HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fusobacterium polymorphum (GCA_022340115.1)

Select a Genome:
BAKTA Annotations for GCA_022340115.1
Genome Selected: Fusobacterium polymorphum
ContigsBases CDSrRNA tmRNAtRNA
42 2299006 2177 0 1 37
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4475 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 4475 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 JAIMZK010000009.1 GCA022340115_02190 CDS open 44469-45383 _na     304_aa cysK cysteine synthase A
2002 JAIMZK010000009.1 GCA022340115_02191 CDS open 45667-46866 _na     399_aa ribA bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II
2003 JAIMZK010000009.1 GCA022340115_02192 CDS open 46876-47532 _na     218_aa ribE riboflavin synthase
2004 JAIMZK010000009.1 GCA022340115_02193 CDS open 47748-48857 _na     369_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
2005 JAIMZK010000009.1 GCA022340115_02194 CDS open 48859-49320 _na     153_aa ribE 6%2C7-dimethyl-8-ribityllumazine synthase
2006 JAIMZK010000009.1 GCA022340115_02195 CDS open 49350-50249 _na     299_aa eamA EamA domain-containing protein
2007 JAIMZK010000009.1 GCA022340115_02196 CDS open 50597-52231 _na     544_aa 9-O-acetyl-N-acetylneuraminate esterase
2008 JAIMZK010000009.1 GCA022340115_02197 CDS open 52255-52737 _na     160_aa putative acetyltransferase
2009 JAIMZK010000009.1 GCA022340115_02198 CDS open 52772-53950 _na     392_aa Major facilitator superfamily (MFS) profile domain-containing protein
2010 JAIMZK010000009.1 GCA022340115_02199 CDS open 54127-54999 _na     290_aa mreC rod shape-determining protein MreC
2011 JAIMZK010000009.1 GCA022340115_02200 CDS open 54996-55574 _na     192_aa Peptidoglycan-binding protein
2012 JAIMZK010000009.1 GCA022340115_02201 CDS open 55585-56286 _na     233_aa recO DNA repair protein RecO
2013 JAIMZK010000009.1 GCA022340115_02202 CDS open 56280-56753 _na     157_aa ptsN PTS family porter
2014 JAIMZK010000009.1 GCA022340115_02203 CDS open 56773-57222 _na     149_aa nrdR transcriptional regulator NrdR
2015 JAIMZK010000009.1 GCA022340115_02204 CDS open 57243-58175 _na     310_aa fmt methionyl-tRNA formyltransferase
2016 JAIMZK010000009.1 GCA022340115_02205 CDS open 58169-59020 _na     283_aa folD Bifunctional protein FolD
2017 JAIMZK010000009.1 GCA022340115_02206 CDS open 59034-59495 _na     153_aa pheB ACT domain-containing protein
2018 JAIMZK010000009.1 GCA022340115_02207 CDS open 59547-60809 _na     420_aa mpfA HlyC/CorC family transporter
2019 JAIMZK010000009.1 GCA022340115_02208 CDS open 60806-61480 _na     224_aa Transporter
2020 JAIMZK010000009.1 GCA022340115_02209 CDS open 61495-62298 _na     267_aa Tetratricopeptide repeat protein
2021 JAIMZK010000009.1 GCA022340115_02210 CDS open 62313-62825 _na     170_aa apt adenine phosphoribosyltransferase
2022 JAIMZK010000009.1 GCA022340115_02211 CDS open 62844-65021 _na     725_aa spoT Guanosine-3'%2C5'-bis(Diphosphate) 3'-pyrophosphohydrolase
2023 JAIMZK010000009.1 GCA022340115_02212 CDS open 65036-66157 _na     373_aa tgt tRNA guanosine(34) transglycosylase Tgt
2024 JAIMZK010000009.1 GCA022340115_02213 CDS open 66391-67722 _na     443_aa mgtE magnesium transporter
2025 JAIMZK010000009.1 GCA022340115_02214 CDS open 67746-68333 _na     195_aa hypothetical protein
2026 JAIMZK010000009.1 GCA022340115_02215 CDS open 68372-68740 _na     122_aa Stress response protein Nst1
2027 JAIMZK010000009.1 GCA022340115_02216 CDS open 68858-70420 _na     520_aa type I restriction-modification system subunit M
2028 JAIMZK010000009.1 GCA022340115_02217 CDS open 70431-71861 _na     476_aa recG ATP-dependent DNA helicase RecG
2029 JAIMZK010000009.1 GCA022340115_02218 CDS open 72096-73394 _na     432_aa Type I restriction modification DNA specificity domain-containing protein
2030 JAIMZK010000009.1 GCA022340115_02219 CDS open 73406-74017 _na     203_aa Restriction endonuclease subunit S
2031 JAIMZK010000009.1 GCA022340115_02220 CDS open 74035-77076 _na     1013_aa Type I restriction enzyme endonuclease subunit
2032 JAIMZK010000009.1 GCA022340115_02221 CDS open 77118-78620 _na     500_aa Band 7 domain-containing protein
2033 JAIMZK010000009.1 GCA022340115_02222 CDS open 78743-80065 _na     440_aa norM Multidrug export protein MepA
2034 JAIMZK010000009.1 GCA022340115_02223 CDS open 80067-80660 _na     197_aa rutF Flavin reductase like domain-containing protein
2035 JAIMZK010000009.1 GCA022340115_02224 CDS open 80844-81359 _na     171_aa flavodoxin
2036 JAIMZK010000009.1 GCA022340115_02225 CDS open 81356-81736 _na     126_aa adhR HTH-type transcriptional regulator AdhR
2037 JAIMZK010000009.1 GCA022340115_02226 CDS open 81749-83500 _na     583_aa 1-deoxy-D-xylulose-5-phosphate synthase
2038 JAIMZK010000009.1 GCA022340115_02227 CDS open 83511-84002 _na     163_aa DUF4878 domain-containing protein
2039 JAIMZK010000009.1 GCA022340115_02228 CDS open 84019-84864 _na     281_aa Organophosphate reductase
2040 JAIMZK010000009.1 GCA022340115_02229 CDS open 85047-85196 _na     49_aa PF06912 domain protein
2041 JAIMZK010000009.1 GCA022340115_02149 gene open 301-1686
2042 JAIMZK010000009.1 GCA022340115_02150 gene open 1691-2635
2043 JAIMZK010000009.1 GCA022340115_02151 gene open 2649-3182
2044 JAIMZK010000009.1 GCA022340115_02152 gene open 3205-3948
2045 JAIMZK010000009.1 GCA022340115_02153 gene open 4016-4900 hflC
2046 JAIMZK010000009.1 GCA022340115_02154 gene open 4919-5338 nfeD
2047 JAIMZK010000009.1 GCA022340115_02155 gene open 5549-7018 ptsG2
2048 JAIMZK010000009.1 GCA022340115_02156 gene open 7217-7786
2049 JAIMZK010000009.1 GCA022340115_02157 gene open 7796-8422
2050 JAIMZK010000009.1 GCA022340115_02158 gene open 8553-10733 fusA
2051 JAIMZK010000009.1 GCA022340115_02159 gene open 10983-12410 glcD
2052 JAIMZK010000009.1 GCA022340115_02160 gene open 12446-13582
2053 JAIMZK010000009.1 GCA022340115_02161 gene open 13592-14371
2054 JAIMZK010000009.1 GCA022340115_02162 gene open 14384-15352
2055 JAIMZK010000009.1 GCA022340115_02163 gene open 15420-15803 lrgA
2056 JAIMZK010000009.1 GCA022340115_02164 gene open 15796-16515 lrgB
2057 JAIMZK010000009.1 GCA022340115_02165 gene open 16604-17590 dppD
2058 JAIMZK010000009.1 GCA022340115_02166 gene open 17571-18356 dppD
2059 JAIMZK010000009.1 GCA022340115_02167 gene open 18368-19948 ddpA
2060 JAIMZK010000009.1 GCA022340115_02168 gene open 19995-20825 nikC
2061 JAIMZK010000009.1 GCA022340115_02169 gene open 20826-21764 nikB
2062 JAIMZK010000009.1 GCA022340115_02170 gene open 22138-23829
2063 JAIMZK010000009.1 GCA022340115_02171 gene open 23963-24586
2064 JAIMZK010000009.1 GCA022340115_02172 gene open 24588-25307 zorC
2065 JAIMZK010000009.1 GCA022340115_02173 gene open 25294-25797 zorC
2066 JAIMZK010000009.1 GCA022340115_02174 gene open 25800-29291
2067 JAIMZK010000009.1 GCA022340115_02175 gene open 29512-30081
2068 JAIMZK010000009.1 GCA022340115_02176 gene open 30091-30717
2069 JAIMZK010000009.1 GCA022340115_02177 gene open 30817-31398
2070 JAIMZK010000009.1 GCA022340115_02178 gene open 31382-32629
2071 JAIMZK010000009.1 GCA022340115_02179 gene open 32768-34039 murA
2072 JAIMZK010000009.1 GCA022340115_02180 gene open 34049-34753 rlmB
2073 JAIMZK010000009.1 GCA022340115_02181 gene open 34764-35378 rpoE
2074 JAIMZK010000009.1 GCA022340115_02182 gene open 35386-37965 leuS
2075 JAIMZK010000009.1 GCA022340115_02183 gene open 37981-38175
2076 JAIMZK010000009.1 GCA022340115_02184 gene open 38217-39740 ywqK
2077 JAIMZK010000009.1 GCA022340115_02185 gene open 39756-41324
2078 JAIMZK010000009.1 GCA022340115_02186 gene open 41349-42017
2079 JAIMZK010000009.1 GCA022340115_02187 gene open 42030-42761
2080 JAIMZK010000009.1 GCA022340115_02188 gene open 42835-43749 metA
2081 JAIMZK010000009.1 GCA022340115_02189 gene open 43894-44430 epsC
2082 JAIMZK010000009.1 GCA022340115_02190 gene open 44469-45383 cysK
2083 JAIMZK010000009.1 GCA022340115_02191 gene open 45667-46866 ribA
2084 JAIMZK010000009.1 GCA022340115_02192 gene open 46876-47532 ribE
2085 JAIMZK010000009.1 GCA022340115_02193 gene open 47748-48857 ribD
2086 JAIMZK010000009.1 GCA022340115_02194 gene open 48859-49320 ribE
2087 JAIMZK010000009.1 GCA022340115_02195 gene open 49350-50249 eamA
2088 JAIMZK010000009.1 GCA022340115_02196 gene open 50597-52231
2089 JAIMZK010000009.1 GCA022340115_02197 gene open 52255-52737
2090 JAIMZK010000009.1 GCA022340115_02198 gene open 52772-53950
2091 JAIMZK010000009.1 GCA022340115_02199 gene open 54127-54999 mreC
2092 JAIMZK010000009.1 GCA022340115_02200 gene open 54996-55574
2093 JAIMZK010000009.1 GCA022340115_02201 gene open 55585-56286 recO
2094 JAIMZK010000009.1 GCA022340115_02202 gene open 56280-56753 ptsN
2095 JAIMZK010000009.1 GCA022340115_02203 gene open 56773-57222 nrdR
2096 JAIMZK010000009.1 GCA022340115_02204 gene open 57243-58175 fmt
2097 JAIMZK010000009.1 GCA022340115_02205 gene open 58169-59020 folD
2098 JAIMZK010000009.1 GCA022340115_02206 gene open 59034-59495 pheB
2099 JAIMZK010000009.1 GCA022340115_02207 gene open 59547-60809 mpfA
2100 JAIMZK010000009.1 GCA022340115_02208 gene open 60806-61480
2101 JAIMZK010000009.1 GCA022340115_02209 gene open 61495-62298
2102 JAIMZK010000009.1 GCA022340115_02210 gene open 62313-62825 apt
2103 JAIMZK010000009.1 GCA022340115_02211 gene open 62844-65021 spoT
2104 JAIMZK010000009.1 GCA022340115_02212 gene open 65036-66157 tgt
2105 JAIMZK010000009.1 GCA022340115_02213 gene open 66391-67722 mgtE
2106 JAIMZK010000009.1 GCA022340115_02214 gene open 67746-68333
2107 JAIMZK010000009.1 GCA022340115_02215 gene open 68372-68740
2108 JAIMZK010000009.1 GCA022340115_02216 gene open 68858-70420
2109 JAIMZK010000009.1 GCA022340115_02217 gene open 70431-71861 recG
2110 JAIMZK010000009.1 GCA022340115_02218 gene open 72096-73394
2111 JAIMZK010000009.1 GCA022340115_02219 gene open 73406-74017
2112 JAIMZK010000009.1 GCA022340115_02220 gene open 74035-77076
2113 JAIMZK010000009.1 GCA022340115_02221 gene open 77118-78620
2114 JAIMZK010000009.1 GCA022340115_02222 gene open 78743-80065 norM
2115 JAIMZK010000009.1 GCA022340115_02223 gene open 80067-80660 rutF
2116 JAIMZK010000009.1 GCA022340115_02224 gene open 80844-81359
2117 JAIMZK010000009.1 GCA022340115_02225 gene open 81356-81736 adhR
2118 JAIMZK010000009.1 GCA022340115_02226 gene open 81749-83500
2119 JAIMZK010000009.1 GCA022340115_02227 gene open 83511-84002
2120 JAIMZK010000009.1 GCA022340115_02228 gene open 84019-84864
2121 JAIMZK010000009.1 GCA022340115_02229 gene open 85047-85196
2122 JAIMZK010000010.1 GCA022340115_00016 gene open 12903-13235 RNaseP_bact_a
2123 JAIMZK010000010.1 GCA022340115_00039 gene open 34215-34267 6A
2124 JAIMZK010000010.1 GCA022340115_00040 gene open 34272-34322 6A
2125 JAIMZK010000010.1 GCA022340115_00016 ncRNA open 12903-13235 Bacterial RNase P class A
2126 JAIMZK010000010.1 GCA022340115_00039 ncRNA open 34215-34267 6A RNA
2127 JAIMZK010000010.1 GCA022340115_00040 ncRNA open 34272-34322 6A RNA
2128 JAIMZK010000010.1 GCA022340115_00001 CDS open 197-718 _na     173_aa hypothetical protein
2129 JAIMZK010000010.1 GCA022340115_00002 CDS open 745-1569 _na     274_aa KAP NTPase domain-containing protein
2130 JAIMZK010000010.1 GCA022340115_00003 CDS open 1762-3381 _na     539_aa uup ABC transporter domain-containing protein
2131 JAIMZK010000010.1 GCA022340115_00004 CDS open 3462-3680 _na     72_aa DUF2642 domain-containing protein
2132 JAIMZK010000010.1 GCA022340115_00005 CDS open 3752-4330 _na     192_aa pduO Corrinoid adenosyltransferase
2133 JAIMZK010000010.1 GCA022340115_00006 CDS open 4345-4809 _na     154_aa Single-stranded DNA-binding protein
2134 JAIMZK010000010.1 GCA022340115_00007 CDS open 4969-5637 _na     222_aa qdoI Cupin type-2 domain-containing protein
2135 JAIMZK010000010.1 GCA022340115_00008 CDS open 5938-7638 _na     566_aa pldB Methyltransferase
2136 JAIMZK010000010.1 GCA022340115_00009 CDS open 7646-8245 _na     199_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
2137 JAIMZK010000010.1 GCA022340115_00010 CDS open 8247-9050 _na     267_aa ynbB Phosphatidate cytidylyltransferase
2138 JAIMZK010000010.1 GCA022340115_00011 CDS open 9125-9319 _na     64_aa DUF1858 domain-containing protein
2139 JAIMZK010000010.1 GCA022340115_00012 CDS open 9484-10272 _na     262_aa tonB Energy transducer TonB
2140 JAIMZK010000010.1 GCA022340115_00013 CDS open 10281-10670 _na     129_aa exbD Transport energizing protein%2C ExbD/TolR family
2141 JAIMZK010000010.1 GCA022340115_00014 CDS open 10673-11281 _na     202_aa tolQ Ligand gated channel protein TolQ
2142 JAIMZK010000010.1 GCA022340115_00015 CDS open 11436-12860 _na     474_aa Solute-binding protein family 5 domain-containing protein
2143 JAIMZK010000010.1 GCA022340115_00017 CDS open 13244-13807 _na     187_aa TPM domain-containing protein
2144 JAIMZK010000010.1 GCA022340115_00018 CDS open 13823-14599 _na     258_aa nIF3 Nif3-like dinuclear metal center hexameric protein
2145 JAIMZK010000010.1 GCA022340115_00019 CDS open 14596-15420 _na     274_aa rpoD RNA polymerase sigma-70 region 2 domain-containing protein
2146 JAIMZK010000010.1 GCA022340115_00020 CDS open 15436-16692 _na     418_aa rpoD RNA polymerase sigma factor SigA
2147 JAIMZK010000010.1 GCA022340115_00021 CDS open 16721-18532 _na     603_aa dnaG DNA primase
2148 JAIMZK010000010.1 GCA022340115_00022 CDS open 18599-20290 _na     563_aa peptidylprolyl isomerase
2149 JAIMZK010000010.1 GCA022340115_00023 CDS open 20319-21704 _na     461_aa atoC Transcriptional regulator
2150 JAIMZK010000010.1 GCA022340115_00024 CDS open 21793-22812 _na     339_aa rseP RIP metalloprotease RseP
2151 JAIMZK010000010.1 GCA022340115_00025 CDS open 22813-23490 _na     225_aa Thymidylate kinase
2152 JAIMZK010000010.1 GCA022340115_00026 CDS open 23478-24641 _na     387_aa dxr 1-deoxy-D-xylulose-5-phosphate reductoisomerase
2153 JAIMZK010000010.1 GCA022340115_00027 CDS open 24655-25542 _na     295_aa Phosphatidate cytidylyltransferase
2154 JAIMZK010000010.1 GCA022340115_00028 CDS open 25535-26227 _na     230_aa uppS isoprenyl transferase
2155 JAIMZK010000010.1 GCA022340115_00029 CDS open 26361-27254 _na     297_aa ispA Dimethylallyltransferase
2156 JAIMZK010000010.1 GCA022340115_00030 CDS open 27256-27468 _na     70_aa xseB exodeoxyribonuclease VII small subunit
2157 JAIMZK010000010.1 GCA022340115_00031 CDS open 27674-28222 _na     182_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
2158 JAIMZK010000010.1 GCA022340115_00032 CDS open 28235-29266 _na     343_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
2159 JAIMZK010000010.1 GCA022340115_00033 CDS open 29247-30398 _na     383_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
2160 JAIMZK010000010.1 GCA022340115_00034 CDS open 30398-31471 _na     357_aa prfA peptide chain release factor 1
2161 JAIMZK010000010.1 GCA022340115_00035 CDS open 31496-31930 _na     144_aa GerMN domain-containing protein
2162 JAIMZK010000010.1 GCA022340115_00036 CDS open 31935-32963 _na     342_aa amiC N-acetylmuramoyl-L-alanine amidase
2163 JAIMZK010000010.1 GCA022340115_00037 CDS open 33059-33343 _na     94_aa yajC preprotein translocase subunit YajC
2164 JAIMZK010000010.1 GCA022340115_00038 CDS open 33738-34145 _na     135_aa tenpIN type III toxin-antitoxin system TenpIN family toxin
2165 JAIMZK010000010.1 GCA022340115_00041 CDS open 34392-34730 _na     112_aa Site-specific recombinase%2C phage integrase domain protein
2166 JAIMZK010000010.1 GCA022340115_00042 CDS open 35593-36567 _na     324_aa dppD ABC transporter domain-containing protein
2167 JAIMZK010000010.1 GCA022340115_00043 CDS open 36560-37567 _na     335_aa dppD Nickel import system ATP-binding protein NikD
2168 JAIMZK010000010.1 GCA022340115_00044 CDS open 37586-38455 _na     289_aa dppC ABC transmembrane type-1 domain-containing protein
2169 JAIMZK010000010.1 GCA022340115_00045 CDS open 38465-39391 _na     308_aa nikB nickel ABC transporter permease
2170 JAIMZK010000010.1 GCA022340115_00046 CDS open 39479-41005 _na     508_aa Solute-binding protein family 5 domain-containing protein
2171 JAIMZK010000010.1 GCA022340115_00047 CDS open 41236-42099 _na     287_aa rhaT EamA domain-containing protein
2172 JAIMZK010000010.1 GCA022340115_00048 CDS open 42102-43085 _na     327_aa Knr4/Smi1-like domain-containing protein
2173 JAIMZK010000010.1 GCA022340115_00049 CDS open 43154-43573 _na     139_aa Tetratrico peptide repeat group 5 domain-containing protein
2174 JAIMZK010000010.1 GCA022340115_00050 CDS open 43588-44328 _na     246_aa ompV MipA/OmpV family protein
2175 JAIMZK010000010.1 GCA022340115_00051 CDS open 44331-46127 _na     598_aa pgaB NodB-like y domain-containing protein
2176 JAIMZK010000010.1 GCA022340115_00052 CDS open 46138-47031 _na     297_aa ygiQ Radical SAM core domain-containing protein
2177 JAIMZK010000010.1 GCA022340115_00053 CDS open 47139-47942 _na     267_aa cof Hydrolase (HAD superfamily)
2178 JAIMZK010000010.1 GCA022340115_00054 CDS open 48120-48545 _na     141_aa Lysozyme inhibitor LprI-like N-terminal domain-containing protein
2179 JAIMZK010000010.1 GCA022340115_00055 CDS open 48736-49533 _na     265_aa tcmP Tetracenomycin polyketide synthesis O-methyltransferase TcmP
2180 JAIMZK010000010.1 GCA022340115_00056 CDS open 49568-51214 _na     548_aa fbpB ABC transmembrane type-1 domain-containing protein
2181 JAIMZK010000010.1 GCA022340115_00057 CDS open 51204-52319 _na     371_aa fbpC Fe(3+) ions import ATP-binding protein FbpC
2182 JAIMZK010000010.1 GCA022340115_00058 CDS open 52334-53395 _na     353_aa Iron (Fe3+) ABC superfamily ATP binding cassette transporter binding protein
2183 JAIMZK010000010.1 GCA022340115_00059 CDS open 53453-54148 _na     231_aa Putative N-acetylmannosamine-6-phosphate 2-epimerase
2184 JAIMZK010000010.1 GCA022340115_00060 CDS open 54186-55244 _na     352_aa afuA Iron(III)-binding protein
2185 JAIMZK010000010.1 GCA022340115_00061 CDS open 55349-57883 _na     844_aa recJ single-stranded-DNA-specific exonuclease RecJ
2186 JAIMZK010000010.1 GCA022340115_00062 CDS open 58072-59064 _na     330_aa lepB signal peptidase I
2187 JAIMZK010000010.1 GCA022340115_00063 CDS open 59253-59687 _na     144_aa rimI ribosomal protein S18-alanine N-acetyltransferase
2188 JAIMZK010000010.1 GCA022340115_00064 CDS open 59677-61110 _na     477_aa purB adenylosuccinate lyase
2189 JAIMZK010000010.1 GCA022340115_00065 CDS open 61139-61657 _na     172_aa Heptaprenyl diphosphate synthase
2190 JAIMZK010000010.1 GCA022340115_00066 CDS open 61683-63041 _na     452_aa glmM phosphoglucosamine mutase
2191 JAIMZK010000010.1 GCA022340115_00067 CDS open 63133-63507 _na     124_aa ATP synthase I
2192 JAIMZK010000010.1 GCA022340115_00068 CDS open 63543-64292 _na     249_aa atpB F0F1 ATP synthase subunit A
2193 JAIMZK010000010.1 GCA022340115_00069 CDS open 64350-64619 _na     89_aa atpE ATP synthase F0 subunit C
2194 JAIMZK010000010.1 GCA022340115_00070 CDS open 64660-65151 _na     163_aa atpF F0F1 ATP synthase subunit B
2195 JAIMZK010000010.1 GCA022340115_00071 CDS open 65148-65672 _na     174_aa atpH ATP synthase F1 subunit delta
2196 JAIMZK010000010.1 GCA022340115_00072 CDS open 65697-67199 _na     500_aa atpA F0F1 ATP synthase subunit alpha
2197 JAIMZK010000010.1 GCA022340115_00073 CDS open 67210-68058 _na     282_aa atpG ATP synthase F1 subunit gamma
2198 JAIMZK010000010.1 GCA022340115_00074 CDS open 68334-69722 _na     462_aa atpD F0F1 ATP synthase subunit beta
2199 JAIMZK010000010.1 GCA022340115_00075 CDS open 69732-70136 _na     134_aa atpC ATP synthase F1 subunit epsilon
2200 JAIMZK010000010.1 GCA022340115_00076 CDS open 70156-70527 _na     123_aa gloA Aldoketomutase
2201 JAIMZK010000010.1 GCA022340115_00001 gene open 197-718
2202 JAIMZK010000010.1 GCA022340115_00002 gene open 745-1569
2203 JAIMZK010000010.1 GCA022340115_00003 gene open 1762-3381 uup
2204 JAIMZK010000010.1 GCA022340115_00004 gene open 3462-3680
2205 JAIMZK010000010.1 GCA022340115_00005 gene open 3752-4330 pduO
2206 JAIMZK010000010.1 GCA022340115_00006 gene open 4345-4809
2207 JAIMZK010000010.1 GCA022340115_00007 gene open 4969-5637 qdoI
2208 JAIMZK010000010.1 GCA022340115_00008 gene open 5938-7638 pldB
2209 JAIMZK010000010.1 GCA022340115_00009 gene open 7646-8245 pgsA
2210 JAIMZK010000010.1 GCA022340115_00010 gene open 8247-9050 ynbB
2211 JAIMZK010000010.1 GCA022340115_00011 gene open 9125-9319
2212 JAIMZK010000010.1 GCA022340115_00012 gene open 9484-10272 tonB
2213 JAIMZK010000010.1 GCA022340115_00013 gene open 10281-10670 exbD
2214 JAIMZK010000010.1 GCA022340115_00014 gene open 10673-11281 tolQ
2215 JAIMZK010000010.1 GCA022340115_00015 gene open 11436-12860
2216 JAIMZK010000010.1 GCA022340115_00017 gene open 13244-13807
2217 JAIMZK010000010.1 GCA022340115_00018 gene open 13823-14599 nIF3
2218 JAIMZK010000010.1 GCA022340115_00019 gene open 14596-15420 rpoD
2219 JAIMZK010000010.1 GCA022340115_00020 gene open 15436-16692 rpoD
2220 JAIMZK010000010.1 GCA022340115_00021 gene open 16721-18532 dnaG
2221 JAIMZK010000010.1 GCA022340115_00022 gene open 18599-20290
2222 JAIMZK010000010.1 GCA022340115_00023 gene open 20319-21704 atoC
2223 JAIMZK010000010.1 GCA022340115_00024 gene open 21793-22812 rseP
2224 JAIMZK010000010.1 GCA022340115_00025 gene open 22813-23490
2225 JAIMZK010000010.1 GCA022340115_00026 gene open 23478-24641 dxr
2226 JAIMZK010000010.1 GCA022340115_00027 gene open 24655-25542
2227 JAIMZK010000010.1 GCA022340115_00028 gene open 25535-26227 uppS
2228 JAIMZK010000010.1 GCA022340115_00029 gene open 26361-27254 ispA
2229 JAIMZK010000010.1 GCA022340115_00030 gene open 27256-27468 xseB
2230 JAIMZK010000010.1 GCA022340115_00031 gene open 27674-28222 rsmD
2231 JAIMZK010000010.1 GCA022340115_00032 gene open 28235-29266 queA
2232 JAIMZK010000010.1 GCA022340115_00033 gene open 29247-30398 prmC
2233 JAIMZK010000010.1 GCA022340115_00034 gene open 30398-31471 prfA
2234 JAIMZK010000010.1 GCA022340115_00035 gene open 31496-31930
2235 JAIMZK010000010.1 GCA022340115_00036 gene open 31935-32963 amiC
2236 JAIMZK010000010.1 GCA022340115_00037 gene open 33059-33343 yajC
2237 JAIMZK010000010.1 GCA022340115_00038 gene open 33738-34145 tenpIN
2238 JAIMZK010000010.1 GCA022340115_00041 gene open 34392-34730
2239 JAIMZK010000010.1 GCA022340115_00042 gene open 35593-36567 dppD
2240 JAIMZK010000010.1 GCA022340115_00043 gene open 36560-37567 dppD
2241 JAIMZK010000010.1 GCA022340115_00044 gene open 37586-38455 dppC
2242 JAIMZK010000010.1 GCA022340115_00045 gene open 38465-39391 nikB
2243 JAIMZK010000010.1 GCA022340115_00046 gene open 39479-41005
2244 JAIMZK010000010.1 GCA022340115_00047 gene open 41236-42099 rhaT
2245 JAIMZK010000010.1 GCA022340115_00048 gene open 42102-43085
2246 JAIMZK010000010.1 GCA022340115_00049 gene open 43154-43573
2247 JAIMZK010000010.1 GCA022340115_00050 gene open 43588-44328 ompV
2248 JAIMZK010000010.1 GCA022340115_00051 gene open 44331-46127 pgaB
2249 JAIMZK010000010.1 GCA022340115_00052 gene open 46138-47031 ygiQ
2250 JAIMZK010000010.1 GCA022340115_00053 gene open 47139-47942 cof
2251 JAIMZK010000010.1 GCA022340115_00054 gene open 48120-48545
2252 JAIMZK010000010.1 GCA022340115_00055 gene open 48736-49533 tcmP
2253 JAIMZK010000010.1 GCA022340115_00056 gene open 49568-51214 fbpB
2254 JAIMZK010000010.1 GCA022340115_00057 gene open 51204-52319 fbpC
2255 JAIMZK010000010.1 GCA022340115_00058 gene open 52334-53395
2256 JAIMZK010000010.1 GCA022340115_00059 gene open 53453-54148
2257 JAIMZK010000010.1 GCA022340115_00060 gene open 54186-55244 afuA
2258 JAIMZK010000010.1 GCA022340115_00061 gene open 55349-57883 recJ
2259 JAIMZK010000010.1 GCA022340115_00062 gene open 58072-59064 lepB
2260 JAIMZK010000010.1 GCA022340115_00063 gene open 59253-59687 rimI
2261 JAIMZK010000010.1 GCA022340115_00064 gene open 59677-61110 purB
2262 JAIMZK010000010.1 GCA022340115_00065 gene open 61139-61657
2263 JAIMZK010000010.1 GCA022340115_00066 gene open 61683-63041 glmM
2264 JAIMZK010000010.1 GCA022340115_00067 gene open 63133-63507
2265 JAIMZK010000010.1 GCA022340115_00068 gene open 63543-64292 atpB
2266 JAIMZK010000010.1 GCA022340115_00069 gene open 64350-64619 atpE
2267 JAIMZK010000010.1 GCA022340115_00070 gene open 64660-65151 atpF
2268 JAIMZK010000010.1 GCA022340115_00071 gene open 65148-65672 atpH
2269 JAIMZK010000010.1 GCA022340115_00072 gene open 65697-67199 atpA
2270 JAIMZK010000010.1 GCA022340115_00073 gene open 67210-68058 atpG
2271 JAIMZK010000010.1 GCA022340115_00074 gene open 68334-69722 atpD
2272 JAIMZK010000010.1 GCA022340115_00075 gene open 69732-70136 atpC
2273 JAIMZK010000010.1 GCA022340115_00076 gene open 70156-70527 gloA
2274 JAIMZK010000011.1 GCA022340115_00077 gene open 6-72 RAGATH-18
2275 JAIMZK010000011.1 GCA022340115_00077 ncRNA open 6-72 RAGATH-18 RNA
2276 JAIMZK010000011.1 GCA022340115_00078 CDS open 126-1226 _na     366_aa mMP0363 ATPase dynein-related AAA domain-containing protein
2277 JAIMZK010000011.1 GCA022340115_00079 CDS open 1241-3517 _na     758_aa DUF5682 domain-containing protein
2278 JAIMZK010000011.1 GCA022340115_00080 CDS open 3526-4713 _na     395_aa VWA domain-containing protein
2279 JAIMZK010000011.1 GCA022340115_00081 CDS open 4744-6294 _na     516_aa citF citrate lyase subunit alpha
2280 JAIMZK010000011.1 GCA022340115_00082 CDS open 6297-7187 _na     296_aa citE citrate (pro-3S)-lyase subunit beta
2281 JAIMZK010000011.1 GCA022340115_00083 CDS open 7196-7480 _na     94_aa citD citrate lyase acyl carrier protein
2282 JAIMZK010000011.1 GCA022340115_00084 CDS open 7491-8324 _na     277_aa triphosphoribosyl-dephospho-CoA synthase
2283 JAIMZK010000011.1 GCA022340115_00085 CDS open 8317-9663 _na     448_aa oadA1 oxaloacetate decarboxylase subunit alpha
2284 JAIMZK010000011.1 GCA022340115_00086 CDS open 9762-11126 _na     454_aa 2-hydroxycarboxylate transporter family protein
2285 JAIMZK010000011.1 GCA022340115_00087 CDS open 11298-12095 _na     265_aa Transcriptional regulator
2286 JAIMZK010000011.1 GCA022340115_00088 CDS open 12107-12595 _na     162_aa ybaK Cys-tRNA(Pro) deacylase
2287 JAIMZK010000011.1 GCA022340115_00089 CDS open 12648-13592 _na     314_aa rluA Pseudouridine synthase
2288 JAIMZK010000011.1 GCA022340115_00090 CDS open 13783-14424 _na     213_aa ribonuclease HII
2289 JAIMZK010000011.1 GCA022340115_00091 CDS open 14436-14804 _na     122_aa yraN YraN family protein
2290 JAIMZK010000011.1 GCA022340115_00092 CDS open 14788-15015 _na     75_aa ypzJ Zinc finger protein
2291 JAIMZK010000011.1 GCA022340115_00093 CDS open 14990-15637 _na     215_aa putative competence protein ComFC
2292 JAIMZK010000011.1 GCA022340115_00094 CDS open 15651-16256 _na     201_aa Chemotaxis protein
2293 JAIMZK010000011.1 GCA022340115_00095 CDS open 16277-17032 _na     251_aa tpiA triose-phosphate isomerase
2294 JAIMZK010000011.1 GCA022340115_00096 CDS open 17056-18150 _na     364_aa ychF redox-regulated ATPase YchF
2295 JAIMZK010000011.1 GCA022340115_00097 CDS open 18234-18413 _na     59_aa rpmF 50S ribosomal protein L32
2296 JAIMZK010000011.1 GCA022340115_00098 CDS open 18477-19304 _na     275_aa ywqK Toxin-antitoxin system YwqK family antitoxin
2297 JAIMZK010000011.1 GCA022340115_00099 CDS open 19349-20110 _na     253_aa dppF ABC transporter domain-containing protein
2298 JAIMZK010000011.1 GCA022340115_00100 CDS open 20110-20811 _na     233_aa dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein
2299 JAIMZK010000011.1 GCA022340115_00101 CDS open 20811-21578 _na     255_aa dppC ABC transmembrane type-1 domain-containing protein
2300 JAIMZK010000011.1 GCA022340115_00102 CDS open 21578-22495 _na     305_aa dppB ABC transmembrane type-1 domain-containing protein
2301 JAIMZK010000011.1 GCA022340115_00103 CDS open 22505-23992 _na     495_aa ddpA Solute-binding protein family 5 domain-containing protein
2302 JAIMZK010000011.1 GCA022340115_00104 CDS open 24165-24917 _na     250_aa sseB Enhanced serine sensitivity protein SseB
2303 JAIMZK010000011.1 GCA022340115_00105 CDS open 25147-26433 _na     428_aa Membrane iron-sulfur containing protein FtrD-like domain-containing protein
2304 JAIMZK010000011.1 GCA022340115_00106 CDS open 26430-27716 _na     428_aa lolE Efflux ABC transporter%2C permease protein
2305 JAIMZK010000011.1 GCA022340115_00107 CDS open 27726-28928 _na     400_aa lolE ABC transporter permease
2306 JAIMZK010000011.1 GCA022340115_00108 CDS open 28932-29624 _na     230_aa lolD ABC transporter domain-containing protein
2307 JAIMZK010000011.1 GCA022340115_00109 CDS open 29841-30263 _na     140_aa tpp15 FMN-binding domain-containing protein
2308 JAIMZK010000011.1 GCA022340115_00110 CDS open 30325-30762 _na     145_aa DUF4418 domain-containing protein
2309 JAIMZK010000011.1 GCA022340115_00111 CDS open 30766-31971 _na     401_aa lolE ABC transporter permease
2310 JAIMZK010000011.1 GCA022340115_00112 CDS open 31980-32651 _na     223_aa lolD ABC transporter domain-containing protein
2311 JAIMZK010000011.1 GCA022340115_00113 CDS open 32764-33468 _na     234_aa ABM domain-containing protein
2312 JAIMZK010000011.1 GCA022340115_00114 CDS open 33533-34135 _na     200_aa Knr4/Smi1-like domain-containing protein
2313 JAIMZK010000011.1 GCA022340115_00115 CDS open 34158-34961 _na     267_aa 2-hydroxy-6-oxo-6-phenylhexa-2%2C4-dienoate hydrolase
2314 JAIMZK010000011.1 GCA022340115_00116 CDS open 34987-35769 _na     260_aa Serine/threonine protein kinase
2315 JAIMZK010000011.1 GCA022340115_00117 CDS open 35912-37210 _na     432_aa ATPase
2316 JAIMZK010000011.1 GCA022340115_00118 CDS open 37270-38028 _na     252_aa tatD Hydrolase%2C TatD family
2317 JAIMZK010000011.1 GCA022340115_00119 CDS open 38025-38393 _na     122_aa acpS Holo-[acyl-carrier-protein] synthase
2318 JAIMZK010000011.1 GCA022340115_00121 CDS open 38594-39520 _na     308_aa prfB peptide chain release factor 2
2319 JAIMZK010000011.1 GCA022340115_00122 CDS open 39529-40929 _na     466_aa hypothetical protein
2320 JAIMZK010000011.1 GCA022340115_00123 CDS open 40926-41522 _na     198_aa DUF304 domain-containing protein
2321 JAIMZK010000011.1 GCA022340115_00124 CDS open 41542-42126 _na     194_aa DUF304 domain-containing protein
2322 JAIMZK010000011.1 GCA022340115_00125 CDS open 42210-43742 _na     510_aa gltX glutamate--tRNA ligase
2323 JAIMZK010000011.1 GCA022340115_00126 CDS open 43791-44768 _na     325_aa trpS tryptophan--tRNA ligase
2324 JAIMZK010000011.1 GCA022340115_00127 CDS open 44836-45900 _na     354_aa alr alanine racemase
2325 JAIMZK010000011.1 GCA022340115_00128 CDS open 45979-46503 _na     174_aa Lipoprotein
2326 JAIMZK010000011.1 GCA022340115_00129 CDS open 46728-47642 _na     304_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
2327 JAIMZK010000011.1 GCA022340115_00130 CDS open 47654-48595 _na     313_aa accA acetyl-CoA carboxylase carboxyltransferase subunit alpha
2328 JAIMZK010000011.1 GCA022340115_00131 CDS open 48627-49595 _na     322_aa pfkA 6-phosphofructokinase
2329 JAIMZK010000011.1 GCA022340115_00132 CDS open 49615-49911 _na     98_aa yeeX DUF496 domain-containing protein
2330 JAIMZK010000011.1 GCA022340115_00133 CDS open 49924-50517 _na     197_aa recR recombination mediator RecR
2331 JAIMZK010000011.1 GCA022340115_00134 CDS open 50562-50909 _na     115_aa Lipoprotein
2332 JAIMZK010000011.1 GCA022340115_00135 CDS open 51072-51623 _na     183_aa Flavin reductase
2333 JAIMZK010000011.1 GCA022340115_00136 CDS open 51849-52370 _na     173_aa pyrR bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR
2334 JAIMZK010000011.1 GCA022340115_00137 CDS open 52457-53347 _na     296_aa pyrB aspartate carbamoyltransferase catalytic subunit
2335 JAIMZK010000011.1 GCA022340115_00138 CDS open 53541-54818 _na     425_aa pyrC dihydroorotase
2336 JAIMZK010000011.1 GCA022340115_00139 CDS open 54834-55910 _na     358_aa carA carbamoyl phosphate synthase small subunit
2337 JAIMZK010000011.1 GCA022340115_00140 CDS open 56175-59351 _na     1058_aa carB carbamoyl-phosphate synthase large subunit
2338 JAIMZK010000011.1 GCA022340115_00141 CDS open 59390-60181 _na     263_aa pyrK dihydroorotate dehydrogenase electron transfer subunit
2339 JAIMZK010000011.1 GCA022340115_00142 CDS open 60194-61108 _na     304_aa pyrD dihydroorotate dehydrogenase
2340 JAIMZK010000011.1 GCA022340115_00143 CDS open 61105-61782 _na     225_aa Cytoplasmic protein
2341 JAIMZK010000011.1 GCA022340115_00144 CDS open 61819-62574 _na     251_aa hypothetical protein
2342 JAIMZK010000011.1 GCA022340115_00145 CDS open 62591-63304 _na     237_aa pyrF orotidine-5'-phosphate decarboxylase
2343 JAIMZK010000011.1 GCA022340115_00146 CDS open 63294-64178 _na     294_aa bamD Outer membrane protein assembly factor BamD
2344 JAIMZK010000011.1 GCA022340115_00147 CDS open 64189-64806 _na     205_aa pyrE Orotate phosphoribosyltransferase
2345 JAIMZK010000011.1 GCA022340115_00148 CDS open 64806-65585 _na     259_aa Histidinol-phosphatase
2346 JAIMZK010000011.1 GCA022340115_00149 CDS open 65614-66222 _na     202_aa Initiator Rep protein domain-containing protein
2347 JAIMZK010000011.1 GCA022340115_00150 CDS open 66313-66663 _na     116_aa rplS 50S ribosomal protein L19
2348 JAIMZK010000011.1 GCA022340115_00151 CDS open 66711-67484 _na     257_aa Glutamate racemase
2349 JAIMZK010000011.1 GCA022340115_00078 gene open 126-1226 mMP0363
2350 JAIMZK010000011.1 GCA022340115_00079 gene open 1241-3517
2351 JAIMZK010000011.1 GCA022340115_00080 gene open 3526-4713
2352 JAIMZK010000011.1 GCA022340115_00081 gene open 4744-6294 citF
2353 JAIMZK010000011.1 GCA022340115_00082 gene open 6297-7187 citE
2354 JAIMZK010000011.1 GCA022340115_00083 gene open 7196-7480 citD
2355 JAIMZK010000011.1 GCA022340115_00084 gene open 7491-8324
2356 JAIMZK010000011.1 GCA022340115_00085 gene open 8317-9663 oadA1
2357 JAIMZK010000011.1 GCA022340115_00086 gene open 9762-11126
2358 JAIMZK010000011.1 GCA022340115_00087 gene open 11298-12095
2359 JAIMZK010000011.1 GCA022340115_00088 gene open 12107-12595 ybaK
2360 JAIMZK010000011.1 GCA022340115_00089 gene open 12648-13592 rluA
2361 JAIMZK010000011.1 GCA022340115_00090 gene open 13783-14424
2362 JAIMZK010000011.1 GCA022340115_00091 gene open 14436-14804 yraN
2363 JAIMZK010000011.1 GCA022340115_00092 gene open 14788-15015 ypzJ
2364 JAIMZK010000011.1 GCA022340115_00093 gene open 14990-15637
2365 JAIMZK010000011.1 GCA022340115_00094 gene open 15651-16256
2366 JAIMZK010000011.1 GCA022340115_00095 gene open 16277-17032 tpiA
2367 JAIMZK010000011.1 GCA022340115_00096 gene open 17056-18150 ychF
2368 JAIMZK010000011.1 GCA022340115_00097 gene open 18234-18413 rpmF
2369 JAIMZK010000011.1 GCA022340115_00098 gene open 18477-19304 ywqK
2370 JAIMZK010000011.1 GCA022340115_00099 gene open 19349-20110 dppF
2371 JAIMZK010000011.1 GCA022340115_00100 gene open 20110-20811
2372 JAIMZK010000011.1 GCA022340115_00101 gene open 20811-21578 dppC
2373 JAIMZK010000011.1 GCA022340115_00102 gene open 21578-22495 dppB
2374 JAIMZK010000011.1 GCA022340115_00103 gene open 22505-23992 ddpA
2375 JAIMZK010000011.1 GCA022340115_00104 gene open 24165-24917 sseB
2376 JAIMZK010000011.1 GCA022340115_00105 gene open 25147-26433
2377 JAIMZK010000011.1 GCA022340115_00106 gene open 26430-27716 lolE
2378 JAIMZK010000011.1 GCA022340115_00107 gene open 27726-28928 lolE
2379 JAIMZK010000011.1 GCA022340115_00108 gene open 28932-29624 lolD
2380 JAIMZK010000011.1 GCA022340115_00109 gene open 29841-30263 tpp15
2381 JAIMZK010000011.1 GCA022340115_00110 gene open 30325-30762
2382 JAIMZK010000011.1 GCA022340115_00111 gene open 30766-31971 lolE
2383 JAIMZK010000011.1 GCA022340115_00112 gene open 31980-32651 lolD
2384 JAIMZK010000011.1 GCA022340115_00113 gene open 32764-33468
2385 JAIMZK010000011.1 GCA022340115_00114 gene open 33533-34135
2386 JAIMZK010000011.1 GCA022340115_00115 gene open 34158-34961
2387 JAIMZK010000011.1 GCA022340115_00116 gene open 34987-35769
2388 JAIMZK010000011.1 GCA022340115_00117 gene open 35912-37210
2389 JAIMZK010000011.1 GCA022340115_00118 gene open 37270-38028 tatD
2390 JAIMZK010000011.1 GCA022340115_00119 gene open 38025-38393 acpS
2391 JAIMZK010000011.1 GCA022340115_00121 gene open 38594-39520 prfB
2392 JAIMZK010000011.1 GCA022340115_00122 gene open 39529-40929
2393 JAIMZK010000011.1 GCA022340115_00123 gene open 40926-41522
2394 JAIMZK010000011.1 GCA022340115_00124 gene open 41542-42126
2395 JAIMZK010000011.1 GCA022340115_00125 gene open 42210-43742 gltX
2396 JAIMZK010000011.1 GCA022340115_00126 gene open 43791-44768 trpS
2397 JAIMZK010000011.1 GCA022340115_00127 gene open 44836-45900 alr
2398 JAIMZK010000011.1 GCA022340115_00128 gene open 45979-46503
2399 JAIMZK010000011.1 GCA022340115_00129 gene open 46728-47642 accD
2400 JAIMZK010000011.1 GCA022340115_00130 gene open 47654-48595 accA
2401 JAIMZK010000011.1 GCA022340115_00131 gene open 48627-49595 pfkA
2402 JAIMZK010000011.1 GCA022340115_00132 gene open 49615-49911 yeeX
2403 JAIMZK010000011.1 GCA022340115_00133 gene open 49924-50517 recR
2404 JAIMZK010000011.1 GCA022340115_00134 gene open 50562-50909
2405 JAIMZK010000011.1 GCA022340115_00135 gene open 51072-51623
2406 JAIMZK010000011.1 GCA022340115_00136 gene open 51849-52370 pyrR
2407 JAIMZK010000011.1 GCA022340115_00137 gene open 52457-53347 pyrB
2408 JAIMZK010000011.1 GCA022340115_00138 gene open 53541-54818 pyrC
2409 JAIMZK010000011.1 GCA022340115_00139 gene open 54834-55910 carA
2410 JAIMZK010000011.1 GCA022340115_00140 gene open 56175-59351 carB
2411 JAIMZK010000011.1 GCA022340115_00141 gene open 59390-60181 pyrK
2412 JAIMZK010000011.1 GCA022340115_00142 gene open 60194-61108 pyrD
2413 JAIMZK010000011.1 GCA022340115_00143 gene open 61105-61782
2414 JAIMZK010000011.1 GCA022340115_00144 gene open 61819-62574
2415 JAIMZK010000011.1 GCA022340115_00145 gene open 62591-63304 pyrF
2416 JAIMZK010000011.1 GCA022340115_00146 gene open 63294-64178 bamD
2417 JAIMZK010000011.1 GCA022340115_00147 gene open 64189-64806 pyrE
2418 JAIMZK010000011.1 GCA022340115_00148 gene open 64806-65585
2419 JAIMZK010000011.1 GCA022340115_00149 gene open 65614-66222
2420 JAIMZK010000011.1 GCA022340115_00150 gene open 66313-66663 rplS
2421 JAIMZK010000011.1 GCA022340115_00151 gene open 66711-67484
2422 JAIMZK010000012.1 repeat_region open 39000-40236 CRISPR array with 19 repeats of length 30%2C consensus sequence ATTTATGTATTTCTATATTAGAATTTAAAT and spacer length 36
2423 JAIMZK010000012.1 repeat_region open 40331-44436 CRISPR array with 62 repeats of length 29%2C consensus sequence ATTTATGTATTTCTATATTAGAATTTAAA and spacer length 37
2424 JAIMZK010000012.1 GCA022340115_00152 CDS open 92-391 _na     99_aa yhbY ribosome assembly RNA-binding protein YhbY
2425 JAIMZK010000012.1 GCA022340115_00153 CDS open 405-2207 _na     600_aa dxs 1-deoxy-D-xylulose-5-phosphate synthase
2426 JAIMZK010000012.1 GCA022340115_00154 CDS open 2191-3015 _na     274_aa yhaM HD domain-containing protein
2427 JAIMZK010000012.1 GCA022340115_00155 CDS open 2993-3793 _na     266_aa putative rRNA methyltransferase
2428 JAIMZK010000012.1 GCA022340115_00156 CDS open 3807-5126 _na     439_aa Peptidase%2C S41 family
2429 JAIMZK010000012.1 GCA022340115_00157 CDS open 5137-5844 _na     235_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
2430 JAIMZK010000012.1 GCA022340115_00158 CDS open 5825-6694 _na     289_aa ylqF ribosome biogenesis GTPase YlqF
2431 JAIMZK010000012.1 GCA022340115_00159 CDS open 6706-7482 _na     258_aa NAD+ synthase
2432 JAIMZK010000012.1 GCA022340115_00160 CDS open 7489-7857 _na     122_aa hypothetical protein
2433 JAIMZK010000012.1 GCA022340115_00161 CDS open 7970-8776 _na     268_aa Outer membrane protein beta-barrel domain-containing protein
2434 JAIMZK010000012.1 GCA022340115_00162 CDS open 8837-9892 _na     351_aa dinB DNA polymerase IV
2435 JAIMZK010000012.1 GCA022340115_00163 CDS open 10064-11326 _na     420_aa ATPase AAA-type core domain-containing protein
2436 JAIMZK010000012.1 GCA022340115_00164 CDS open 11329-11970 _na     213_aa rloB RloB family protein
2437 JAIMZK010000012.1 GCA022340115_00165 CDS open 11984-12793 _na     269_aa hypothetical protein
2438 JAIMZK010000012.1 GCA022340115_00166 CDS open 12812-15508 _na     898_aa trlF TrlF family AAA-like ATPase
2439 JAIMZK010000012.1 GCA022340115_00167 CDS open 15740-16003 _na     87_aa DUF4176 domain-containing protein
2440 JAIMZK010000012.1 GCA022340115_00168 CDS open 16390-16689 _na     99_aa GTP cyclohydrolase
2441 JAIMZK010000012.1 GCA022340115_00169 CDS open 16802-17077 _na     91_aa Tat pathway signal sequence domain protein
2442 JAIMZK010000012.1 GCA022340115_00170 CDS open 17107-17859 _na     250_aa hypothetical protein
2443 JAIMZK010000012.1 GCA022340115_00171 CDS open 17871-20078 _na     735_aa zntA putative cadmium-transporting ATPase
2444 JAIMZK010000012.1 GCA022340115_00172 CDS open 20085-20468 _na     127_aa Cation transporter
2445 JAIMZK010000012.1 GCA022340115_00173 CDS open 20478-20975 _na     165_aa DUF697 domain-containing protein
2446 JAIMZK010000012.1 GCA022340115_00174 CDS open 21239-21991 _na     250_aa hisJ Solute-binding protein family 3/N-terminal domain-containing protein
2447 JAIMZK010000012.1 GCA022340115_00175 CDS open 22006-23184 _na     392_aa abgB Peptidase M20 domain-containing protein 2
2448 JAIMZK010000012.1 GCA022340115_00176 CDS open 23646-25247 _na     533_aa nikA nickel ABC transporter substrate-binding protein
2449 JAIMZK010000012.1 GCA022340115_00177 CDS open 25342-25995 _na     217_aa ABC transporter permease subunit
2450 JAIMZK010000012.1 GCA022340115_00178 CDS open 26010-26270 _na     86_aa ABC transporter permease subunit
2451 JAIMZK010000012.1 GCA022340115_00179 CDS open 26267-27091 _na     274_aa opp1C nickel/cobalt ABC transporter permease
2452 JAIMZK010000012.1 GCA022340115_00180 CDS open 27091-27897 _na     268_aa Oligopeptide ABC superfamily ATP binding cassette transporter ABC protein
2453 JAIMZK010000012.1 GCA022340115_00181 CDS open 27887-28663 _na     258_aa ABC transporter%2C ATP-binding protein
2454 JAIMZK010000012.1 GCA022340115_00182 CDS open 28801-29559 _na     252_aa NAD-dependent protein deacylase
2455 JAIMZK010000012.1 GCA022340115_00183 CDS open 29752-30048 _na     98_aa hypothetical protein
2456 JAIMZK010000012.1 GCA022340115_00184 CDS open 30137-30889 _na     250_aa cas6 CRISPR-associated endoribonuclease Cas6
2457 JAIMZK010000012.1 GCA022340115_00185 CDS open 30879-32423 _na     514_aa cas8a1 type I CRISPR-associated protein Cas8a1/Csx8
2458 JAIMZK010000012.1 GCA022340115_00186 CDS open 32436-33338 _na     300_aa cas7i type I-B CRISPR-associated protein Cas7/Cst2/DevR
2459 JAIMZK010000012.1 GCA022340115_00187 CDS open 33351-34451 _na     366_aa CRISPR-associated protein Cas5
2460 JAIMZK010000012.1 GCA022340115_00188 CDS open 34543-36981 _na     812_aa cas3 HD Cas3-type domain-containing protein
2461 JAIMZK010000012.1 GCA022340115_00189 CDS open 37024-37518 _na     164_aa cas4 CRISPR-associated protein Cas4
2462 JAIMZK010000012.1 GCA022340115_00190 CDS open 37530-38522 _na     330_aa cas1b type I-B CRISPR-associated endonuclease Cas1b
2463 JAIMZK010000012.1 GCA022340115_00191 CDS open 38527-38805 _na     92_aa cas2 CRISPR-associated endonuclease Cas2
2464 JAIMZK010000012.1 GCA022340115_00192 CDS open 44909-45913 _na     334_aa pta phosphate acetyltransferase
2465 JAIMZK010000012.1 GCA022340115_00193 CDS open 45981-47177 _na     398_aa ackA Acetate kinase
2466 JAIMZK010000012.1 GCA022340115_00194 CDS open 47325-50900 _na     1191_aa nifJ pyruvate:ferredoxin (flavodoxin) oxidoreductase
2467 JAIMZK010000012.1 GCA022340115_00195 CDS open 51054-51815 _na     253_aa 3-methyl-2-oxobutanoate hydroxymethyltransferase
2468 JAIMZK010000012.1 GCA022340115_00196 CDS open 51812-52672 _na     286_aa HTH lysR-type domain-containing protein
2469 JAIMZK010000012.1 GCA022340115_00197 CDS open 52689-54665 _na     658_aa aconitate hydratase
2470 JAIMZK010000012.1 GCA022340115_00198 CDS open 54667-55698 _na     343_aa Hemagglutinin
2471 JAIMZK010000012.1 GCA022340115_00199 CDS open 55707-56969 _na     420_aa matC Dicarboxylate carrier MatC N-terminal domain-containing protein
2472 JAIMZK010000012.1 GCA022340115_00200 CDS open 57089-58045 _na     318_aa ldh L-lactate dehydrogenase
2473 JAIMZK010000012.1 GCA022340115_00201 CDS open 58066-59280 _na     404_aa Major facilitator superfamily (MFS) profile domain-containing protein
2474 JAIMZK010000012.1 GCA022340115_00202 CDS open 59322-60341 _na     339_aa mglC galactose/methyl galactoside ABC transporter permease MglC
2475 JAIMZK010000012.1 GCA022340115_00203 CDS open 60362-61864 _na     500_aa mglA galactose/methyl galactoside ABC transporter ATP-binding protein MglA
2476 JAIMZK010000012.1 GCA022340115_00204 CDS open 61956-62981 _na     341_aa mglB galactose/glucose ABC transporter substrate-binding protein MglB
2477 JAIMZK010000012.1 GCA022340115_00205 CDS open 63178-64125 _na     315_aa nagC Glucokinase
2478 JAIMZK010000012.1 GCA022340115_00206 CDS open 64147-65289 _na     380_aa Metallo-beta-lactamase domain-containing protein
2479 JAIMZK010000012.1 GCA022340115_00207 CDS open 65300-66223 _na     307_aa trxB Thioredoxin reductase
2480 JAIMZK010000012.1 GCA022340115_00208 CDS open 66245-66868 _na     207_aa gloB Metallo-beta-lactamase domain-containing protein
2481 JAIMZK010000012.1 GCA022340115_00152 gene open 92-391 yhbY
2482 JAIMZK010000012.1 GCA022340115_00153 gene open 405-2207 dxs
2483 JAIMZK010000012.1 GCA022340115_00154 gene open 2191-3015 yhaM
2484 JAIMZK010000012.1 GCA022340115_00155 gene open 2993-3793
2485 JAIMZK010000012.1 GCA022340115_00156 gene open 3807-5126
2486 JAIMZK010000012.1 GCA022340115_00157 gene open 5137-5844 rsmI
2487 JAIMZK010000012.1 GCA022340115_00158 gene open 5825-6694 ylqF
2488 JAIMZK010000012.1 GCA022340115_00159 gene open 6706-7482
2489 JAIMZK010000012.1 GCA022340115_00160 gene open 7489-7857
2490 JAIMZK010000012.1 GCA022340115_00161 gene open 7970-8776
2491 JAIMZK010000012.1 GCA022340115_00162 gene open 8837-9892 dinB
2492 JAIMZK010000012.1 GCA022340115_00163 gene open 10064-11326
2493 JAIMZK010000012.1 GCA022340115_00164 gene open 11329-11970 rloB
2494 JAIMZK010000012.1 GCA022340115_00165 gene open 11984-12793
2495 JAIMZK010000012.1 GCA022340115_00166 gene open 12812-15508 trlF
2496 JAIMZK010000012.1 GCA022340115_00167 gene open 15740-16003
2497 JAIMZK010000012.1 GCA022340115_00168 gene open 16390-16689
2498 JAIMZK010000012.1 GCA022340115_00169 gene open 16802-17077
2499 JAIMZK010000012.1 GCA022340115_00170 gene open 17107-17859
2500 JAIMZK010000012.1 GCA022340115_00171 gene open 17871-20078 zntA