | CDS | open | 799-1644 | _na 281_aa | GLPGLI family protein | |
| 4324 | JAEMBP010000110.1 | GCA021406795_01920 | CDS | open | 1816-2109 | _na 97_aa | hypothetical protein | |
| 4325 | JAEMBP010000110.1 | GCA021406795_01918 | gene | open | 397-732 | |||
| 4326 | JAEMBP010000110.1 | GCA021406795_01919 | gene | open | 799-1644 | |||
| 4327 | JAEMBP010000110.1 | GCA021406795_01920 | gene | open | 1816-2109 | |||
| 4328 | JAEMBP010000111.1 | GCA021406795_00434 | CDS | open | 112-738 | _na 208_aa | hypothetical protein | |
| 4329 | JAEMBP010000111.1 | GCA021406795_00435 | CDS | open | 1164-1838 | _na 224_aa | Virulence-associated protein E-like domain-containing protein | |
| 4330 | JAEMBP010000111.1 | GCA021406795_00434 | gene | open | 112-738 | |||
| 4331 | JAEMBP010000111.1 | GCA021406795_00435 | gene | open | 1164-1838 | |||
| 4332 | JAEMBP010000112.1 | GCA021406795_01071 | CDS | open | 532-1644 | _na 370_aa | hypothetical protein | |
| 4333 | JAEMBP010000112.1 | GCA021406795_01071 | gene | open | 532-1644 | |||
| 4334 | JAEMBP010000113.1 | GCA021406795_01186 | CDS | open | 326-568 | _na 80_aa | hypothetical protein | |
| 4335 | JAEMBP010000113.1 | GCA021406795_01187 | CDS | open | 639-1262 | _na 207_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 4336 | JAEMBP010000113.1 | GCA021406795_01186 | gene | open | 326-568 | |||
| 4337 | JAEMBP010000113.1 | GCA021406795_01187 | gene | open | 639-1262 | |||
| 4338 | JAEMBP010000114.1 | GCA021406795_01078 | gene | open | 448-1366 | rrs | ||
| 4339 | JAEMBP010000114.1 | GCA021406795_01078 | rRNA | open | 448-1366 | rrs | 16S ribosomal RNA | |
| 4340 | JAEMBP010000116.1 | repeat_region | open | 27-654 | CRISPR array with 10 repeats of length 30%2C consensus sequence ATTTCAATTGCACCATACAGGAATTAAAAC and spacer length 35 | |||
| 4341 | JAEMBP010000117.1 | GCA021406795_02011 | CDS | open | 24-335 | _na 103_aa | DUF4942 domain-containing protein | |
| 4342 | JAEMBP010000117.1 | GCA021406795_02012 | CDS | open | 410-613 | _na 67_aa | hypothetical protein | |
| 4343 | JAEMBP010000117.1 | GCA021406795_02011 | gene | open | 24-335 | |||
| 4344 | JAEMBP010000117.1 | GCA021406795_02012 | gene | open | 410-613 | |||
| 4345 | JAEMBP010000120.1 | GCA021406795_00069 | CDS | open | 29-202 | _na 57_aa | hypothetical protein | |
| 4346 | JAEMBP010000120.1 | GCA021406795_00069 | gene | open | 29-202 | |||
| 4347 | JAEMBP010000121.1 | GCA021406795_01921 | gene | open | 1-97 | rrf | ||
| 4348 | JAEMBP010000121.1 | GCA021406795_01921 | rRNA | open | 1-97 | rrf | 5S ribosomal RNA | |
| 4349 | JAEMBP010000123.1 | GCA021406795_01944 | gene | open | 509-610 | rrf | ||
| 4350 | JAEMBP010000123.1 | GCA021406795_01944 | rRNA | open | 509-610 | rrf | 5S ribosomal RNA | |
| 4351 | JAEMBP010000123.1 | GCA021406795_01942 | CDS | open | 177-299 | _na 40_aa | hypothetical protein | |
| 4352 | JAEMBP010000123.1 | GCA021406795_01943 | CDS | open | 335-472 | _na 45_aa | hypothetical protein | |
| 4353 | JAEMBP010000123.1 | GCA021406795_01942 | gene | open | 177-299 | |||
| 4354 | JAEMBP010000123.1 | GCA021406795_01943 | gene | open | 335-472 | |||
| 4355 | JAEMBP010000125.1 | GCA021406795_02010 | CDS | open | 368-598 | _na 76_aa | hypothetical protein | |
| 4356 | JAEMBP010000125.1 | GCA021406795_02010 | gene | open | 368-598 | |||
| 4357 | JAEMBP010000134.1 | GCA021406795_02110 | CDS | open | 51-482 | _na 143_aa | topoisomerase C-terminal repeat-containing protein | |
| 4358 | JAEMBP010000134.1 | GCA021406795_02110 | gene | open | 51-482 |

