HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_021406845.1)

Select a Genome:
BAKTA Annotations for GCA_021406845.1
Genome Selected: Porphyromonas gingivalis
ContigsBases CDSrRNA tmRNAtRNA
90 2333098 1992 3 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4106 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4106 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 JAEMBR010000001.1 repeat_region open 86458-86965 CRISPR array with 8 repeats of length 36%2C consensus sequence GTTGTGTGTACCCTTCGAATAGAGGGTAGATCCAAC and spacer length 30
2 JAEMBR010000001.1 GCA021406845_01216 CDS open 432-1160 _na     242_aa Putative carbonic anhydrase
3 JAEMBR010000001.1 GCA021406845_01217 CDS open 1745-4123 _na     792_aa Collagen-binding protein
4 JAEMBR010000001.1 GCA021406845_01218 CDS open 4285-5124 _na     279_aa frmB Alpha/beta hydrolase family protein
5 JAEMBR010000001.1 GCA021406845_01219 CDS open 5160-5819 _na     219_aa Orthopoxovirus protein%2C PF05708 family
6 JAEMBR010000001.1 GCA021406845_01220 CDS open 5800-6144 _na     114_aa DUF4878 domain-containing protein
7 JAEMBR010000001.1 GCA021406845_01221 CDS open 6650-7507 _na     285_aa Putative auto-transporter adhesin head GIN domain-containing protein
8 JAEMBR010000001.1 GCA021406845_01222 CDS open 7781-8641 _na     286_aa Putative auto-transporter adhesin head GIN domain-containing protein
9 JAEMBR010000001.1 GCA021406845_01223 CDS open 8996-9682 _na     228_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
10 JAEMBR010000001.1 GCA021406845_01224 CDS open 9785-10954 _na     389_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
11 JAEMBR010000001.1 GCA021406845_01225 CDS open 11033-13210 _na     725_aa recQ DNA helicase RecQ
12 JAEMBR010000001.1 GCA021406845_01226 CDS open 13262-14629 _na     455_aa surA Peptidylprolyl isomerase
13 JAEMBR010000001.1 GCA021406845_01227 CDS open 14691-16571 _na     626_aa Organic solvent tolerance-like N-terminal domain-containing protein
14 JAEMBR010000001.1 GCA021406845_01228 CDS open 16562-16906 _na     114_aa Ubiquitin carboxyl-hydrolase
15 JAEMBR010000001.1 GCA021406845_01229 CDS open 16903-18759 _na     618_aa mutL DNA mismatch repair endonuclease MutL
16 JAEMBR010000001.1 GCA021406845_01230 CDS open 19015-21780 _na     921_aa cTD-A Cleaved adhesin domain-containing protein
17 JAEMBR010000001.1 GCA021406845_01231 CDS open 22150-22971 _na     273_aa Outer membrane protein beta-barrel domain-containing protein
18 JAEMBR010000001.1 GCA021406845_01232 CDS open 23015-23329 _na     104_aa hypothetical protein
19 JAEMBR010000001.1 GCA021406845_01233 CDS open 24365-24703 _na     112_aa Phenylalanyl-tRNA synthetase subunit beta
20 JAEMBR010000001.1 GCA021406845_01234 CDS open 24710-25018 _na     102_aa zapA Cell division protein ZapA
21 JAEMBR010000001.1 GCA021406845_01235 CDS open 25165-26706 _na     513_aa rny ribonuclease Y
22 JAEMBR010000001.1 GCA021406845_01236 CDS open 26811-28223 _na     470_aa yaaT PSP1 C-terminal domain-containing protein
23 JAEMBR010000001.1 GCA021406845_01237 CDS open 28231-28761 _na     176_aa gldH Gliding motility protein GldH
24 JAEMBR010000001.1 GCA021406845_01238 CDS open 28758-29852 _na     364_aa recF DNA replication/repair protein RecF
25 JAEMBR010000001.1 GCA021406845_01239 CDS open 29866-30156 _na     96_aa DUF721 domain-containing protein
26 JAEMBR010000001.1 GCA021406845_01240 CDS open 30206-30904 _na     232_aa crp Transcriptional regulator%2C Crp/Fnr family
27 JAEMBR010000001.1 GCA021406845_01241 CDS open 31192-35493 _na     1433_aa rpoC DNA-directed RNA polymerase subunit beta'
28 JAEMBR010000001.1 GCA021406845_01242 CDS open 35559-39368 _na     1269_aa rpoB DNA-directed RNA polymerase subunit beta
29 JAEMBR010000001.1 GCA021406845_01243 CDS open 39480-39857 _na     125_aa rplL 50S ribosomal protein L7/L12
30 JAEMBR010000001.1 GCA021406845_01244 CDS open 39899-40423 _na     174_aa rplJ 50S ribosomal protein L10
31 JAEMBR010000001.1 GCA021406845_01245 CDS open 40439-41137 _na     232_aa rplA 50S ribosomal protein L1
32 JAEMBR010000001.1 GCA021406845_01246 CDS open 41158-41595 _na     145_aa rplK 50S ribosomal protein L11
33 JAEMBR010000001.1 GCA021406845_01247 CDS open 41664-42203 _na     179_aa nusG transcription termination/antitermination protein NusG
34 JAEMBR010000001.1 GCA021406845_01248 CDS open 42225-42428 _na     67_aa secE preprotein translocase subunit SecE
35 JAEMBR010000001.1 GCA021406845_01250 CDS open 42587-43774 _na     395_aa tuf elongation factor Tu
36 JAEMBR010000001.1 GCA021406845_01253 CDS open 44168-45370 _na     400_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
37 JAEMBR010000001.1 GCA021406845_01254 CDS open 45447-45638 _na     63_aa rpsU 30S ribosomal protein S21
38 JAEMBR010000001.1 GCA021406845_01255 CDS open 45793-48315 _na     840_aa rqcU endonuclease MutS2
39 JAEMBR010000001.1 GCA021406845_01256 CDS open 48325-49644 _na     439_aa rseP RIP metalloprotease RseP
40 JAEMBR010000001.1 GCA021406845_01257 CDS open 50120-51640 _na     506_aa nhaP2 potassium/proton antiporter
41 JAEMBR010000001.1 GCA021406845_01258 CDS open 51637-53673 _na     678_aa uvrB excinuclease ABC subunit UvrB
42 JAEMBR010000001.1 GCA021406845_01259 CDS open 54047-54871 _na     274_aa tsf translation elongation factor Ts
43 JAEMBR010000001.1 GCA021406845_01260 CDS open 55010-55855 _na     281_aa rpsB 30S ribosomal protein S2
44 JAEMBR010000001.1 GCA021406845_01261 CDS open 55990-56376 _na     128_aa rpsI 30S ribosomal protein S9
45 JAEMBR010000001.1 GCA021406845_01262 CDS open 56386-56841 _na     151_aa rplM 50S ribosomal protein L13
46 JAEMBR010000001.1 GCA021406845_01263 CDS open 57402-58070 _na     222_aa Outer membrane protein beta-barrel domain-containing protein
47 JAEMBR010000001.1 GCA021406845_01264 CDS open 58240-58419 _na     59_aa hypothetical protein
48 JAEMBR010000001.1 GCA021406845_01265 CDS open 59104-59565 _na     153_aa coaD pantetheine-phosphate adenylyltransferase
49 JAEMBR010000001.1 GCA021406845_01266 CDS open 59596-61530 _na     644_aa gyrB DNA topoisomerase (ATP-hydrolyzing)
50 JAEMBR010000001.1 GCA021406845_01267 CDS open 62009-62569 _na     186_aa DUF5063 domain-containing protein
51 JAEMBR010000001.1 GCA021406845_01268 CDS open 62610-63212 _na     200_aa rnd 3'-5' exonuclease domain protein
52 JAEMBR010000001.1 GCA021406845_01269 CDS open 63209-64414 _na     401_aa rlmK PUA domain-containing protein
53 JAEMBR010000001.1 GCA021406845_01270 CDS open 64477-65298 _na     273_aa mltF Solute-binding protein family 3/N-terminal domain-containing protein
54 JAEMBR010000001.1 GCA021406845_01271 CDS open 65305-67365 _na     686_aa TonB-dependent receptor
55 JAEMBR010000001.1 GCA021406845_01272 CDS open 67373-68680 _na     435_aa rPS27A TPM domain-containing protein
56 JAEMBR010000001.1 GCA021406845_01273 CDS open 68702-69292 _na     196_aa lemA LemA protein
57 JAEMBR010000001.1 GCA021406845_01274 CDS open 69336-69923 _na     195_aa rutF Putative flavoredoxin
58 JAEMBR010000001.1 GCA021406845_01275 CDS open 69952-70392 _na     146_aa pyrI aspartate carbamoyltransferase regulatory subunit
59 JAEMBR010000001.1 GCA021406845_01276 CDS open 70420-71334 _na     304_aa pyrB aspartate carbamoyltransferase
60 JAEMBR010000001.1 GCA021406845_01277 CDS open 71381-72118 _na     245_aa sIMPL SIMPL domain-containing protein
61 JAEMBR010000001.1 GCA021406845_01278 CDS open 72147-73073 _na     308_aa hypothetical protein
62 JAEMBR010000001.1 GCA021406845_01279 CDS open 74005-75585 _na     526_aa nanH exo-alpha-sialidase
63 JAEMBR010000001.1 GCA021406845_01280 CDS open 76012-77469 _na     485_aa yopM Internalin
64 JAEMBR010000001.1 GCA021406845_01281 CDS open 77564-78334 _na     256_aa ycjU Hydrolase%2C haloacid dehalogenase-like family
65 JAEMBR010000001.1 GCA021406845_01282 CDS open 78334-80430 _na     698_aa recG ATP-dependent DNA helicase RecG
66 JAEMBR010000001.1 GCA021406845_01283 CDS open 80473-81501 _na     342_aa galE UDP-glucose 4-epimerase GalE
67 JAEMBR010000001.1 GCA021406845_01284 CDS open 81511-82116 _na     201_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
68 JAEMBR010000001.1 GCA021406845_01285 CDS open 82217-82810 _na     197_aa Histidine kinase
69 JAEMBR010000001.1 GCA021406845_01286 CDS open 82813-83742 _na     309_aa fibronectin type III domain-containing protein
70 JAEMBR010000001.1 GCA021406845_01287 CDS open 83788-84282 _na     164_aa metallophosphoesterase
71 JAEMBR010000001.1 GCA021406845_01288 CDS open 84463-85644 _na     393_aa megL methionine gamma-lyase
72 JAEMBR010000001.1 GCA021406845_01289 CDS open 85726-85971 _na     81_aa hypothetical protein
73 JAEMBR010000001.1 GCA021406845_01290 CDS open 87165-87707 _na     180_aa csx28 CRISPR-associated protein Csx28
74 JAEMBR010000001.1 GCA021406845_01291 CDS open 87715-91242 _na     1175_aa cas13b type VI-B CRISPR-associated RNA-guided ribonuclease Cas13b
75 JAEMBR010000001.1 GCA021406845_01292 CDS open 91530-92099 _na     189_aa Plasmid pRiA4b Orf3-like domain-containing protein
76 JAEMBR010000001.1 GCA021406845_01293 CDS open 92116-93018 _na     300_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
77 JAEMBR010000001.1 GCA021406845_01294 CDS open 93158-94672 _na     504_aa Glycosyltransferase family 39 protein
78 JAEMBR010000001.1 GCA021406845_01295 CDS open 94700-95659 _na     319_aa wcaA Glycosyl transferase%2C group 2 family protein
79 JAEMBR010000001.1 GCA021406845_01296 CDS open 95670-96578 _na     302_aa rhaT EamA domain-containing protein
80 JAEMBR010000001.1 GCA021406845_01297 CDS open 96806-98782 _na     658_aa rho transcription termination factor Rho
81 JAEMBR010000001.1 GCA021406845_01298 CDS open 99458-99976 _na     172_aa hupA DNA-binding protein%2C histone-like family
82 JAEMBR010000001.1 GCA021406845_01299 CDS open 100009-101004 _na     331_aa Lipoprotein
83 JAEMBR010000001.1 GCA021406845_01300 CDS open 101045-101947 _na     300_aa ftcD glutamate formimidoyltransferase
84 JAEMBR010000001.1 GCA021406845_01301 CDS open 102069-103319 _na     416_aa hutI imidazolonepropionase
85 JAEMBR010000001.1 GCA021406845_01302 CDS open 103413-104567 _na     384_aa Nucleoside transporter/FeoB GTPase Gate domain-containing protein
86 JAEMBR010000001.1 GCA021406845_01303 CDS open 104608-105735 _na     375_aa lomR Porin
87 JAEMBR010000001.1 GCA021406845_01304 CDS open 105760-106389 _na     209_aa ftcD Cyclodeaminase/cyclohydrolase domain-containing protein
88 JAEMBR010000001.1 GCA021406845_01305 CDS open 106392-107885 _na     497_aa hutH histidine ammonia-lyase
89 JAEMBR010000001.1 GCA021406845_01306 CDS open 108086-108415 _na     109_aa qdoI Cupin type-2 domain-containing protein
90 JAEMBR010000001.1 GCA021406845_01307 CDS open 108538-109716 _na     392_aa gltP Serine/threonine transporter
91 JAEMBR010000001.1 GCA021406845_01308 CDS open 109745-110851 _na     368_aa meaB methylmalonyl Co-A mutase-associated GTPase MeaB
92 JAEMBR010000001.1 GCA021406845_01309 CDS open 110927-112015 _na     362_aa DUF1573 domain-containing protein
93 JAEMBR010000001.1 GCA021406845_01310 CDS open 112047-112430 _na     127_aa DUF1573 domain-containing protein
94 JAEMBR010000001.1 GCA021406845_01311 CDS open 113043-115703 _na     886_aa Peptidase family M49
95 JAEMBR010000001.1 GCA021406845_01312 CDS open 115716-116987 _na     423_aa serS serine--tRNA ligase
96 JAEMBR010000001.1 GCA021406845_01313 CDS open 117086-117343 _na     85_aa rpmA 50S ribosomal protein L27
97 JAEMBR010000001.1 GCA021406845_01314 CDS open 117371-117688 _na     105_aa rplU 50S ribosomal protein L21
98 JAEMBR010000001.1 GCA021406845_01315 CDS open 117939-118154 _na     71_aa 50S ribosomal protein L28 domain protein
99 JAEMBR010000001.1 GCA021406845_01316 CDS open 118418-118957 _na     179_aa DUF4199 domain-containing protein
100 JAEMBR010000001.1 GCA021406845_01317 CDS open 118954-119907 _na     317_aa wcaA Glycosyl transferase%2C group 2 family protein
101 JAEMBR010000001.1 GCA021406845_01318 CDS open 119907-120446 _na     179_aa nfnB Nitroreductase family protein
102 JAEMBR010000001.1 GCA021406845_01319 CDS open 120443-121456 _na     337_aa apbE FAD:protein FMN transferase
103 JAEMBR010000001.1 GCA021406845_01320 CDS open 121675-122247 _na     190_aa rnfA Ion-translocating oxidoreductase complex subunit A
104 JAEMBR010000001.1 GCA021406845_01321 CDS open 122272-122862 _na     196_aa rnfE Ion-translocating oxidoreductase complex subunit E
105 JAEMBR010000001.1 GCA021406845_01322 CDS open 122859-123536 _na     225_aa rnfG Ion-translocating oxidoreductase complex subunit G
106 JAEMBR010000001.1 GCA021406845_01323 CDS open 123533-124516 _na     327_aa rnfD Ion-translocating oxidoreductase complex subunit D
107 JAEMBR010000001.1 GCA021406845_01324 CDS open 124532-125863 _na     443_aa rsxC electron transport complex subunit RsxC
108 JAEMBR010000001.1 GCA021406845_01325 CDS open 125899-126771 _na     290_aa rnfB Fe-S cluster domain-containing protein
109 JAEMBR010000001.1 GCA021406845_01326 CDS open 126781-127203 _na     140_aa rseC Positive regulator of sigma(E)%2C RseC/MucC
110 JAEMBR010000001.1 GCA021406845_01327 CDS open 127265-127555 _na     96_aa hypothetical protein
111 JAEMBR010000001.1 GCA021406845_01328 CDS open 127559-128851 _na     430_aa cpoB TPR domain protein
112 JAEMBR010000001.1 GCA021406845_01329 CDS open 129016-129354 _na     112_aa Partial transposase in ISPg3
113 JAEMBR010000001.1 GCA021406845_01330 CDS open 129485-130024 _na     179_aa hypothetical protein
114 JAEMBR010000001.1 GCA021406845_01331 CDS open 130259-133963 _na     1234_aa purL phosphoribosylformylglycinamidine synthase
115 JAEMBR010000001.1 GCA021406845_01332 CDS open 133956-135080 _na     374_aa dprA DNA-processing protein DprA
116 JAEMBR010000001.1 GCA021406845_01333 CDS open 135095-135985 _na     296_aa wcaE Glycosyltransferase 2-like domain-containing protein
117 JAEMBR010000001.1 GCA021406845_01216 gene open 432-1160
118 JAEMBR010000001.1 GCA021406845_01217 gene open 1745-4123
119 JAEMBR010000001.1 GCA021406845_01218 gene open 4285-5124 frmB
120 JAEMBR010000001.1 GCA021406845_01219 gene open 5160-5819
121 JAEMBR010000001.1 GCA021406845_01220 gene open 5800-6144
122 JAEMBR010000001.1 GCA021406845_01221 gene open 6650-7507
123 JAEMBR010000001.1 GCA021406845_01222 gene open 7781-8641
124 JAEMBR010000001.1 GCA021406845_01223 gene open 8996-9682 clpP
125 JAEMBR010000001.1 GCA021406845_01224 gene open 9785-10954 clpX
126 JAEMBR010000001.1 GCA021406845_01225 gene open 11033-13210 recQ
127 JAEMBR010000001.1 GCA021406845_01226 gene open 13262-14629 surA
128 JAEMBR010000001.1 GCA021406845_01227 gene open 14691-16571
129 JAEMBR010000001.1 GCA021406845_01228 gene open 16562-16906
130 JAEMBR010000001.1 GCA021406845_01229 gene open 16903-18759 mutL
131 JAEMBR010000001.1 GCA021406845_01230 gene open 19015-21780 cTD-A
132 JAEMBR010000001.1 GCA021406845_01231 gene open 22150-22971
133 JAEMBR010000001.1 GCA021406845_01232 gene open 23015-23329
134 JAEMBR010000001.1 GCA021406845_01233 gene open 24365-24703
135 JAEMBR010000001.1 GCA021406845_01234 gene open 24710-25018 zapA
136 JAEMBR010000001.1 GCA021406845_01235 gene open 25165-26706 rny
137 JAEMBR010000001.1 GCA021406845_01236 gene open 26811-28223 yaaT
138 JAEMBR010000001.1 GCA021406845_01237 gene open 28231-28761 gldH
139 JAEMBR010000001.1 GCA021406845_01238 gene open 28758-29852 recF
140 JAEMBR010000001.1 GCA021406845_01239 gene open 29866-30156
141 JAEMBR010000001.1 GCA021406845_01240 gene open 30206-30904 crp
142 JAEMBR010000001.1 GCA021406845_01241 gene open 31192-35493 rpoC
143 JAEMBR010000001.1 GCA021406845_01242 gene open 35559-39368 rpoB
144 JAEMBR010000001.1 GCA021406845_01243 gene open 39480-39857 rplL
145 JAEMBR010000001.1 GCA021406845_01244 gene open 39899-40423 rplJ
146 JAEMBR010000001.1 GCA021406845_01245 gene open 40439-41137 rplA
147 JAEMBR010000001.1 GCA021406845_01246 gene open 41158-41595 rplK
148 JAEMBR010000001.1 GCA021406845_01247 gene open 41664-42203 nusG
149 JAEMBR010000001.1 GCA021406845_01248 gene open 42225-42428 secE
150 JAEMBR010000001.1 GCA021406845_01250 gene open 42587-43774 tuf
151 JAEMBR010000001.1 GCA021406845_01253 gene open 44168-45370 hpf
152 JAEMBR010000001.1 GCA021406845_01254 gene open 45447-45638 rpsU
153 JAEMBR010000001.1 GCA021406845_01255 gene open 45793-48315 rqcU
154 JAEMBR010000001.1 GCA021406845_01256 gene open 48325-49644 rseP
155 JAEMBR010000001.1 GCA021406845_01257 gene open 50120-51640 nhaP2
156 JAEMBR010000001.1 GCA021406845_01258 gene open 51637-53673 uvrB
157 JAEMBR010000001.1 GCA021406845_01259 gene open 54047-54871 tsf
158 JAEMBR010000001.1 GCA021406845_01260 gene open 55010-55855 rpsB
159 JAEMBR010000001.1 GCA021406845_01261 gene open 55990-56376 rpsI
160 JAEMBR010000001.1 GCA021406845_01262 gene open 56386-56841 rplM
161 JAEMBR010000001.1 GCA021406845_01263 gene open 57402-58070
162 JAEMBR010000001.1 GCA021406845_01264 gene open 58240-58419
163 JAEMBR010000001.1 GCA021406845_01265 gene open 59104-59565 coaD
164 JAEMBR010000001.1 GCA021406845_01266 gene open 59596-61530 gyrB
165 JAEMBR010000001.1 GCA021406845_01267 gene open 62009-62569
166 JAEMBR010000001.1 GCA021406845_01268 gene open 62610-63212 rnd
167 JAEMBR010000001.1 GCA021406845_01269 gene open 63209-64414 rlmK
168 JAEMBR010000001.1 GCA021406845_01270 gene open 64477-65298 mltF
169 JAEMBR010000001.1 GCA021406845_01271 gene open 65305-67365
170 JAEMBR010000001.1 GCA021406845_01272 gene open 67373-68680 rPS27A
171 JAEMBR010000001.1 GCA021406845_01273 gene open 68702-69292 lemA
172 JAEMBR010000001.1 GCA021406845_01274 gene open 69336-69923 rutF
173 JAEMBR010000001.1 GCA021406845_01275 gene open 69952-70392 pyrI
174 JAEMBR010000001.1 GCA021406845_01276 gene open 70420-71334 pyrB
175 JAEMBR010000001.1 GCA021406845_01277 gene open 71381-72118 sIMPL
176 JAEMBR010000001.1 GCA021406845_01278 gene open 72147-73073
177 JAEMBR010000001.1 GCA021406845_01279 gene open 74005-75585 nanH
178 JAEMBR010000001.1 GCA021406845_01280 gene open 76012-77469 yopM
179 JAEMBR010000001.1 GCA021406845_01281 gene open 77564-78334 ycjU
180 JAEMBR010000001.1 GCA021406845_01282 gene open 78334-80430 recG
181 JAEMBR010000001.1 GCA021406845_01283 gene open 80473-81501 galE
182 JAEMBR010000001.1 GCA021406845_01284 gene open 81511-82116 yihA
183 JAEMBR010000001.1 GCA021406845_01285 gene open 82217-82810
184 JAEMBR010000001.1 GCA021406845_01286 gene open 82813-83742
185 JAEMBR010000001.1 GCA021406845_01287 gene open 83788-84282
186 JAEMBR010000001.1 GCA021406845_01288 gene open 84463-85644 megL
187 JAEMBR010000001.1 GCA021406845_01289 gene open 85726-85971
188 JAEMBR010000001.1 GCA021406845_01290 gene open 87165-87707 csx28
189 JAEMBR010000001.1 GCA021406845_01291 gene open 87715-91242 cas13b
190 JAEMBR010000001.1 GCA021406845_01292 gene open 91530-92099
191 JAEMBR010000001.1 GCA021406845_01293 gene open 92116-93018 miaA
192 JAEMBR010000001.1 GCA021406845_01294 gene open 93158-94672
193 JAEMBR010000001.1 GCA021406845_01295 gene open 94700-95659 wcaA
194 JAEMBR010000001.1 GCA021406845_01296 gene open 95670-96578 rhaT
195 JAEMBR010000001.1 GCA021406845_01297 gene open 96806-98782 rho
196 JAEMBR010000001.1 GCA021406845_01298 gene open 99458-99976 hupA
197 JAEMBR010000001.1 GCA021406845_01299 gene open 100009-101004
198 JAEMBR010000001.1 GCA021406845_01300 gene open 101045-101947 ftcD
199 JAEMBR010000001.1 GCA021406845_01301 gene open 102069-103319 hutI
200 JAEMBR010000001.1 GCA021406845_01302 gene open 103413-104567
201 JAEMBR010000001.1 GCA021406845_01303 gene open 104608-105735 lomR
202 JAEMBR010000001.1 GCA021406845_01304 gene open 105760-106389 ftcD
203 JAEMBR010000001.1 GCA021406845_01305 gene open 106392-107885 hutH
204 JAEMBR010000001.1 GCA021406845_01306 gene open 108086-108415 qdoI
205 JAEMBR010000001.1 GCA021406845_01307 gene open 108538-109716 gltP
206 JAEMBR010000001.1 GCA021406845_01308 gene open 109745-110851 meaB
207 JAEMBR010000001.1 GCA021406845_01309 gene open 110927-112015
208 JAEMBR010000001.1 GCA021406845_01310 gene open 112047-112430
209 JAEMBR010000001.1 GCA021406845_01311 gene open 113043-115703
210 JAEMBR010000001.1 GCA021406845_01312 gene open 115716-116987 serS
211 JAEMBR010000001.1 GCA021406845_01313 gene open 117086-117343 rpmA
212 JAEMBR010000001.1 GCA021406845_01314 gene open 117371-117688 rplU
213 JAEMBR010000001.1 GCA021406845_01315 gene open 117939-118154
214 JAEMBR010000001.1 GCA021406845_01316 gene open 118418-118957
215 JAEMBR010000001.1 GCA021406845_01317 gene open 118954-119907 wcaA
216 JAEMBR010000001.1 GCA021406845_01318 gene open 119907-120446 nfnB
217 JAEMBR010000001.1 GCA021406845_01319 gene open 120443-121456 apbE
218 JAEMBR010000001.1 GCA021406845_01320 gene open 121675-122247 rnfA
219 JAEMBR010000001.1 GCA021406845_01321 gene open 122272-122862 rnfE
220 JAEMBR010000001.1 GCA021406845_01322 gene open 122859-123536 rnfG
221 JAEMBR010000001.1 GCA021406845_01323 gene open 123533-124516 rnfD
222 JAEMBR010000001.1 GCA021406845_01324 gene open 124532-125863 rsxC
223 JAEMBR010000001.1 GCA021406845_01325 gene open 125899-126771 rnfB
224 JAEMBR010000001.1 GCA021406845_01326 gene open 126781-127203 rseC
225 JAEMBR010000001.1 GCA021406845_01327 gene open 127265-127555
226 JAEMBR010000001.1 GCA021406845_01328 gene open 127559-128851 cpoB
227 JAEMBR010000001.1 GCA021406845_01329 gene open 129016-129354
228 JAEMBR010000001.1 GCA021406845_01330 gene open 129485-130024
229 JAEMBR010000001.1 GCA021406845_01331 gene open 130259-133963 purL
230 JAEMBR010000001.1 GCA021406845_01332 gene open 133956-135080 dprA
231 JAEMBR010000001.1 GCA021406845_01333 gene open 135095-135985 wcaE
232 JAEMBR010000001.1 GCA021406845_01249 gene open 42444-42516 trnW
233 JAEMBR010000001.1 GCA021406845_01251 gene open 43842-43913 trnT
234 JAEMBR010000001.1 GCA021406845_01252 gene open 43946-44028 trnY
235 JAEMBR010000001.1 GCA021406845_01249 tRNA open 42444-42516 trnW tRNA-Trp(cca)
236 JAEMBR010000001.1 GCA021406845_01251 tRNA open 43842-43913 trnT tRNA-Thr(ggt)
237 JAEMBR010000001.1 GCA021406845_01252 tRNA open 43946-44028 trnY tRNA-Tyr(gta)
238 JAEMBR010000002.1 repeat_region open 51178-51537 CRISPR array with 5 repeats of length 46%2C consensus sequence ACTGGGAATAGCTTTCAGATTTAGTATTTTTGTTGCAACGCACAGC and spacer length 29
239 JAEMBR010000002.1 repeat_region open 53607-54573 CRISPR array with 13 repeats of length 46%2C consensus sequence ACTGGGAATAGCTTTCAGATTTAGTATTTTTGTTGCAACGCACAGC and spacer length 29
240 JAEMBR010000002.1 GCA021406845_01431 CDS open 840-2372 _na     510_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
241 JAEMBR010000002.1 GCA021406845_01432 CDS open 2597-4267 _na     556_aa cTD-A peptidylarginine deiminase PPAD
242 JAEMBR010000002.1 GCA021406845_01433 CDS open 5345-7876 _na     843_aa cTD-A Thiol protease/hemagglutinin PrtT%2C putative
243 JAEMBR010000002.1 GCA021406845_01434 CDS open 8016-8501 _na     161_aa ribH 6%2C7-dimethyl-8-ribityllumazine synthase
244 JAEMBR010000002.1 GCA021406845_01435 CDS open 8593-9279 _na     228_aa cpoB TPR domain protein
245 JAEMBR010000002.1 GCA021406845_01436 CDS open 9465-10148 _na     227_aa citB FimR protein
246 JAEMBR010000002.1 GCA021406845_01437 CDS open 10161-10622 _na     153_aa kdpD sensor histidine kinase KdpD
247 JAEMBR010000002.1 GCA021406845_01438 CDS open 10634-12076 _na     480_aa tetratricopeptide repeat protein
248 JAEMBR010000002.1 GCA021406845_01439 CDS open 12358-12552 _na     64_aa xseB exodeoxyribonuclease VII small subunit
249 JAEMBR010000002.1 GCA021406845_01440 CDS open 12549-13217 _na     222_aa ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
250 JAEMBR010000002.1 GCA021406845_01442 CDS open 14636-15463 _na     275_aa ftsX Cell division protein FtsX
251 JAEMBR010000002.1 GCA021406845_01443 CDS open 15510-15737 _na     75_aa DUF3098 domain-containing protein
252 JAEMBR010000002.1 GCA021406845_01444 CDS open 15845-16687 _na     280_aa uppP undecaprenyl-diphosphate phosphatase
253 JAEMBR010000002.1 GCA021406845_01445 CDS open 16697-17473 _na     258_aa truB tRNA pseudouridine(55) synthase TruB
254 JAEMBR010000002.1 GCA021406845_01446 CDS open 17491-18543 _na     350_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
255 JAEMBR010000002.1 GCA021406845_01447 CDS open 18546-18989 _na     147_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
256 JAEMBR010000002.1 GCA021406845_01448 CDS open 19002-20246 _na     414_aa prtC Collagenase
257 JAEMBR010000002.1 GCA021406845_01449 CDS open 20302-20721 _na     139_aa fadM Thioesterase family protein
258 JAEMBR010000002.1 GCA021406845_01450 CDS open 20806-21576 _na     256_aa yaaA peroxide stress protein YaaA
259 JAEMBR010000002.1 GCA021406845_01451 CDS open 21714-22289 _na     191_aa sodB Superoxide dismutase [Mn/Fe]
260 JAEMBR010000002.1 GCA021406845_01452 CDS open 22478-22831 _na     117_aa hypothetical protein
261 JAEMBR010000002.1 GCA021406845_01454 CDS open 22979-25579 _na     866_aa prtT Thiol protease/hemagglutinin PrtT
262 JAEMBR010000002.1 GCA021406845_01455 CDS open 25973-26113 _na     46_aa hypothetical protein
263 JAEMBR010000002.1 GCA021406845_01456 CDS open 26272-26403 _na     43_aa hypothetical protein
264 JAEMBR010000002.1 GCA021406845_01457 CDS open 26432-27082 _na     216_aa hmuY HmuY protein
265 JAEMBR010000002.1 GCA021406845_01458 CDS open 27097-29037 _na     646_aa hmuR TonB-dependent receptor HmuR
266 JAEMBR010000002.1 GCA021406845_01459 CDS open 29074-33483 _na     1469_aa cobN Putative cobalamin biosynthesis-related protein
267 JAEMBR010000002.1 GCA021406845_01460 CDS open 33480-34157 _na     225_aa hypothetical protein
268 JAEMBR010000002.1 GCA021406845_01461 CDS open 34227-34805 _na     192_aa tolQ MotA/TolQ/ExbB proton channel domain-containing protein
269 JAEMBR010000002.1 GCA021406845_01462 CDS open 34811-35137 _na     108_aa DUF2149 domain-containing protein
270 JAEMBR010000002.1 GCA021406845_01463 CDS open 36187-37275 _na     362_aa gcvT glycine cleavage system aminomethyltransferase GcvT
271 JAEMBR010000002.1 GCA021406845_01464 CDS open 37350-38414 _na     354_aa rfbB dTDP-glucose 4%2C6-dehydratase
272 JAEMBR010000002.1 GCA021406845_01465 CDS open 38421-39278 _na     285_aa rfbD dTDP-4-dehydrorhamnose reductase
273 JAEMBR010000002.1 GCA021406845_01466 CDS open 39275-39865 _na     196_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
274 JAEMBR010000002.1 GCA021406845_01467 CDS open 39880-40749 _na     289_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
275 JAEMBR010000002.1 GCA021406845_01468 CDS open 40864-42819 _na     651_aa mdoB Sulfatase-like hydrolase/transferase
276 JAEMBR010000002.1 GCA021406845_01469 CDS open 42904-44142 _na     412_aa kdtA 3-deoxy-D-manno-octulosonic acid transferase
277 JAEMBR010000002.1 GCA021406845_01470 CDS open 44167-45882 _na     571_aa gltX glutamate--tRNA ligase
278 JAEMBR010000002.1 GCA021406845_01471 CDS open 46010-46267 _na     85_aa Partial transposase in ISPg2
279 JAEMBR010000002.1 GCA021406845_01472 CDS open 46864-47247 _na     127_aa pspE Rhodanese domain-containing protein
280 JAEMBR010000002.1 GCA021406845_01473 CDS open 47220-48635 _na     471_aa pspE Metallo-beta-lactamase superfamily protein
281 JAEMBR010000002.1 GCA021406845_01474 CDS open 48728-49534 _na     268_aa tauE putative membrane transporter protein
282 JAEMBR010000002.1 GCA021406845_01475 CDS open 49599-50303 _na     234_aa crp Transcriptional regulator%2C Crp family
283 JAEMBR010000002.1 GCA021406845_01476 CDS open 52229-52366 _na     45_aa hypothetical protein
284 JAEMBR010000002.1 GCA021406845_01477 CDS open 54722-55015 _na     97_aa cas2 CRISPR-associated endonuclease Cas2
285 JAEMBR010000002.1 GCA021406845_01478 CDS open 55063-56001 _na     312_aa cas1 type II CRISPR-associated endonuclease Cas1
286 JAEMBR010000002.1 GCA021406845_01479 CDS open 56014-60300 _na     1428_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
287 JAEMBR010000002.1 GCA021406845_01480 CDS open 60662-62218 _na     518_aa nadB L-aspartate oxidase
288 JAEMBR010000002.1 GCA021406845_01481 CDS open 62250-63092 _na     280_aa nadC carboxylating nicotinate-nucleotide diphosphorylase
289 JAEMBR010000002.1 GCA021406845_01482 CDS open 63112-64038 _na     308_aa nadA quinolinate synthase NadA
290 JAEMBR010000002.1 GCA021406845_01483 CDS open 64138-65133 _na     331_aa mMP0363 ATPase%2C MoxR family
291 JAEMBR010000002.1 GCA021406845_01484 CDS open 65255-66016 _na     253_aa mMP0362 DUF58 domain-containing protein
292 JAEMBR010000002.1 GCA021406845_01485 CDS open 66013-66969 _na     318_aa batD Protein BatD
293 JAEMBR010000002.1 GCA021406845_01486 CDS open 66966-67949 _na     327_aa batA BatA protein
294 JAEMBR010000002.1 GCA021406845_01487 CDS open 67960-68979 _na     339_aa batB Putative aerotolerance-related exported protein BatB
295 JAEMBR010000002.1 GCA021406845_01488 CDS open 68976-69719 _na     247_aa batC putative aerotolerance-related exported protein BatC
296 JAEMBR010000002.1 GCA021406845_01489 CDS open 69900-71702 _na     600_aa batD Aerotolerance regulator BatD
297 JAEMBR010000002.1 GCA021406845_01490 CDS open 71699-72607 _na     302_aa batE BatE protein
298 JAEMBR010000002.1 GCA021406845_01491 CDS open 72628-73344 _na     238_aa lpxF Lipid A 4'-phosphatase
299 JAEMBR010000002.1 GCA021406845_01492 CDS open 73360-74127 _na     255_aa cdaA diadenylate cyclase CdaA
300 JAEMBR010000002.1 GCA021406845_01493 CDS open 74187-75032 _na     281_aa folP dihydropteroate synthase
301 JAEMBR010000002.1 GCA021406845_01494 CDS open 75564-76661 _na     365_aa type I site-specific deoxyribonuclease
302 JAEMBR010000002.1 GCA021406845_01496 CDS open 77018-79102 _na     694_aa pgpH HD domain-containing protein
303 JAEMBR010000002.1 GCA021406845_01497 CDS open 79150-79710 _na     186_aa aroK shikimate kinase
304 JAEMBR010000002.1 GCA021406845_01498 CDS open 79649-81184 _na     511_aa comEC ComEC/Rec2-related protein
305 JAEMBR010000002.1 GCA021406845_01499 CDS open 81191-81847 _na     218_aa rpe ribulose-phosphate 3-epimerase
306 JAEMBR010000002.1 GCA021406845_01500 CDS open 82190-85603 _na     1137_aa ileS isoleucine--tRNA ligase
307 JAEMBR010000002.1 GCA021406845_01501 CDS open 85673-86053 _na     126_aa dksA DnaK suppressor protein%2C putative
308 JAEMBR010000002.1 GCA021406845_01502 CDS open 86057-86737 _na     226_aa lspA lipoprotein signal peptidase
309 JAEMBR010000002.1 GCA021406845_01503 CDS open 86734-87522 _na     262_aa DUF4296 domain-containing protein
310 JAEMBR010000002.1 GCA021406845_01504 CDS open 87556-88581 _na     341_aa Acyltransferase 3 domain-containing protein
311 JAEMBR010000002.1 GCA021406845_01505 CDS open 88616-89389 _na     257_aa birA2 Biotin--[acetyl-CoA-carboxylase] ligase
312 JAEMBR010000002.1 GCA021406845_01506 CDS open 89361-89741 _na     126_aa mmcQ MmcQ-like protein
313 JAEMBR010000002.1 GCA021406845_01507 CDS open 89812-90396 _na     194_aa rdgB non-canonical purine NTP diphosphatase
314 JAEMBR010000002.1 GCA021406845_01508 CDS open 90408-92714 _na     768_aa porZ TSS9 PorZ N-terminal beta-propeller domain-containing protein
315 JAEMBR010000002.1 GCA021406845_01509 CDS open 92764-94167 _na     467_aa pepC Aminopeptidase
316 JAEMBR010000002.1 GCA021406845_01510 CDS open 94494-95240 _na     248_aa Ion transporter
317 JAEMBR010000002.1 GCA021406845_01511 CDS open 96293-97444 _na     383_aa oadB Methylmalonyl-CoA decarboxylase%2C beta subunit
318 JAEMBR010000002.1 GCA021406845_01512 CDS open 97449-97883 _na     144_aa pccA Methylmalonyl-CoA decarboxylase%2C gamma subunit
319 JAEMBR010000002.1 GCA021406845_01513 CDS open 97921-98157 _na     78_aa hypothetical protein
320 JAEMBR010000002.1 GCA021406845_01514 CDS open 98154-99095 _na     313_aa oadG LTD domain-containing protein
321 JAEMBR010000002.1 GCA021406845_01515 CDS open 99120-100673 _na     517_aa mmdA Methylmalonyl-CoA decarboxylase%2C alpha subunit
322 JAEMBR010000002.1 GCA021406845_01516 CDS open 100772-101176 _na     134_aa mce methylmalonyl-CoA epimerase
323 JAEMBR010000002.1 GCA021406845_01517 CDS open 101408-102163 _na     251_aa sdhB Fumarate reductase%2C iron-sulfur protein
324 JAEMBR010000002.1 GCA021406845_01518 CDS open 102192-104135 _na     647_aa sdhA Succinate dehydrogenase
325 JAEMBR010000002.1 GCA021406845_01519 CDS open 104166-104858 _na     230_aa Succinate dehydrogenase/fumarate reductase cytochrome b subunit
326 JAEMBR010000002.1 GCA021406845_01520 CDS open 105065-105577 _na     170_aa hypothetical protein
327 JAEMBR010000002.1 GCA021406845_01521 CDS open 105639-105848 _na     69_aa copZ HMA domain-containing protein
328 JAEMBR010000002.1 GCA021406845_01522 CDS open 105884-108091 _na     735_aa zntA Cation-transporting ATPase
329 JAEMBR010000002.1 GCA021406845_01523 CDS open 108099-108602 _na     167_aa wzb Phosphotyrosine protein phosphatase
330 JAEMBR010000002.1 GCA021406845_01524 CDS open 108593-109927 _na     444_aa norM DNA-damage-inducible protein F
331 JAEMBR010000002.1 GCA021406845_01525 CDS open 110083-111198 _na     371_aa trxA Thioredoxin domain-containing protein
332 JAEMBR010000002.1 GCA021406845_01526 CDS open 111434-113986 _na     850_aa ftsK FtsK/SpoIIIE family protein
333 JAEMBR010000002.1 GCA021406845_01527 CDS open 114000-114647 _na     215_aa lolA Outer membrane lipoprotein carrier protein LolA
334 JAEMBR010000002.1 GCA021406845_01528 CDS open 114713-115138 _na     141_aa Lipocalin-like domain-containing protein
335 JAEMBR010000002.1 GCA021406845_01529 CDS open 115272-116426 _na     384_aa galK galactokinase
336 JAEMBR010000002.1 GCA021406845_01530 CDS open 116476-117543 _na     355_aa galM Aldose 1-epimerase
337 JAEMBR010000002.1 GCA021406845_01531 CDS open 117750-118379 _na     209_aa Outer membrane protein beta-barrel domain-containing protein
338 JAEMBR010000002.1 GCA021406845_01532 CDS open 118599-118856 _na     85_aa Partial transposase in ISPg4
339 JAEMBR010000002.1 GCA021406845_01533 CDS open 119842-119973 _na     43_aa hypothetical protein
340 JAEMBR010000002.1 GCA021406845_01431 gene open 840-2372 dacB
341 JAEMBR010000002.1 GCA021406845_01432 gene open 2597-4267 cTD-A
342 JAEMBR010000002.1 GCA021406845_01433 gene open 5345-7876 cTD-A
343 JAEMBR010000002.1 GCA021406845_01434 gene open 8016-8501 ribH
344 JAEMBR010000002.1 GCA021406845_01435 gene open 8593-9279 cpoB
345 JAEMBR010000002.1 GCA021406845_01436 gene open 9465-10148 citB
346 JAEMBR010000002.1 GCA021406845_01437 gene open 10161-10622 kdpD
347 JAEMBR010000002.1 GCA021406845_01438 gene open 10634-12076
348 JAEMBR010000002.1 GCA021406845_01439 gene open 12358-12552 xseB
349 JAEMBR010000002.1 GCA021406845_01440 gene open 12549-13217 ispD
350 JAEMBR010000002.1 GCA021406845_01442 gene open 14636-15463 ftsX
351 JAEMBR010000002.1 GCA021406845_01443 gene open 15510-15737
352 JAEMBR010000002.1 GCA021406845_01444 gene open 15845-16687 uppP
353 JAEMBR010000002.1 GCA021406845_01445 gene open 16697-17473 truB
354 JAEMBR010000002.1 GCA021406845_01446 gene open 17491-18543 queA
355 JAEMBR010000002.1 GCA021406845_01447 gene open 18546-18989 folK
356 JAEMBR010000002.1 GCA021406845_01448 gene open 19002-20246 prtC
357 JAEMBR010000002.1 GCA021406845_01449 gene open 20302-20721 fadM
358 JAEMBR010000002.1 GCA021406845_01450 gene open 20806-21576 yaaA
359 JAEMBR010000002.1 GCA021406845_01451 gene open 21714-22289 sodB
360 JAEMBR010000002.1 GCA021406845_01452 gene open 22478-22831
361 JAEMBR010000002.1 GCA021406845_01454 gene open 22979-25579 prtT
362 JAEMBR010000002.1 GCA021406845_01455 gene open 25973-26113
363 JAEMBR010000002.1 GCA021406845_01456 gene open 26272-26403
364 JAEMBR010000002.1 GCA021406845_01457 gene open 26432-27082 hmuY
365 JAEMBR010000002.1 GCA021406845_01458 gene open 27097-29037 hmuR
366 JAEMBR010000002.1 GCA021406845_01459 gene open 29074-33483 cobN
367 JAEMBR010000002.1 GCA021406845_01460 gene open 33480-34157
368 JAEMBR010000002.1 GCA021406845_01461 gene open 34227-34805 tolQ
369 JAEMBR010000002.1 GCA021406845_01462 gene open 34811-35137
370 JAEMBR010000002.1 GCA021406845_01463 gene open 36187-37275 gcvT
371 JAEMBR010000002.1 GCA021406845_01464 gene open 37350-38414 rfbB
372 JAEMBR010000002.1 GCA021406845_01465 gene open 38421-39278 rfbD
373 JAEMBR010000002.1 GCA021406845_01466 gene open 39275-39865 rfbC
374 JAEMBR010000002.1 GCA021406845_01467 gene open 39880-40749 rfbA
375 JAEMBR010000002.1 GCA021406845_01468 gene open 40864-42819 mdoB
376 JAEMBR010000002.1 GCA021406845_01469 gene open 42904-44142 kdtA
377 JAEMBR010000002.1 GCA021406845_01470 gene open 44167-45882 gltX
378 JAEMBR010000002.1 GCA021406845_01471 gene open 46010-46267
379 JAEMBR010000002.1 GCA021406845_01472 gene open 46864-47247 pspE
380 JAEMBR010000002.1 GCA021406845_01473 gene open 47220-48635 pspE
381 JAEMBR010000002.1 GCA021406845_01474 gene open 48728-49534 tauE
382 JAEMBR010000002.1 GCA021406845_01475 gene open 49599-50303 crp
383 JAEMBR010000002.1 GCA021406845_01476 gene open 52229-52366
384 JAEMBR010000002.1 GCA021406845_01477 gene open 54722-55015 cas2
385 JAEMBR010000002.1 GCA021406845_01478 gene open 55063-56001 cas1
386 JAEMBR010000002.1 GCA021406845_01479 gene open 56014-60300 cas9
387 JAEMBR010000002.1 GCA021406845_01480 gene open 60662-62218 nadB
388 JAEMBR010000002.1 GCA021406845_01481 gene open 62250-63092 nadC
389 JAEMBR010000002.1 GCA021406845_01482 gene open 63112-64038 nadA
390 JAEMBR010000002.1 GCA021406845_01483 gene open 64138-65133 mMP0363
391 JAEMBR010000002.1 GCA021406845_01484 gene open 65255-66016 mMP0362
392 JAEMBR010000002.1 GCA021406845_01485 gene open 66013-66969 batD
393 JAEMBR010000002.1 GCA021406845_01486 gene open 66966-67949 batA
394 JAEMBR010000002.1 GCA021406845_01487 gene open 67960-68979 batB
395 JAEMBR010000002.1 GCA021406845_01488 gene open 68976-69719 batC
396 JAEMBR010000002.1 GCA021406845_01489 gene open 69900-71702 batD
397 JAEMBR010000002.1 GCA021406845_01490 gene open 71699-72607 batE
398 JAEMBR010000002.1 GCA021406845_01491 gene open 72628-73344 lpxF
399 JAEMBR010000002.1 GCA021406845_01492 gene open 73360-74127 cdaA
400 JAEMBR010000002.1 GCA021406845_01493 gene open 74187-75032 folP
401 JAEMBR010000002.1 GCA021406845_01494 gene open 75564-76661
402 JAEMBR010000002.1 GCA021406845_01496 gene open 77018-79102 pgpH
403 JAEMBR010000002.1 GCA021406845_01497 gene open 79150-79710 aroK
404 JAEMBR010000002.1 GCA021406845_01498 gene open 79649-81184 comEC
405 JAEMBR010000002.1 GCA021406845_01499 gene open 81191-81847 rpe
406 JAEMBR010000002.1 GCA021406845_01500 gene open 82190-85603 ileS
407 JAEMBR010000002.1 GCA021406845_01501 gene open 85673-86053 dksA
408 JAEMBR010000002.1 GCA021406845_01502 gene open 86057-86737 lspA
409 JAEMBR010000002.1 GCA021406845_01503 gene open 86734-87522
410 JAEMBR010000002.1 GCA021406845_01504 gene open 87556-88581
411 JAEMBR010000002.1 GCA021406845_01505 gene open 88616-89389 birA2
412 JAEMBR010000002.1 GCA021406845_01506 gene open 89361-89741 mmcQ
413 JAEMBR010000002.1 GCA021406845_01507 gene open 89812-90396 rdgB
414 JAEMBR010000002.1 GCA021406845_01508 gene open 90408-92714 porZ
415 JAEMBR010000002.1 GCA021406845_01509 gene open 92764-94167 pepC
416 JAEMBR010000002.1 GCA021406845_01510 gene open 94494-95240
417 JAEMBR010000002.1 GCA021406845_01511 gene open 96293-97444 oadB
418 JAEMBR010000002.1 GCA021406845_01512 gene open 97449-97883 pccA
419 JAEMBR010000002.1 GCA021406845_01513 gene open 97921-98157
420 JAEMBR010000002.1 GCA021406845_01514 gene open 98154-99095 oadG
421 JAEMBR010000002.1 GCA021406845_01515 gene open 99120-100673 mmdA
422 JAEMBR010000002.1 GCA021406845_01516 gene open 100772-101176 mce
423 JAEMBR010000002.1 GCA021406845_01517 gene open 101408-102163 sdhB
424 JAEMBR010000002.1 GCA021406845_01518 gene open 102192-104135 sdhA
425 JAEMBR010000002.1 GCA021406845_01519 gene open 104166-104858
426 JAEMBR010000002.1 GCA021406845_01520 gene open 105065-105577
427 JAEMBR010000002.1 GCA021406845_01521 gene open 105639-105848 copZ
428 JAEMBR010000002.1 GCA021406845_01522 gene open 105884-108091 zntA
429 JAEMBR010000002.1 GCA021406845_01523 gene open 108099-108602 wzb
430 JAEMBR010000002.1 GCA021406845_01524 gene open 108593-109927 norM
431 JAEMBR010000002.1 GCA021406845_01525 gene open 110083-111198 trxA
432 JAEMBR010000002.1 GCA021406845_01526 gene open 111434-113986 ftsK
433 JAEMBR010000002.1 GCA021406845_01527 gene open 114000-114647 lolA
434 JAEMBR010000002.1 GCA021406845_01528 gene open 114713-115138
435 JAEMBR010000002.1 GCA021406845_01529 gene open 115272-116426 galK
436 JAEMBR010000002.1 GCA021406845_01530 gene open 116476-117543 galM
437 JAEMBR010000002.1 GCA021406845_01531 gene open 117750-118379
438 JAEMBR010000002.1 GCA021406845_01532 gene open 118599-118856
439 JAEMBR010000002.1 GCA021406845_01533 gene open 119842-119973
440 JAEMBR010000002.1 GCA021406845_01441 gene open 13446-13519 trnD
441 JAEMBR010000002.1 GCA021406845_01453 gene open 22836-22909 trnR
442 JAEMBR010000002.1 GCA021406845_01495 gene open 76740-76814 trnH
443 JAEMBR010000002.1 GCA021406845_01441 tRNA open 13446-13519 trnD tRNA-Asp(gtc)
444 JAEMBR010000002.1 GCA021406845_01453 tRNA open 22836-22909 trnR tRNA-Arg(tct)
445 JAEMBR010000002.1 GCA021406845_01495 tRNA open 76740-76814 trnH tRNA-His(gtg)
446 JAEMBR010000003.1 GCA021406845_00548 CDS open 489-941 _na     150_aa rsuA RNA-binding S4 domain-containing protein
447 JAEMBR010000003.1 GCA021406845_00549 CDS open 925-1980 _na     351_aa rfaF ADP-heptose--LPS heptosyltransferase%2C putative
448 JAEMBR010000003.1 GCA021406845_00550 CDS open 2064-2669 _na     201_aa DUF4254 domain-containing protein
449 JAEMBR010000003.1 GCA021406845_00551 CDS open 2829-3245 _na     138_aa hypothetical protein
450 JAEMBR010000003.1 GCA021406845_00552 CDS open 3384-4532 _na     382_aa yqdH Iron-containing alcohol dehydrogenase
451 JAEMBR010000003.1 GCA021406845_00553 CDS open 4513-4770 _na     85_aa hypothetical protein
452 JAEMBR010000003.1 GCA021406845_00554 CDS open 4913-6001 _na     362_aa rfaB Glycosyl transferase%2C group 1 family protein
453 JAEMBR010000003.1 GCA021406845_00555 CDS open 6161-6379 _na     72_aa hypothetical protein
454 JAEMBR010000003.1 GCA021406845_00556 CDS open 6386-6478 _na     30_aa hypothetical protein
455 JAEMBR010000003.1 GCA021406845_00557 CDS open 7423-9249 _na     608_aa fAA1 Long-chain-fatty-acid-CoA ligase
456 JAEMBR010000003.1 GCA021406845_00558 CDS open 9526-10485 _na     319_aa prfB peptide chain release factor 2
457 JAEMBR010000003.1 GCA021406845_00559 CDS open 10529-12097 _na     522_aa ugd UDP-glucose 6-dehydrogenase
458 JAEMBR010000003.1 GCA021406845_00560 CDS open 12113-13156 _na     347_aa Putative O-antigen polymerase Wzy
459 JAEMBR010000003.1 GCA021406845_00561 CDS open 13177-13488 _na     103_aa hypothetical protein
460 JAEMBR010000003.1 GCA021406845_00562 CDS open 13535-14686 _na     383_aa rfaB Glycosyl transferase
461 JAEMBR010000003.1 GCA021406845_00563 CDS open 14692-15552 _na     286_aa wcaE Glycosyl transferase%2C group 2 family protein
462 JAEMBR010000003.1 GCA021406845_00564 CDS open 15684-16811 _na     375_aa DUF4369 domain-containing protein
463 JAEMBR010000003.1 GCA021406845_00565 CDS open 16992-18146 _na     384_aa wecE Pigmentation and extracellular proteinase regulator
464 JAEMBR010000003.1 GCA021406845_00566 CDS open 18143-19450 _na     435_aa rfbX PorS protein
465 JAEMBR010000003.1 GCA021406845_00567 CDS open 19413-21041 _na     542_aa asnB asparagine synthase (glutamine-hydrolyzing)
466 JAEMBR010000003.1 GCA021406845_00568 CDS open 21214-21828 _na     204_aa wcaJ Bacterial sugar transferase domain-containing protein
467 JAEMBR010000003.1 GCA021406845_00569 CDS open 21978-22154 _na     58_aa hypothetical protein
468 JAEMBR010000003.1 GCA021406845_00570 CDS open 22396-23337 _na     313_aa trxB thioredoxin-disulfide reductase
469 JAEMBR010000003.1 GCA021406845_00572 CDS open 23664-24116 _na     150_aa hypothetical protein
470 JAEMBR010000003.1 GCA021406845_00573 CDS open 24145-26775 _na     876_aa valS valine--tRNA ligase
471 JAEMBR010000003.1 GCA021406845_00574 CDS open 27500-27838 _na     112_aa hypothetical protein
472 JAEMBR010000003.1 GCA021406845_00575 CDS open 28042-30594 _na     850_aa nrdA adenosylcobalamin-dependent ribonucleoside-diphosphate reductase
473 JAEMBR010000003.1 GCA021406845_00576 CDS open 30867-32249 _na     460_aa xseA exodeoxyribonuclease VII large subunit
474 JAEMBR010000003.1 GCA021406845_00577 CDS open 32297-32764 _na     155_aa lrp Transcriptional regulator%2C AsnC Family
475 JAEMBR010000003.1 GCA021406845_00578 CDS open 33104-34291 _na     395_aa uraA Uracil permease
476 JAEMBR010000003.1 GCA021406845_00579 CDS open 34316-34966 _na     216_aa SAM-dependent methyltransferase
477 JAEMBR010000003.1 GCA021406845_00580 CDS open 34989-35552 _na     187_aa pduO Corrinoid adenosyltransferase
478 JAEMBR010000003.1 GCA021406845_00581 CDS open 35687-37030 _na     447_aa purB adenylosuccinate lyase
479 JAEMBR010000003.1 GCA021406845_00582 CDS open 37131-38450 _na     439_aa pseudouridine synthase
480 JAEMBR010000003.1 GCA021406845_00583 CDS open 38482-39891 _na     469_aa asnS asparagine--tRNA ligase
481 JAEMBR010000003.1 GCA021406845_00584 CDS open 40584-41144 _na     186_aa fldA Flavodoxin-like domain-containing protein
482 JAEMBR010000003.1 GCA021406845_00585 CDS open 41363-43954 _na     863_aa clpB ATP-dependent chaperone ClpB
483 JAEMBR010000003.1 GCA021406845_00586 CDS open 44619-45965 _na     448_aa norM Multidrug-efflux transporter
484 JAEMBR010000003.1 GCA021406845_00587 CDS open 46258-47148 _na     296_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD
485 JAEMBR010000003.1 GCA021406845_00588 CDS open 47269-48606 _na     445_aa ffh signal recognition particle protein
486 JAEMBR010000003.1 GCA021406845_00589 CDS open 48683-49039 _na     118_aa panD aspartate 1-decarboxylase
487 JAEMBR010000003.1 GCA021406845_00590 CDS open 49249-50553 _na     434_aa murF UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
488 JAEMBR010000003.1 GCA021406845_00591 CDS open 50547-52004 _na     485_aa rpoN RNA polymerase factor sigma-54
489 JAEMBR010000003.1 GCA021406845_00592 CDS open 51968-52735 _na     255_aa trmN6 tRNA1(Val) (adenine(37)-N6)-methyltransferase
490 JAEMBR010000003.1 GCA021406845_00593 CDS open 52761-54122 _na     453_aa rarA ATPase%2C AAA family
491 JAEMBR010000003.1 GCA021406845_00594 CDS open 54212-56860 _na     882_aa Carboxypeptidase-like regulatory domain-containing protein
492 JAEMBR010000003.1 GCA021406845_00595 CDS open 57252-58712 _na     486_aa putP Sodium:solute symporter family protein
493 JAEMBR010000003.1 GCA021406845_00596 CDS open 58709-59560 _na     283_aa badF BadF/BadG/BcrA/BcrD ATPase family protein
494 JAEMBR010000003.1 GCA021406845_00597 CDS open 59553-60377 _na     274_aa murQ N-acetylmuramic acid 6-phosphate etherase
495 JAEMBR010000003.1 GCA021406845_00600 CDS open 60713-61936 _na     407_aa rsmD THUMP-like domain-containing protein
496 JAEMBR010000003.1 GCA021406845_00601 CDS open 62244-64715 _na     823_aa alr bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase
497 JAEMBR010000003.1 GCA021406845_00602 CDS open 64751-65737 _na     328_aa GSCFA domain-containing protein
498 JAEMBR010000003.1 GCA021406845_00603 CDS open 65974-66195 _na     73_aa hypothetical protein
499 JAEMBR010000003.1 GCA021406845_00604 CDS open 66262-66543 _na     93_aa hypothetical protein
500 JAEMBR010000003.1 GCA021406845_00605 CDS open 66772-68208 _na     478_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD