HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fusobacterium polymorphum (GCA_022340115.1)

Select a Genome:
BAKTA Annotations for GCA_022340115.1
Genome Selected: Fusobacterium polymorphum
ContigsBases CDSrRNA tmRNAtRNA
42 2299006 2177 0 1 37
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4475 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 4475 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer
Range
(bp)
Show Sequences
(length) NA / AA
BAKTA
Gene
BAKTA
GeneProduct
2501 JAIMZK010000012.1 GCA022340115_00172 gene open 20085-20468
2502 JAIMZK010000012.1 GCA022340115_00173 gene open 20478-20975
2503 JAIMZK010000012.1 GCA022340115_00174 gene open 21239-21991 hisJ
2504 JAIMZK010000012.1 GCA022340115_00175 gene open 22006-23184 abgB
2505 JAIMZK010000012.1 GCA022340115_00176 gene open 23646-25247 nikA
2506 JAIMZK010000012.1 GCA022340115_00177 gene open 25342-25995
2507 JAIMZK010000012.1 GCA022340115_00178 gene open 26010-26270
2508 JAIMZK010000012.1 GCA022340115_00179 gene open 26267-27091 opp1C
2509 JAIMZK010000012.1 GCA022340115_00180 gene open 27091-27897
2510 JAIMZK010000012.1 GCA022340115_00181 gene open 27887-28663
2511 JAIMZK010000012.1 GCA022340115_00182 gene open 28801-29559
2512 JAIMZK010000012.1 GCA022340115_00183 gene open 29752-30048
2513 JAIMZK010000012.1 GCA022340115_00184 gene open 30137-30889 cas6
2514 JAIMZK010000012.1 GCA022340115_00185 gene open 30879-32423 cas8a1
2515 JAIMZK010000012.1 GCA022340115_00186 gene open 32436-33338 cas7i
2516 JAIMZK010000012.1 GCA022340115_00187 gene open 33351-34451
2517 JAIMZK010000012.1 GCA022340115_00188 gene open 34543-36981 cas3
2518 JAIMZK010000012.1 GCA022340115_00189 gene open 37024-37518 cas4
2519 JAIMZK010000012.1 GCA022340115_00190 gene open 37530-38522 cas1b
2520 JAIMZK010000012.1 GCA022340115_00191 gene open 38527-38805 cas2
2521 JAIMZK010000012.1 GCA022340115_00192 gene open 44909-45913 pta
2522 JAIMZK010000012.1 GCA022340115_00193 gene open 45981-47177 ackA
2523 JAIMZK010000012.1 GCA022340115_00194 gene open 47325-50900 nifJ
2524 JAIMZK010000012.1 GCA022340115_00195 gene open 51054-51815
2525 JAIMZK010000012.1 GCA022340115_00196 gene open 51812-52672
2526 JAIMZK010000012.1 GCA022340115_00197 gene open 52689-54665
2527 JAIMZK010000012.1 GCA022340115_00198 gene open 54667-55698
2528 JAIMZK010000012.1 GCA022340115_00199 gene open 55707-56969 matC
2529 JAIMZK010000012.1 GCA022340115_00200 gene open 57089-58045 ldh
2530 JAIMZK010000012.1 GCA022340115_00201 gene open 58066-59280
2531 JAIMZK010000012.1 GCA022340115_00202 gene open 59322-60341 mglC
2532 JAIMZK010000012.1 GCA022340115_00203 gene open 60362-61864 mglA
2533 JAIMZK010000012.1 GCA022340115_00204 gene open 61956-62981 mglB
2534 JAIMZK010000012.1 GCA022340115_00205 gene open 63178-64125 nagC
2535 JAIMZK010000012.1 GCA022340115_00206 gene open 64147-65289
2536 JAIMZK010000012.1 GCA022340115_00207 gene open 65300-66223 trxB
2537 JAIMZK010000012.1 GCA022340115_00208 gene open 66245-66868 gloB
2538 JAIMZK010000013.1 GCA022340115_00209 CDS open 223-534 _na     103_aa trxA thioredoxin
2539 JAIMZK010000013.1 GCA022340115_00210 CDS open 676-1791 _na     371_aa eutG Alcohol dehydrogenase
2540 JAIMZK010000013.1 GCA022340115_00211 CDS open 1810-2952 _na     380_aa phosphoserine phosphatase
2541 JAIMZK010000013.1 GCA022340115_00212 CDS open 2967-4070 _na     367_aa serB phosphoserine phosphatase
2542 JAIMZK010000013.1 GCA022340115_00213 CDS open 4094-4543 _na     149_aa eutQ Ethanolamine utilization protein EutQ
2543 JAIMZK010000013.1 GCA022340115_00214 CDS open 4554-5636 _na     360_aa eutH ethanolamine utilization protein EutH
2544 JAIMZK010000013.1 GCA022340115_00215 CDS open 5636-5983 _na     115_aa Phage protein
2545 JAIMZK010000013.1 GCA022340115_00216 CDS open 5996-6244 _na     82_aa eutN Ethanolamine utilization protein EutN
2546 JAIMZK010000013.1 GCA022340115_00217 CDS open 6246-6836 _na     196_aa Ethanolamine utilization protein
2547 JAIMZK010000013.1 GCA022340115_00218 CDS open 6833-7600 _na     255_aa eutT Cobalamin adenosyltransferase-like domain-containing protein
2548 JAIMZK010000013.1 GCA022340115_00219 CDS open 7860-9308 _na     482_aa adhE acetaldehyde dehydrogenase (acetylating)
2549 JAIMZK010000013.1 GCA022340115_00220 CDS open 9417-9701 _na     94_aa eutM ethanolamine utilization microcompartment protein EutM
2550 JAIMZK010000013.1 GCA022340115_00221 CDS open 9743-10189 _na     148_aa BMC domain-containing protein
2551 JAIMZK010000013.1 GCA022340115_00222 CDS open 10200-10853 _na     217_aa eutL ethanolamine utilization microcompartment protein EutL
2552 JAIMZK010000013.1 GCA022340115_00223 CDS open 11056-11943 _na     295_aa eutC ethanolamine ammonia-lyase subunit EutC
2553 JAIMZK010000013.1 GCA022340115_00224 CDS open 11955-13322 _na     455_aa eutB Ethanolamine ammonia-lyase large subunit
2554 JAIMZK010000013.1 GCA022340115_00225 CDS open 13349-14779 _na     476_aa eutA ethanolamine ammonia-lyase reactivating factor EutA
2555 JAIMZK010000013.1 GCA022340115_00226 CDS open 14893-16281 _na     462_aa histidine kinase
2556 JAIMZK010000013.1 GCA022340115_00227 CDS open 16281-16859 _na     192_aa amiR Response regulator
2557 JAIMZK010000013.1 GCA022340115_00228 CDS open 16849-17286 _na     145_aa eutP Ethanolamine utilization protein%2C EutP
2558 JAIMZK010000013.1 GCA022340115_00229 CDS open 17289-17630 _na     113_aa eutS BMC circularly permuted domain-containing protein
2559 JAIMZK010000013.1 GCA022340115_00230 CDS open 17632-18459 _na     275_aa folP dihydropteroate synthase
2560 JAIMZK010000013.1 GCA022340115_00231 CDS open 18446-19270 _na     274_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
2561 JAIMZK010000013.1 GCA022340115_00232 CDS open 19520-20071 _na     183_aa folE GTP cyclohydrolase I FolE
2562 JAIMZK010000013.1 GCA022340115_00233 CDS open 20082-22142 _na     686_aa glyS Glycine--tRNA ligase beta subunit
2563 JAIMZK010000013.1 GCA022340115_00234 CDS open 22462-23334 _na     290_aa glyQ glycine--tRNA ligase subunit alpha
2564 JAIMZK010000013.1 GCA022340115_00235 CDS open 23338-23796 _na     152_aa lspA signal peptidase II
2565 JAIMZK010000013.1 GCA022340115_00236 CDS open 23805-26606 _na     933_aa ileS isoleucine--tRNA ligase
2566 JAIMZK010000013.1 GCA022340115_00237 CDS open 26603-29020 _na     805_aa kinE histidine kinase
2567 JAIMZK010000013.1 GCA022340115_00238 CDS open 29041-31320 _na     759_aa tex S1 motif domain-containing protein
2568 JAIMZK010000013.1 GCA022340115_00239 CDS open 31401-31550 _na     49_aa Integral membrane protein
2569 JAIMZK010000013.1 GCA022340115_00240 CDS open 31553-31981 _na     142_aa Histidine kinase
2570 JAIMZK010000013.1 GCA022340115_00241 CDS open 31984-32331 _na     115_aa DUF3024 domain-containing protein
2571 JAIMZK010000013.1 GCA022340115_00242 CDS open 32565-32843 _na     92_aa hypothetical protein
2572 JAIMZK010000013.1 GCA022340115_00243 CDS open 32859-33554 _na     231_aa HEAT repeat domain-containing protein
2573 JAIMZK010000013.1 GCA022340115_00244 CDS open 33650-34618 _na     322_aa ywqK Toxin-antitoxin system YwqK family antitoxin
2574 JAIMZK010000013.1 GCA022340115_00245 CDS open 34602-35531 _na     309_aa Phage head-tail adapter protein
2575 JAIMZK010000013.1 GCA022340115_00246 CDS open 35615-35974 _na     119_aa DUF1353 domain-containing protein
2576 JAIMZK010000013.1 GCA022340115_00247 CDS open 36134-36400 _na     88_aa hypothetical protein
2577 JAIMZK010000013.1 GCA022340115_00248 CDS open 36508-37038 _na     176_aa Late embryogenesis abundant protein
2578 JAIMZK010000013.1 GCA022340115_00249 CDS open 37106-37429 _na     107_aa Late embryogenesis abundant protein
2579 JAIMZK010000013.1 GCA022340115_00250 CDS open 37525-39015 _na     496_aa ypwA Metal-dependent carboxypeptidase
2580 JAIMZK010000013.1 GCA022340115_00251 CDS open 39052-40332 _na     426_aa Serine-type D-Ala-D-Ala carboxypeptidase
2581 JAIMZK010000013.1 GCA022340115_00252 CDS open 40415-40801 _na     128_aa nifU Fe-S cluster assembly scaffold protein NifU
2582 JAIMZK010000013.1 GCA022340115_00253 CDS open 40864-42060 _na     398_aa nifS cysteine desulfurase NifS
2583 JAIMZK010000013.1 GCA022340115_00254 CDS open 42139-42789 _na     216_aa nth endonuclease III
2584 JAIMZK010000013.1 GCA022340115_00255 CDS open 42875-43327 _na     150_aa N-acetyltransferase domain-containing protein
2585 JAIMZK010000013.1 GCA022340115_00256 CDS open 43469-44677 _na     402_aa tyrS tyrosine--tRNA ligase
2586 JAIMZK010000013.1 GCA022340115_00257 CDS open 44670-45953 _na     427_aa brnQ branched-chain amino acid transport system II carrier protein
2587 JAIMZK010000013.1 GCA022340115_00258 CDS open 45955-46317 _na     120_aa arsC Arsenate reductase
2588 JAIMZK010000013.1 GCA022340115_00259 CDS open 46503-48224 _na     573_aa Urocanate reductase
2589 JAIMZK010000013.1 GCA022340115_00260 CDS open 48370-48912 _na     180_aa Caldesmon (CDM)
2590 JAIMZK010000013.1 GCA022340115_00261 CDS open 49234-49992 _na     252_aa 4-nitrophenylphosphatase
2591 JAIMZK010000013.1 GCA022340115_00262 CDS open 50053-50814 _na     253_aa exodeoxyribonuclease III
2592 JAIMZK010000013.1 GCA022340115_00263 CDS open 50817-51266 _na     149_aa aroQ type II 3-dehydroquinate dehydratase
2593 JAIMZK010000013.1 GCA022340115_00264 CDS open 51247-52050 _na     267_aa Shikimate dehydrogenase (NADP(+))
2594 JAIMZK010000013.1 GCA022340115_00265 CDS open 52047-52307 _na     86_aa pheA Shikimate 5-dehydrogenase
2595 JAIMZK010000013.1 GCA022340115_00266 CDS open 52270-52815 _na     181_aa MORN repeat protein
2596 JAIMZK010000013.1 GCA022340115_00267 CDS open 52929-54173 _na     414_aa ftsW Rod shape-determining protein FtsW
2597 JAIMZK010000013.1 GCA022340115_00268 CDS open 54251-54439 _na     62_aa ynzC DUF896 domain-containing protein
2598 JAIMZK010000013.1 GCA022340115_00269 CDS open 54449-55834 _na     461_aa asnS asparagine--tRNA ligase
2599 JAIMZK010000013.1 GCA022340115_00270 CDS open 55846-56397 _na     183_aa rnmV ribonuclease M5
2600 JAIMZK010000013.1 GCA022340115_00271 CDS open 56539-57168 _na     209_aa PD-(D/E)XK nuclease family transposase
2601 JAIMZK010000013.1 GCA022340115_00272 CDS open 57231-57641 _na     136_aa yopX YopX protein domain-containing protein
2602 JAIMZK010000013.1 GCA022340115_00273 CDS open 57644-58018 _na     124_aa hypothetical protein
2603 JAIMZK010000013.1 GCA022340115_00274 CDS open 58063-58383 _na     106_aa Peptidylprolyl isomerase
2604 JAIMZK010000013.1 GCA022340115_00275 CDS open 58432-58773 _na     113_aa hypothetical protein
2605 JAIMZK010000013.1 GCA022340115_00276 CDS open 58799-59362 _na     187_aa hypothetical protein
2606 JAIMZK010000013.1 GCA022340115_00277 CDS open 59399-60340 _na     313_aa EF-hand domain-containing protein
2607 JAIMZK010000013.1 GCA022340115_00278 CDS open 60384-60794 _na     136_aa yopX YopX protein domain-containing protein
2608 JAIMZK010000013.1 GCA022340115_00279 CDS open 61011-61343 _na     110_aa Peptidylprolyl isomerase
2609 JAIMZK010000013.1 GCA022340115_00280 CDS open 61574-61861 _na     95_aa hypothetical protein
2610 JAIMZK010000013.1 GCA022340115_00281 CDS open 61988-62386 _na     132_aa Testis-expressed sequence 9 protein
2611 JAIMZK010000013.1 GCA022340115_00209 gene open 223-534 trxA
2612 JAIMZK010000013.1 GCA022340115_00210 gene open 676-1791 eutG
2613 JAIMZK010000013.1 GCA022340115_00211 gene open 1810-2952
2614 JAIMZK010000013.1 GCA022340115_00212 gene open 2967-4070 serB
2615 JAIMZK010000013.1 GCA022340115_00213 gene open 4094-4543 eutQ
2616 JAIMZK010000013.1 GCA022340115_00214 gene open 4554-5636 eutH
2617 JAIMZK010000013.1 GCA022340115_00215 gene open 5636-5983
2618 JAIMZK010000013.1 GCA022340115_00216 gene open 5996-6244 eutN
2619 JAIMZK010000013.1 GCA022340115_00217 gene open 6246-6836
2620 JAIMZK010000013.1 GCA022340115_00218 gene open 6833-7600 eutT
2621 JAIMZK010000013.1 GCA022340115_00219 gene open 7860-9308 adhE
2622 JAIMZK010000013.1 GCA022340115_00220 gene open 9417-9701 eutM
2623 JAIMZK010000013.1 GCA022340115_00221 gene open 9743-10189
2624 JAIMZK010000013.1 GCA022340115_00222 gene open 10200-10853 eutL
2625 JAIMZK010000013.1 GCA022340115_00223 gene open 11056-11943 eutC
2626 JAIMZK010000013.1 GCA022340115_00224 gene open 11955-13322 eutB
2627 JAIMZK010000013.1 GCA022340115_00225 gene open 13349-14779 eutA
2628 JAIMZK010000013.1 GCA022340115_00226 gene open 14893-16281
2629 JAIMZK010000013.1 GCA022340115_00227 gene open 16281-16859 amiR
2630 JAIMZK010000013.1 GCA022340115_00228 gene open 16849-17286 eutP
2631 JAIMZK010000013.1 GCA022340115_00229 gene open 17289-17630 eutS
2632 JAIMZK010000013.1 GCA022340115_00230 gene open 17632-18459 folP
2633 JAIMZK010000013.1 GCA022340115_00231 gene open 18446-19270 folK
2634 JAIMZK010000013.1 GCA022340115_00232 gene open 19520-20071 folE
2635 JAIMZK010000013.1 GCA022340115_00233 gene open 20082-22142 glyS
2636 JAIMZK010000013.1 GCA022340115_00234 gene open 22462-23334 glyQ
2637 JAIMZK010000013.1 GCA022340115_00235 gene open 23338-23796 lspA
2638 JAIMZK010000013.1 GCA022340115_00236 gene open 23805-26606 ileS
2639 JAIMZK010000013.1 GCA022340115_00237 gene open 26603-29020 kinE
2640 JAIMZK010000013.1 GCA022340115_00238 gene open 29041-31320 tex
2641 JAIMZK010000013.1 GCA022340115_00239 gene open 31401-31550
2642 JAIMZK010000013.1 GCA022340115_00240 gene open 31553-31981
2643 JAIMZK010000013.1 GCA022340115_00241 gene open 31984-32331
2644 JAIMZK010000013.1 GCA022340115_00242 gene open 32565-32843
2645 JAIMZK010000013.1 GCA022340115_00243 gene open 32859-33554
2646 JAIMZK010000013.1 GCA022340115_00244 gene open 33650-34618 ywqK
2647 JAIMZK010000013.1 GCA022340115_00245 gene open 34602-35531
2648 JAIMZK010000013.1 GCA022340115_00246 gene open 35615-35974
2649 JAIMZK010000013.1 GCA022340115_00247 gene open 36134-36400
2650 JAIMZK010000013.1 GCA022340115_00248 gene open 36508-37038
2651 JAIMZK010000013.1 GCA022340115_00249 gene open 37106-37429
2652 JAIMZK010000013.1 GCA022340115_00250 gene open 37525-39015 ypwA
2653 JAIMZK010000013.1 GCA022340115_00251 gene open 39052-40332
2654 JAIMZK010000013.1 GCA022340115_00252 gene open 40415-40801 nifU
2655 JAIMZK010000013.1 GCA022340115_00253 gene open 40864-42060 nifS
2656 JAIMZK010000013.1 GCA022340115_00254 gene open 42139-42789 nth
2657 JAIMZK010000013.1 GCA022340115_00255 gene open 42875-43327
2658 JAIMZK010000013.1 GCA022340115_00256 gene open 43469-44677 tyrS
2659 JAIMZK010000013.1 GCA022340115_00257 gene open 44670-45953 brnQ
2660 JAIMZK010000013.1 GCA022340115_00258 gene open 45955-46317 arsC
2661 JAIMZK010000013.1 GCA022340115_00259 gene open 46503-48224
2662 JAIMZK010000013.1 GCA022340115_00260 gene open 48370-48912
2663 JAIMZK010000013.1 GCA022340115_00261 gene open 49234-49992
2664 JAIMZK010000013.1 GCA022340115_00262 gene open 50053-50814
2665 JAIMZK010000013.1 GCA022340115_00263 gene open 50817-51266 aroQ
2666 JAIMZK010000013.1 GCA022340115_00264 gene open 51247-52050
2667 JAIMZK010000013.1 GCA022340115_00265 gene open 52047-52307 pheA
2668 JAIMZK010000013.1 GCA022340115_00266 gene open 52270-52815
2669 JAIMZK010000013.1 GCA022340115_00267 gene open 52929-54173 ftsW
2670 JAIMZK010000013.1 GCA022340115_00268 gene open 54251-54439 ynzC
2671 JAIMZK010000013.1 GCA022340115_00269 gene open 54449-55834 asnS
2672 JAIMZK010000013.1 GCA022340115_00270 gene open 55846-56397 rnmV
2673 JAIMZK010000013.1 GCA022340115_00271 gene open 56539-57168
2674 JAIMZK010000013.1 GCA022340115_00272 gene open 57231-57641 yopX
2675 JAIMZK010000013.1 GCA022340115_00273 gene open 57644-58018
2676 JAIMZK010000013.1 GCA022340115_00274 gene open 58063-58383
2677 JAIMZK010000013.1 GCA022340115_00275 gene open 58432-58773
2678 JAIMZK010000013.1 GCA022340115_00276 gene open 58799-59362
2679 JAIMZK010000013.1 GCA022340115_00277 gene open 59399-60340
2680 JAIMZK010000013.1 GCA022340115_00278 gene open 60384-60794 yopX
2681 JAIMZK010000013.1 GCA022340115_00279 gene open 61011-61343
2682 JAIMZK010000013.1 GCA022340115_00280 gene open 61574-61861
2683 JAIMZK010000013.1 GCA022340115_00281 gene open 61988-62386
2684 JAIMZK010000014.1 regulatory_region open 254-360 TPP riboswitch aptamer (THI element)
2685 JAIMZK010000014.1 GCA022340115_00282 CDS open 418-1251 _na     277_aa thiD hydroxymethylpyrimidine kinase
2686 JAIMZK010000014.1 GCA022340115_00283 CDS open 1261-1881 _na     206_aa Thiamine-phosphate synthase
2687 JAIMZK010000014.1 GCA022340115_00284 CDS open 1898-3199 _na     433_aa thiC phosphomethylpyrimidine synthase ThiC
2688 JAIMZK010000014.1 GCA022340115_00285 CDS open 3212-3406 _na     64_aa thiS sulfur carrier protein ThiS
2689 JAIMZK010000014.1 GCA022340115_00286 CDS open 3410-4030 _na     206_aa thiF sulfur carrier protein ThiS adenylyltransferase ThiF
2690 JAIMZK010000014.1 GCA022340115_00287 CDS open 4031-4804 _na     257_aa thiG Thiazole synthase
2691 JAIMZK010000014.1 GCA022340115_00288 CDS open 4804-5934 _na     376_aa thiH 2-iminoacetate synthase ThiH
2692 JAIMZK010000014.1 GCA022340115_00289 CDS open 5937-6557 _na     206_aa thiamine phosphate synthase
2693 JAIMZK010000014.1 GCA022340115_00290 CDS open 6805-7131 _na     108_aa V-type sodium ATP synthase subunit G
2694 JAIMZK010000014.1 GCA022340115_00291 CDS open 7118-9034 _na     638_aa ntpI V-type ATP synthase subunit I
2695 JAIMZK010000014.1 GCA022340115_00292 CDS open 9314-9796 _na     160_aa V-type ATP synthase subunit K
2696 JAIMZK010000014.1 GCA022340115_00293 CDS open 9812-10363 _na     183_aa V-type proton ATPase subunit E
2697 JAIMZK010000014.1 GCA022340115_00294 CDS open 10373-11374 _na     333_aa ntpC V-type ATP synthase subunit C
2698 JAIMZK010000014.1 GCA022340115_00295 CDS open 11367-11675 _na     102_aa atpF V-type ATP synthase subunit F
2699 JAIMZK010000014.1 GCA022340115_00296 CDS open 11693-13462 _na     589_aa ntpA V-type ATP synthase alpha chain
2700 JAIMZK010000014.1 GCA022340115_00297 CDS open 13455-14831 _na     458_aa V-type ATP synthase beta chain
2701 JAIMZK010000014.1 GCA022340115_00298 CDS open 14842-15477 _na     211_aa atpD V-type ATP synthase subunit D
2702 JAIMZK010000014.1 GCA022340115_00299 CDS open 15678-17312 _na     544_aa AAA-ATPase-like domain-containing protein
2703 JAIMZK010000014.1 GCA022340115_00300 CDS open 17341-18135 _na     264_aa dapF Diaminopimelate epimerase DapF
2704 JAIMZK010000014.1 GCA022340115_00301 CDS open 18348-18959 _na     203_aa pabA Glutamine amidotransferase%2C class I
2705 JAIMZK010000014.1 GCA022340115_00302 CDS open 18943-20295 _na     450_aa pabB aminodeoxychorismate synthase component I
2706 JAIMZK010000014.1 GCA022340115_00303 CDS open 20289-21038 _na     249_aa Aminodeoxychorismate lyase
2707 JAIMZK010000014.1 GCA022340115_00304 CDS open 21010-21654 _na     214_aa pcp pyroglutamyl-peptidase I
2708 JAIMZK010000014.1 GCA022340115_00305 CDS open 21766-23331 _na     521_aa trkA RCK C-terminal domain-containing protein
2709 JAIMZK010000014.1 GCA022340115_00306 CDS open 23481-24854 _na     457_aa norM Multidrug export protein MepA
2710 JAIMZK010000014.1 GCA022340115_00307 CDS open 24869-26215 _na     448_aa trkH Potassium uptake protein%2C TrkH family
2711 JAIMZK010000014.1 GCA022340115_00308 CDS open 26225-26881 _na     218_aa trkA Trk system potassium uptake protein TrkA
2712 JAIMZK010000014.1 GCA022340115_00309 CDS open 26890-28791 _na     633_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
2713 JAIMZK010000014.1 GCA022340115_00310 CDS open 28793-29491 _na     232_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
2714 JAIMZK010000014.1 GCA022340115_00311 CDS open 29590-29874 _na     94_aa DUF1871 domain-containing protein
2715 JAIMZK010000014.1 GCA022340115_00312 CDS open 29908-30762 _na     284_aa DUF58 domain-containing protein
2716 JAIMZK010000014.1 GCA022340115_00313 CDS open 30815-31561 _na     248_aa Lipoprotein
2717 JAIMZK010000014.1 GCA022340115_00314 CDS open 31574-34216 _na     880_aa secA preprotein translocase subunit SecA
2718 JAIMZK010000014.1 GCA022340115_00315 CDS open 34275-36365 _na     696_aa ligA NAD-dependent DNA ligase LigA
2719 JAIMZK010000014.1 GCA022340115_00316 CDS open 36470-37039 _na     189_aa NlpC/P60 domain-containing protein
2720 JAIMZK010000014.1 GCA022340115_00317 CDS open 37036-38250 _na     404_aa ATPase
2721 JAIMZK010000014.1 GCA022340115_00318 CDS open 38338-39831 _na     497_aa CRISPR-associated protein
2722 JAIMZK010000014.1 GCA022340115_00319 CDS open 39864-41156 _na     430_aa ATPase
2723 JAIMZK010000014.1 GCA022340115_00320 CDS open 41289-42140 _na     283_aa ATP-binding cassette domain-containing protein
2724 JAIMZK010000014.1 GCA022340115_00321 CDS open 42174-42635 _na     153_aa ABC transporter ATP-binding protein
2725 JAIMZK010000014.1 GCA022340115_00322 CDS open 42611-44320 _na     569_aa mdlB ABC transporter
2726 JAIMZK010000014.1 GCA022340115_00323 CDS open 44313-46052 _na     579_aa mdlB ABC transporter
2727 JAIMZK010000014.1 GCA022340115_00324 CDS open 46156-46728 _na     190_aa acrR HTH tetR-type domain-containing protein
2728 JAIMZK010000014.1 GCA022340115_00325 CDS open 47027-47377 _na     116_aa plasmid mobilization protein
2729 JAIMZK010000014.1 GCA022340115_00326 CDS open 47383-48309 _na     308_aa relaxase/mobilization nuclease domain-containing protein
2730 JAIMZK010000014.1 GCA022340115_00327 CDS open 48740-51283 _na     847_aa DEAD/DEAH box helicase
2731 JAIMZK010000014.1 GCA022340115_00328 CDS open 51314-52129 _na     271_aa Abortive infection protein-like C-terminal domain-containing protein
2732 JAIMZK010000014.1 GCA022340115_00329 CDS open 52166-52378 _na     70_aa yozG HTH cro/C1-type domain-containing protein
2733 JAIMZK010000014.1 GCA022340115_00330 CDS open 52519-52635 _na     38_aa hypothetical protein
2734 JAIMZK010000014.1 GCA022340115_00331 CDS open 53449-54153 _na     234_aa Transposase IS110-like N-terminal domain-containing protein
2735 JAIMZK010000014.1 GCA022340115_00332 CDS open 54405-54623 _na     72_aa hypothetical protein
2736 JAIMZK010000014.1 GCA022340115_00333 CDS open 55330-56691 _na     453_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
2737 JAIMZK010000014.1 GCA022340115_00334 CDS open 56693-56950 _na     85_aa Septum formation initiator
2738 JAIMZK010000014.1 GCA022340115_00335 CDS open 56952-57896 _na     314_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
2739 JAIMZK010000014.1 GCA022340115_00336 CDS open 58153-58428 _na     91_aa yggT YggT family protein
2740 JAIMZK010000014.1 GCA022340115_00337 CDS open 58442-59005 _na     187_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
2741 JAIMZK010000014.1 GCA022340115_00338 CDS open 59021-61120 _na     699_aa pnp polyribonucleotide nucleotidyltransferase
2742 JAIMZK010000014.1 GCA022340115_00339 CDS open 61308-62285 _na     325_aa Aldose 1-epimerase
2743 JAIMZK010000014.1 GCA022340115_00282 gene open 418-1251 thiD
2744 JAIMZK010000014.1 GCA022340115_00283 gene open 1261-1881
2745 JAIMZK010000014.1 GCA022340115_00284 gene open 1898-3199 thiC
2746 JAIMZK010000014.1 GCA022340115_00285 gene open 3212-3406 thiS
2747 JAIMZK010000014.1 GCA022340115_00286 gene open 3410-4030 thiF
2748 JAIMZK010000014.1 GCA022340115_00287 gene open 4031-4804 thiG
2749 JAIMZK010000014.1 GCA022340115_00288 gene open 4804-5934 thiH
2750 JAIMZK010000014.1 GCA022340115_00289 gene open 5937-6557
2751 JAIMZK010000014.1 GCA022340115_00290 gene open 6805-7131
2752 JAIMZK010000014.1 GCA022340115_00291 gene open 7118-9034 ntpI
2753 JAIMZK010000014.1 GCA022340115_00292 gene open 9314-9796
2754 JAIMZK010000014.1 GCA022340115_00293 gene open 9812-10363
2755 JAIMZK010000014.1 GCA022340115_00294 gene open 10373-11374 ntpC
2756 JAIMZK010000014.1 GCA022340115_00295 gene open 11367-11675 atpF
2757 JAIMZK010000014.1 GCA022340115_00296 gene open 11693-13462 ntpA
2758 JAIMZK010000014.1 GCA022340115_00297 gene open 13455-14831
2759 JAIMZK010000014.1 GCA022340115_00298 gene open 14842-15477 atpD
2760 JAIMZK010000014.1 GCA022340115_00299 gene open 15678-17312
2761 JAIMZK010000014.1 GCA022340115_00300 gene open 17341-18135 dapF
2762 JAIMZK010000014.1 GCA022340115_00301 gene open 18348-18959 pabA
2763 JAIMZK010000014.1 GCA022340115_00302 gene open 18943-20295 pabB
2764 JAIMZK010000014.1 GCA022340115_00303 gene open 20289-21038
2765 JAIMZK010000014.1 GCA022340115_00304 gene open 21010-21654 pcp
2766 JAIMZK010000014.1 GCA022340115_00305 gene open 21766-23331 trkA
2767 JAIMZK010000014.1 GCA022340115_00306 gene open 23481-24854 norM
2768 JAIMZK010000014.1 GCA022340115_00307 gene open 24869-26215 trkH
2769 JAIMZK010000014.1 GCA022340115_00308 gene open 26225-26881 trkA
2770 JAIMZK010000014.1 GCA022340115_00309 gene open 26890-28791 mnmG
2771 JAIMZK010000014.1 GCA022340115_00310 gene open 28793-29491 rsmG
2772 JAIMZK010000014.1 GCA022340115_00311 gene open 29590-29874
2773 JAIMZK010000014.1 GCA022340115_00312 gene open 29908-30762
2774 JAIMZK010000014.1 GCA022340115_00313 gene open 30815-31561
2775 JAIMZK010000014.1 GCA022340115_00314 gene open 31574-34216 secA
2776 JAIMZK010000014.1 GCA022340115_00315 gene open 34275-36365 ligA
2777 JAIMZK010000014.1 GCA022340115_00316 gene open 36470-37039
2778 JAIMZK010000014.1 GCA022340115_00317 gene open 37036-38250
2779 JAIMZK010000014.1 GCA022340115_00318 gene open 38338-39831
2780 JAIMZK010000014.1 GCA022340115_00319 gene open 39864-41156
2781 JAIMZK010000014.1 GCA022340115_00320 gene open 41289-42140
2782 JAIMZK010000014.1 GCA022340115_00321 gene open 42174-42635
2783 JAIMZK010000014.1 GCA022340115_00322 gene open 42611-44320 mdlB
2784 JAIMZK010000014.1 GCA022340115_00323 gene open 44313-46052 mdlB
2785 JAIMZK010000014.1 GCA022340115_00324 gene open 46156-46728 acrR
2786 JAIMZK010000014.1 GCA022340115_00325 gene open 47027-47377
2787 JAIMZK010000014.1 GCA022340115_00326 gene open 47383-48309
2788 JAIMZK010000014.1 GCA022340115_00327 gene open 48740-51283
2789 JAIMZK010000014.1 GCA022340115_00328 gene open 51314-52129
2790 JAIMZK010000014.1 GCA022340115_00329 gene open 52166-52378 yozG
2791 JAIMZK010000014.1 GCA022340115_00330 gene open 52519-52635
2792 JAIMZK010000014.1 GCA022340115_00331 gene open 53449-54153
2793 JAIMZK010000014.1 GCA022340115_00332 gene open 54405-54623
2794 JAIMZK010000014.1 GCA022340115_00333 gene open 55330-56691 rlmD
2795 JAIMZK010000014.1 GCA022340115_00334 gene open 56693-56950
2796 JAIMZK010000014.1 GCA022340115_00335 gene open 56952-57896 rsmH
2797 JAIMZK010000014.1 GCA022340115_00336 gene open 58153-58428 yggT
2798 JAIMZK010000014.1 GCA022340115_00337 gene open 58442-59005 pgsA
2799 JAIMZK010000014.1 GCA022340115_00338 gene open 59021-61120 pnp
2800 JAIMZK010000014.1 GCA022340115_00339 gene open 61308-62285
2801 JAIMZK010000015.1 GCA022340115_00346 gene open 7375-7718 ssrA
2802 JAIMZK010000015.1 GCA022340115_00346 tmRNA open 7375-7718 ssrA transfer-messenger RNA%2C SsrA
2803 JAIMZK010000015.1 GCA022340115_00381 gene open 46888-46985 n00280
2804 JAIMZK010000015.1 GCA022340115_00381 ncRNA open 46888-46985 Clostridioides difficile sRNA included into helicase gene
2805 JAIMZK010000015.1 repeat_region open 17-432 CRISPR array with 6 repeats of length 36%2C consensus sequence ATAAGAAAGAATATAACTCCGATAGGAGACGGAAAC and spacer length 37
2806 JAIMZK010000015.1 repeat_region open 472-1387 CRISPR array with 12 repeats of length 27%2C consensus sequence GAATATAACTCCGATAGGAGACGGAAA and spacer length 49
2807 JAIMZK010000015.1 GCA022340115_00340 CDS open 1588-2055 _na     155_aa Mannose-6-phosphate isomerase
2808 JAIMZK010000015.1 GCA022340115_00341 CDS open 2216-2545 _na     109_aa Elongation factor Tu
2809 JAIMZK010000015.1 GCA022340115_00342 CDS open 2591-3952 _na     453_aa putative ESS family glutamate:sodium (Na+) symporter
2810 JAIMZK010000015.1 GCA022340115_00343 CDS open 3988-5172 _na     394_aa N-acyl-L-amino acid amidohydrolase
2811 JAIMZK010000015.1 GCA022340115_00344 CDS open 5353-6552 _na     399_aa Helix-turn-helix type 11 domain-containing protein
2812 JAIMZK010000015.1 GCA022340115_00345 CDS open 6621-7241 _na     206_aa Lipoprotein
2813 JAIMZK010000015.1 GCA022340115_00347 CDS open 7844-8584 _na     246_aa VWFA domain-containing protein
2814 JAIMZK010000015.1 GCA022340115_00348 CDS open 8754-9473 _na     239_aa traT Complement resistance protein TraT
2815 JAIMZK010000015.1 GCA022340115_00349 CDS open 9512-11200 _na     562_aa manB PHOSPHOGLUCOMUTASE
2816 JAIMZK010000015.1 GCA022340115_00350 CDS open 11184-12287 _na     367_aa hemW radical SAM family heme chaperone HemW
2817 JAIMZK010000015.1 GCA022340115_00351 CDS open 12531-13202 _na     223_aa yggS Pyridoxal phosphate homeostasis protein
2818 JAIMZK010000015.1 GCA022340115_00352 CDS open 13222-13677 _na     151_aa sepF Cell division protein SepF
2819 JAIMZK010000015.1 GCA022340115_00353 CDS open 13664-14665 _na     333_aa mnmA tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase
2820 JAIMZK010000015.1 GCA022340115_00354 CDS open 14786-15031 _na     81_aa hypothetical protein
2821 JAIMZK010000015.1 GCA022340115_00355 CDS open 15234-15833 _na     199_aa Restriction endonuclease
2822 JAIMZK010000015.1 GCA022340115_00356 CDS open 15830-17323 _na     497_aa ywqK toxin-antitoxin system YwqK family antitoxin
2823 JAIMZK010000015.1 GCA022340115_00357 CDS open 17381-18952 _na     523_aa dnaJ Molecular chaperone DnaJ
2824 JAIMZK010000015.1 GCA022340115_00358 CDS open 19132-19623 _na     163_aa Beta-carotene 15%2C15'-monooxygenase
2825 JAIMZK010000015.1 GCA022340115_00359 CDS open 19616-20530 _na     304_aa smf putative SMF family Rossmann fold nucleotide-binding protein
2826 JAIMZK010000015.1 GCA022340115_00360 CDS open 20590-21081 _na     163_aa N-acetyltransferase domain-containing protein
2827 JAIMZK010000015.1 GCA022340115_00361 CDS open 21078-21254 _na     58_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
2828 JAIMZK010000015.1 GCA022340115_00362 CDS open 21409-22152 _na     247_aa DUF4253 domain-containing protein
2829 JAIMZK010000015.1 GCA022340115_00363 CDS open 22156-23976 _na     606_aa recQ DNA helicase RecQ
2830 JAIMZK010000015.1 GCA022340115_00364 CDS open 23973-28829 _na     1618_aa yfaS Alpha-2-macroglobulin family protein
2831 JAIMZK010000015.1 GCA022340115_00365 CDS open 29064-29876 _na     270_aa Stage V sporulation protein K
2832 JAIMZK010000015.1 GCA022340115_00366 CDS open 29873-30748 _na     291_aa EF-hand domain-containing protein
2833 JAIMZK010000015.1 GCA022340115_00367 CDS open 31088-33334 _na     748_aa pbpC penicillin-binding protein 1C
2834 JAIMZK010000015.1 GCA022340115_00368 CDS open 33338-34507 _na     389_aa lolE ABC transporter permease
2835 JAIMZK010000015.1 GCA022340115_00369 CDS open 34500-35177 _na     225_aa lolD Lipoprotein-releasing system ATP-binding protein LolD
2836 JAIMZK010000015.1 GCA022340115_00370 CDS open 35192-35668 _na     158_aa PepSY domain-containing protein
2837 JAIMZK010000015.1 GCA022340115_00371 CDS open 35734-36408 _na     224_aa ompR DNA-binding response regulator
2838 JAIMZK010000015.1 GCA022340115_00372 CDS open 36386-37723 _na     445_aa baeS histidine kinase
2839 JAIMZK010000015.1 GCA022340115_00373 CDS open 37779-38036 _na     85_aa Integral membrane protein
2840 JAIMZK010000015.1 GCA022340115_00374 CDS open 38108-39289 _na     393_aa abgB N-acyl-L-amino acid amidohydrolase
2841 JAIMZK010000015.1 GCA022340115_00375 CDS open 39305-40825 _na     506_aa abgT AbgT transporter
2842 JAIMZK010000015.1 GCA022340115_00376 CDS open 40985-42439 _na     484_aa Transporter
2843 JAIMZK010000015.1 GCA022340115_00377 CDS open 42445-42642 _na     65_aa DUF997 domain-containing protein
2844 JAIMZK010000015.1 GCA022340115_00378 CDS open 42658-44205 _na     515_aa HTH araC/xylS-type domain-containing protein
2845 JAIMZK010000015.1 GCA022340115_00379 CDS open 44261-44935 _na     224_aa Flavin reductase
2846 JAIMZK010000015.1 GCA022340115_00380 CDS open 45163-47376 _na     737_aa uvrD DNA 3'-5' helicase
2847 JAIMZK010000015.1 GCA022340115_00382 CDS open 47387-48220 _na     277_aa lpxC UDP-3-O-acyl-N-acetylglucosamine deacetylase
2848 JAIMZK010000015.1 GCA022340115_00383 CDS open 48243-48668 _na     141_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
2849 JAIMZK010000015.1 GCA022340115_00384 CDS open 48686-49459 _na     257_aa lpxA acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
2850 JAIMZK010000015.1 GCA022340115_00385 CDS open 49459-50262 _na     267_aa lpxI Septum site-determining protein MinC
2851 JAIMZK010000015.1 GCA022340115_00386 CDS open 50272-51342 _na     356_aa lpxB lipid-A-disaccharide synthase
2852 JAIMZK010000015.1 GCA022340115_00387 CDS open 51339-53090 _na     583_aa mdlB ABC transporter
2853 JAIMZK010000015.1 GCA022340115_00388 CDS open 53161-55206 _na     681_aa DUF262 domain-containing protein
2854 JAIMZK010000015.1 GCA022340115_00389 CDS open 55727-56227 _na     166_aa Septicolysin
2855 JAIMZK010000015.1 GCA022340115_00390 CDS open 56306-56776 _na     156_aa ywqK Toxin-antitoxin system YwqK family antitoxin
2856 JAIMZK010000015.1 GCA022340115_00391 CDS open 56902-57612 _na     236_aa Phage tail protein
2857 JAIMZK010000015.1 GCA022340115_00340 gene open 1588-2055
2858 JAIMZK010000015.1 GCA022340115_00341 gene open 2216-2545
2859 JAIMZK010000015.1 GCA022340115_00342 gene open 2591-3952
2860 JAIMZK010000015.1 GCA022340115_00343 gene open 3988-5172
2861 JAIMZK010000015.1 GCA022340115_00344 gene open 5353-6552
2862 JAIMZK010000015.1 GCA022340115_00345 gene open 6621-7241
2863 JAIMZK010000015.1 GCA022340115_00347 gene open 7844-8584
2864 JAIMZK010000015.1 GCA022340115_00348 gene open 8754-9473 traT
2865 JAIMZK010000015.1 GCA022340115_00349 gene open 9512-11200 manB
2866 JAIMZK010000015.1 GCA022340115_00350 gene open 11184-12287 hemW
2867 JAIMZK010000015.1 GCA022340115_00351 gene open 12531-13202 yggS
2868 JAIMZK010000015.1 GCA022340115_00352 gene open 13222-13677 sepF
2869 JAIMZK010000015.1 GCA022340115_00353 gene open 13664-14665 mnmA
2870 JAIMZK010000015.1 GCA022340115_00354 gene open 14786-15031
2871 JAIMZK010000015.1 GCA022340115_00355 gene open 15234-15833
2872 JAIMZK010000015.1 GCA022340115_00356 gene open 15830-17323 ywqK
2873 JAIMZK010000015.1 GCA022340115_00357 gene open 17381-18952 dnaJ
2874 JAIMZK010000015.1 GCA022340115_00358 gene open 19132-19623
2875 JAIMZK010000015.1 GCA022340115_00359 gene open 19616-20530 smf
2876 JAIMZK010000015.1 GCA022340115_00360 gene open 20590-21081
2877 JAIMZK010000015.1 GCA022340115_00361 gene open 21078-21254
2878 JAIMZK010000015.1 GCA022340115_00362 gene open 21409-22152
2879 JAIMZK010000015.1 GCA022340115_00363 gene open 22156-23976 recQ
2880 JAIMZK010000015.1 GCA022340115_00364 gene open 23973-28829 yfaS
2881 JAIMZK010000015.1 GCA022340115_00365 gene open 29064-29876
2882 JAIMZK010000015.1 GCA022340115_00366 gene open 29873-30748
2883 JAIMZK010000015.1 GCA022340115_00367 gene open 31088-33334 pbpC
2884 JAIMZK010000015.1 GCA022340115_00368 gene open 33338-34507 lolE
2885 JAIMZK010000015.1 GCA022340115_00369 gene open 34500-35177 lolD
2886 JAIMZK010000015.1 GCA022340115_00370 gene open 35192-35668
2887 JAIMZK010000015.1 GCA022340115_00371 gene open 35734-36408 ompR
2888 JAIMZK010000015.1 GCA022340115_00372 gene open 36386-37723 baeS
2889 JAIMZK010000015.1 GCA022340115_00373 gene open 37779-38036
2890 JAIMZK010000015.1 GCA022340115_00374 gene open 38108-39289 abgB
2891 JAIMZK010000015.1 GCA022340115_00375 gene open 39305-40825 abgT
2892 JAIMZK010000015.1 GCA022340115_00376 gene open 40985-42439
2893 JAIMZK010000015.1 GCA022340115_00377 gene open 42445-42642
2894 JAIMZK010000015.1 GCA022340115_00378 gene open 42658-44205
2895 JAIMZK010000015.1 GCA022340115_00379 gene open 44261-44935
2896 JAIMZK010000015.1 GCA022340115_00380 gene open 45163-47376 uvrD
2897 JAIMZK010000015.1 GCA022340115_00382 gene open 47387-48220 lpxC
2898 JAIMZK010000015.1 GCA022340115_00383 gene open 48243-48668 fabZ
2899 JAIMZK010000015.1 GCA022340115_00384 gene open 48686-49459 lpxA
2900 JAIMZK010000015.1 GCA022340115_00385 gene open 49459-50262 lpxI
2901 JAIMZK010000015.1 GCA022340115_00386 gene open 50272-51342 lpxB
2902 JAIMZK010000015.1 GCA022340115_00387 gene open 51339-53090 mdlB
2903 JAIMZK010000015.1 GCA022340115_00388 gene open 53161-55206
2904 JAIMZK010000015.1 GCA022340115_00389 gene open 55727-56227
2905 JAIMZK010000015.1 GCA022340115_00390 gene open 56306-56776 ywqK
2906 JAIMZK010000015.1 GCA022340115_00391 gene open 56902-57612
2907 JAIMZK010000016.1 GCA022340115_00392 CDS open 69-833 _na     254_aa putative membrane transporter protein
2908 JAIMZK010000016.1 GCA022340115_00393 CDS open 849-3131 _na     760_aa fplA autotransporter phospholipase A1 FplA
2909 JAIMZK010000016.1 GCA022340115_00394 CDS open 3324-4322 _na     332_aa rfaD ADP-glyceromanno-heptose 6-epimerase
2910 JAIMZK010000016.1 GCA022340115_00395 CDS open 4340-5155 _na     271_aa uppP undecaprenyl-diphosphate phosphatase
2911 JAIMZK010000016.1 GCA022340115_00396 CDS open 5513-5788 _na     91_aa dTDP-4-dehydrorhamnose 3%2C5-epimerase domain protein
2912 JAIMZK010000016.1 GCA022340115_00397 CDS open 5798-6694 _na     298_aa rfbD dTDP-4-dehydrorhamnose reductase
2913 JAIMZK010000016.1 GCA022340115_00398 CDS open 6707-7705 _na     332_aa Polysaccharide chain length determinant N-terminal domain-containing protein
2914 JAIMZK010000016.1 GCA022340115_00399 CDS open 7717-9528 _na     603_aa flaA1 UDP-N-acetylglucosamine 4%2C6-dehydratase
2915 JAIMZK010000016.1 GCA022340115_00400 CDS open 9530-10690 _na     386_aa degT Aminotransferase DegT
2916 JAIMZK010000016.1 GCA022340115_00401 CDS open 10687-11334 _na     215_aa acetyltransferase
2917 JAIMZK010000016.1 GCA022340115_00402 CDS open 11327-11932 _na     201_aa Sugar transferase
2918 JAIMZK010000016.1 GCA022340115_00403 CDS open 11948-13129 _na     393_aa wbuB Glycosyltransferase WbuB
2919 JAIMZK010000016.1 GCA022340115_00404 CDS open 13130-14152 _na     340_aa UDP-glucose 4-epimerase
2920 JAIMZK010000016.1 GCA022340115_00405 CDS open 14152-15258 _na     368_aa NAD-dependent epimerase/dehydratase domain-containing protein
2921 JAIMZK010000016.1 GCA022340115_00406 CDS open 15262-16386 _na     374_aa wecB non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase
2922 JAIMZK010000016.1 GCA022340115_00407 CDS open 16387-17619 _na     410_aa glycosyltransferase family 4 protein
2923 JAIMZK010000016.1 GCA022340115_00408 CDS open 17632-18855 _na     407_aa O-antigen polymerase
2924 JAIMZK010000016.1 GCA022340115_00409 CDS open 18852-20027 _na     391_aa glycosyltransferase family 9 protein
2925 JAIMZK010000016.1 GCA022340115_00410 CDS open 20021-20962 _na     313_aa glycosyltransferase
2926 JAIMZK010000016.1 GCA022340115_00411 CDS open 20959-22401 _na     480_aa flippase
2927 JAIMZK010000016.1 GCA022340115_00412 CDS open 22385-23503 _na     372_aa DegT/DnrJ/EryC1/StrS family aminotransferase
2928 JAIMZK010000016.1 GCA022340115_00413 CDS open 23505-24233 _na     242_aa dTDP-4-amino-4%2C6-dideoxyglucose formyltransferase
2929 JAIMZK010000016.1 GCA022340115_00414 CDS open 24424-25392 _na     322_aa D-glycero-beta-D-manno-heptose-7-phosphate kinase
2930 JAIMZK010000016.1 GCA022340115_00415 CDS open 25519-26559 _na     346_aa DUF2971 domain-containing protein
2931 JAIMZK010000016.1 GCA022340115_00416 CDS open 26625-27494 _na     289_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
2932 JAIMZK010000016.1 GCA022340115_00417 CDS open 27531-28850 _na     439_aa ATP/GTP-binding protein
2933 JAIMZK010000016.1 GCA022340115_00418 CDS open 28837-29526 _na     229_aa RiboL-PSP-HEPN domain-containing protein
2934 JAIMZK010000016.1 GCA022340115_00419 CDS open 29544-30743 _na     399_aa rfbB dTDP-glucose 4%2C6-dehydratase
2935 JAIMZK010000016.1 GCA022340115_00420 CDS open 31195-31338 _na     47_aa hypothetical protein
2936 JAIMZK010000016.1 GCA022340115_00421 CDS open 31384-32496 _na     370_aa hypothetical protein
2937 JAIMZK010000016.1 GCA022340115_00422 CDS open 32471-33946 _na     491_aa DUF5677 domain-containing protein
2938 JAIMZK010000016.1 GCA022340115_00423 CDS open 34936-35613 _na     225_aa HTH cro/C1-type domain-containing protein
2939 JAIMZK010000016.1 GCA022340115_00424 CDS open 35619-36404 _na     261_aa phoU PhoU family transcriptional regulator
2940 JAIMZK010000016.1 GCA022340115_00425 CDS open 36424-37512 _na     362_aa ATP-binding protein
2941 JAIMZK010000016.1 GCA022340115_00426 CDS open 37610-38008 _na     132_aa DUF4276 domain-containing protein
2942 JAIMZK010000016.1 GCA022340115_00427 CDS open 38267-38620 _na     117_aa hypothetical protein
2943 JAIMZK010000016.1 GCA022340115_00428 CDS open 38630-39001 _na     123_aa Virulence factor
2944 JAIMZK010000016.1 GCA022340115_00429 CDS open 39212-39328 _na     38_aa hypothetical protein
2945 JAIMZK010000016.1 GCA022340115_00430 CDS open 39682-40167 _na     161_aa Antitoxin SocA-like Panacea domain-containing protein
2946 JAIMZK010000016.1 GCA022340115_00431 CDS open 40164-40544 _na     126_aa type II toxin-antitoxin system PemK/MazF family toxin
2947 JAIMZK010000016.1 GCA022340115_00432 CDS open 40673-41422 _na     249_aa tACO1 YebC/PmpR family DNA-binding transcriptional regulator
2948 JAIMZK010000016.1 GCA022340115_00433 CDS open 41476-43545 _na     689_aa recG ATP-dependent DNA helicase RecG
2949 JAIMZK010000016.1 GCA022340115_00434 CDS open 43616-45319 _na     567_aa proS proline--tRNA ligase
2950 JAIMZK010000016.1 GCA022340115_00435 CDS open 45418-45702 _na     94_aa rpsF 30S ribosomal protein S6
2951 JAIMZK010000016.1 GCA022340115_00436 CDS open 45748-45966 _na     72_aa rpsR 30S ribosomal protein S18
2952 JAIMZK010000016.1 GCA022340115_00437 CDS open 46036-46839 _na     267_aa Peptidase M48 domain-containing protein
2953 JAIMZK010000016.1 GCA022340115_00438 CDS open 46893-48470 _na     525_aa DUF1858 domain-containing protein
2954 JAIMZK010000016.1 GCA022340115_00439 CDS open 49566-50249 _na     227_aa hypothetical protein
2955 JAIMZK010000016.1 GCA022340115_00440 CDS open 50303-51652 _na     449_aa ATP/GTP-binding protein
2956 JAIMZK010000016.1 GCA022340115_00441 CDS open 51654-52343 _na     229_aa DUF4276 domain-containing protein
2957 JAIMZK010000016.1 GCA022340115_00392 gene open 69-833
2958 JAIMZK010000016.1 GCA022340115_00393 gene open 849-3131 fplA
2959 JAIMZK010000016.1 GCA022340115_00394 gene open 3324-4322 rfaD
2960 JAIMZK010000016.1 GCA022340115_00395 gene open 4340-5155 uppP
2961 JAIMZK010000016.1 GCA022340115_00396 gene open 5513-5788
2962 JAIMZK010000016.1 GCA022340115_00397 gene open 5798-6694 rfbD
2963 JAIMZK010000016.1 GCA022340115_00398 gene open 6707-7705
2964 JAIMZK010000016.1 GCA022340115_00399 gene open 7717-9528 flaA1
2965 JAIMZK010000016.1 GCA022340115_00400 gene open 9530-10690 degT
2966 JAIMZK010000016.1 GCA022340115_00401 gene open 10687-11334
2967 JAIMZK010000016.1 GCA022340115_00402 gene open 11327-11932
2968 JAIMZK010000016.1 GCA022340115_00403 gene open 11948-13129 wbuB
2969 JAIMZK010000016.1 GCA022340115_00404 gene open 13130-14152
2970 JAIMZK010000016.1 GCA022340115_00405 gene open 14152-15258
2971 JAIMZK010000016.1 GCA022340115_00406 gene open 15262-16386 wecB
2972 JAIMZK010000016.1 GCA022340115_00407 gene open 16387-17619
2973 JAIMZK010000016.1 GCA022340115_00408 gene open 17632-18855
2974 JAIMZK010000016.1 GCA022340115_00409 gene open 18852-20027
2975 JAIMZK010000016.1 GCA022340115_00410 gene open 20021-20962
2976 JAIMZK010000016.1 GCA022340115_00411 gene open 20959-22401
2977 JAIMZK010000016.1 GCA022340115_00412 gene open 22385-23503
2978 JAIMZK010000016.1 GCA022340115_00413 gene open 23505-24233
2979 JAIMZK010000016.1 GCA022340115_00414 gene open 24424-25392
2980 JAIMZK010000016.1 GCA022340115_00415 gene open 25519-26559
2981 JAIMZK010000016.1 GCA022340115_00416 gene open 26625-27494 rfbA
2982 JAIMZK010000016.1 GCA022340115_00417 gene open 27531-28850
2983 JAIMZK010000016.1 GCA022340115_00418 gene open 28837-29526
2984 JAIMZK010000016.1 GCA022340115_00419 gene open 29544-30743 rfbB
2985 JAIMZK010000016.1 GCA022340115_00420 gene open 31195-31338
2986 JAIMZK010000016.1 GCA022340115_00421 gene open 31384-32496
2987 JAIMZK010000016.1 GCA022340115_00422 gene open 32471-33946
2988 JAIMZK010000016.1 GCA022340115_00423 gene open 34936-35613
2989 JAIMZK010000016.1 GCA022340115_00424 gene open 35619-36404 phoU
2990 JAIMZK010000016.1 GCA022340115_00425 gene open 36424-37512
2991 JAIMZK010000016.1 GCA022340115_00426 gene open 37610-38008
2992 JAIMZK010000016.1 GCA022340115_00427 gene open 38267-38620
2993 JAIMZK010000016.1 GCA022340115_00428 gene open 38630-39001
2994 JAIMZK010000016.1 GCA022340115_00429 gene open 39212-39328
2995 JAIMZK010000016.1 GCA022340115_00430 gene open 39682-40167
2996 JAIMZK010000016.1 GCA022340115_00431 gene open 40164-40544
2997 JAIMZK010000016.1 GCA022340115_00432 gene open 40673-41422 tACO1
2998 JAIMZK010000016.1 GCA022340115_00433 gene open 41476-43545 recG
2999 JAIMZK010000016.1 GCA022340115_00434 gene open 43616-45319 proS
3000 JAIMZK010000016.1 GCA022340115_00435 gene open 45418-45702 rpsF