HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Paenibacillus phoenicis (GCA_027665525.1)

Select a Genome:
BAKTA Annotations for GCA_027665525.1
Genome Selected: Paenibacillus phoenicis
ContigsBases CDSrRNA tmRNAtRNA
226 4969493 4661 5 2 53
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 9507 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:13]    |    Number of Records Found: 9507 [20 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
6001 JAQDEC010000051.1 GCA027665525_03277 gene open 6341-7996
6002 JAQDEC010000051.1 GCA027665525_03278 gene open 8324-9493 kamA
6003 JAQDEC010000051.1 GCA027665525_03279 gene open 9558-11249
6004 JAQDEC010000051.1 GCA027665525_03280 gene open 11508-12593
6005 JAQDEC010000051.1 GCA027665525_03281 gene open 12796-14319
6006 JAQDEC010000051.1 GCA027665525_03282 gene open 14326-14907 padR
6007 JAQDEC010000051.1 GCA027665525_03283 gene open 14970-15968
6008 JAQDEC010000051.1 GCA027665525_03284 gene open 16028-16525 queF
6009 JAQDEC010000051.1 GCA027665525_03285 gene open 17088-17849 queE
6010 JAQDEC010000051.1 GCA027665525_03286 gene open 17842-18336 queD
6011 JAQDEC010000051.1 GCA027665525_03287 gene open 18333-19001 queC
6012 JAQDEC010000051.1 GCA027665525_03288 gene open 19709-20182
6013 JAQDEC010000051.1 GCA027665525_03289 gene open 20765-21508
6014 JAQDEC010000051.1 GCA027665525_03290 gene open 21453-21863
6015 JAQDEC010000051.1 GCA027665525_03291 gene open 22017-23048
6016 JAQDEC010000051.1 GCA027665525_03292 gene open 23311-23718 nusG
6017 JAQDEC010000051.1 GCA027665525_03293 gene open 23895-24122
6018 JAQDEC010000051.1 GCA027665525_03294 gene open 24339-25559 cobW
6019 JAQDEC010000051.1 GCA027665525_03295 gene open 25586-25735 rpmG
6020 JAQDEC010000051.1 GCA027665525_03296 gene open 25823-26530
6021 JAQDEC010000051.1 GCA027665525_03297 gene open 26482-27369
6022 JAQDEC010000051.1 GCA027665525_03298 gene open 27395-28525
6023 JAQDEC010000051.1 GCA027665525_03299 gene open 28602-29408 speD
6024 JAQDEC010000051.1 GCA027665525_03300 gene open 29797-29943
6025 JAQDEC010000051.1 GCA027665525_03301 gene open 29950-30774
6026 JAQDEC010000051.1 GCA027665525_03302 gene open 30845-31558 glnP
6027 JAQDEC010000051.1 GCA027665525_03303 gene open 31577-32320 artM
6028 JAQDEC010000051.1 GCA027665525_03304 gene open 32875-33549
6029 JAQDEC010000051.1 GCA027665525_03305 gene open 33706-34188 marR
6030 JAQDEC010000051.1 GCA027665525_03306 gene open 34288-35703
6031 JAQDEC010000052.1 GCA027665525_03307 CDS open 30-695 _na     221_aa fliK flagellar hook-length control protein FliK
6032 JAQDEC010000052.1 GCA027665525_03308 CDS open 692-997 _na     101_aa flhB FlhB domain-containing protein
6033 JAQDEC010000052.1 GCA027665525_03309 CDS open 990-1382 _na     130_aa yraN YraN family protein
6034 JAQDEC010000052.1 GCA027665525_03310 CDS open 1390-3009 _na     539_aa Mg chelatase-like protein
6035 JAQDEC010000052.1 GCA027665525_03311 CDS open 3595-4755 _na     386_aa sucC ADP-forming succinate--CoA ligase subunit beta
6036 JAQDEC010000052.1 GCA027665525_03312 CDS open 4810-5739 _na     309_aa sucD succinate--CoA ligase subunit alpha
6037 JAQDEC010000052.1 GCA027665525_03313 CDS open 5838-6926 _na     362_aa dprA DNA-processing protein DprA
6038 JAQDEC010000052.1 GCA027665525_03314 CDS open 7035-9134 _na     699_aa topA type I DNA topoisomerase
6039 JAQDEC010000052.1 GCA027665525_03315 CDS open 9202-10524 _na     440_aa trmFO FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO
6040 JAQDEC010000052.1 GCA027665525_03316 CDS open 10711-11253 _na     180_aa hslV ATP-dependent protease subunit HslV
6041 JAQDEC010000052.1 GCA027665525_03317 CDS open 11289-12692 _na     467_aa hslU ATP-dependent protease ATPase subunit HslU
6042 JAQDEC010000052.1 GCA027665525_03318 CDS open 13085-13492 _na     135_aa flgB flagellar basal body rod protein FlgB
6043 JAQDEC010000052.1 GCA027665525_03319 CDS open 13499-13948 _na     149_aa flgC flagellar basal body rod protein FlgC
6044 JAQDEC010000052.1 GCA027665525_03320 CDS open 13993-14301 _na     102_aa fliE flagellar hook-basal body complex protein FliE
6045 JAQDEC010000052.1 GCA027665525_03321 CDS open 14333-15916 _na     527_aa fliF flagellar basal-body MS-ring/collar protein FliF
6046 JAQDEC010000052.1 GCA027665525_03322 CDS open 15928-16944 _na     338_aa fliG flagellar motor switch protein FliG
6047 JAQDEC010000052.1 GCA027665525_03323 CDS open 16937-17791 _na     284_aa fliH Flagellar assembly protein FliH
6048 JAQDEC010000052.1 GCA027665525_03324 CDS open 17772-19091 _na     439_aa fliI flagellar protein export ATPase FliI
6049 JAQDEC010000052.1 GCA027665525_03325 CDS open 19102-19545 _na     147_aa fliJ Flagellar FliJ protein
6050 JAQDEC010000052.1 GCA027665525_03326 CDS open 19587-20525 _na     312_aa mgtE Magnesium transporter MgtE intracellular domain-containing protein
6051 JAQDEC010000052.1 GCA027665525_03327 CDS open 20566-21990 _na     474_aa Flagellar hook-length control protein-like C-terminal domain-containing protein
6052 JAQDEC010000052.1 GCA027665525_03328 CDS open 22023-22526 _na     167_aa Flagellar hook capping protein
6053 JAQDEC010000052.1 GCA027665525_03329 CDS open 22523-22903 _na     126_aa TIGR02530 family flagellar biosynthesis protein
6054 JAQDEC010000052.1 GCA027665525_03330 CDS open 22996-23820 _na     274_aa flgE Flagellar hook protein FlgE
6055 JAQDEC010000052.1 GCA027665525_03331 CDS open 23902-24126 _na     74_aa flbD Flagellar protein FlbD
6056 JAQDEC010000052.1 GCA027665525_03332 CDS open 24123-24596 _na     157_aa fliL Flagellar protein FliL
6057 JAQDEC010000052.1 GCA027665525_03333 CDS open 24640-25641 _na     333_aa fliM flagellar motor switch protein FliM
6058 JAQDEC010000052.1 GCA027665525_03334 CDS open 25628-26881 _na     417_aa fliY flagellar motor switch phosphatase FliY
6059 JAQDEC010000052.1 GCA027665525_03335 CDS open 26909-27274 _na     121_aa cheY Chemotaxis protein CheY
6060 JAQDEC010000052.1 GCA027665525_03336 CDS open 27283-27810 _na     175_aa Flagellar protein
6061 JAQDEC010000052.1 GCA027665525_03337 CDS open 27807-28574 _na     255_aa fliP flagellar type III secretion system pore protein FliP
6062 JAQDEC010000052.1 GCA027665525_03338 CDS open 28612-28881 _na     89_aa fliQ flagellar biosynthesis protein FliQ
6063 JAQDEC010000052.1 GCA027665525_03339 CDS open 28894-29682 _na     262_aa fliR flagellar biosynthetic protein FliR
6064 JAQDEC010000052.1 GCA027665525_03340 CDS open 29697-30788 _na     363_aa flhB flagellar biosynthesis protein FlhB
6065 JAQDEC010000052.1 GCA027665525_03341 CDS open 30810-32846 _na     678_aa flhA flagellar biosynthesis protein FlhA
6066 JAQDEC010000052.1 GCA027665525_03342 CDS open 32843-34270 _na     475_aa flhF flagellar biosynthesis protein FlhF
6067 JAQDEC010000052.1 GCA027665525_03343 CDS open 34267-35154 _na     295_aa AAA domain-containing protein
6068 JAQDEC010000052.1 GCA027665525_03307 gene open 30-695 fliK
6069 JAQDEC010000052.1 GCA027665525_03308 gene open 692-997 flhB
6070 JAQDEC010000052.1 GCA027665525_03309 gene open 990-1382 yraN
6071 JAQDEC010000052.1 GCA027665525_03310 gene open 1390-3009
6072 JAQDEC010000052.1 GCA027665525_03311 gene open 3595-4755 sucC
6073 JAQDEC010000052.1 GCA027665525_03312 gene open 4810-5739 sucD
6074 JAQDEC010000052.1 GCA027665525_03313 gene open 5838-6926 dprA
6075 JAQDEC010000052.1 GCA027665525_03314 gene open 7035-9134 topA
6076 JAQDEC010000052.1 GCA027665525_03315 gene open 9202-10524 trmFO
6077 JAQDEC010000052.1 GCA027665525_03316 gene open 10711-11253 hslV
6078 JAQDEC010000052.1 GCA027665525_03317 gene open 11289-12692 hslU
6079 JAQDEC010000052.1 GCA027665525_03318 gene open 13085-13492 flgB
6080 JAQDEC010000052.1 GCA027665525_03319 gene open 13499-13948 flgC
6081 JAQDEC010000052.1 GCA027665525_03320 gene open 13993-14301 fliE
6082 JAQDEC010000052.1 GCA027665525_03321 gene open 14333-15916 fliF
6083 JAQDEC010000052.1 GCA027665525_03322 gene open 15928-16944 fliG
6084 JAQDEC010000052.1 GCA027665525_03323 gene open 16937-17791 fliH
6085 JAQDEC010000052.1 GCA027665525_03324 gene open 17772-19091 fliI
6086 JAQDEC010000052.1 GCA027665525_03325 gene open 19102-19545 fliJ
6087 JAQDEC010000052.1 GCA027665525_03326 gene open 19587-20525 mgtE
6088 JAQDEC010000052.1 GCA027665525_03327 gene open 20566-21990
6089 JAQDEC010000052.1 GCA027665525_03328 gene open 22023-22526
6090 JAQDEC010000052.1 GCA027665525_03329 gene open 22523-22903
6091 JAQDEC010000052.1 GCA027665525_03330 gene open 22996-23820 flgE
6092 JAQDEC010000052.1 GCA027665525_03331 gene open 23902-24126 flbD
6093 JAQDEC010000052.1 GCA027665525_03332 gene open 24123-24596 fliL
6094 JAQDEC010000052.1 GCA027665525_03333 gene open 24640-25641 fliM
6095 JAQDEC010000052.1 GCA027665525_03334 gene open 25628-26881 fliY
6096 JAQDEC010000052.1 GCA027665525_03335 gene open 26909-27274 cheY
6097 JAQDEC010000052.1 GCA027665525_03336 gene open 27283-27810
6098 JAQDEC010000052.1 GCA027665525_03337 gene open 27807-28574 fliP
6099 JAQDEC010000052.1 GCA027665525_03338 gene open 28612-28881 fliQ
6100 JAQDEC010000052.1 GCA027665525_03339 gene open 28894-29682 fliR
6101 JAQDEC010000052.1 GCA027665525_03340 gene open 29697-30788 flhB
6102 JAQDEC010000052.1 GCA027665525_03341 gene open 30810-32846 flhA
6103 JAQDEC010000052.1 GCA027665525_03342 gene open 32843-34270 flhF
6104 JAQDEC010000052.1 GCA027665525_03343 gene open 34267-35154
6105 JAQDEC010000053.1 GCA027665525_03359 gene open 22867-23117 bsrG
6106 JAQDEC010000053.1 GCA027665525_03359 ncRNA open 22867-23117 bsrG BsrG
6107 JAQDEC010000053.1 GCA027665525_03344 CDS open 540-833 _na     97_aa hypothetical protein
6108 JAQDEC010000053.1 GCA027665525_03345 CDS open 926-1138 _na     70_aa hypothetical protein
6109 JAQDEC010000053.1 GCA027665525_03346 CDS open 1600-2250 _na     216_aa Transcriptional regulator
6110 JAQDEC010000053.1 GCA027665525_03347 CDS open 2698-3579 _na     293_aa OmpA-like domain-containing protein
6111 JAQDEC010000053.1 GCA027665525_03348 CDS open 3576-4412 _na     278_aa flagellar motor protein
6112 JAQDEC010000053.1 GCA027665525_03349 CDS open 4686-6668 _na     660_aa uvrB excinuclease ABC subunit UvrB
6113 JAQDEC010000053.1 GCA027665525_03350 CDS open 7374-10253 _na     959_aa uvrA excinuclease ABC subunit UvrA
6114 JAQDEC010000053.1 GCA027665525_03351 CDS open 10566-12203 _na     545_aa Nitrite and sulphite reductase 4Fe-4S domain protein
6115 JAQDEC010000053.1 GCA027665525_03352 CDS open 12558-12773 _na     71_aa DUF2759 domain-containing protein
6116 JAQDEC010000053.1 GCA027665525_03353 CDS open 13068-14288 _na     406_aa S-layer-like y domain-containing protein
6117 JAQDEC010000053.1 GCA027665525_03354 CDS open 14300-17617 _na     1105_aa BIG2 domain-containing protein
6118 JAQDEC010000053.1 GCA027665525_03355 CDS open 17662-18213 _na     183_aa SpoVT/AbrB-like protein
6119 JAQDEC010000053.1 GCA027665525_03356 CDS open 18423-19046 _na     207_aa Deoxynucleoside kinase domain-containing protein
6120 JAQDEC010000053.1 GCA027665525_03357 CDS open 19050-19703 _na     217_aa Deoxyadenosine/deoxycytidine kinase
6121 JAQDEC010000053.1 GCA027665525_03358 CDS open 20156-22756 _na     866_aa yhbU Putative protease YhbU
6122 JAQDEC010000053.1 GCA027665525_03360 CDS open 23247-23546 _na     99_aa DUF6809 domain-containing protein
6123 JAQDEC010000053.1 GCA027665525_03361 CDS open 23599-23772 _na     57_aa hypothetical protein
6124 JAQDEC010000053.1 GCA027665525_03362 CDS open 23686-23967 _na     93_aa hypothetical protein
6125 JAQDEC010000053.1 GCA027665525_03363 CDS open 24213-24410 _na     65_aa hypothetical protein
6126 JAQDEC010000053.1 GCA027665525_03364 CDS open 24558-25433 _na     291_aa galU UTP--glucose-1-phosphate uridylyltransferase GalU
6127 JAQDEC010000053.1 GCA027665525_03365 CDS open 25605-26150 _na     181_aa dTDP-4-dehydrorhamnose 3%2C5-epimerase
6128 JAQDEC010000053.1 GCA027665525_03366 CDS open 26184-27206 _na     340_aa dTDP-glucose 4%2C6-dehydratase
6129 JAQDEC010000053.1 GCA027665525_03367 CDS open 27203-28078 _na     291_aa dTDP-4-dehydrorhamnose reductase
6130 JAQDEC010000053.1 GCA027665525_03368 CDS open 28126-29328 _na     400_aa Acyltransferase 3 domain-containing protein
6131 JAQDEC010000053.1 GCA027665525_03369 CDS open 29445-30335 _na     296_aa GP-PDE domain-containing protein
6132 JAQDEC010000053.1 GCA027665525_03370 CDS open 30751-31458 _na     235_aa heptaprenylglyceryl phosphate synthase
6133 JAQDEC010000053.1 GCA027665525_03371 CDS open 32018-33550 _na     510_aa hypothetical protein
6134 JAQDEC010000053.1 GCA027665525_03344 gene open 540-833
6135 JAQDEC010000053.1 GCA027665525_03345 gene open 926-1138
6136 JAQDEC010000053.1 GCA027665525_03346 gene open 1600-2250
6137 JAQDEC010000053.1 GCA027665525_03347 gene open 2698-3579
6138 JAQDEC010000053.1 GCA027665525_03348 gene open 3576-4412
6139 JAQDEC010000053.1 GCA027665525_03349 gene open 4686-6668 uvrB
6140 JAQDEC010000053.1 GCA027665525_03350 gene open 7374-10253 uvrA
6141 JAQDEC010000053.1 GCA027665525_03351 gene open 10566-12203
6142 JAQDEC010000053.1 GCA027665525_03352 gene open 12558-12773
6143 JAQDEC010000053.1 GCA027665525_03353 gene open 13068-14288
6144 JAQDEC010000053.1 GCA027665525_03354 gene open 14300-17617
6145 JAQDEC010000053.1 GCA027665525_03355 gene open 17662-18213
6146 JAQDEC010000053.1 GCA027665525_03356 gene open 18423-19046
6147 JAQDEC010000053.1 GCA027665525_03357 gene open 19050-19703
6148 JAQDEC010000053.1 GCA027665525_03358 gene open 20156-22756 yhbU
6149 JAQDEC010000053.1 GCA027665525_03360 gene open 23247-23546
6150 JAQDEC010000053.1 GCA027665525_03361 gene open 23599-23772
6151 JAQDEC010000053.1 GCA027665525_03362 gene open 23686-23967
6152 JAQDEC010000053.1 GCA027665525_03363 gene open 24213-24410
6153 JAQDEC010000053.1 GCA027665525_03364 gene open 24558-25433 galU
6154 JAQDEC010000053.1 GCA027665525_03365 gene open 25605-26150
6155 JAQDEC010000053.1 GCA027665525_03366 gene open 26184-27206
6156 JAQDEC010000053.1 GCA027665525_03367 gene open 27203-28078
6157 JAQDEC010000053.1 GCA027665525_03368 gene open 28126-29328
6158 JAQDEC010000053.1 GCA027665525_03369 gene open 29445-30335
6159 JAQDEC010000053.1 GCA027665525_03370 gene open 30751-31458
6160 JAQDEC010000053.1 GCA027665525_03371 gene open 32018-33550
6161 JAQDEC010000054.1 regulatory_region open 18899-19110 c-di-AMP riboswitch aptamer (ydaO/yuaA leader)
6162 JAQDEC010000054.1 GCA027665525_03372 CDS open 1610-2152 _na     180_aa spoVT stage V sporulation protein T
6163 JAQDEC010000054.1 GCA027665525_03373 CDS open 2467-3597 _na     376_aa ppiC PpiC domain-containing protein
6164 JAQDEC010000054.1 GCA027665525_03374 CDS open 3614-7138 _na     1174_aa mfd transcription-repair coupling factor
6165 JAQDEC010000054.1 GCA027665525_03375 CDS open 7297-7527 _na     76_aa Anti-sigma-F factor Fin family protein
6166 JAQDEC010000054.1 GCA027665525_03376 CDS open 7613-8173 _na     186_aa pth aminoacyl-tRNA hydrolase
6167 JAQDEC010000054.1 GCA027665525_03377 CDS open 8838-9791 _na     317_aa prsA ribose-phosphate diphosphokinase
6168 JAQDEC010000054.1 GCA027665525_03378 CDS open 9904-11304 _na     466_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
6169 JAQDEC010000054.1 GCA027665525_03379 CDS open 11466-11750 _na     94_aa spoVG septation regulator SpoVG
6170 JAQDEC010000054.1 GCA027665525_03380 CDS open 11927-12763 _na     278_aa purR pur operon repressor
6171 JAQDEC010000054.1 GCA027665525_03381 CDS open 12878-13732 _na     284_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
6172 JAQDEC010000054.1 GCA027665525_03382 CDS open 13921-14100 _na     59_aa Small%2C acid-soluble spore protein%2C alpha/beta type
6173 JAQDEC010000054.1 GCA027665525_03383 CDS open 14298-14573 _na     91_aa veg biofilm formation stimulator Veg
6174 JAQDEC010000054.1 GCA027665525_03384 CDS open 14780-15682 _na     300_aa yabG sporulation peptidase YabG
6175 JAQDEC010000054.1 GCA027665525_03385 CDS open 15721-16617 _na     298_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
6176 JAQDEC010000054.1 GCA027665525_03386 CDS open 16623-17168 _na     181_aa rnmV ribonuclease M5
6177 JAQDEC010000054.1 GCA027665525_03387 CDS open 17317-18453 _na     378_aa G5 domain-containing protein
6178 JAQDEC010000054.1 GCA027665525_03388 CDS open 19312-20085 _na     257_aa tatD TatD DNase family protein
6179 JAQDEC010000054.1 GCA027665525_03389 CDS open 20102-21391 _na     429_aa HD domain-containing protein
6180 JAQDEC010000054.1 GCA027665525_03390 CDS open 21696-21950 _na     84_aa AbrB/MazE/SpoVT family DNA-binding domain-containing protein
6181 JAQDEC010000054.1 GCA027665525_03391 CDS open 22101-23000 _na     299_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
6182 JAQDEC010000054.1 GCA027665525_03392 CDS open 22997-23752 _na     251_aa tRNA1(Val) (adenine(37)-N6)-methyltransferase
6183 JAQDEC010000054.1 GCA027665525_03393 CDS open 23820-24191 _na     123_aa yabA Initiation-control protein YabA
6184 JAQDEC010000054.1 GCA027665525_03394 CDS open 24241-25041 _na     266_aa PSP1 C-terminal domain-containing protein
6185 JAQDEC010000054.1 GCA027665525_03395 CDS open 25192-26172 _na     326_aa DNA polymerase III subunit delta
6186 JAQDEC010000054.1 GCA027665525_03396 CDS open 26197-26640 _na     147_aa DUF327 domain-containing protein
6187 JAQDEC010000054.1 GCA027665525_03397 CDS open 26802-27131 _na     109_aa darA Protein from nitrogen regulatory protein P-II
6188 JAQDEC010000054.1 GCA027665525_03398 CDS open 27183-27833 _na     216_aa tmk dTMP kinase
6189 JAQDEC010000054.1 GCA027665525_03399 CDS open 27889-29421 _na     510_aa Orn/Lys/Arg decarboxylases family 1 pyridoxal-P attachment site domain-containing protein
6190 JAQDEC010000054.1 GCA027665525_03400 CDS open 29565-29750 _na     61_aa Inhibitor of sigma-G Gin
6191 JAQDEC010000054.1 GCA027665525_03401 CDS open 29967-30494 _na     175_aa Sensor domain-containing protein
6192 JAQDEC010000054.1 GCA027665525_03402 CDS open 30635-31066 _na     143_aa Lipoprotein
6193 JAQDEC010000054.1 GCA027665525_03403 CDS open 31482-33395 _na     637_aa SLH domain-containing protein
6194 JAQDEC010000054.1 GCA027665525_03372 gene open 1610-2152 spoVT
6195 JAQDEC010000054.1 GCA027665525_03373 gene open 2467-3597 ppiC
6196 JAQDEC010000054.1 GCA027665525_03374 gene open 3614-7138 mfd
6197 JAQDEC010000054.1 GCA027665525_03375 gene open 7297-7527
6198 JAQDEC010000054.1 GCA027665525_03376 gene open 7613-8173 pth
6199 JAQDEC010000054.1 GCA027665525_03377 gene open 8838-9791 prsA
6200 JAQDEC010000054.1 GCA027665525_03378 gene open 9904-11304 glmU
6201 JAQDEC010000054.1 GCA027665525_03379 gene open 11466-11750 spoVG
6202 JAQDEC010000054.1 GCA027665525_03380 gene open 11927-12763 purR
6203 JAQDEC010000054.1 GCA027665525_03381 gene open 12878-13732 ispE
6204 JAQDEC010000054.1 GCA027665525_03382 gene open 13921-14100
6205 JAQDEC010000054.1 GCA027665525_03383 gene open 14298-14573 veg
6206 JAQDEC010000054.1 GCA027665525_03384 gene open 14780-15682 yabG
6207 JAQDEC010000054.1 GCA027665525_03385 gene open 15721-16617 rsmA
6208 JAQDEC010000054.1 GCA027665525_03386 gene open 16623-17168 rnmV
6209 JAQDEC010000054.1 GCA027665525_03387 gene open 17317-18453
6210 JAQDEC010000054.1 GCA027665525_03388 gene open 19312-20085 tatD
6211 JAQDEC010000054.1 GCA027665525_03389 gene open 20102-21391
6212 JAQDEC010000054.1 GCA027665525_03390 gene open 21696-21950
6213 JAQDEC010000054.1 GCA027665525_03391 gene open 22101-23000 rsmI
6214 JAQDEC010000054.1 GCA027665525_03392 gene open 22997-23752
6215 JAQDEC010000054.1 GCA027665525_03393 gene open 23820-24191 yabA
6216 JAQDEC010000054.1 GCA027665525_03394 gene open 24241-25041
6217 JAQDEC010000054.1 GCA027665525_03395 gene open 25192-26172
6218 JAQDEC010000054.1 GCA027665525_03396 gene open 26197-26640
6219 JAQDEC010000054.1 GCA027665525_03397 gene open 26802-27131 darA
6220 JAQDEC010000054.1 GCA027665525_03398 gene open 27183-27833 tmk
6221 JAQDEC010000054.1 GCA027665525_03399 gene open 27889-29421
6222 JAQDEC010000054.1 GCA027665525_03400 gene open 29565-29750
6223 JAQDEC010000054.1 GCA027665525_03401 gene open 29967-30494
6224 JAQDEC010000054.1 GCA027665525_03402 gene open 30635-31066
6225 JAQDEC010000054.1 GCA027665525_03403 gene open 31482-33395
6226 JAQDEC010000055.1 GCA027665525_03404 CDS open 276-470 _na     64_aa hypothetical protein
6227 JAQDEC010000055.1 GCA027665525_03405 CDS open 1151-1645 _na     164_aa YutG/PgpA domain-containing protein
6228 JAQDEC010000055.1 GCA027665525_03406 CDS open 1836-2084 _na     82_aa Glutamate decarboxylase
6229 JAQDEC010000055.1 GCA027665525_03407 CDS open 2208-3101 _na     297_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
6230 JAQDEC010000055.1 GCA027665525_03408 CDS open 3102-4202 _na     366_aa acetyl-CoA carboxylase carboxyltransferase subunit alpha
6231 JAQDEC010000055.1 GCA027665525_03409 CDS open 4441-5862 _na     473_aa pyk pyruvate kinase
6232 JAQDEC010000055.1 GCA027665525_03410 CDS open 5999-6418 _na     139_aa Acyl-CoA thioester hydrolase%2C YbgC/YbaW family
6233 JAQDEC010000055.1 GCA027665525_03411 CDS open 6485-6877 _na     130_aa fxsA FxsA cytoplasmic membrane protein
6234 JAQDEC010000055.1 GCA027665525_03412 CDS open 6969-8087 _na     372_aa ytvI sporulation integral membrane protein YtvI
6235 JAQDEC010000055.1 GCA027665525_03413 CDS open 8440-9552 _na     370_aa citZ citrate synthase
6236 JAQDEC010000055.1 GCA027665525_03414 CDS open 9604-10935 _na     443_aa icd NADP-dependent isocitrate dehydrogenase
6237 JAQDEC010000055.1 GCA027665525_03415 CDS open 11115-11540 _na     141_aa DUF2269 domain-containing protein
6238 JAQDEC010000055.1 GCA027665525_03416 CDS open 11622-11975 _na     117_aa DNA-binding helix-turn-helix protein
6239 JAQDEC010000055.1 GCA027665525_03417 CDS open 12140-13030 _na     296_aa Glycosyltransferase 2-like domain-containing protein
6240 JAQDEC010000055.1 GCA027665525_03418 CDS open 13129-13998 _na     289_aa KR domain-containing protein
6241 JAQDEC010000055.1 GCA027665525_03419 CDS open 14303-15856 _na     517_aa Fumarate hydratase class I
6242 JAQDEC010000055.1 GCA027665525_03420 CDS open 15859-17655 _na     598_aa pnpS two-component system histidine kinase PnpS
6243 JAQDEC010000055.1 GCA027665525_03421 CDS open 17803-18528 _na     241_aa phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP
6244 JAQDEC010000055.1 GCA027665525_03422 CDS open 18645-19871 _na     408_aa Methyl-accepting chemotaxis protein signaling domain protein
6245 JAQDEC010000055.1 GCA027665525_03423 CDS open 20110-20865 _na     251_aa pstB phosphate ABC transporter ATP-binding protein PstB
6246 JAQDEC010000055.1 GCA027665525_03424 CDS open 20884-21543 _na     219_aa phoU phosphate signaling complex protein PhoU
6247 JAQDEC010000055.1 GCA027665525_03425 CDS open 21700-24360 _na     886_aa polA DNA polymerase I
6248 JAQDEC010000055.1 GCA027665525_03426 CDS open 24401-25258 _na     285_aa mutM DNA-formamidopyrimidine glycosylase
6249 JAQDEC010000055.1 GCA027665525_03427 CDS open 25313-25909 _na     198_aa coaE dephospho-CoA kinase
6250 JAQDEC010000055.1 GCA027665525_03428 CDS open 25906-26469 _na     187_aa Transglycosylase SLT domain protein
6251 JAQDEC010000055.1 GCA027665525_03429 CDS open 26543-26764 _na     73_aa Small%2C acid-soluble spore protein C
6252 JAQDEC010000055.1 GCA027665525_03430 CDS open 26902-27372 _na     156_aa nrdR transcriptional regulator NrdR
6253 JAQDEC010000055.1 GCA027665525_03431 CDS open 27553-28509 _na     318_aa Phosphate-binding protein
6254 JAQDEC010000055.1 GCA027665525_03432 CDS open 28596-29498 _na     300_aa pstC phosphate ABC transporter permease subunit PstC
6255 JAQDEC010000055.1 GCA027665525_03433 CDS open 29495-30382 _na     295_aa pstA phosphate ABC transporter permease PstA
6256 JAQDEC010000055.1 GCA027665525_03434 CDS open 30397-31155 _na     252_aa pstB phosphate ABC transporter ATP-binding protein PstB
6257 JAQDEC010000055.1 GCA027665525_03435 CDS open 31322-31945 _na     207_aa VTT domain-containing protein
6258 JAQDEC010000055.1 GCA027665525_03436 CDS open 31984-32220 _na     78_aa hypothetical protein
6259 JAQDEC010000055.1 GCA027665525_03437 CDS open 32431-32550 _na     39_aa yjcZ Sporulation protein YjcZ
6260 JAQDEC010000055.1 GCA027665525_03404 gene open 276-470
6261 JAQDEC010000055.1 GCA027665525_03405 gene open 1151-1645
6262 JAQDEC010000055.1 GCA027665525_03406 gene open 1836-2084
6263 JAQDEC010000055.1 GCA027665525_03407 gene open 2208-3101 accD
6264 JAQDEC010000055.1 GCA027665525_03408 gene open 3102-4202
6265 JAQDEC010000055.1 GCA027665525_03409 gene open 4441-5862 pyk
6266 JAQDEC010000055.1 GCA027665525_03410 gene open 5999-6418
6267 JAQDEC010000055.1 GCA027665525_03411 gene open 6485-6877 fxsA
6268 JAQDEC010000055.1 GCA027665525_03412 gene open 6969-8087 ytvI
6269 JAQDEC010000055.1 GCA027665525_03413 gene open 8440-9552 citZ
6270 JAQDEC010000055.1 GCA027665525_03414 gene open 9604-10935 icd
6271 JAQDEC010000055.1 GCA027665525_03415 gene open 11115-11540
6272 JAQDEC010000055.1 GCA027665525_03416 gene open 11622-11975
6273 JAQDEC010000055.1 GCA027665525_03417 gene open 12140-13030
6274 JAQDEC010000055.1 GCA027665525_03418 gene open 13129-13998
6275 JAQDEC010000055.1 GCA027665525_03419 gene open 14303-15856
6276 JAQDEC010000055.1 GCA027665525_03420 gene open 15859-17655 pnpS
6277 JAQDEC010000055.1 GCA027665525_03421 gene open 17803-18528 phoP
6278 JAQDEC010000055.1 GCA027665525_03422 gene open 18645-19871
6279 JAQDEC010000055.1 GCA027665525_03423 gene open 20110-20865 pstB
6280 JAQDEC010000055.1 GCA027665525_03424 gene open 20884-21543 phoU
6281 JAQDEC010000055.1 GCA027665525_03425 gene open 21700-24360 polA
6282 JAQDEC010000055.1 GCA027665525_03426 gene open 24401-25258 mutM
6283 JAQDEC010000055.1 GCA027665525_03427 gene open 25313-25909 coaE
6284 JAQDEC010000055.1 GCA027665525_03428 gene open 25906-26469
6285 JAQDEC010000055.1 GCA027665525_03429 gene open 26543-26764
6286 JAQDEC010000055.1 GCA027665525_03430 gene open 26902-27372 nrdR
6287 JAQDEC010000055.1 GCA027665525_03431 gene open 27553-28509
6288 JAQDEC010000055.1 GCA027665525_03432 gene open 28596-29498 pstC
6289 JAQDEC010000055.1 GCA027665525_03433 gene open 29495-30382 pstA
6290 JAQDEC010000055.1 GCA027665525_03434 gene open 30397-31155 pstB
6291 JAQDEC010000055.1 GCA027665525_03435 gene open 31322-31945
6292 JAQDEC010000055.1 GCA027665525_03436 gene open 31984-32220
6293 JAQDEC010000055.1 GCA027665525_03437 gene open 32431-32550 yjcZ
6294 JAQDEC010000056.1 repeat_region open 5957-6798 CRISPR array with 13 repeats of length 32%2C consensus sequence GTCGCACTCCTTGTGAGTGCGTGGATTGAAAT and spacer length 34
6295 JAQDEC010000056.1 GCA027665525_03438 CDS open 191-295 _na     34_aa hypothetical protein
6296 JAQDEC010000056.1 GCA027665525_03439 CDS open 365-1078 _na     237_aa cas5c type I-C CRISPR-associated protein Cas5c
6297 JAQDEC010000056.1 GCA027665525_03440 CDS open 1080-2960 _na     626_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
6298 JAQDEC010000056.1 GCA027665525_03441 CDS open 2957-3808 _na     283_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
6299 JAQDEC010000056.1 GCA027665525_03442 CDS open 3798-4457 _na     219_aa cas4 CRISPR-associated protein Cas4
6300 JAQDEC010000056.1 GCA027665525_03443 CDS open 4454-5485 _na     343_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
6301 JAQDEC010000056.1 GCA027665525_03444 CDS open 5496-5786 _na     96_aa cas2 CRISPR-associated endonuclease Cas2
6302 JAQDEC010000056.1 GCA027665525_03445 CDS open 7404-7628 _na     74_aa DUF86 domain-containing protein
6303 JAQDEC010000056.1 GCA027665525_03446 CDS open 7625-8134 _na     169_aa mntA type VII toxin-antitoxin system MntA family adenylyltransferase antitoxin
6304 JAQDEC010000056.1 GCA027665525_03447 CDS open 8460-9212 _na     250_aa arsB Putative arsenic efflux pump protein ArsB
6305 JAQDEC010000056.1 GCA027665525_03448 CDS open 9254-9757 _na     167_aa Arsenical pump membrane protein
6306 JAQDEC010000056.1 GCA027665525_03449 CDS open 10188-11864 _na     558_aa TIGR02677 family protein
6307 JAQDEC010000056.1 GCA027665525_03450 CDS open 11865-13073 _na     402_aa TIGR02678 family protein
6308 JAQDEC010000056.1 GCA027665525_03451 CDS open 13124-17317 _na     1397_aa TIGR02680 family protein
6309 JAQDEC010000056.1 GCA027665525_03452 CDS open 17314-18765 _na     483_aa Putative TIGR02679 family protein
6310 JAQDEC010000056.1 GCA027665525_03453 CDS open 19047-19301 _na     84_aa hypothetical protein
6311 JAQDEC010000056.1 GCA027665525_03454 CDS open 19744-20880 _na     378_aa ABC transporter%2C solute-binding protein
6312 JAQDEC010000056.1 GCA027665525_03455 CDS open 20976-21896 _na     306_aa ABC transporter%2C permease protein
6313 JAQDEC010000056.1 GCA027665525_03456 CDS open 21896-22705 _na     269_aa ABC transporter%2C permease protein
6314 JAQDEC010000056.1 GCA027665525_03457 CDS open 22702-23745 _na     347_aa cysA Sulfate/thiosulfate import ATP-binding protein CysA
6315 JAQDEC010000056.1 GCA027665525_03458 CDS open 23787-24539 _na     250_aa Putative glycerol-3-phosphate regulon repressor
6316 JAQDEC010000056.1 GCA027665525_03459 CDS open 24556-25392 _na     278_aa Type I phosphodiesterase / nucleotide pyrophosphatase
6317 JAQDEC010000056.1 GCA027665525_03460 CDS open 25410-26429 _na     339_aa Histidinol-phosphatase
6318 JAQDEC010000056.1 GCA027665525_03461 CDS open 26507-26656 _na     49_aa hypothetical protein
6319 JAQDEC010000056.1 GCA027665525_03462 CDS open 26840-27529 _na     229_aa Phage shock protein A
6320 JAQDEC010000056.1 GCA027665525_03463 CDS open 27570-28601 _na     343_aa fmdB Putative regulatory protein FmdB zinc ribbon domain-containing protein
6321 JAQDEC010000056.1 GCA027665525_03464 CDS open 28598-29401 _na     267_aa TPM domain-containing protein
6322 JAQDEC010000056.1 GCA027665525_03465 CDS open 29423-30457 _na     344_aa SPFH domain-containing protein
6323 JAQDEC010000056.1 GCA027665525_03466 CDS open 30520-30915 _na     131_aa mscL large conductance mechanosensitive channel protein MscL
6324 JAQDEC010000056.1 GCA027665525_03467 CDS open 31287-32195 _na     302_aa eamA EamA domain-containing protein
6325 JAQDEC010000056.1 GCA027665525_03438 gene open 191-295
6326 JAQDEC010000056.1 GCA027665525_03439 gene open 365-1078 cas5c
6327 JAQDEC010000056.1 GCA027665525_03440 gene open 1080-2960 cas8c
6328 JAQDEC010000056.1 GCA027665525_03441 gene open 2957-3808 cas7c
6329 JAQDEC010000056.1 GCA027665525_03442 gene open 3798-4457 cas4
6330 JAQDEC010000056.1 GCA027665525_03443 gene open 4454-5485 cas1c
6331 JAQDEC010000056.1 GCA027665525_03444 gene open 5496-5786 cas2
6332 JAQDEC010000056.1 GCA027665525_03445 gene open 7404-7628
6333 JAQDEC010000056.1 GCA027665525_03446 gene open 7625-8134 mntA
6334 JAQDEC010000056.1 GCA027665525_03447 gene open 8460-9212 arsB
6335 JAQDEC010000056.1 GCA027665525_03448 gene open 9254-9757
6336 JAQDEC010000056.1 GCA027665525_03449 gene open 10188-11864
6337 JAQDEC010000056.1 GCA027665525_03450 gene open 11865-13073
6338 JAQDEC010000056.1 GCA027665525_03451 gene open 13124-17317
6339 JAQDEC010000056.1 GCA027665525_03452 gene open 17314-18765
6340 JAQDEC010000056.1 GCA027665525_03453 gene open 19047-19301
6341 JAQDEC010000056.1 GCA027665525_03454 gene open 19744-20880
6342 JAQDEC010000056.1 GCA027665525_03455 gene open 20976-21896
6343 JAQDEC010000056.1 GCA027665525_03456 gene open 21896-22705
6344 JAQDEC010000056.1 GCA027665525_03457 gene open 22702-23745 cysA
6345 JAQDEC010000056.1 GCA027665525_03458 gene open 23787-24539
6346 JAQDEC010000056.1 GCA027665525_03459 gene open 24556-25392
6347 JAQDEC010000056.1 GCA027665525_03460 gene open 25410-26429
6348 JAQDEC010000056.1 GCA027665525_03461 gene open 26507-26656
6349 JAQDEC010000056.1 GCA027665525_03462 gene open 26840-27529
6350 JAQDEC010000056.1 GCA027665525_03463 gene open 27570-28601 fmdB
6351 JAQDEC010000056.1 GCA027665525_03464 gene open 28598-29401
6352 JAQDEC010000056.1 GCA027665525_03465 gene open 29423-30457
6353 JAQDEC010000056.1 GCA027665525_03466 gene open 30520-30915 mscL
6354 JAQDEC010000056.1 GCA027665525_03467 gene open 31287-32195 eamA
6355 JAQDEC010000057.1 GCA027665525_03468 CDS open 284-418 _na     44_aa rpmH 50S ribosomal protein L34
6356 JAQDEC010000057.1 GCA027665525_03469 CDS open 588-938 _na     116_aa rnpA ribonuclease P protein component
6357 JAQDEC010000057.1 GCA027665525_03470 CDS open 1014-1913 _na     299_aa Membrane insertase%2C YidC/Oxa1 family domain protein
6358 JAQDEC010000057.1 GCA027665525_03471 CDS open 1910-2647 _na     245_aa jag RNA-binding cell elongation regulator Jag/EloR
6359 JAQDEC010000057.1 GCA027665525_03472 CDS open 3377-4756 _na     459_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
6360 JAQDEC010000057.1 GCA027665525_03473 CDS open 4844-6730 _na     628_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
6361 JAQDEC010000057.1 GCA027665525_03474 CDS open 6734-7456 _na     240_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
6362 JAQDEC010000057.1 GCA027665525_03475 CDS open 7770-8594 _na     274_aa noc nucleoid occlusion protein
6363 JAQDEC010000057.1 GCA027665525_03476 CDS open 8877-9638 _na     253_aa AAA family ATPase
6364 JAQDEC010000057.1 GCA027665525_03477 CDS open 9631-10476 _na     281_aa Stage 0 sporulation protein J
6365 JAQDEC010000057.1 GCA027665525_03478 CDS open 10631-11791 _na     386_aa cysteine desulfurase
6366 JAQDEC010000057.1 GCA027665525_03479 CDS open 11820-12320 _na     166_aa DUF4446 domain-containing protein
6367 JAQDEC010000057.1 GCA027665525_03480 CDS open 12292-12900 _na     202_aa yyaC spore protease YyaC
6368 JAQDEC010000057.1 GCA027665525_03481 CDS open 13033-13287 _na     84_aa Putative Se/S carrier protein-like domain-containing protein
6369 JAQDEC010000057.1 GCA027665525_03482 CDS open 13342-14226 _na     294_aa Small conductance mechanosensitive channel
6370 JAQDEC010000057.1 GCA027665525_03483 CDS open 14283-14525 _na     80_aa DUF951 domain-containing protein
6371 JAQDEC010000057.1 GCA027665525_03485 CDS open 15066-15263 _na     65_aa yjzC YjzC family protein
6372 JAQDEC010000057.1 GCA027665525_03486 CDS open 15578-15862 _na     94_aa rpsF 30S ribosomal protein S6
6373 JAQDEC010000057.1 GCA027665525_03487 CDS open 15903-16376 _na     157_aa ssb Single-stranded DNA-binding protein
6374 JAQDEC010000057.1 GCA027665525_03488 CDS open 16398-16667 _na     89_aa rpsR 30S ribosomal protein S18
6375 JAQDEC010000057.1 GCA027665525_03489 CDS open 17457-18755 _na     432_aa IS110 family transposase
6376 JAQDEC010000057.1 GCA027665525_03490 CDS open 19168-20907 _na     579_aa peptide-binding protein
6377 JAQDEC010000057.1 GCA027665525_03491 CDS open 21037-22008 _na     323_aa ABC transporter%2C permease protein
6378 JAQDEC010000057.1 GCA027665525_03492 CDS open 22050-23021 _na     323_aa ABC transporter permease
6379 JAQDEC010000057.1 GCA027665525_03493 CDS open 22988-24016 _na     342_aa nikD Nickel import system ATP-binding protein NikD
6380 JAQDEC010000057.1 GCA027665525_03494 CDS open 24013-25053 _na     346_aa appF Oligopeptide ABC transporter%2C ATP-binding protein AppF
6381 JAQDEC010000057.1 GCA027665525_03495 CDS open 25338-26426 _na     362_aa Cell envelope-related transcriptional attenuator domain-containing protein
6382 JAQDEC010000057.1 GCA027665525_03496 CDS open 26596-27021 _na     141_aa CBS domain-containing protein
6383 JAQDEC010000057.1 GCA027665525_03497 CDS open 27110-27412 _na     100_aa MazG-like family protein
6384 JAQDEC010000057.1 GCA027665525_03498 CDS open 27419-28339 _na     306_aa DUF2232 domain-containing protein
6385 JAQDEC010000057.1 GCA027665525_03499 CDS open 28351-30333 _na     660_aa Cyclic-di-AMP phosphodiesterase
6386 JAQDEC010000057.1 GCA027665525_03500 CDS open 30330-30773 _na     147_aa rplI 50S ribosomal protein L9
6387 JAQDEC010000057.1 GCA027665525_03501 CDS open 30775-32136 _na     453_aa dnaB replicative DNA helicase
6388 JAQDEC010000057.1 GCA027665525_03468 gene open 284-418 rpmH
6389 JAQDEC010000057.1 GCA027665525_03469 gene open 588-938 rnpA
6390 JAQDEC010000057.1 GCA027665525_03470 gene open 1014-1913
6391 JAQDEC010000057.1 GCA027665525_03471 gene open 1910-2647 jag
6392 JAQDEC010000057.1 GCA027665525_03472 gene open 3377-4756 mnmE
6393 JAQDEC010000057.1 GCA027665525_03473 gene open 4844-6730 mnmG
6394 JAQDEC010000057.1 GCA027665525_03474 gene open 6734-7456 rsmG
6395 JAQDEC010000057.1 GCA027665525_03475 gene open 7770-8594 noc
6396 JAQDEC010000057.1 GCA027665525_03476 gene open 8877-9638
6397 JAQDEC010000057.1 GCA027665525_03477 gene open 9631-10476
6398 JAQDEC010000057.1 GCA027665525_03478 gene open 10631-11791
6399 JAQDEC010000057.1 GCA027665525_03479 gene open 11820-12320
6400 JAQDEC010000057.1 GCA027665525_03480 gene open 12292-12900 yyaC
6401 JAQDEC010000057.1 GCA027665525_03481 gene open 13033-13287
6402 JAQDEC010000057.1 GCA027665525_03482 gene open 13342-14226
6403 JAQDEC010000057.1 GCA027665525_03483 gene open 14283-14525
6404 JAQDEC010000057.1 GCA027665525_03485 gene open 15066-15263 yjzC
6405 JAQDEC010000057.1 GCA027665525_03486 gene open 15578-15862 rpsF
6406 JAQDEC010000057.1 GCA027665525_03487 gene open 15903-16376 ssb
6407 JAQDEC010000057.1 GCA027665525_03488 gene open 16398-16667 rpsR
6408 JAQDEC010000057.1 GCA027665525_03489 gene open 17457-18755
6409 JAQDEC010000057.1 GCA027665525_03490 gene open 19168-20907
6410 JAQDEC010000057.1 GCA027665525_03491 gene open 21037-22008
6411 JAQDEC010000057.1 GCA027665525_03492 gene open 22050-23021
6412 JAQDEC010000057.1 GCA027665525_03493 gene open 22988-24016 nikD
6413 JAQDEC010000057.1 GCA027665525_03494 gene open 24013-25053 appF
6414 JAQDEC010000057.1 GCA027665525_03495 gene open 25338-26426
6415 JAQDEC010000057.1 GCA027665525_03496 gene open 26596-27021
6416 JAQDEC010000057.1 GCA027665525_03497 gene open 27110-27412
6417 JAQDEC010000057.1 GCA027665525_03498 gene open 27419-28339
6418 JAQDEC010000057.1 GCA027665525_03499 gene open 28351-30333
6419 JAQDEC010000057.1 GCA027665525_03500 gene open 30330-30773 rplI
6420 JAQDEC010000057.1 GCA027665525_03501 gene open 30775-32136 dnaB
6421 JAQDEC010000057.1 GCA027665525_03484 gene open 14596-14686 trnS
6422 JAQDEC010000057.1 GCA027665525_03484 tRNA open 14596-14686 trnS tRNA-Ser(cga)
6423 JAQDEC010000058.1 GCA027665525_03502 CDS open 140-1036 _na     298_aa Peptidase M15B domain-containing protein
6424 JAQDEC010000058.1 GCA027665525_03503 CDS open 1276-2139 _na     287_aa ABC transporter ATP-binding protein
6425 JAQDEC010000058.1 GCA027665525_03504 CDS open 2154-2957 _na     267_aa Ferric siderophore reductase C-terminal domain-containing protein
6426 JAQDEC010000058.1 GCA027665525_03505 CDS open 3393-4754 _na     453_aa NADH oxidase
6427 JAQDEC010000058.1 GCA027665525_03506 CDS open 5010-5843 _na     277_aa Formate/nitrite transporter
6428 JAQDEC010000058.1 GCA027665525_03507 CDS open 6435-8504 _na     689_aa 4Fe-4S Mo/W bis-MGD-type domain-containing protein
6429 JAQDEC010000058.1 GCA027665525_03508 CDS open 8661-9884 _na     407_aa Major facilitator superfamily (MFS) profile domain-containing protein
6430 JAQDEC010000058.1 GCA027665525_03509 CDS open 9906-10397 _na     163_aa N-acetyltransferase domain-containing protein
6431 JAQDEC010000058.1 GCA027665525_03510 CDS open 10513-12282 _na     589_aa glutamine--tRNA ligase/YqeY domain fusion protein
6432 JAQDEC010000058.1 GCA027665525_03511 CDS open 12355-13332 _na     325_aa HTH lacI-type domain-containing protein
6433 JAQDEC010000058.1 GCA027665525_03512 CDS open 13535-14758 _na     407_aa Major facilitator superfamily associated domain-containing protein
6434 JAQDEC010000058.1 GCA027665525_03513 CDS open 14892-15572 _na     226_aa molybdenum cofactor guanylyltransferase
6435 JAQDEC010000058.1 GCA027665525_03514 CDS open 15569-16576 _na     335_aa moaA GTP 3'%2C8-cyclase MoaA
6436 JAQDEC010000058.1 GCA027665525_03515 CDS open 16892-17587 _na     231_aa torD Cytoplasmic chaperone TorD
6437 JAQDEC010000058.1 GCA027665525_03516 CDS open 17931-21194 _na     1087_aa Efflux RND transporter permease subunit
6438 JAQDEC010000058.1 GCA027665525_03517 CDS open 21238-22143 _na     301_aa HTH tetR-type domain-containing protein
6439 JAQDEC010000058.1 GCA027665525_03518 CDS open 22334-23842 _na     502_aa cls cardiolipin synthase
6440 JAQDEC010000058.1 GCA027665525_03519 CDS open 23888-24916 _na     342_aa fni type 2 isopentenyl-diphosphate Delta-isomerase
6441 JAQDEC010000058.1 GCA027665525_03520 CDS open 25533-26099 _na     188_aa ECF-type riboflavin transporter substrate-binding protein
6442 JAQDEC010000058.1 GCA027665525_03521 CDS open 26115-27965 _na     616_aa energy-coupling factor transporter ATPase
6443 JAQDEC010000058.1 GCA027665525_03522 CDS open 27962-28792 _na     276_aa Cobalt/nickel transport system permease
6444 JAQDEC010000058.1 GCA027665525_03523 CDS open 28824-29147 _na     107_aa Acetyltransferase%2C GNAT family
6445 JAQDEC010000058.1 GCA027665525_03524 CDS open 29220-30320 _na     366_aa ychF redox-regulated ATPase YchF
6446 JAQDEC010000058.1 GCA027665525_03525 CDS open 30474-30722 _na     82_aa hypothetical protein
6447 JAQDEC010000058.1 GCA027665525_03526 CDS open 30933-32102 _na     389_aa Integrase core domain protein
6448 JAQDEC010000058.1 GCA027665525_03502 gene open 140-1036
6449 JAQDEC010000058.1 GCA027665525_03503 gene open 1276-2139
6450 JAQDEC010000058.1 GCA027665525_03504 gene open 2154-2957
6451 JAQDEC010000058.1 GCA027665525_03505 gene open 3393-4754
6452 JAQDEC010000058.1 GCA027665525_03506 gene open 5010-5843
6453 JAQDEC010000058.1 GCA027665525_03507 gene open 6435-8504
6454 JAQDEC010000058.1 GCA027665525_03508 gene open 8661-9884
6455 JAQDEC010000058.1 GCA027665525_03509 gene open 9906-10397
6456 JAQDEC010000058.1 GCA027665525_03510 gene open 10513-12282
6457 JAQDEC010000058.1 GCA027665525_03511 gene open 12355-13332
6458 JAQDEC010000058.1 GCA027665525_03512 gene open 13535-14758
6459 JAQDEC010000058.1 GCA027665525_03513 gene open 14892-15572
6460 JAQDEC010000058.1 GCA027665525_03514 gene open 15569-16576 moaA
6461 JAQDEC010000058.1 GCA027665525_03515 gene open 16892-17587 torD
6462 JAQDEC010000058.1 GCA027665525_03516 gene open 17931-21194
6463 JAQDEC010000058.1 GCA027665525_03517 gene open 21238-22143
6464 JAQDEC010000058.1 GCA027665525_03518 gene open 22334-23842 cls
6465 JAQDEC010000058.1 GCA027665525_03519 gene open 23888-24916 fni
6466 JAQDEC010000058.1 GCA027665525_03520 gene open 25533-26099
6467 JAQDEC010000058.1 GCA027665525_03521 gene open 26115-27965
6468 JAQDEC010000058.1 GCA027665525_03522 gene open 27962-28792
6469 JAQDEC010000058.1 GCA027665525_03523 gene open 28824-29147
6470 JAQDEC010000058.1 GCA027665525_03524 gene open 29220-30320 ychF
6471 JAQDEC010000058.1 GCA027665525_03525 gene open 30474-30722
6472 JAQDEC010000058.1 GCA027665525_03526 gene open 30933-32102
6473 JAQDEC010000059.1 GCA027665525_03527 CDS open 76-1683 _na     535_aa nagZ beta-N-acetylhexosaminidase
6474 JAQDEC010000059.1 GCA027665525_03528 CDS open 1716-3323 _na     535_aa yesN Two-component system%2C response regulator YesN
6475 JAQDEC010000059.1 GCA027665525_03529 CDS open 3298-5148 _na     616_aa histidine kinase
6476 JAQDEC010000059.1 GCA027665525_03530 CDS open 5200-6027 _na     275_aa ABC transmembrane type-1 domain-containing protein
6477 JAQDEC010000059.1 GCA027665525_03531 CDS open 6027-6911 _na     294_aa ABC transporter%2C permease protein
6478 JAQDEC010000059.1 GCA027665525_03532 CDS open 7005-8396 _na     463_aa Multiple sugar transport system substrate-binding protein
6479 JAQDEC010000059.1 GCA027665525_03533 CDS open 8606-9346 _na     246_aa pflA pyruvate formate-lyase-activating protein
6480 JAQDEC010000059.1 GCA027665525_03534 CDS open 9462-11729 _na     755_aa pflB formate C-acetyltransferase
6481 JAQDEC010000059.1 GCA027665525_03535 CDS open 11974-14589 _na     871_aa adhE bifunctional acetaldehyde-CoA/alcohol dehydrogenase
6482 JAQDEC010000059.1 GCA027665525_03536 CDS open 15035-15754 _na     239_aa Crp/Fnr family transcriptional regulator
6483 JAQDEC010000059.1 GCA027665525_03537 CDS open 15902-16111 _na     69_aa hypothetical protein
6484 JAQDEC010000059.1 GCA027665525_03538 CDS open 16080-16685 _na     201_aa Formate/nitrite transporter family protein
6485 JAQDEC010000059.1 GCA027665525_03539 CDS open 16771-17118 _na     115_aa Nitrite reductase [NAD(P)H]%2C small subunit
6486 JAQDEC010000059.1 GCA027665525_03540 CDS open 17151-19589 _na     812_aa Nitrite reductase [NAD(P)H]%2C large subunit
6487 JAQDEC010000059.1 GCA027665525_03541 CDS open 19825-20538 _na     237_aa DUF4430 domain-containing protein
6488 JAQDEC010000059.1 GCA027665525_03542 CDS open 20712-21278 _na     188_aa FAD binding domain protein
6489 JAQDEC010000059.1 GCA027665525_03543 CDS open 21342-21659 _na     105_aa hxlR Transcriptional regulator%2C HxlR family
6490 JAQDEC010000059.1 GCA027665525_03544 CDS open 21829-22797 _na     322_aa Xylose isomerase-like TIM barrel domain-containing protein
6491 JAQDEC010000059.1 GCA027665525_03545 CDS open 22817-23899 _na     360_aa Oxidoreductase
6492 JAQDEC010000059.1 GCA027665525_03546 CDS open 23892-24662 _na     256_aa Xylose isomerase-like TIM barrel domain-containing protein
6493 JAQDEC010000059.1 GCA027665525_03547 CDS open 24697-25755 _na     352_aa Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein
6494 JAQDEC010000059.1 GCA027665525_03548 CDS open 25905-26726 _na     273_aa HTH araC/xylS-type domain-containing protein
6495 JAQDEC010000059.1 GCA027665525_03549 CDS open 26814-27515 _na     233_aa yjbE Integral membrane protein%2C YjbE family
6496 JAQDEC010000059.1 GCA027665525_03550 CDS open 27969-28265 _na     98_aa peptide-methionine (S)-S-oxide reductase
6497 JAQDEC010000059.1 GCA027665525_03551 CDS open 28423-29676 _na     417_aa Core-binding (CB) domain-containing protein
6498 JAQDEC010000059.1 GCA027665525_03527 gene open 76-1683 nagZ
6499 JAQDEC010000059.1 GCA027665525_03528 gene open 1716-3323 yesN
6500 JAQDEC010000059.1 GCA027665525_03529 gene open 3298-5148