HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Pyramidobacter piscolens (GCA_023455535.1)

Select a Genome:
BAKTA Annotations for GCA_023455535.1
Genome Selected: Pyramidobacter piscolens
ContigsBases CDSrRNA tmRNAtRNA
69 2438666 2200 4 1 52
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4537 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 4537 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 JAEYBZ010000007.1 GCA023455535_00670 gene open 25200-25922 menH
502 JAEYBZ010000007.1 GCA023455535_00671 gene open 25974-26516 fic
503 JAEYBZ010000008.1 GCA023455535_00430 CDS open 146-850 _na     234_aa B3/B4 tRNA-binding domain-containing protein
504 JAEYBZ010000008.1 GCA023455535_00431 CDS open 1261-1407 _na     48_aa hypothetical protein
505 JAEYBZ010000008.1 GCA023455535_00432 CDS open 1398-1733 _na     111_aa cupin domain-containing protein
506 JAEYBZ010000008.1 GCA023455535_00433 CDS open 1980-3251 _na     423_aa hisS histidine--tRNA ligase
507 JAEYBZ010000008.1 GCA023455535_00434 CDS open 3325-5133 _na     602_aa aspS aspartate--tRNA ligase
508 JAEYBZ010000008.1 GCA023455535_00435 CDS open 5281-7281 _na     666_aa rnc ribonuclease III
509 JAEYBZ010000008.1 GCA023455535_00430 gene open 146-850
510 JAEYBZ010000008.1 GCA023455535_00431 gene open 1261-1407
511 JAEYBZ010000008.1 GCA023455535_00432 gene open 1398-1733
512 JAEYBZ010000008.1 GCA023455535_00433 gene open 1980-3251 hisS
513 JAEYBZ010000008.1 GCA023455535_00434 gene open 3325-5133 aspS
514 JAEYBZ010000008.1 GCA023455535_00435 gene open 5281-7281 rnc
515 JAEYBZ010000009.1 GCA023455535_00576 gene open 85690-85804 rrf
516 JAEYBZ010000009.1 GCA023455535_00577 gene open 85967-86081 rrf
517 JAEYBZ010000009.1 regulatory_region open 73500-73668 Cobalamin riboswitch aptamer
518 JAEYBZ010000009.1 GCA023455535_00576 rRNA open 85690-85804 rrf 5S ribosomal RNA
519 JAEYBZ010000009.1 GCA023455535_00577 rRNA open 85967-86081 rrf 5S ribosomal RNA
520 JAEYBZ010000009.1 repeat_region open 127-348 CRISPR array with 4 repeats of length 28%2C consensus sequence CAAAACCCCGCTCACGCGGGGATGAACC and spacer length 33
521 JAEYBZ010000009.1 GCA023455535_00497 CDS open 370-678 _na     102_aa hypothetical protein
522 JAEYBZ010000009.1 GCA023455535_00498 CDS open 751-990 _na     79_aa hypothetical protein
523 JAEYBZ010000009.1 GCA023455535_00499 CDS open 1506-1766 _na     86_aa relB Type II toxin-antitoxin system RelB/DinJ family antitoxin
524 JAEYBZ010000009.1 GCA023455535_00500 CDS open 1753-2046 _na     97_aa yafQ Type II toxin-antitoxin system YafQ family toxin
525 JAEYBZ010000009.1 GCA023455535_00501 CDS open 2248-2478 _na     76_aa hypothetical protein
526 JAEYBZ010000009.1 GCA023455535_00502 CDS open 2868-3332 _na     154_aa resIII Type III restriction endonuclease
527 JAEYBZ010000009.1 GCA023455535_00503 CDS open 3459-4352 _na     297_aa soxR helix-turn-helix domain-containing protein
528 JAEYBZ010000009.1 GCA023455535_00504 CDS open 4529-5554 _na     341_aa dihydrodipicolinate reductase
529 JAEYBZ010000009.1 GCA023455535_00505 CDS open 5916-6068 _na     50_aa hypothetical protein
530 JAEYBZ010000009.1 GCA023455535_00506 CDS open 6581-8311 _na     576_aa mdlB ABC transporter ATP-binding protein
531 JAEYBZ010000009.1 GCA023455535_00507 CDS open 8305-10071 _na     588_aa mdlB ABC transporter ATP-binding protein
532 JAEYBZ010000009.1 GCA023455535_00508 CDS open 10142-10753 _na     203_aa acrR TetR/AcrR family transcriptional regulator
533 JAEYBZ010000009.1 GCA023455535_00509 CDS open 11026-11691 _na     221_aa aNKYR ankyrin repeat domain-containing protein
534 JAEYBZ010000009.1 GCA023455535_00510 CDS open 11897-12850 _na     317_aa DUF362 domain-containing protein
535 JAEYBZ010000009.1 GCA023455535_00511 CDS open 12843-13742 _na     299_aa yraQ Permease
536 JAEYBZ010000009.1 GCA023455535_00512 CDS open 13832-14302 _na     156_aa ATPase P
537 JAEYBZ010000009.1 GCA023455535_00513 CDS open 14309-15088 _na     259_aa coaX Type III pantothenate kinase
538 JAEYBZ010000009.1 GCA023455535_00514 CDS open 15278-16471 _na     397_aa coaBC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
539 JAEYBZ010000009.1 GCA023455535_00515 CDS open 16579-17913 _na     444_aa pepC Aminopeptidase
540 JAEYBZ010000009.1 GCA023455535_00516 CDS open 18050-18493 _na     147_aa DUF4430 domain-containing protein
541 JAEYBZ010000009.1 GCA023455535_00517 CDS open 18714-19331 _na     205_aa citB HTH luxR-type domain-containing protein
542 JAEYBZ010000009.1 GCA023455535_00518 CDS open 19545-20027 _na     160_aa proX Prolyl-tRNA synthetase associated domain-containing protein
543 JAEYBZ010000009.1 GCA023455535_00519 CDS open 20123-21418 _na     431_aa cdaR Sugar diacid utilization regulator
544 JAEYBZ010000009.1 GCA023455535_00520 CDS open 21578-22864 _na     428_aa Beta-aspartyl-peptidase
545 JAEYBZ010000009.1 GCA023455535_00521 CDS open 22878-23924 _na     348_aa Sarcosine reductase complex component B subunit beta
546 JAEYBZ010000009.1 GCA023455535_00522 CDS open 23952-24191 _na     79_aa hypothetical protein
547 JAEYBZ010000009.1 GCA023455535_00523 CDS open 24387-24743 _na     118_aa grdX GrdX family protein
548 JAEYBZ010000009.1 GCA023455535_00524 CDS open 24858-26243 _na     461_aa yocR Sodium-dependent transporter
549 JAEYBZ010000009.1 GCA023455535_00525 CDS open 26419-27948 _na     509_aa mdoB LTA synthase family protein
550 JAEYBZ010000009.1 GCA023455535_00526 CDS open 28140-28958 _na     272_aa iclR IclR family transcriptional regulator
551 JAEYBZ010000009.1 GCA023455535_00527 CDS open 29160-30350 _na     396_aa abgB Peptidase M20 domain-containing protein 2
552 JAEYBZ010000009.1 GCA023455535_00528 CDS open 30414-31826 _na     470_aa yfcC YfcC family protein
553 JAEYBZ010000009.1 GCA023455535_00529 CDS open 32012-33055 _na     347_aa wcaA glycosyltransferase family 2 protein
554 JAEYBZ010000009.1 GCA023455535_00530 CDS open 33148-34359 _na     403_aa abgB Peptidase M20 dimerisation domain-containing protein
555 JAEYBZ010000009.1 GCA023455535_00531 CDS open 34624-36288 _na     554_aa pucR PucR family transcriptional regulator
556 JAEYBZ010000009.1 GCA023455535_00532 CDS open 36542-37870 _na     442_aa codB cytosine permease
557 JAEYBZ010000009.1 GCA023455535_00533 CDS open 37908-38954 _na     348_aa ampS leucyl aminopeptidase
558 JAEYBZ010000009.1 GCA023455535_00534 CDS open 38980-39621 _na     213_aa hisJ ABC transporter substrate-binding protein
559 JAEYBZ010000009.1 GCA023455535_00535 CDS open 39995-40804 _na     269_aa aspB aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme
560 JAEYBZ010000009.1 GCA023455535_00536 CDS open 40801-41025 _na     74_aa aspB aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme
561 JAEYBZ010000009.1 GCA023455535_00537 CDS open 41066-42244 _na     392_aa glxK Glycerate kinase
562 JAEYBZ010000009.1 GCA023455535_00538 CDS open 42442-44124 _na     560_aa aNKYR ankyrin repeat domain-containing protein
563 JAEYBZ010000009.1 GCA023455535_00539 CDS open 44784-46031 _na     415_aa fadL Transporter
564 JAEYBZ010000009.1 GCA023455535_00540 CDS open 46127-46705 _na     192_aa rhtB Lysine transporter LysE
565 JAEYBZ010000009.1 GCA023455535_00542 CDS open 47131-47544 _na     137_aa hicB type II toxin-antitoxin system HicB family antitoxin
566 JAEYBZ010000009.1 GCA023455535_00543 CDS open 48141-49376 _na     411_aa gltP Dicarboxylate/amino acid:cation symporter
567 JAEYBZ010000009.1 GCA023455535_00544 CDS open 49401-50438 _na     345_aa gLY1 Low specificity L-threonine aldolase
568 JAEYBZ010000009.1 GCA023455535_00545 CDS open 50588-51538 _na     316_aa lysR LysR family transcriptional regulator
569 JAEYBZ010000009.1 GCA023455535_00546 CDS open 51777-52694 _na     305_aa dppB ABC transporter permease
570 JAEYBZ010000009.1 GCA023455535_00547 CDS open 52687-53547 _na     286_aa opp1C nickel/cobalt ABC transporter permease
571 JAEYBZ010000009.1 GCA023455535_00548 CDS open 53554-54531 _na     325_aa dppD ABC transporter ATP-binding protein
572 JAEYBZ010000009.1 GCA023455535_00549 CDS open 54518-55486 _na     322_aa dppD ATP-binding cassette domain-containing protein
573 JAEYBZ010000009.1 GCA023455535_00550 CDS open 55580-57151 _na     523_aa ddpA Glutathione ABC transporter substrate-binding protein
574 JAEYBZ010000009.1 GCA023455535_00551 CDS open 57294-58127 _na     277_aa dppA Aminopeptidase
575 JAEYBZ010000009.1 GCA023455535_00552 CDS open 58226-59737 _na     503_aa DUF112 domain-containing protein
576 JAEYBZ010000009.1 GCA023455535_00553 CDS open 59749-60228 _na     159_aa DUF1468 domain-containing protein
577 JAEYBZ010000009.1 GCA023455535_00554 CDS open 60308-61270 _na     320_aa tctC Tripartite tricarboxylate transporter substrate binding protein
578 JAEYBZ010000009.1 GCA023455535_00555 CDS open 61284-62315 _na     343_aa serA 3-phosphoglycerate dehydrogenase
579 JAEYBZ010000009.1 GCA023455535_00556 CDS open 62346-63071 _na     241_aa rraA Regulator of ribonuclease activity-like protein
580 JAEYBZ010000009.1 GCA023455535_00557 CDS open 63157-64197 _na     346_aa lysR HTH lysR-type domain-containing protein
581 JAEYBZ010000009.1 GCA023455535_00558 CDS open 64362-65276 _na     304_aa rhaT DMT family transporter
582 JAEYBZ010000009.1 GCA023455535_00559 CDS open 65353-65868 _na     171_aa nimA Pyridoxamine 5'-phosphate oxidase family protein
583 JAEYBZ010000009.1 GCA023455535_00560 CDS open 65962-66618 _na     218_aa Transporter
584 JAEYBZ010000009.1 GCA023455535_00561 CDS open 66632-67327 _na     231_aa DUF5058 domain-containing protein
585 JAEYBZ010000009.1 GCA023455535_00562 CDS open 67412-68842 _na     476_aa gatA Amidase domain-containing protein
586 JAEYBZ010000009.1 GCA023455535_00563 CDS open 69131-69916 _na     261_aa fepC ABC transporter ATP-binding protein
587 JAEYBZ010000009.1 GCA023455535_00564 CDS open 69913-70974 _na     353_aa fepD Iron ABC transporter permease
588 JAEYBZ010000009.1 GCA023455535_00565 CDS open 70975-71979 _na     334_aa fepB ABC transporter substrate-binding protein
589 JAEYBZ010000009.1 GCA023455535_00566 CDS open 72342-73349 _na     335_aa fepB Iron ABC transporter substrate-binding protein
590 JAEYBZ010000009.1 GCA023455535_00567 CDS open 73811-74473 _na     220_aa L%2CD-TPase catalytic domain-containing protein
591 JAEYBZ010000009.1 GCA023455535_00568 CDS open 74588-75691 _na     367_aa LOR/SDH bifunctional protein
592 JAEYBZ010000009.1 GCA023455535_00569 CDS open 75688-76854 _na     388_aa Arginine dihydrolase ArgZ/ArgE-like C-terminal second subdomain domain-containing protein
593 JAEYBZ010000009.1 GCA023455535_00570 CDS open 76851-78182 _na     443_aa araC HTH araC/xylS-type domain-containing protein
594 JAEYBZ010000009.1 GCA023455535_00571 CDS open 78233-79162 _na     309_aa arcC Carbamate kinase
595 JAEYBZ010000009.1 GCA023455535_00572 CDS open 79198-81687 _na     829_aa clpA Clp R domain-containing protein
596 JAEYBZ010000009.1 GCA023455535_00573 CDS open 81697-82854 _na     385_aa Transporter gate domain protein
597 JAEYBZ010000009.1 GCA023455535_00574 CDS open 82952-84331 _na     459_aa alsT Sodium:alanine symporter family protein
598 JAEYBZ010000009.1 GCA023455535_00575 CDS open 84416-85408 _na     330_aa argF ornithine carbamoyltransferase
599 JAEYBZ010000009.1 GCA023455535_00497 gene open 370-678
600 JAEYBZ010000009.1 GCA023455535_00498 gene open 751-990
601 JAEYBZ010000009.1 GCA023455535_00499 gene open 1506-1766 relB
602 JAEYBZ010000009.1 GCA023455535_00500 gene open 1753-2046 yafQ
603 JAEYBZ010000009.1 GCA023455535_00501 gene open 2248-2478
604 JAEYBZ010000009.1 GCA023455535_00502 gene open 2868-3332 resIII
605 JAEYBZ010000009.1 GCA023455535_00503 gene open 3459-4352 soxR
606 JAEYBZ010000009.1 GCA023455535_00504 gene open 4529-5554
607 JAEYBZ010000009.1 GCA023455535_00505 gene open 5916-6068
608 JAEYBZ010000009.1 GCA023455535_00506 gene open 6581-8311 mdlB
609 JAEYBZ010000009.1 GCA023455535_00507 gene open 8305-10071 mdlB
610 JAEYBZ010000009.1 GCA023455535_00508 gene open 10142-10753 acrR
611 JAEYBZ010000009.1 GCA023455535_00509 gene open 11026-11691 aNKYR
612 JAEYBZ010000009.1 GCA023455535_00510 gene open 11897-12850
613 JAEYBZ010000009.1 GCA023455535_00511 gene open 12843-13742 yraQ
614 JAEYBZ010000009.1 GCA023455535_00512 gene open 13832-14302
615 JAEYBZ010000009.1 GCA023455535_00513 gene open 14309-15088 coaX
616 JAEYBZ010000009.1 GCA023455535_00514 gene open 15278-16471 coaBC
617 JAEYBZ010000009.1 GCA023455535_00515 gene open 16579-17913 pepC
618 JAEYBZ010000009.1 GCA023455535_00516 gene open 18050-18493
619 JAEYBZ010000009.1 GCA023455535_00517 gene open 18714-19331 citB
620 JAEYBZ010000009.1 GCA023455535_00518 gene open 19545-20027 proX
621 JAEYBZ010000009.1 GCA023455535_00519 gene open 20123-21418 cdaR
622 JAEYBZ010000009.1 GCA023455535_00520 gene open 21578-22864
623 JAEYBZ010000009.1 GCA023455535_00521 gene open 22878-23924
624 JAEYBZ010000009.1 GCA023455535_00522 gene open 23952-24191
625 JAEYBZ010000009.1 GCA023455535_00523 gene open 24387-24743 grdX
626 JAEYBZ010000009.1 GCA023455535_00524 gene open 24858-26243 yocR
627 JAEYBZ010000009.1 GCA023455535_00525 gene open 26419-27948 mdoB
628 JAEYBZ010000009.1 GCA023455535_00526 gene open 28140-28958 iclR
629 JAEYBZ010000009.1 GCA023455535_00527 gene open 29160-30350 abgB
630 JAEYBZ010000009.1 GCA023455535_00528 gene open 30414-31826 yfcC
631 JAEYBZ010000009.1 GCA023455535_00529 gene open 32012-33055 wcaA
632 JAEYBZ010000009.1 GCA023455535_00530 gene open 33148-34359 abgB
633 JAEYBZ010000009.1 GCA023455535_00531 gene open 34624-36288 pucR
634 JAEYBZ010000009.1 GCA023455535_00532 gene open 36542-37870 codB
635 JAEYBZ010000009.1 GCA023455535_00533 gene open 37908-38954 ampS
636 JAEYBZ010000009.1 GCA023455535_00534 gene open 38980-39621 hisJ
637 JAEYBZ010000009.1 GCA023455535_00535 gene open 39995-40804 aspB
638 JAEYBZ010000009.1 GCA023455535_00536 gene open 40801-41025 aspB
639 JAEYBZ010000009.1 GCA023455535_00537 gene open 41066-42244 glxK
640 JAEYBZ010000009.1 GCA023455535_00538 gene open 42442-44124 aNKYR
641 JAEYBZ010000009.1 GCA023455535_00539 gene open 44784-46031 fadL
642 JAEYBZ010000009.1 GCA023455535_00540 gene open 46127-46705 rhtB
643 JAEYBZ010000009.1 GCA023455535_00542 gene open 47131-47544 hicB
644 JAEYBZ010000009.1 GCA023455535_00543 gene open 48141-49376 gltP
645 JAEYBZ010000009.1 GCA023455535_00544 gene open 49401-50438 gLY1
646 JAEYBZ010000009.1 GCA023455535_00545 gene open 50588-51538 lysR
647 JAEYBZ010000009.1 GCA023455535_00546 gene open 51777-52694 dppB
648 JAEYBZ010000009.1 GCA023455535_00547 gene open 52687-53547 opp1C
649 JAEYBZ010000009.1 GCA023455535_00548 gene open 53554-54531 dppD
650 JAEYBZ010000009.1 GCA023455535_00549 gene open 54518-55486 dppD
651 JAEYBZ010000009.1 GCA023455535_00550 gene open 55580-57151 ddpA
652 JAEYBZ010000009.1 GCA023455535_00551 gene open 57294-58127 dppA
653 JAEYBZ010000009.1 GCA023455535_00552 gene open 58226-59737
654 JAEYBZ010000009.1 GCA023455535_00553 gene open 59749-60228
655 JAEYBZ010000009.1 GCA023455535_00554 gene open 60308-61270 tctC
656 JAEYBZ010000009.1 GCA023455535_00555 gene open 61284-62315 serA
657 JAEYBZ010000009.1 GCA023455535_00556 gene open 62346-63071 rraA
658 JAEYBZ010000009.1 GCA023455535_00557 gene open 63157-64197 lysR
659 JAEYBZ010000009.1 GCA023455535_00558 gene open 64362-65276 rhaT
660 JAEYBZ010000009.1 GCA023455535_00559 gene open 65353-65868 nimA
661 JAEYBZ010000009.1 GCA023455535_00560 gene open 65962-66618
662 JAEYBZ010000009.1 GCA023455535_00561 gene open 66632-67327
663 JAEYBZ010000009.1 GCA023455535_00562 gene open 67412-68842 gatA
664 JAEYBZ010000009.1 GCA023455535_00563 gene open 69131-69916 fepC
665 JAEYBZ010000009.1 GCA023455535_00564 gene open 69913-70974 fepD
666 JAEYBZ010000009.1 GCA023455535_00565 gene open 70975-71979 fepB
667 JAEYBZ010000009.1 GCA023455535_00566 gene open 72342-73349 fepB
668 JAEYBZ010000009.1 GCA023455535_00567 gene open 73811-74473
669 JAEYBZ010000009.1 GCA023455535_00568 gene open 74588-75691
670 JAEYBZ010000009.1 GCA023455535_00569 gene open 75688-76854
671 JAEYBZ010000009.1 GCA023455535_00570 gene open 76851-78182 araC
672 JAEYBZ010000009.1 GCA023455535_00571 gene open 78233-79162 arcC
673 JAEYBZ010000009.1 GCA023455535_00572 gene open 79198-81687 clpA
674 JAEYBZ010000009.1 GCA023455535_00573 gene open 81697-82854
675 JAEYBZ010000009.1 GCA023455535_00574 gene open 82952-84331 alsT
676 JAEYBZ010000009.1 GCA023455535_00575 gene open 84416-85408 argF
677 JAEYBZ010000009.1 GCA023455535_00541 gene open 46773-46858 trnS
678 JAEYBZ010000009.1 GCA023455535_00541 tRNA open 46773-46858 trnS tRNA-Ser(tga)
679 JAEYBZ010000010.1 GCA023455535_01971 CDS open 132-593 _na     153_aa SWIM zinc finger domain-containing protein
680 JAEYBZ010000010.1 GCA023455535_01972 CDS open 750-2177 _na     475_aa pepV dipeptidase PepV
681 JAEYBZ010000010.1 GCA023455535_01973 CDS open 2310-3587 _na     425_aa capA CapA family protein
682 JAEYBZ010000010.1 GCA023455535_01974 CDS open 3846-4496 _na     216_aa yciV Polymerase/histidinol phosphatase N-terminal domain-containing protein
683 JAEYBZ010000010.1 GCA023455535_01975 CDS open 4551-5543 _na     330_aa afuA ABC transporter substrate-binding protein
684 JAEYBZ010000010.1 GCA023455535_01976 CDS open 5578-7152 _na     524_aa fbpB ABC transmembrane type-1 domain-containing protein
685 JAEYBZ010000010.1 GCA023455535_01977 CDS open 7153-8100 _na     315_aa potA ABC transporter ATP-binding protein
686 JAEYBZ010000010.1 GCA023455535_01978 CDS open 8379-9119 _na     246_aa iclR IclR family transcriptional regulator
687 JAEYBZ010000010.1 GCA023455535_01979 CDS open 9185-10105 _na     306_aa aes Alpha/beta hydrolase
688 JAEYBZ010000010.1 GCA023455535_01980 CDS open 10759-11553 _na     264_aa nlpA ABC transporter substrate-binding protein
689 JAEYBZ010000010.1 GCA023455535_01981 CDS open 11580-12233 _na     217_aa metP ABC transporter permease
690 JAEYBZ010000010.1 GCA023455535_01982 CDS open 12226-13245 _na     339_aa abcC Methionine ABC transporter ATP-binding protein
691 JAEYBZ010000010.1 GCA023455535_01983 CDS open 13513-14169 _na     218_aa ulaG metal-dependent hydrolase
692 JAEYBZ010000010.1 GCA023455535_01984 CDS open 14522-14815 _na     97_aa TIGR04076 family protein
693 JAEYBZ010000010.1 GCA023455535_01985 CDS open 14812-14973 _na     53_aa hypothetical protein
694 JAEYBZ010000010.1 GCA023455535_01986 CDS open 15092-15766 _na     224_aa gntR GntR family transcriptional regulator
695 JAEYBZ010000010.1 GCA023455535_01987 CDS open 16091-17734 _na     547_aa nptA Na/Pi cotransporter family protein
696 JAEYBZ010000010.1 GCA023455535_01988 CDS open 17967-18299 _na     110_aa dgkA Diacylglycerol kinase
697 JAEYBZ010000010.1 GCA023455535_01989 CDS open 18359-18565 _na     68_aa fliH Flagellar assembly protein FliH
698 JAEYBZ010000010.1 GCA023455535_01990 CDS open 18594-19409 _na     271_aa dapF diaminopimelate epimerase
699 JAEYBZ010000010.1 GCA023455535_01991 CDS open 19603-20541 _na     312_aa dnaJ Septum site-determining protein MinC
700 JAEYBZ010000010.1 GCA023455535_01992 CDS open 20707-21072 _na     121_aa sORL Superoxide reductase
701 JAEYBZ010000010.1 GCA023455535_01993 CDS open 21167-21364 _na     65_aa AtpZ/AtpI family protein
702 JAEYBZ010000010.1 GCA023455535_01994 CDS open 21590-22723 _na     377_aa wecE DegT/DnrJ/EryC1/StrS family aminotransferase
703 JAEYBZ010000010.1 GCA023455535_01995 CDS open 22817-23512 _na     231_aa yugP Zinc metallopeptidase
704 JAEYBZ010000010.1 GCA023455535_01996 CDS open 23594-24295 _na     233_aa DUF6391 domain-containing protein
705 JAEYBZ010000010.1 GCA023455535_01997 CDS open 24303-25622 _na     439_aa rsmB RsmB/NOP family class I SAM-dependent RNA methyltransferase
706 JAEYBZ010000010.1 GCA023455535_01998 CDS open 25648-26733 _na     361_aa pASTA PASTA domain-containing protein
707 JAEYBZ010000010.1 GCA023455535_01999 CDS open 26712-27395 _na     227_aa rpe ribulose-phosphate 3-epimerase
708 JAEYBZ010000010.1 GCA023455535_02000 CDS open 27454-28452 _na     332_aa rodZ helix-turn-helix domain-containing protein
709 JAEYBZ010000010.1 GCA023455535_02001 CDS open 28456-29760 _na     434_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
710 JAEYBZ010000010.1 GCA023455535_02002 CDS open 29753-30250 _na     165_aa pgpA phosphatidylglycerophosphatase A
711 JAEYBZ010000010.1 GCA023455535_02003 CDS open 30284-30781 _na     165_aa pncC CinA family protein
712 JAEYBZ010000010.1 GCA023455535_02004 CDS open 30781-31365 _na     194_aa thpR RNA 2'%2C3'-cyclic phosphodiesterase
713 JAEYBZ010000010.1 GCA023455535_02005 CDS open 31402-32562 _na     386_aa recA recombinase RecA
714 JAEYBZ010000010.1 GCA023455535_02006 CDS open 33167-34546 _na     459_aa skfB Radical SAM protein
715 JAEYBZ010000010.1 GCA023455535_02007 CDS open 34849-36102 _na     417_aa AAA family ATPase
716 JAEYBZ010000010.1 GCA023455535_02008 CDS open 36202-37617 _na     471_aa purF Amidophosphoribosyltransferase
717 JAEYBZ010000010.1 GCA023455535_02009 CDS open 37813-38139 _na     108_aa azlD Branched-chain amino acid transporter AzlD
718 JAEYBZ010000010.1 GCA023455535_02010 CDS open 38136-38849 _na     237_aa azlC Branched-chain amino acid ABC transporter permease
719 JAEYBZ010000010.1 GCA023455535_02011 CDS open 39023-39265 _na     80_aa AbrB/MazE/SpoVT family DNA-binding domain-containing protein
720 JAEYBZ010000010.1 GCA023455535_02012 CDS open 39297-39566 _na     89_aa hypothetical protein
721 JAEYBZ010000010.1 GCA023455535_02013 CDS open 39680-40255 _na     191_aa nfnB Nitroreductase
722 JAEYBZ010000010.1 GCA023455535_02014 CDS open 40678-41337 _na     219_aa glpF Aquaporin
723 JAEYBZ010000010.1 GCA023455535_01971 gene open 132-593
724 JAEYBZ010000010.1 GCA023455535_01972 gene open 750-2177 pepV
725 JAEYBZ010000010.1 GCA023455535_01973 gene open 2310-3587 capA
726 JAEYBZ010000010.1 GCA023455535_01974 gene open 3846-4496 yciV
727 JAEYBZ010000010.1 GCA023455535_01975 gene open 4551-5543 afuA
728 JAEYBZ010000010.1 GCA023455535_01976 gene open 5578-7152 fbpB
729 JAEYBZ010000010.1 GCA023455535_01977 gene open 7153-8100 potA
730 JAEYBZ010000010.1 GCA023455535_01978 gene open 8379-9119 iclR
731 JAEYBZ010000010.1 GCA023455535_01979 gene open 9185-10105 aes
732 JAEYBZ010000010.1 GCA023455535_01980 gene open 10759-11553 nlpA
733 JAEYBZ010000010.1 GCA023455535_01981 gene open 11580-12233 metP
734 JAEYBZ010000010.1 GCA023455535_01982 gene open 12226-13245 abcC
735 JAEYBZ010000010.1 GCA023455535_01983 gene open 13513-14169 ulaG
736 JAEYBZ010000010.1 GCA023455535_01984 gene open 14522-14815
737 JAEYBZ010000010.1 GCA023455535_01985 gene open 14812-14973
738 JAEYBZ010000010.1 GCA023455535_01986 gene open 15092-15766 gntR
739 JAEYBZ010000010.1 GCA023455535_01987 gene open 16091-17734 nptA
740 JAEYBZ010000010.1 GCA023455535_01988 gene open 17967-18299 dgkA
741 JAEYBZ010000010.1 GCA023455535_01989 gene open 18359-18565 fliH
742 JAEYBZ010000010.1 GCA023455535_01990 gene open 18594-19409 dapF
743 JAEYBZ010000010.1 GCA023455535_01991 gene open 19603-20541 dnaJ
744 JAEYBZ010000010.1 GCA023455535_01992 gene open 20707-21072 sORL
745 JAEYBZ010000010.1 GCA023455535_01993 gene open 21167-21364
746 JAEYBZ010000010.1 GCA023455535_01994 gene open 21590-22723 wecE
747 JAEYBZ010000010.1 GCA023455535_01995 gene open 22817-23512 yugP
748 JAEYBZ010000010.1 GCA023455535_01996 gene open 23594-24295
749 JAEYBZ010000010.1 GCA023455535_01997 gene open 24303-25622 rsmB
750 JAEYBZ010000010.1 GCA023455535_01998 gene open 25648-26733 pASTA
751 JAEYBZ010000010.1 GCA023455535_01999 gene open 26712-27395 rpe
752 JAEYBZ010000010.1 GCA023455535_02000 gene open 27454-28452 rodZ
753 JAEYBZ010000010.1 GCA023455535_02001 gene open 28456-29760 rimO
754 JAEYBZ010000010.1 GCA023455535_02002 gene open 29753-30250 pgpA
755 JAEYBZ010000010.1 GCA023455535_02003 gene open 30284-30781 pncC
756 JAEYBZ010000010.1 GCA023455535_02004 gene open 30781-31365 thpR
757 JAEYBZ010000010.1 GCA023455535_02005 gene open 31402-32562 recA
758 JAEYBZ010000010.1 GCA023455535_02006 gene open 33167-34546 skfB
759 JAEYBZ010000010.1 GCA023455535_02007 gene open 34849-36102
760 JAEYBZ010000010.1 GCA023455535_02008 gene open 36202-37617 purF
761 JAEYBZ010000010.1 GCA023455535_02009 gene open 37813-38139 azlD
762 JAEYBZ010000010.1 GCA023455535_02010 gene open 38136-38849 azlC
763 JAEYBZ010000010.1 GCA023455535_02011 gene open 39023-39265
764 JAEYBZ010000010.1 GCA023455535_02012 gene open 39297-39566
765 JAEYBZ010000010.1 GCA023455535_02013 gene open 39680-40255 nfnB
766 JAEYBZ010000010.1 GCA023455535_02014 gene open 40678-41337 glpF
767 JAEYBZ010000011.1 GCA023455535_01618 CDS open 132-938 _na     268_aa ubiG bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG
768 JAEYBZ010000011.1 GCA023455535_01619 CDS open 931-2049 _na     372_aa fepB ABC transporter substrate-binding protein
769 JAEYBZ010000011.1 GCA023455535_01620 CDS open 2059-2811 _na     250_aa fepC ABC transporter ATP-binding protein
770 JAEYBZ010000011.1 GCA023455535_01621 CDS open 2813-3847 _na     344_aa fepD iron ABC transporter permease
771 JAEYBZ010000011.1 GCA023455535_01622 CDS open 4206-5981 _na     591_aa srmB DEAD/DEAH box helicase
772 JAEYBZ010000011.1 GCA023455535_01623 CDS open 6160-6528 _na     122_aa dnaJ Molecular chaperone DnaJ
773 JAEYBZ010000011.1 GCA023455535_01624 CDS open 6894-7871 _na     325_aa ycjU HAD family hydrolase
774 JAEYBZ010000011.1 GCA023455535_01625 CDS open 7990-8769 _na     259_aa elyC YdcF family protein
775 JAEYBZ010000011.1 GCA023455535_01626 CDS open 8766-9455 _na     229_aa gntR GntR family transcriptional regulator
776 JAEYBZ010000011.1 GCA023455535_01627 CDS open 9687-10130 _na     147_aa DUF340 domain-containing protein
777 JAEYBZ010000011.1 GCA023455535_01628 CDS open 10155-10970 _na     271_aa DUF3100 domain-containing protein
778 JAEYBZ010000011.1 GCA023455535_01629 CDS open 11055-12368 _na     437_aa abgB Peptidase M20 domain-containing protein 2
779 JAEYBZ010000011.1 GCA023455535_01632 CDS open 13025-15364 _na     779_aa rqcU endonuclease MutS2
780 JAEYBZ010000011.1 GCA023455535_01633 CDS open 15378-15881 _na     167_aa cvpA CvpA family protein
781 JAEYBZ010000011.1 GCA023455535_01634 CDS open 15878-16165 _na     95_aa flaG Flagellar biosynthesis protein FlaG
782 JAEYBZ010000011.1 GCA023455535_01635 CDS open 16170-16463 _na     97_aa zapB Cell division protein ZapB
783 JAEYBZ010000011.1 GCA023455535_01636 CDS open 16513-18894 _na     793_aa pheT phenylalanine--tRNA ligase subunit beta
784 JAEYBZ010000011.1 GCA023455535_01637 CDS open 18894-20045 _na     383_aa pheS phenylalanine--tRNA ligase subunit alpha
785 JAEYBZ010000011.1 GCA023455535_01638 CDS open 20076-20432 _na     118_aa rplT 50S ribosomal protein L20
786 JAEYBZ010000011.1 GCA023455535_01639 CDS open 20460-20660 _na     66_aa rpmI 50S ribosomal protein L35
787 JAEYBZ010000011.1 GCA023455535_01640 CDS open 20688-21251 _na     187_aa infC translation initiation factor IF-3
788 JAEYBZ010000011.1 GCA023455535_01618 gene open 132-938 ubiG
789 JAEYBZ010000011.1 GCA023455535_01619 gene open 931-2049 fepB
790 JAEYBZ010000011.1 GCA023455535_01620 gene open 2059-2811 fepC
791 JAEYBZ010000011.1 GCA023455535_01621 gene open 2813-3847 fepD
792 JAEYBZ010000011.1 GCA023455535_01622 gene open 4206-5981 srmB
793 JAEYBZ010000011.1 GCA023455535_01623 gene open 6160-6528 dnaJ
794 JAEYBZ010000011.1 GCA023455535_01624 gene open 6894-7871 ycjU
795 JAEYBZ010000011.1 GCA023455535_01625 gene open 7990-8769 elyC
796 JAEYBZ010000011.1 GCA023455535_01626 gene open 8766-9455 gntR
797 JAEYBZ010000011.1 GCA023455535_01627 gene open 9687-10130
798 JAEYBZ010000011.1 GCA023455535_01628 gene open 10155-10970
799 JAEYBZ010000011.1 GCA023455535_01629 gene open 11055-12368 abgB
800 JAEYBZ010000011.1 GCA023455535_01632 gene open 13025-15364 rqcU
801 JAEYBZ010000011.1 GCA023455535_01633 gene open 15378-15881 cvpA
802 JAEYBZ010000011.1 GCA023455535_01634 gene open 15878-16165 flaG
803 JAEYBZ010000011.1 GCA023455535_01635 gene open 16170-16463 zapB
804 JAEYBZ010000011.1 GCA023455535_01636 gene open 16513-18894 pheT
805 JAEYBZ010000011.1 GCA023455535_01637 gene open 18894-20045 pheS
806 JAEYBZ010000011.1 GCA023455535_01638 gene open 20076-20432 rplT
807 JAEYBZ010000011.1 GCA023455535_01639 gene open 20460-20660 rpmI
808 JAEYBZ010000011.1 GCA023455535_01640 gene open 20688-21251 infC
809 JAEYBZ010000011.1 GCA023455535_01630 gene open 12697-12773 trnR
810 JAEYBZ010000011.1 GCA023455535_01631 gene open 12791-12864 trnQ
811 JAEYBZ010000011.1 GCA023455535_01630 tRNA open 12697-12773 trnR tRNA-Arg(ccg)
812 JAEYBZ010000011.1 GCA023455535_01631 tRNA open 12791-12864 trnQ tRNA-Gln(ttg)
813 JAEYBZ010000012.1 GCA023455535_00682 CDS open 158-490 _na     110_aa rpoZ DNA-directed RNA polymerase subunit omega
814 JAEYBZ010000012.1 GCA023455535_00683 CDS open 512-2299 _na     595_aa priA primosomal protein
815 JAEYBZ010000012.1 GCA023455535_00684 CDS open 2332-3663 _na     443_aa der ribosome biogenesis GTPase Der
816 JAEYBZ010000012.1 GCA023455535_00685 CDS open 3762-4037 _na     91_aa hupA HU family DNA-binding protein
817 JAEYBZ010000012.1 GCA023455535_00686 CDS open 4310-5524 _na     404_aa DUF3798 domain-containing protein
818 JAEYBZ010000012.1 GCA023455535_00687 CDS open 5957-7168 _na     403_aa DUF3798 domain-containing protein
819 JAEYBZ010000012.1 GCA023455535_00688 CDS open 7406-9004 _na     532_aa nupO Sugar ABC transporter ATP-binding protein
820 JAEYBZ010000012.1 GCA023455535_00689 CDS open 9001-10044 _na     347_aa araH ABC transporter
821 JAEYBZ010000012.1 GCA023455535_00690 CDS open 10044-11156 _na     370_aa araH ABC transporter permease
822 JAEYBZ010000012.1 GCA023455535_00691 CDS open 11153-11539 _na     128_aa DUF6672 domain-containing protein
823 JAEYBZ010000012.1 GCA023455535_00692 CDS open 11703-12323 _na     206_aa rpsD 30S ribosomal protein S4
824 JAEYBZ010000012.1 GCA023455535_00693 CDS open 12489-13238 _na     249_aa gpmA 2%2C3-diphosphoglycerate-dependent phosphoglycerate mutase
825 JAEYBZ010000012.1 GCA023455535_00694 CDS open 13342-14220 _na     292_aa lpxP Lipid A biosynthesis acyltransferase
826 JAEYBZ010000012.1 GCA023455535_00695 CDS open 14222-14662 _na     146_aa endonuclease
827 JAEYBZ010000012.1 GCA023455535_00696 CDS open 14677-16041 _na     454_aa clcA Voltage-gated chloride channel
828 JAEYBZ010000012.1 GCA023455535_00682 gene open 158-490 rpoZ
829 JAEYBZ010000012.1 GCA023455535_00683 gene open 512-2299 priA
830 JAEYBZ010000012.1 GCA023455535_00684 gene open 2332-3663 der
831 JAEYBZ010000012.1 GCA023455535_00685 gene open 3762-4037 hupA
832 JAEYBZ010000012.1 GCA023455535_00686 gene open 4310-5524
833 JAEYBZ010000012.1 GCA023455535_00687 gene open 5957-7168
834 JAEYBZ010000012.1 GCA023455535_00688 gene open 7406-9004 nupO
835 JAEYBZ010000012.1 GCA023455535_00689 gene open 9001-10044 araH
836 JAEYBZ010000012.1 GCA023455535_00690 gene open 10044-11156 araH
837 JAEYBZ010000012.1 GCA023455535_00691 gene open 11153-11539
838 JAEYBZ010000012.1 GCA023455535_00692 gene open 11703-12323 rpsD
839 JAEYBZ010000012.1 GCA023455535_00693 gene open 12489-13238 gpmA
840 JAEYBZ010000012.1 GCA023455535_00694 gene open 13342-14220 lpxP
841 JAEYBZ010000012.1 GCA023455535_00695 gene open 14222-14662
842 JAEYBZ010000012.1 GCA023455535_00696 gene open 14677-16041 clcA
843 JAEYBZ010000013.1 GCA023455535_01171 CDS open 72-1133 _na     353_aa abrB AbrB family transcriptional regulator
844 JAEYBZ010000013.1 GCA023455535_01172 CDS open 1173-1808 _na     211_aa spoIVFB Site-2 protease family protein
845 JAEYBZ010000013.1 GCA023455535_01173 CDS open 1826-2437 _na     203_aa coaE dephospho-CoA kinase
846 JAEYBZ010000013.1 GCA023455535_01174 CDS open 2391-3572 _na     393_aa hypothetical protein
847 JAEYBZ010000013.1 GCA023455535_01171 gene open 72-1133 abrB
848 JAEYBZ010000013.1 GCA023455535_01172 gene open 1173-1808 spoIVFB
849 JAEYBZ010000013.1 GCA023455535_01173 gene open 1826-2437 coaE
850 JAEYBZ010000013.1 GCA023455535_01174 gene open 2391-3572
851 JAEYBZ010000014.1 GCA023455535_01346 CDS open 724-1140 _na     138_aa eamA EamA family transporter
852 JAEYBZ010000014.1 GCA023455535_01347 CDS open 1866-2015 _na     49_aa hypothetical protein
853 JAEYBZ010000014.1 GCA023455535_01348 CDS open 2195-3106 _na     303_aa eamA EamA domain-containing protein
854 JAEYBZ010000014.1 GCA023455535_01349 CDS open 3392-3703 _na     103_aa HMA2 domain-containing protein
855 JAEYBZ010000014.1 GCA023455535_01350 CDS open 3705-5795 _na     696_aa zntA heavy metal translocating P-type ATPase
856 JAEYBZ010000014.1 GCA023455535_01351 CDS open 5850-6077 _na     75_aa DUF1490 domain-containing protein
857 JAEYBZ010000014.1 GCA023455535_01352 CDS open 6404-6964 _na     186_aa ubiE class I SAM-dependent methyltransferase
858 JAEYBZ010000014.1 GCA023455535_01353 CDS open 6984-7775 _na     263_aa ubiE Methyltransferase domain-containing protein
859 JAEYBZ010000014.1 GCA023455535_01354 CDS open 7792-8580 _na     262_aa zupT ZIP family metal transporter
860 JAEYBZ010000014.1 GCA023455535_01355 CDS open 8695-9978 _na     427_aa Heme-binding protein Shr-like Hb-interacting domain-containing protein
861 JAEYBZ010000014.1 GCA023455535_01356 CDS open 10249-10662 _na     137_aa DNA-3-methyladenine glycosylase
862 JAEYBZ010000014.1 GCA023455535_01357 CDS open 10672-10932 _na     86_aa hypothetical protein
863 JAEYBZ010000014.1 GCA023455535_01358 CDS open 10935-11468 _na     177_aa adaB Methylated-DNA--protein-cysteine methyltransferase
864 JAEYBZ010000014.1 GCA023455535_01359 CDS open 11731-13047 _na     438_aa Succinylglutamate desuccinylase
865 JAEYBZ010000014.1 GCA023455535_01360 CDS open 13072-13236 _na     54_aa hypothetical protein
866 JAEYBZ010000014.1 GCA023455535_01361 CDS open 13255-14619 _na     454_aa dctQ TRAP C4-dicarboxylate transport system permease DctM subunit domain-containing protein
867 JAEYBZ010000014.1 GCA023455535_01346 gene open 724-1140 eamA
868 JAEYBZ010000014.1 GCA023455535_01347 gene open 1866-2015
869 JAEYBZ010000014.1 GCA023455535_01348 gene open 2195-3106 eamA
870 JAEYBZ010000014.1 GCA023455535_01349 gene open 3392-3703
871 JAEYBZ010000014.1 GCA023455535_01350 gene open 3705-5795 zntA
872 JAEYBZ010000014.1 GCA023455535_01351 gene open 5850-6077
873 JAEYBZ010000014.1 GCA023455535_01352 gene open 6404-6964 ubiE
874 JAEYBZ010000014.1 GCA023455535_01353 gene open 6984-7775 ubiE
875 JAEYBZ010000014.1 GCA023455535_01354 gene open 7792-8580 zupT
876 JAEYBZ010000014.1 GCA023455535_01355 gene open 8695-9978
877 JAEYBZ010000014.1 GCA023455535_01356 gene open 10249-10662
878 JAEYBZ010000014.1 GCA023455535_01357 gene open 10672-10932
879 JAEYBZ010000014.1 GCA023455535_01358 gene open 10935-11468 adaB
880 JAEYBZ010000014.1 GCA023455535_01359 gene open 11731-13047
881 JAEYBZ010000014.1 GCA023455535_01360 gene open 13072-13236
882 JAEYBZ010000014.1 GCA023455535_01361 gene open 13255-14619 dctQ
883 JAEYBZ010000015.1 GCA023455535_01641 CDS open 279-3041 _na     920_aa tamB AsmA-like C-terminal domain-containing protein
884 JAEYBZ010000015.1 GCA023455535_01642 CDS open 3342-4952 _na     536_aa ddpA ABC transporter substrate-binding protein
885 JAEYBZ010000015.1 GCA023455535_01643 CDS open 5074-6051 _na     325_aa dppB ABC transporter permease
886 JAEYBZ010000015.1 GCA023455535_01644 CDS open 6066-6965 _na     299_aa dppC ABC transporter permease
887 JAEYBZ010000015.1 GCA023455535_01645 CDS open 6976-7959 _na     327_aa dppD ABC transporter ATP-binding protein
888 JAEYBZ010000015.1 GCA023455535_01646 CDS open 7961-8962 _na     333_aa dppD ATP-binding cassette domain-containing protein
889 JAEYBZ010000015.1 GCA023455535_01647 CDS open 9089-10885 _na     598_aa C69 family dipeptidase
890 JAEYBZ010000015.1 GCA023455535_01641 gene open 279-3041 tamB
891 JAEYBZ010000015.1 GCA023455535_01642 gene open 3342-4952 ddpA
892 JAEYBZ010000015.1 GCA023455535_01643 gene open 5074-6051 dppB
893 JAEYBZ010000015.1 GCA023455535_01644 gene open 6066-6965 dppC
894 JAEYBZ010000015.1 GCA023455535_01645 gene open 6976-7959 dppD
895 JAEYBZ010000015.1 GCA023455535_01646 gene open 7961-8962 dppD
896 JAEYBZ010000015.1 GCA023455535_01647 gene open 9089-10885
897 JAEYBZ010000016.1 GCA023455535_00893 CDS open 69-1790 _na     573_aa lldP L-lactate permease
898 JAEYBZ010000016.1 GCA023455535_00894 CDS open 2179-2802 _na     207_aa acrR TetR family transcriptional regulator
899 JAEYBZ010000016.1 GCA023455535_00895 CDS open 2799-3620 _na     273_aa Glycine reductase
900 JAEYBZ010000016.1 GCA023455535_00896 CDS open 3798-5066 _na     422_aa Glycine reductase
901 JAEYBZ010000016.1 GCA023455535_00897 CDS open 5087-6139 _na     350_aa Selenoprotein B%2C glycine/betaine/sarcosine/D-proline reductase family
902 JAEYBZ010000016.1 GCA023455535_00898 CDS open 6167-6406 _na     79_aa Glycine reductase complex component B subunit gamma
903 JAEYBZ010000016.1 GCA023455535_00899 CDS open 6561-7442 _na     293_aa menH Alpha/beta hydrolase
904 JAEYBZ010000016.1 GCA023455535_00900 CDS open 7529-8269 _na     246_aa fadR HTH gntR-type domain-containing protein
905 JAEYBZ010000016.1 GCA023455535_00901 CDS open 8461-9165 _na     234_aa fadR HTH gntR-type domain-containing protein
906 JAEYBZ010000016.1 GCA023455535_00902 CDS open 9226-9540 _na     104_aa hypothetical protein
907 JAEYBZ010000016.1 GCA023455535_00903 CDS open 9681-10562 _na     293_aa menH Alpha/beta hydrolase
908 JAEYBZ010000016.1 GCA023455535_00904 CDS open 10707-11327 _na     206_aa frnE DSBA-like thioredoxin domain-containing protein
909 JAEYBZ010000016.1 GCA023455535_00905 CDS open 11465-12340 _na     291_aa manC Cupin domain-containing protein
910 JAEYBZ010000016.1 GCA023455535_00906 CDS open 12416-13543 _na     375_aa fliB flagellin lysine-N-methylase
911 JAEYBZ010000016.1 GCA023455535_00907 CDS open 14017-15297 _na     426_aa SLC13 family permease
912 JAEYBZ010000016.1 GCA023455535_00908 CDS open 15662-16870 _na     402_aa MmgE/PrpD family protein
913 JAEYBZ010000016.1 GCA023455535_00909 CDS open 17064-17999 _na     311_aa lysR LysR family transcriptional regulator
914 JAEYBZ010000016.1 GCA023455535_00910 CDS open 18231-18815 _na     194_aa fldA Flavodoxin
915 JAEYBZ010000016.1 GCA023455535_00911 CDS open 19026-20033 _na     335_aa afuA Extracellular solute-binding protein
916 JAEYBZ010000016.1 GCA023455535_00912 CDS open 20179-22425 _na     748_aa pflB formate C-acetyltransferase
917 JAEYBZ010000016.1 GCA023455535_00913 CDS open 22477-23325 _na     282_aa pflA pyruvate formate-lyase-activating protein
918 JAEYBZ010000016.1 GCA023455535_00914 CDS open 23474-23719 _na     81_aa helix-turn-helix domain-containing protein
919 JAEYBZ010000016.1 GCA023455535_00915 CDS open 23747-24178 _na     143_aa cyclic nucleotide-binding domain-containing protein
920 JAEYBZ010000016.1 GCA023455535_00916 CDS open 24481-26184 _na     567_aa fbpB Iron ABC transporter permease
921 JAEYBZ010000016.1 GCA023455535_00917 CDS open 26203-27267 _na     354_aa potA ABC transporter ATP-binding protein
922 JAEYBZ010000016.1 GCA023455535_00918 CDS open 27475-28341 _na     288_aa gpmA 2%2C3-bisphosphoglycerate-dependent phosphoglycerate mutase
923 JAEYBZ010000016.1 GCA023455535_00919 CDS open 28420-29085 _na     221_aa L-2-amino-thiazoline-4-carboxylic acid hydrolase
924 JAEYBZ010000016.1 GCA023455535_00920 CDS open 29600-30055 _na     151_aa flavodoxin
925 JAEYBZ010000016.1 GCA023455535_00921 CDS open 30084-31181 _na     365_aa glxA GNAT family N-acetyltransferase
926 JAEYBZ010000016.1 GCA023455535_00893 gene open 69-1790 lldP
927 JAEYBZ010000016.1 GCA023455535_00894 gene open 2179-2802 acrR
928 JAEYBZ010000016.1 GCA023455535_00895 gene open 2799-3620
929 JAEYBZ010000016.1 GCA023455535_00896 gene open 3798-5066
930 JAEYBZ010000016.1 GCA023455535_00897 gene open 5087-6139
931 JAEYBZ010000016.1 GCA023455535_00898 gene open 6167-6406
932 JAEYBZ010000016.1 GCA023455535_00899 gene open 6561-7442 menH
933 JAEYBZ010000016.1 GCA023455535_00900 gene open 7529-8269 fadR
934 JAEYBZ010000016.1 GCA023455535_00901 gene open 8461-9165 fadR
935 JAEYBZ010000016.1 GCA023455535_00902 gene open 9226-9540
936 JAEYBZ010000016.1 GCA023455535_00903 gene open 9681-10562 menH
937 JAEYBZ010000016.1 GCA023455535_00904 gene open 10707-11327 frnE
938 JAEYBZ010000016.1 GCA023455535_00905 gene open 11465-12340 manC
939 JAEYBZ010000016.1 GCA023455535_00906 gene open 12416-13543 fliB
940 JAEYBZ010000016.1 GCA023455535_00907 gene open 14017-15297
941 JAEYBZ010000016.1 GCA023455535_00908 gene open 15662-16870
942 JAEYBZ010000016.1 GCA023455535_00909 gene open 17064-17999 lysR
943 JAEYBZ010000016.1 GCA023455535_00910 gene open 18231-18815 fldA
944 JAEYBZ010000016.1 GCA023455535_00911 gene open 19026-20033 afuA
945 JAEYBZ010000016.1 GCA023455535_00912 gene open 20179-22425 pflB
946 JAEYBZ010000016.1 GCA023455535_00913 gene open 22477-23325 pflA
947 JAEYBZ010000016.1 GCA023455535_00914 gene open 23474-23719
948 JAEYBZ010000016.1 GCA023455535_00915 gene open 23747-24178
949 JAEYBZ010000016.1 GCA023455535_00916 gene open 24481-26184 fbpB
950 JAEYBZ010000016.1 GCA023455535_00917 gene open 26203-27267 potA
951 JAEYBZ010000016.1 GCA023455535_00918 gene open 27475-28341 gpmA
952 JAEYBZ010000016.1 GCA023455535_00919 gene open 28420-29085
953 JAEYBZ010000016.1 GCA023455535_00920 gene open 29600-30055
954 JAEYBZ010000016.1 GCA023455535_00921 gene open 30084-31181 glxA
955 JAEYBZ010000017.1 GCA023455535_00735 CDS open 206-826 _na     206_aa phoU PhoU domain-containing protein
956 JAEYBZ010000017.1 GCA023455535_00736 CDS open 1005-1775 _na     256_aa xth exodeoxyribonuclease III
957 JAEYBZ010000017.1 GCA023455535_00737 CDS open 1793-3325 _na     510_aa YbaK/aminoacyl-tRNA synthetase-associated domain-containing protein
958 JAEYBZ010000017.1 GCA023455535_00738 CDS open 3362-3763 _na     133_aa hypothetical protein
959 JAEYBZ010000017.1 GCA023455535_00739 CDS open 3766-4233 _na     155_aa Spc97/Spc98 family protein
960 JAEYBZ010000017.1 GCA023455535_00740 CDS open 4295-5446 _na     383_aa hypothetical protein
961 JAEYBZ010000017.1 GCA023455535_00741 CDS open 5627-6988 _na     453_aa norM Multidrug-efflux transporter
962 JAEYBZ010000017.1 GCA023455535_00742 CDS open 7016-8269 _na     417_aa proA glutamate-5-semialdehyde dehydrogenase
963 JAEYBZ010000017.1 GCA023455535_00743 CDS open 8300-9457 _na     385_aa proB Glutamate 5-kinase
964 JAEYBZ010000017.1 GCA023455535_00744 CDS open 9642-9950 _na     102_aa trxA thioredoxin
965 JAEYBZ010000017.1 GCA023455535_00745 CDS open 10036-10707 _na     223_aa crp Crp/Fnr family transcriptional regulator
966 JAEYBZ010000017.1 GCA023455535_00746 CDS open 10777-13101 _na     774_aa clpA ATP-dependent Clp protease ATP-binding subunit
967 JAEYBZ010000017.1 GCA023455535_00747 CDS open 13142-13639 _na     165_aa ctsR CtsR family transcriptional regulator
968 JAEYBZ010000017.1 GCA023455535_00748 CDS open 13719-14318 _na     199_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
969 JAEYBZ010000017.1 GCA023455535_00749 CDS open 14448-16499 _na     683_aa patZN Succinyl-CoA synthetase-like flavodoxin domain-containing protein
970 JAEYBZ010000017.1 GCA023455535_00750 CDS open 16673-17011 _na     112_aa hupA HU family DNA-binding protein
971 JAEYBZ010000017.1 GCA023455535_00751 CDS open 17298-17657 _na     119_aa gloA Lactoylglutathione lyase
972 JAEYBZ010000017.1 GCA023455535_00752 CDS open 17716-18171 _na     151_aa iscR Rrf2 family transcriptional regulator
973 JAEYBZ010000017.1 GCA023455535_00753 CDS open 18640-20049 _na     469_aa norM Multidrug export protein MepA
974 JAEYBZ010000017.1 GCA023455535_00735 gene open 206-826 phoU
975 JAEYBZ010000017.1 GCA023455535_00736 gene open 1005-1775 xth
976 JAEYBZ010000017.1 GCA023455535_00737 gene open 1793-3325
977 JAEYBZ010000017.1 GCA023455535_00738 gene open 3362-3763
978 JAEYBZ010000017.1 GCA023455535_00739 gene open 3766-4233
979 JAEYBZ010000017.1 GCA023455535_00740 gene open 4295-5446
980 JAEYBZ010000017.1 GCA023455535_00741 gene open 5627-6988 norM
981 JAEYBZ010000017.1 GCA023455535_00742 gene open 7016-8269 proA
982 JAEYBZ010000017.1 GCA023455535_00743 gene open 8300-9457 proB
983 JAEYBZ010000017.1 GCA023455535_00744 gene open 9642-9950 trxA
984 JAEYBZ010000017.1 GCA023455535_00745 gene open 10036-10707 crp
985 JAEYBZ010000017.1 GCA023455535_00746 gene open 10777-13101 clpA
986 JAEYBZ010000017.1 GCA023455535_00747 gene open 13142-13639 ctsR
987 JAEYBZ010000017.1 GCA023455535_00748 gene open 13719-14318 plsY
988 JAEYBZ010000017.1 GCA023455535_00749 gene open 14448-16499 patZN
989 JAEYBZ010000017.1 GCA023455535_00750 gene open 16673-17011 hupA
990 JAEYBZ010000017.1 GCA023455535_00751 gene open 17298-17657 gloA
991 JAEYBZ010000017.1 GCA023455535_00752 gene open 17716-18171 iscR
992 JAEYBZ010000017.1 GCA023455535_00753 gene open 18640-20049 norM
993 JAEYBZ010000017.1 GCA023455535_00754 gene open 20476-20560 trnL
994 JAEYBZ010000017.1 GCA023455535_00754 tRNA open 20476-20560 trnL tRNA-Leu(aag)
995 JAEYBZ010000018.1 GCA023455535_00922 CDS open 233-808 _na     191_aa efp elongation factor P
996 JAEYBZ010000018.1 GCA023455535_00923 CDS open 928-1353 _na     141_aa Zinc ribbon domain-containing protein
997 JAEYBZ010000018.1 GCA023455535_00924 CDS open 1340-1843 _na     167_aa yloU Alkaline-shock protein
998 JAEYBZ010000018.1 GCA023455535_00925 CDS open 1960-2403 _na     147_aa Cytochrome D ubiquinol oxidase subunit I
999 JAEYBZ010000018.1 GCA023455535_00926 CDS open 2400-2921 _na     173_aa nusB transcription antitermination factor NusB
1000 JAEYBZ010000018.1 GCA023455535_00927 CDS open 2918-4177 _na     419_aa xseA exodeoxyribonuclease VII large subunit