HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Paenibacillus phoenicis (GCA_027665525.1)

Select a Genome:
BAKTA Annotations for GCA_027665525.1
Genome Selected: Paenibacillus phoenicis
ContigsBases CDSrRNA tmRNAtRNA
226 4969493 4661 5 2 53
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 9507 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 9507 [20 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 JAQDEC010000022.1 GCA027665525_01715 gene open 23716-23967
3502 JAQDEC010000022.1 GCA027665525_01716 gene open 23981-24292
3503 JAQDEC010000022.1 GCA027665525_01717 gene open 24457-25107
3504 JAQDEC010000022.1 GCA027665525_01718 gene open 25380-26756 gdhA
3505 JAQDEC010000022.1 GCA027665525_01719 gene open 26828-28006 yjlD
3506 JAQDEC010000022.1 GCA027665525_01720 gene open 28022-28462
3507 JAQDEC010000022.1 GCA027665525_01721 gene open 28682-29581
3508 JAQDEC010000022.1 GCA027665525_01722 gene open 30338-32146 cydC
3509 JAQDEC010000022.1 GCA027665525_01723 gene open 32143-33879 cydD
3510 JAQDEC010000022.1 GCA027665525_01724 gene open 33879-34892 cydB
3511 JAQDEC010000022.1 GCA027665525_01725 gene open 34882-36291
3512 JAQDEC010000022.1 GCA027665525_01726 gene open 36475-36855
3513 JAQDEC010000022.1 GCA027665525_01727 gene open 36857-38512
3514 JAQDEC010000022.1 GCA027665525_01728 gene open 38516-39304
3515 JAQDEC010000022.1 GCA027665525_01729 gene open 39440-40903
3516 JAQDEC010000022.1 GCA027665525_01730 gene open 41186-42019
3517 JAQDEC010000022.1 GCA027665525_01731 gene open 41964-42251
3518 JAQDEC010000022.1 GCA027665525_01732 gene open 42415-42543
3519 JAQDEC010000022.1 GCA027665525_01733 gene open 42620-42805 yuzL
3520 JAQDEC010000022.1 GCA027665525_01734 gene open 43015-43524
3521 JAQDEC010000022.1 GCA027665525_01735 gene open 43792-44133
3522 JAQDEC010000022.1 GCA027665525_01736 gene open 44300-44974
3523 JAQDEC010000022.1 GCA027665525_01737 gene open 45241-46323
3524 JAQDEC010000022.1 GCA027665525_01738 gene open 46406-47353 menA
3525 JAQDEC010000022.1 GCA027665525_01739 gene open 47550-47849
3526 JAQDEC010000022.1 GCA027665525_01740 gene open 47851-49236
3527 JAQDEC010000022.1 GCA027665525_01741 gene open 49423-49980
3528 JAQDEC010000022.1 GCA027665525_01742 gene open 50128-51417
3529 JAQDEC010000022.1 GCA027665525_01743 gene open 51519-52574 hemH
3530 JAQDEC010000022.1 GCA027665525_01744 gene open 52780-54291
3531 JAQDEC010000022.1 GCA027665525_01745 gene open 54486-55055
3532 JAQDEC010000022.1 GCA027665525_01746 gene open 55159-56016
3533 JAQDEC010000022.1 GCA027665525_01747 gene open 56046-57026
3534 JAQDEC010000022.1 GCA027665525_01748 gene open 57239-57637 arsR
3535 JAQDEC010000022.1 GCA027665525_01749 gene open 57641-58066
3536 JAQDEC010000022.1 GCA027665525_01750 gene open 58248-59729
3537 JAQDEC010000022.1 GCA027665525_01751 gene open 59838-60350
3538 JAQDEC010000022.1 GCA027665525_01752 gene open 60458-61780
3539 JAQDEC010000023.1 GCA027665525_01756 CDS open 223-1590 _na     455_aa VWA domain-containing protein
3540 JAQDEC010000023.1 GCA027665525_01757 CDS open 1736-3499 _na     587_aa DUF4365 domain-containing protein
3541 JAQDEC010000023.1 GCA027665525_01758 CDS open 3829-4932 _na     367_aa DUF3800 domain-containing protein
3542 JAQDEC010000023.1 GCA027665525_01759 CDS open 5080-5364 _na     94_aa cpaF Pilus assembly protein CpaF
3543 JAQDEC010000023.1 GCA027665525_01760 CDS open 5389-6201 _na     270_aa gspF Type II secretion system protein GspF domain-containing protein
3544 JAQDEC010000023.1 GCA027665525_01761 CDS open 6217-7092 _na     291_aa gspF Type II secretion system protein GspF domain-containing protein
3545 JAQDEC010000023.1 GCA027665525_01762 CDS open 7115-7309 _na     64_aa Putative Flagellin Flp1-like domain-containing protein
3546 JAQDEC010000023.1 GCA027665525_01763 CDS open 7312-7974 _na     220_aa TadE-like protein
3547 JAQDEC010000023.1 GCA027665525_01764 CDS open 7997-10210 _na     737_aa Flp pilus-assembly TadG-like N-terminal domain-containing protein
3548 JAQDEC010000023.1 GCA027665525_01765 CDS open 10179-11255 _na     358_aa TadE-like protein
3549 JAQDEC010000023.1 GCA027665525_01766 CDS open 11275-11778 _na     167_aa Prepilin type IV endopeptidase peptidase domain-containing protein
3550 JAQDEC010000023.1 GCA027665525_01767 CDS open 11799-13445 _na     548_aa FHA domain protein
3551 JAQDEC010000023.1 GCA027665525_01768 CDS open 13568-14605 _na     345_aa Iron complex transport system permease
3552 JAQDEC010000023.1 GCA027665525_01769 CDS open 14602-15636 _na     344_aa Iron complex transport system permease
3553 JAQDEC010000023.1 GCA027665525_01770 CDS open 15712-16635 _na     307_aa TIGR01777 family protein
3554 JAQDEC010000023.1 GCA027665525_01771 CDS open 16719-17186 _na     155_aa DUF2621 domain-containing protein
3555 JAQDEC010000023.1 GCA027665525_01772 CDS open 17369-18481 _na     370_aa deoxyribonuclease IV
3556 JAQDEC010000023.1 GCA027665525_01773 CDS open 18521-19420 _na     299_aa purU formyltetrahydrofolate deformylase
3557 JAQDEC010000023.1 GCA027665525_01774 CDS open 19733-21757 _na     674_aa tkt transketolase
3558 JAQDEC010000023.1 GCA027665525_01775 CDS open 21839-22168 _na     109_aa Pyrimidine/purine nucleoside phosphorylase
3559 JAQDEC010000023.1 GCA027665525_01776 CDS open 22268-23164 _na     298_aa 3-hydroxyisobutyrate dehydrogenase
3560 JAQDEC010000023.1 GCA027665525_01777 CDS open 23394-24749 _na     451_aa glucose-6-phosphate isomerase
3561 JAQDEC010000023.1 GCA027665525_01778 CDS open 24849-25481 _na     210_aa Impact family member yvye
3562 JAQDEC010000023.1 GCA027665525_01779 CDS open 25487-26083 _na     198_aa HTH tetR-type domain-containing protein
3563 JAQDEC010000023.1 GCA027665525_01780 CDS open 26378-27484 _na     368_aa Sulfate ABC transporter ATP-binding protein
3564 JAQDEC010000023.1 GCA027665525_01781 CDS open 27545-28375 _na     276_aa ABC transporter permease subunit
3565 JAQDEC010000023.1 GCA027665525_01782 CDS open 28400-29287 _na     295_aa ABC transporter permease subunit
3566 JAQDEC010000023.1 GCA027665525_01783 CDS open 29395-30672 _na     425_aa Multiple sugar transport system substrate-binding protein
3567 JAQDEC010000023.1 GCA027665525_01784 CDS open 31147-33312 _na     721_aa bglX beta-glucosidase BglX
3568 JAQDEC010000023.1 GCA027665525_01785 CDS open 33342-36695 _na     1117_aa Cellobiose phosphorylase
3569 JAQDEC010000023.1 GCA027665525_01786 CDS open 37013-37978 _na     321_aa lacI LacI family transcriptional regulator
3570 JAQDEC010000023.1 GCA027665525_01787 CDS open 38256-39350 _na     364_aa ABC-2 type transporter
3571 JAQDEC010000023.1 GCA027665525_01788 CDS open 39350-40363 _na     337_aa ABC transporter domain-containing protein
3572 JAQDEC010000023.1 GCA027665525_01789 CDS open 40367-41524 _na     385_aa Alpha-galactosidase NEW3 domain-containing protein
3573 JAQDEC010000023.1 GCA027665525_01790 CDS open 41687-42295 _na     202_aa Sigma-70 family RNA polymerase sigma factor
3574 JAQDEC010000023.1 GCA027665525_01791 CDS open 42273-43268 _na     331_aa rskA Anti-sigma K factor RskA C-terminal domain-containing protein
3575 JAQDEC010000023.1 GCA027665525_01792 CDS open 43399-44181 _na     260_aa Metallo-beta-lactamase domain-containing protein
3576 JAQDEC010000023.1 GCA027665525_01793 CDS open 44597-45400 _na     267_aa Cof-like hydrolase family protein
3577 JAQDEC010000023.1 GCA027665525_01794 CDS open 45428-46399 _na     323_aa eamA EamA domain-containing protein
3578 JAQDEC010000023.1 GCA027665525_01795 CDS open 46389-47393 _na     334_aa lipoate--protein ligase
3579 JAQDEC010000023.1 GCA027665525_01796 CDS open 47619-48707 _na     362_aa Aminotransferase
3580 JAQDEC010000023.1 GCA027665525_01797 CDS open 48798-49535 _na     245_aa Adenosylcobinamide amidohydrolase
3581 JAQDEC010000023.1 GCA027665525_01798 CDS open 49535-50503 _na     322_aa cbiB adenosylcobinamide-phosphate synthase CbiB
3582 JAQDEC010000023.1 GCA027665525_01799 CDS open 50540-51226 _na     228_aa Phosphoglycerate mutase family protein
3583 JAQDEC010000023.1 GCA027665525_01800 CDS open 51223-52128 _na     301_aa Luciferase family oxidoreductase%2C FMN-dependent%2C PP_0088 family
3584 JAQDEC010000023.1 GCA027665525_01801 CDS open 52359-53711 _na     450_aa Multiple sugar transport system substrate-binding protein
3585 JAQDEC010000023.1 GCA027665525_01802 CDS open 53839-54729 _na     296_aa Multiple sugar transport system permease
3586 JAQDEC010000023.1 GCA027665525_01803 CDS open 54747-55571 _na     274_aa Multiple sugar transport system permease
3587 JAQDEC010000023.1 GCA027665525_01804 CDS open 55607-57421 _na     604_aa histidine kinase
3588 JAQDEC010000023.1 GCA027665525_01805 CDS open 57418-58629 _na     403_aa yesN Two-component system%2C response regulator YesN
3589 JAQDEC010000023.1 GCA027665525_01806 CDS open 58888-60468 _na     526_aa Methyl-accepting chemotaxis protein signaling domain protein
3590 JAQDEC010000023.1 GCA027665525_01756 gene open 223-1590
3591 JAQDEC010000023.1 GCA027665525_01757 gene open 1736-3499
3592 JAQDEC010000023.1 GCA027665525_01758 gene open 3829-4932
3593 JAQDEC010000023.1 GCA027665525_01759 gene open 5080-5364 cpaF
3594 JAQDEC010000023.1 GCA027665525_01760 gene open 5389-6201 gspF
3595 JAQDEC010000023.1 GCA027665525_01761 gene open 6217-7092 gspF
3596 JAQDEC010000023.1 GCA027665525_01762 gene open 7115-7309
3597 JAQDEC010000023.1 GCA027665525_01763 gene open 7312-7974
3598 JAQDEC010000023.1 GCA027665525_01764 gene open 7997-10210
3599 JAQDEC010000023.1 GCA027665525_01765 gene open 10179-11255
3600 JAQDEC010000023.1 GCA027665525_01766 gene open 11275-11778
3601 JAQDEC010000023.1 GCA027665525_01767 gene open 11799-13445
3602 JAQDEC010000023.1 GCA027665525_01768 gene open 13568-14605
3603 JAQDEC010000023.1 GCA027665525_01769 gene open 14602-15636
3604 JAQDEC010000023.1 GCA027665525_01770 gene open 15712-16635
3605 JAQDEC010000023.1 GCA027665525_01771 gene open 16719-17186
3606 JAQDEC010000023.1 GCA027665525_01772 gene open 17369-18481
3607 JAQDEC010000023.1 GCA027665525_01773 gene open 18521-19420 purU
3608 JAQDEC010000023.1 GCA027665525_01774 gene open 19733-21757 tkt
3609 JAQDEC010000023.1 GCA027665525_01775 gene open 21839-22168
3610 JAQDEC010000023.1 GCA027665525_01776 gene open 22268-23164
3611 JAQDEC010000023.1 GCA027665525_01777 gene open 23394-24749
3612 JAQDEC010000023.1 GCA027665525_01778 gene open 24849-25481
3613 JAQDEC010000023.1 GCA027665525_01779 gene open 25487-26083
3614 JAQDEC010000023.1 GCA027665525_01780 gene open 26378-27484
3615 JAQDEC010000023.1 GCA027665525_01781 gene open 27545-28375
3616 JAQDEC010000023.1 GCA027665525_01782 gene open 28400-29287
3617 JAQDEC010000023.1 GCA027665525_01783 gene open 29395-30672
3618 JAQDEC010000023.1 GCA027665525_01784 gene open 31147-33312 bglX
3619 JAQDEC010000023.1 GCA027665525_01785 gene open 33342-36695
3620 JAQDEC010000023.1 GCA027665525_01786 gene open 37013-37978 lacI
3621 JAQDEC010000023.1 GCA027665525_01787 gene open 38256-39350
3622 JAQDEC010000023.1 GCA027665525_01788 gene open 39350-40363
3623 JAQDEC010000023.1 GCA027665525_01789 gene open 40367-41524
3624 JAQDEC010000023.1 GCA027665525_01790 gene open 41687-42295
3625 JAQDEC010000023.1 GCA027665525_01791 gene open 42273-43268 rskA
3626 JAQDEC010000023.1 GCA027665525_01792 gene open 43399-44181
3627 JAQDEC010000023.1 GCA027665525_01793 gene open 44597-45400
3628 JAQDEC010000023.1 GCA027665525_01794 gene open 45428-46399 eamA
3629 JAQDEC010000023.1 GCA027665525_01795 gene open 46389-47393
3630 JAQDEC010000023.1 GCA027665525_01796 gene open 47619-48707
3631 JAQDEC010000023.1 GCA027665525_01797 gene open 48798-49535
3632 JAQDEC010000023.1 GCA027665525_01798 gene open 49535-50503 cbiB
3633 JAQDEC010000023.1 GCA027665525_01799 gene open 50540-51226
3634 JAQDEC010000023.1 GCA027665525_01800 gene open 51223-52128
3635 JAQDEC010000023.1 GCA027665525_01801 gene open 52359-53711
3636 JAQDEC010000023.1 GCA027665525_01802 gene open 53839-54729
3637 JAQDEC010000023.1 GCA027665525_01803 gene open 54747-55571
3638 JAQDEC010000023.1 GCA027665525_01804 gene open 55607-57421
3639 JAQDEC010000023.1 GCA027665525_01805 gene open 57418-58629 yesN
3640 JAQDEC010000023.1 GCA027665525_01806 gene open 58888-60468
3641 JAQDEC010000024.1 repeat_region open 54053-54900 CRISPR array with 13 repeats of length 32%2C consensus sequence GTCGCACCCTGTAAGGGTGCGTGGATTGAAAT and spacer length 35
3642 JAQDEC010000024.1 repeat_region open 55406-56050 CRISPR array with 10 repeats of length 32%2C consensus sequence GTCGCACCCTGTAAGGGTGCGTGGATTGAAAT and spacer length 35
3643 JAQDEC010000024.1 GCA027665525_01807 CDS open 513-1139 _na     208_aa desE fatty acid desaturase DesE
3644 JAQDEC010000024.1 GCA027665525_01808 CDS open 1428-1823 _na     131_aa rsbT Serine/threonine-protein kinase RsbT
3645 JAQDEC010000024.1 GCA027665525_01809 CDS open 1795-3327 _na     510_aa ATP-binding protein
3646 JAQDEC010000024.1 GCA027665525_01810 CDS open 3370-4029 _na     219_aa hypothetical protein
3647 JAQDEC010000024.1 GCA027665525_01811 CDS open 4665-6383 _na     572_aa phosphotransferase family protein
3648 JAQDEC010000024.1 GCA027665525_01812 CDS open 6539-7186 _na     215_aa Fe2OG dioxygenase domain-containing protein
3649 JAQDEC010000024.1 GCA027665525_01813 CDS open 7279-7566 _na     95_aa DUF1878 domain-containing protein
3650 JAQDEC010000024.1 GCA027665525_01814 CDS open 8211-9047 _na     278_aa ABC-2 type transporter
3651 JAQDEC010000024.1 GCA027665525_01815 CDS open 9040-9678 _na     212_aa hypothetical protein
3652 JAQDEC010000024.1 GCA027665525_01816 CDS open 9675-10370 _na     231_aa ABC transporter permease
3653 JAQDEC010000024.1 GCA027665525_01817 CDS open 10360-11022 _na     220_aa ABC transporter ATP-binding protein
3654 JAQDEC010000024.1 GCA027665525_01818 CDS open 11088-11543 _na     151_aa CAAX amino terminal protease family protein
3655 JAQDEC010000024.1 GCA027665525_01819 CDS open 11703-14000 _na     765_aa Chlorophyllase
3656 JAQDEC010000024.1 GCA027665525_01820 CDS open 14149-14880 _na     243_aa gtcR Response regulator GtcR
3657 JAQDEC010000024.1 GCA027665525_01821 CDS open 14870-15316 _na     148_aa hypothetical protein
3658 JAQDEC010000024.1 GCA027665525_01822 CDS open 15306-16331 _na     341_aa walK cell wall metabolism sensor histidine kinase WalK
3659 JAQDEC010000024.1 GCA027665525_01823 CDS open 16721-17773 _na     350_aa Fe/B12 periplasmic-binding domain-containing protein
3660 JAQDEC010000024.1 GCA027665525_01824 CDS open 17793-18806 _na     337_aa Iron complex transport system permease
3661 JAQDEC010000024.1 GCA027665525_01825 CDS open 18806-19870 _na     354_aa Iron complex transport system permease
3662 JAQDEC010000024.1 GCA027665525_01826 CDS open 19867-20619 _na     250_aa Iron complex transport system ATP-binding protein
3663 JAQDEC010000024.1 GCA027665525_01827 CDS open 21150-22304 _na     384_aa DUF418 domain-containing protein
3664 JAQDEC010000024.1 GCA027665525_01828 CDS open 22332-23441 _na     369_aa histidine kinase
3665 JAQDEC010000024.1 GCA027665525_01829 CDS open 23448-24053 _na     201_aa desR Two-component system%2C NarL family%2C response regulator DesR
3666 JAQDEC010000024.1 GCA027665525_01830 CDS open 24092-24499 _na     135_aa WYL domain-containing protein
3667 JAQDEC010000024.1 GCA027665525_01831 CDS open 24850-28542 _na     1230_aa GH92 family glycosyl hydrolase
3668 JAQDEC010000024.1 GCA027665525_01832 CDS open 28626-29768 _na     380_aa enolase C-terminal domain-like protein
3669 JAQDEC010000024.1 GCA027665525_01833 CDS open 29810-29992 _na     60_aa hypothetical protein
3670 JAQDEC010000024.1 GCA027665525_01834 CDS open 30124-30918 _na     264_aa sensor domain-containing protein
3671 JAQDEC010000024.1 GCA027665525_01835 CDS open 31166-31729 _na     187_aa Tyr recombinase domain-containing protein
3672 JAQDEC010000024.1 GCA027665525_01836 CDS open 31824-32510 _na     228_aa uspA UspA domain-containing protein
3673 JAQDEC010000024.1 GCA027665525_01837 CDS open 32639-35050 _na     803_aa Na+/H+ antiporter subunit A
3674 JAQDEC010000024.1 GCA027665525_01838 CDS open 35037-35459 _na     140_aa Na(+)/H(+) antiporter subunit B
3675 JAQDEC010000024.1 GCA027665525_01839 CDS open 35462-35800 _na     112_aa Na(+)/H(+) antiporter subunit C
3676 JAQDEC010000024.1 GCA027665525_01840 CDS open 35787-37268 _na     493_aa Na+/H+ antiporter subunit D
3677 JAQDEC010000024.1 GCA027665525_01841 CDS open 37282-37761 _na     159_aa Multicomponent Na+:H+ antiporter subunit E
3678 JAQDEC010000024.1 GCA027665525_01842 CDS open 37758-38039 _na     93_aa Na(+)/H(+) antiporter subunit F1
3679 JAQDEC010000024.1 GCA027665525_01843 CDS open 38023-38436 _na     137_aa mnhG monovalent cation/H(+) antiporter subunit G
3680 JAQDEC010000024.1 GCA027665525_01844 CDS open 38547-38765 _na     72_aa DUF5678 domain-containing protein
3681 JAQDEC010000024.1 GCA027665525_01845 CDS open 38891-39037 _na     48_aa hypothetical protein
3682 JAQDEC010000024.1 GCA027665525_01846 CDS open 39372-39935 _na     187_aa ahpC alkyl hydroperoxide reductase subunit C
3683 JAQDEC010000024.1 GCA027665525_01847 CDS open 39947-41476 _na     509_aa ahpF alkyl hydroperoxide reductase subunit F
3684 JAQDEC010000024.1 GCA027665525_01848 CDS open 41647-42591 _na     314_aa Multiple sugar transport system permease
3685 JAQDEC010000024.1 GCA027665525_01849 CDS open 42604-43533 _na     309_aa ABC transmembrane type-1 domain-containing protein
3686 JAQDEC010000024.1 GCA027665525_01850 CDS open 43598-45109 _na     503_aa DUF3502 domain-containing protein
3687 JAQDEC010000024.1 GCA027665525_01851 CDS open 45245-46972 _na     575_aa Signal transduction histidine kinase internal region domain-containing protein
3688 JAQDEC010000024.1 GCA027665525_01852 CDS open 46980-47741 _na     253_aa yesN Two-component system%2C response regulator YesN
3689 JAQDEC010000024.1 GCA027665525_01853 CDS open 47769-49289 _na     506_aa DUF3502 domain-containing protein
3690 JAQDEC010000024.1 GCA027665525_01854 CDS open 49343-52405 _na     1020_aa Beta-xylanase
3691 JAQDEC010000024.1 GCA027665525_01855 CDS open 52780-53616 _na     278_aa DUF2179 domain-containing protein
3692 JAQDEC010000024.1 GCA027665525_01856 CDS open 53768-53914 _na     48_aa hypothetical protein
3693 JAQDEC010000024.1 GCA027665525_01857 CDS open 56389-58806 _na     805_aa CRISPR-associated endonuclease Cas3-HD
3694 JAQDEC010000024.1 GCA027665525_01807 gene open 513-1139 desE
3695 JAQDEC010000024.1 GCA027665525_01808 gene open 1428-1823 rsbT
3696 JAQDEC010000024.1 GCA027665525_01809 gene open 1795-3327
3697 JAQDEC010000024.1 GCA027665525_01810 gene open 3370-4029
3698 JAQDEC010000024.1 GCA027665525_01811 gene open 4665-6383
3699 JAQDEC010000024.1 GCA027665525_01812 gene open 6539-7186
3700 JAQDEC010000024.1 GCA027665525_01813 gene open 7279-7566
3701 JAQDEC010000024.1 GCA027665525_01814 gene open 8211-9047
3702 JAQDEC010000024.1 GCA027665525_01815 gene open 9040-9678
3703 JAQDEC010000024.1 GCA027665525_01816 gene open 9675-10370
3704 JAQDEC010000024.1 GCA027665525_01817 gene open 10360-11022
3705 JAQDEC010000024.1 GCA027665525_01818 gene open 11088-11543
3706 JAQDEC010000024.1 GCA027665525_01819 gene open 11703-14000
3707 JAQDEC010000024.1 GCA027665525_01820 gene open 14149-14880 gtcR
3708 JAQDEC010000024.1 GCA027665525_01821 gene open 14870-15316
3709 JAQDEC010000024.1 GCA027665525_01822 gene open 15306-16331 walK
3710 JAQDEC010000024.1 GCA027665525_01823 gene open 16721-17773
3711 JAQDEC010000024.1 GCA027665525_01824 gene open 17793-18806
3712 JAQDEC010000024.1 GCA027665525_01825 gene open 18806-19870
3713 JAQDEC010000024.1 GCA027665525_01826 gene open 19867-20619
3714 JAQDEC010000024.1 GCA027665525_01827 gene open 21150-22304
3715 JAQDEC010000024.1 GCA027665525_01828 gene open 22332-23441
3716 JAQDEC010000024.1 GCA027665525_01829 gene open 23448-24053 desR
3717 JAQDEC010000024.1 GCA027665525_01830 gene open 24092-24499
3718 JAQDEC010000024.1 GCA027665525_01831 gene open 24850-28542
3719 JAQDEC010000024.1 GCA027665525_01832 gene open 28626-29768
3720 JAQDEC010000024.1 GCA027665525_01833 gene open 29810-29992
3721 JAQDEC010000024.1 GCA027665525_01834 gene open 30124-30918
3722 JAQDEC010000024.1 GCA027665525_01835 gene open 31166-31729
3723 JAQDEC010000024.1 GCA027665525_01836 gene open 31824-32510 uspA
3724 JAQDEC010000024.1 GCA027665525_01837 gene open 32639-35050
3725 JAQDEC010000024.1 GCA027665525_01838 gene open 35037-35459
3726 JAQDEC010000024.1 GCA027665525_01839 gene open 35462-35800
3727 JAQDEC010000024.1 GCA027665525_01840 gene open 35787-37268
3728 JAQDEC010000024.1 GCA027665525_01841 gene open 37282-37761
3729 JAQDEC010000024.1 GCA027665525_01842 gene open 37758-38039
3730 JAQDEC010000024.1 GCA027665525_01843 gene open 38023-38436 mnhG
3731 JAQDEC010000024.1 GCA027665525_01844 gene open 38547-38765
3732 JAQDEC010000024.1 GCA027665525_01845 gene open 38891-39037
3733 JAQDEC010000024.1 GCA027665525_01846 gene open 39372-39935 ahpC
3734 JAQDEC010000024.1 GCA027665525_01847 gene open 39947-41476 ahpF
3735 JAQDEC010000024.1 GCA027665525_01848 gene open 41647-42591
3736 JAQDEC010000024.1 GCA027665525_01849 gene open 42604-43533
3737 JAQDEC010000024.1 GCA027665525_01850 gene open 43598-45109
3738 JAQDEC010000024.1 GCA027665525_01851 gene open 45245-46972
3739 JAQDEC010000024.1 GCA027665525_01852 gene open 46980-47741 yesN
3740 JAQDEC010000024.1 GCA027665525_01853 gene open 47769-49289
3741 JAQDEC010000024.1 GCA027665525_01854 gene open 49343-52405
3742 JAQDEC010000024.1 GCA027665525_01855 gene open 52780-53616
3743 JAQDEC010000024.1 GCA027665525_01856 gene open 53768-53914
3744 JAQDEC010000024.1 GCA027665525_01857 gene open 56389-58806
3745 JAQDEC010000025.1 GCA027665525_01858 CDS open 42-1856 _na     604_aa Dynamin family
3746 JAQDEC010000025.1 GCA027665525_01859 CDS open 2110-3870 _na     586_aa ATP-binding cassette%2C subfamily B%2C bacterial
3747 JAQDEC010000025.1 GCA027665525_01860 CDS open 3867-5723 _na     618_aa ABC transporter%2C ATP-binding protein
3748 JAQDEC010000025.1 GCA027665525_01861 CDS open 5840-6295 _na     151_aa N-acetyltransferase domain-containing protein
3749 JAQDEC010000025.1 GCA027665525_01862 CDS open 6596-7780 _na     394_aa Receptor family ligand-binding protein
3750 JAQDEC010000025.1 GCA027665525_01863 CDS open 7719-8138 _na     139_aa hypothetical protein
3751 JAQDEC010000025.1 GCA027665525_01864 CDS open 8135-8944 _na     269_aa Branched-chain amino acid transport system ATP-binding protein
3752 JAQDEC010000025.1 GCA027665525_01865 CDS open 8941-9645 _na     234_aa livF High-affinity branched-chain amino acid ABC transporter%2C ATP-binding protein LivF
3753 JAQDEC010000025.1 GCA027665525_01866 CDS open 9897-10487 _na     196_aa Permuted papain-like amidase enzyme%2C YaeF/YiiX%2C C92 family
3754 JAQDEC010000025.1 GCA027665525_01867 CDS open 10701-12362 _na     553_aa yesN Two-component system%2C response regulator YesN
3755 JAQDEC010000025.1 GCA027665525_01868 CDS open 12359-14149 _na     596_aa histidine kinase
3756 JAQDEC010000025.1 GCA027665525_01869 CDS open 14146-15135 _na     329_aa Periplasmic binding protein domain-containing protein
3757 JAQDEC010000025.1 GCA027665525_01870 CDS open 15406-16443 _na     345_aa mglB D-galactose/methyl-galactoside binding periplasmic protein MglB
3758 JAQDEC010000025.1 GCA027665525_01871 CDS open 16613-18118 _na     501_aa Ribose/galactose/methyl galactoside import ATP-binding protein
3759 JAQDEC010000025.1 GCA027665525_01872 CDS open 18141-19151 _na     336_aa mglC galactose/methyl galactoside ABC transporter permease MglC
3760 JAQDEC010000025.1 GCA027665525_01873 CDS open 19301-19843 _na     180_aa SCP domain-containing protein
3761 JAQDEC010000025.1 GCA027665525_01874 CDS open 20584-21255 _na     223_aa PspA/IM30 family protein
3762 JAQDEC010000025.1 GCA027665525_01875 CDS open 21289-21795 _na     168_aa DUF4178 domain-containing protein
3763 JAQDEC010000025.1 GCA027665525_01877 CDS open 22221-23024 _na     267_aa SGNH hydrolase-type esterase domain-containing protein
3764 JAQDEC010000025.1 GCA027665525_01878 CDS open 23066-24052 _na     328_aa bcrA Putative bacitracin ABC transporter%2C ATP-binding protein BcrA
3765 JAQDEC010000025.1 GCA027665525_01879 CDS open 24036-25034 _na     332_aa ABC transporter%2C permease protein
3766 JAQDEC010000025.1 GCA027665525_01880 CDS open 25110-27095 _na     661_aa parE DNA topoisomerase IV subunit B
3767 JAQDEC010000025.1 GCA027665525_01881 CDS open 27109-29547 _na     812_aa parC DNA topoisomerase IV subunit A
3768 JAQDEC010000025.1 GCA027665525_01882 CDS open 29628-29921 _na     97_aa RNA polymerase alpha subunit C-terminal domain-containing protein
3769 JAQDEC010000025.1 GCA027665525_01883 CDS open 29904-30824 _na     306_aa HTH lysR-type domain-containing protein
3770 JAQDEC010000025.1 GCA027665525_01884 CDS open 30978-32045 _na     355_aa branched-chain amino acid aminotransferase
3771 JAQDEC010000025.1 GCA027665525_01885 CDS open 32166-32576 _na     136_aa HTH marR-type domain-containing protein
3772 JAQDEC010000025.1 GCA027665525_01886 CDS open 32656-33426 _na     256_aa Pseudouridine synthase RsuA-like
3773 JAQDEC010000025.1 GCA027665525_01887 CDS open 33430-34293 _na     287_aa S-adenosylmethionine-dependent methyltransferase domain-containing protein
3774 JAQDEC010000025.1 GCA027665525_01888 CDS open 34565-34882 _na     105_aa hypothetical protein
3775 JAQDEC010000025.1 GCA027665525_01889 CDS open 34885-35724 _na     279_aa N-acetyltransferase domain-containing protein
3776 JAQDEC010000025.1 GCA027665525_01890 CDS open 35872-36648 _na     258_aa ABC transporter domain-containing protein
3777 JAQDEC010000025.1 GCA027665525_01891 CDS open 36652-37779 _na     375_aa Spore germination protein (Amino acid permease)
3778 JAQDEC010000025.1 GCA027665525_01892 CDS open 37808-38023 _na     71_aa hypothetical protein
3779 JAQDEC010000025.1 GCA027665525_01893 CDS open 38037-39230 _na     397_aa Ger(X)C family germination protein
3780 JAQDEC010000025.1 GCA027665525_01894 CDS open 39227-39796 _na     189_aa spore germination protein
3781 JAQDEC010000025.1 GCA027665525_01895 CDS open 39793-40821 _na     342_aa Spore germination protein KA
3782 JAQDEC010000025.1 GCA027665525_01896 CDS open 41010-42590 _na     526_aa Spore germination protein
3783 JAQDEC010000025.1 GCA027665525_01897 CDS open 42587-43693 _na     368_aa Spore germination protein (Amino acid permease)
3784 JAQDEC010000025.1 GCA027665525_01898 CDS open 43686-44858 _na     390_aa Ger(X)C family germination protein
3785 JAQDEC010000025.1 GCA027665525_01899 CDS open 44878-45018 _na     46_aa hypothetical protein
3786 JAQDEC010000025.1 GCA027665525_01900 CDS open 45181-46227 _na     348_aa HDIG domain protein
3787 JAQDEC010000025.1 GCA027665525_01901 CDS open 46321-46752 _na     143_aa Glyoxalase family protein
3788 JAQDEC010000025.1 GCA027665525_01902 CDS open 47130-47993 _na     287_aa rpiR RpiR family transcriptional regulator
3789 JAQDEC010000025.1 GCA027665525_01903 CDS open 48195-49109 _na     304_aa murQ N-acetylmuramic acid 6-phosphate etherase
3790 JAQDEC010000025.1 GCA027665525_01904 CDS open 49140-50594 _na     484_aa Multiple sugar transport system substrate-binding protein
3791 JAQDEC010000025.1 GCA027665525_01905 CDS open 50681-51604 _na     307_aa ABC transmembrane type-1 domain-containing protein
3792 JAQDEC010000025.1 GCA027665525_01906 CDS open 51625-52485 _na     286_aa ABC transmembrane type-1 domain-containing protein
3793 JAQDEC010000025.1 GCA027665525_01907 CDS open 52502-53722 _na     406_aa anhydro-N-acetylmuramic acid kinase
3794 JAQDEC010000025.1 GCA027665525_01908 CDS open 53719-54906 _na     395_aa DUF1343 domain-containing protein
3795 JAQDEC010000025.1 GCA027665525_01909 CDS open 54986-55909 _na     307_aa ATPase BadF/BadG/BcrA/BcrD type domain-containing protein
3796 JAQDEC010000025.1 GCA027665525_01910 CDS open 55990-57354 _na     454_aa Glycolate oxidase iron-sulfur subunit
3797 JAQDEC010000025.1 GCA027665525_01911 CDS open 57351-58763 _na     470_aa glcD Glycolate oxidase%2C subunit GlcD
3798 JAQDEC010000025.1 GCA027665525_01858 gene open 42-1856
3799 JAQDEC010000025.1 GCA027665525_01859 gene open 2110-3870
3800 JAQDEC010000025.1 GCA027665525_01860 gene open 3867-5723
3801 JAQDEC010000025.1 GCA027665525_01861 gene open 5840-6295
3802 JAQDEC010000025.1 GCA027665525_01862 gene open 6596-7780
3803 JAQDEC010000025.1 GCA027665525_01863 gene open 7719-8138
3804 JAQDEC010000025.1 GCA027665525_01864 gene open 8135-8944
3805 JAQDEC010000025.1 GCA027665525_01865 gene open 8941-9645 livF
3806 JAQDEC010000025.1 GCA027665525_01866 gene open 9897-10487
3807 JAQDEC010000025.1 GCA027665525_01867 gene open 10701-12362 yesN
3808 JAQDEC010000025.1 GCA027665525_01868 gene open 12359-14149
3809 JAQDEC010000025.1 GCA027665525_01869 gene open 14146-15135
3810 JAQDEC010000025.1 GCA027665525_01870 gene open 15406-16443 mglB
3811 JAQDEC010000025.1 GCA027665525_01871 gene open 16613-18118
3812 JAQDEC010000025.1 GCA027665525_01872 gene open 18141-19151 mglC
3813 JAQDEC010000025.1 GCA027665525_01873 gene open 19301-19843
3814 JAQDEC010000025.1 GCA027665525_01874 gene open 20584-21255
3815 JAQDEC010000025.1 GCA027665525_01875 gene open 21289-21795
3816 JAQDEC010000025.1 GCA027665525_01877 gene open 22221-23024
3817 JAQDEC010000025.1 GCA027665525_01878 gene open 23066-24052 bcrA
3818 JAQDEC010000025.1 GCA027665525_01879 gene open 24036-25034
3819 JAQDEC010000025.1 GCA027665525_01880 gene open 25110-27095 parE
3820 JAQDEC010000025.1 GCA027665525_01881 gene open 27109-29547 parC
3821 JAQDEC010000025.1 GCA027665525_01882 gene open 29628-29921
3822 JAQDEC010000025.1 GCA027665525_01883 gene open 29904-30824
3823 JAQDEC010000025.1 GCA027665525_01884 gene open 30978-32045
3824 JAQDEC010000025.1 GCA027665525_01885 gene open 32166-32576
3825 JAQDEC010000025.1 GCA027665525_01886 gene open 32656-33426
3826 JAQDEC010000025.1 GCA027665525_01887 gene open 33430-34293
3827 JAQDEC010000025.1 GCA027665525_01888 gene open 34565-34882
3828 JAQDEC010000025.1 GCA027665525_01889 gene open 34885-35724
3829 JAQDEC010000025.1 GCA027665525_01890 gene open 35872-36648
3830 JAQDEC010000025.1 GCA027665525_01891 gene open 36652-37779
3831 JAQDEC010000025.1 GCA027665525_01892 gene open 37808-38023
3832 JAQDEC010000025.1 GCA027665525_01893 gene open 38037-39230
3833 JAQDEC010000025.1 GCA027665525_01894 gene open 39227-39796
3834 JAQDEC010000025.1 GCA027665525_01895 gene open 39793-40821
3835 JAQDEC010000025.1 GCA027665525_01896 gene open 41010-42590
3836 JAQDEC010000025.1 GCA027665525_01897 gene open 42587-43693
3837 JAQDEC010000025.1 GCA027665525_01898 gene open 43686-44858
3838 JAQDEC010000025.1 GCA027665525_01899 gene open 44878-45018
3839 JAQDEC010000025.1 GCA027665525_01900 gene open 45181-46227
3840 JAQDEC010000025.1 GCA027665525_01901 gene open 46321-46752
3841 JAQDEC010000025.1 GCA027665525_01902 gene open 47130-47993 rpiR
3842 JAQDEC010000025.1 GCA027665525_01903 gene open 48195-49109 murQ
3843 JAQDEC010000025.1 GCA027665525_01904 gene open 49140-50594
3844 JAQDEC010000025.1 GCA027665525_01905 gene open 50681-51604
3845 JAQDEC010000025.1 GCA027665525_01906 gene open 51625-52485
3846 JAQDEC010000025.1 GCA027665525_01907 gene open 52502-53722
3847 JAQDEC010000025.1 GCA027665525_01908 gene open 53719-54906
3848 JAQDEC010000025.1 GCA027665525_01909 gene open 54986-55909
3849 JAQDEC010000025.1 GCA027665525_01910 gene open 55990-57354
3850 JAQDEC010000025.1 GCA027665525_01911 gene open 57351-58763 glcD
3851 JAQDEC010000025.1 GCA027665525_01876 gene open 21955-22027 trnK
3852 JAQDEC010000025.1 GCA027665525_01876 tRNA open 21955-22027 trnK tRNA-Lys(ctt)
3853 JAQDEC010000026.1 regulatory_region open 6297-6453 FMN riboswitch aptamer (RFN element)
3854 JAQDEC010000026.1 regulatory_region open 14268-14394 Glycine riboswitch aptamer
3855 JAQDEC010000026.1 GCA027665525_01912 CDS open 595-981 _na     128_aa Peptidase S9 prolyl oligopeptidase catalytic domain-containing protein
3856 JAQDEC010000026.1 GCA027665525_01913 CDS open 995-1234 _na     79_aa SGNH hydrolase-type esterase domain-containing protein
3857 JAQDEC010000026.1 GCA027665525_01914 CDS open 1278-2303 _na     341_aa araC Transcriptional regulator%2C AraC family
3858 JAQDEC010000026.1 GCA027665525_01915 CDS open 2460-4595 _na     711_aa Beta-xylosidase
3859 JAQDEC010000026.1 GCA027665525_01916 CDS open 4758-4949 _na     63_aa hypothetical protein
3860 JAQDEC010000026.1 GCA027665525_01917 CDS open 5146-6267 _na     373_aa eamA EamA domain-containing protein
3861 JAQDEC010000026.1 GCA027665525_01918 CDS open 6560-7846 _na     428_aa Spore germination protein
3862 JAQDEC010000026.1 GCA027665525_01919 CDS open 7959-8828 _na     289_aa Lipoprotein
3863 JAQDEC010000026.1 GCA027665525_01920 CDS open 8846-9526 _na     226_aa D-methionine transport system permease
3864 JAQDEC010000026.1 GCA027665525_01921 CDS open 9532-10314 _na     260_aa D-methionine transport system ATP-binding protein
3865 JAQDEC010000026.1 GCA027665525_01922 CDS open 10859-11623 _na     254_aa 3-oxoacyl-[acyl-carrier protein] reductase
3866 JAQDEC010000026.1 GCA027665525_01923 CDS open 11710-12048 _na     112_aa arsR Transcriptional regulator%2C ArsR family
3867 JAQDEC010000026.1 GCA027665525_01924 CDS open 12534-13415 _na     293_aa sdaAA L-serine ammonia-lyase%2C iron-sulfur-dependent%2C subunit alpha
3868 JAQDEC010000026.1 GCA027665525_01925 CDS open 13433-14104 _na     223_aa sdaAB L-serine ammonia-lyase%2C iron-sulfur-dependent subunit beta
3869 JAQDEC010000026.1 GCA027665525_01926 CDS open 14891-20323 _na     1810_aa Bacillopeptidase F
3870 JAQDEC010000026.1 GCA027665525_01927 CDS open 20460-20669 _na     69_aa hypothetical protein
3871 JAQDEC010000026.1 GCA027665525_01928 CDS open 21089-23197 _na     702_aa Alpha-galactosidase
3872 JAQDEC010000026.1 GCA027665525_01929 CDS open 23205-25283 _na     692_aa Alpha galactosidase C-terminal beta sandwich domain-containing protein
3873 JAQDEC010000026.1 GCA027665525_01930 CDS open 25388-26980 _na     530_aa response regulator
3874 JAQDEC010000026.1 GCA027665525_01931 CDS open 26949-28814 _na     621_aa sensor histidine kinase
3875 JAQDEC010000026.1 GCA027665525_01932 CDS open 28957-30645 _na     562_aa ABC transporter substrate-binding protein
3876 JAQDEC010000026.1 GCA027665525_01933 CDS open 30713-31609 _na     298_aa carbohydrate ABC transporter permease
3877 JAQDEC010000026.1 GCA027665525_01934 CDS open 31613-32506 _na     297_aa ABC transporter permease subunit
3878 JAQDEC010000026.1 GCA027665525_01935 CDS open 32677-34386 _na     569_aa Multiple sugar transport system substrate-binding protein
3879 JAQDEC010000026.1 GCA027665525_01936 CDS open 34474-36300 _na     608_aa histidine kinase
3880 JAQDEC010000026.1 GCA027665525_01937 CDS open 36278-37879 _na     533_aa yesN Two-component system%2C response regulator YesN
3881 JAQDEC010000026.1 GCA027665525_01938 CDS open 38149-39120 _na     323_aa ABC transmembrane type-1 domain-containing protein
3882 JAQDEC010000026.1 GCA027665525_01939 CDS open 39142-40035 _na     297_aa ABC transmembrane type-1 domain-containing protein
3883 JAQDEC010000026.1 GCA027665525_01940 CDS open 40113-40601 _na     162_aa low molecular weight protein-tyrosine-phosphatase
3884 JAQDEC010000026.1 GCA027665525_01941 CDS open 40703-41098 _na     131_aa GyrI-like domain-containing protein
3885 JAQDEC010000026.1 GCA027665525_01942 CDS open 41116-41334 _na     72_aa HTH araC/xylS-type domain-containing protein
3886 JAQDEC010000026.1 GCA027665525_01943 CDS open 41642-43747 _na     701_aa discoidin domain-containing protein
3887 JAQDEC010000026.1 GCA027665525_01944 CDS open 43744-44787 _na     347_aa hypothetical protein
3888 JAQDEC010000026.1 GCA027665525_01945 CDS open 45021-45848 _na     275_aa HTH araC/xylS-type domain-containing protein
3889 JAQDEC010000026.1 GCA027665525_01946 CDS open 46088-47254 _na     388_aa Oxidoreductase
3890 JAQDEC010000026.1 GCA027665525_01947 CDS open 47362-48105 _na     247_aa hypothetical protein
3891 JAQDEC010000026.1 GCA027665525_01948 CDS open 48441-49289 _na     282_aa Xylose isomerase-like TIM barrel domain-containing protein
3892 JAQDEC010000026.1 GCA027665525_01949 CDS open 49299-50408 _na     369_aa Gfo/Idh/MocA-like oxidoreductase C-terminal domain-containing protein
3893 JAQDEC010000026.1 GCA027665525_01950 CDS open 50428-51459 _na     343_aa Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein
3894 JAQDEC010000026.1 GCA027665525_01951 CDS open 51595-51786 _na     63_aa Resolvase/invertase-type recombinase catalytic domain-containing protein
3895 JAQDEC010000026.1 GCA027665525_01952 CDS open 52049-52546 _na     165_aa hypothetical protein
3896 JAQDEC010000026.1 GCA027665525_01953 CDS open 52543-53640 _na     365_aa Alpha-glucoside transport system permease
3897 JAQDEC010000026.1 GCA027665525_01954 CDS open 53640-54722 _na     360_aa Alpha-glucoside transport system permease
3898 JAQDEC010000026.1 GCA027665525_01955 CDS open 54875-56263 _na     462_aa ABC transporter substrate-binding protein
3899 JAQDEC010000026.1 GCA027665525_01956 CDS open 56639-57667 _na     342_aa HTH lacI-type domain-containing protein
3900 JAQDEC010000026.1 GCA027665525_01912 gene open 595-981
3901 JAQDEC010000026.1 GCA027665525_01913 gene open 995-1234
3902 JAQDEC010000026.1 GCA027665525_01914 gene open 1278-2303 araC
3903 JAQDEC010000026.1 GCA027665525_01915 gene open 2460-4595
3904 JAQDEC010000026.1 GCA027665525_01916 gene open 4758-4949
3905 JAQDEC010000026.1 GCA027665525_01917 gene open 5146-6267 eamA
3906 JAQDEC010000026.1 GCA027665525_01918 gene open 6560-7846
3907 JAQDEC010000026.1 GCA027665525_01919 gene open 7959-8828
3908 JAQDEC010000026.1 GCA027665525_01920 gene open 8846-9526
3909 JAQDEC010000026.1 GCA027665525_01921 gene open 9532-10314
3910 JAQDEC010000026.1 GCA027665525_01922 gene open 10859-11623
3911 JAQDEC010000026.1 GCA027665525_01923 gene open 11710-12048 arsR
3912 JAQDEC010000026.1 GCA027665525_01924 gene open 12534-13415 sdaAA
3913 JAQDEC010000026.1 GCA027665525_01925 gene open 13433-14104 sdaAB
3914 JAQDEC010000026.1 GCA027665525_01926 gene open 14891-20323
3915 JAQDEC010000026.1 GCA027665525_01927 gene open 20460-20669
3916 JAQDEC010000026.1 GCA027665525_01928 gene open 21089-23197
3917 JAQDEC010000026.1 GCA027665525_01929 gene open 23205-25283
3918 JAQDEC010000026.1 GCA027665525_01930 gene open 25388-26980
3919 JAQDEC010000026.1 GCA027665525_01931 gene open 26949-28814
3920 JAQDEC010000026.1 GCA027665525_01932 gene open 28957-30645
3921 JAQDEC010000026.1 GCA027665525_01933 gene open 30713-31609
3922 JAQDEC010000026.1 GCA027665525_01934 gene open 31613-32506
3923 JAQDEC010000026.1 GCA027665525_01935 gene open 32677-34386
3924 JAQDEC010000026.1 GCA027665525_01936 gene open 34474-36300
3925 JAQDEC010000026.1 GCA027665525_01937 gene open 36278-37879 yesN
3926 JAQDEC010000026.1 GCA027665525_01938 gene open 38149-39120
3927 JAQDEC010000026.1 GCA027665525_01939 gene open 39142-40035
3928 JAQDEC010000026.1 GCA027665525_01940 gene open 40113-40601
3929 JAQDEC010000026.1 GCA027665525_01941 gene open 40703-41098
3930 JAQDEC010000026.1 GCA027665525_01942 gene open 41116-41334
3931 JAQDEC010000026.1 GCA027665525_01943 gene open 41642-43747
3932 JAQDEC010000026.1 GCA027665525_01944 gene open 43744-44787
3933 JAQDEC010000026.1 GCA027665525_01945 gene open 45021-45848
3934 JAQDEC010000026.1 GCA027665525_01946 gene open 46088-47254
3935 JAQDEC010000026.1 GCA027665525_01947 gene open 47362-48105
3936 JAQDEC010000026.1 GCA027665525_01948 gene open 48441-49289
3937 JAQDEC010000026.1 GCA027665525_01949 gene open 49299-50408
3938 JAQDEC010000026.1 GCA027665525_01950 gene open 50428-51459
3939 JAQDEC010000026.1 GCA027665525_01951 gene open 51595-51786
3940 JAQDEC010000026.1 GCA027665525_01952 gene open 52049-52546
3941 JAQDEC010000026.1 GCA027665525_01953 gene open 52543-53640
3942 JAQDEC010000026.1 GCA027665525_01954 gene open 53640-54722
3943 JAQDEC010000026.1 GCA027665525_01955 gene open 54875-56263
3944 JAQDEC010000026.1 GCA027665525_01956 gene open 56639-57667
3945 JAQDEC010000027.1 GCA027665525_01957 CDS open 543-1424 _na     293_aa HTH araC/xylS-type domain-containing protein
3946 JAQDEC010000027.1 GCA027665525_01958 CDS open 1451-2371 _na     306_aa Acetyl xylan esterase domain-containing protein
3947 JAQDEC010000027.1 GCA027665525_01959 CDS open 2542-3573 _na     343_aa HTH lacI-type domain-containing protein
3948 JAQDEC010000027.1 GCA027665525_01960 CDS open 3800-5242 _na     480_aa Tagaturonate reductase
3949 JAQDEC010000027.1 GCA027665525_01961 CDS open 5230-6855 _na     541_aa Altronate hydrolase
3950 JAQDEC010000027.1 GCA027665525_01962 CDS open 6772-8151 _na     459_aa Major facilitator superfamily (MFS) profile domain-containing protein
3951 JAQDEC010000027.1 GCA027665525_01963 CDS open 8165-8812 _na     215_aa Isochorismatase-like domain-containing protein
3952 JAQDEC010000027.1 GCA027665525_01964 CDS open 8834-9868 _na     344_aa SsuA/THI5-like domain-containing protein
3953 JAQDEC010000027.1 GCA027665525_01965 CDS open 9923-10825 _na     300_aa NitT/TauT family transport system permease
3954 JAQDEC010000027.1 GCA027665525_01966 CDS open 10866-11648 _na     260_aa ABC transporter family protein
3955 JAQDEC010000027.1 GCA027665525_01967 CDS open 11772-12152 _na     126_aa mpsC Na+-translocating membrane putative-generating system MpsC domain-containing protein
3956 JAQDEC010000027.1 GCA027665525_01968 CDS open 12359-12568 _na     69_aa Spo0E like sporulation regulatory protein
3957 JAQDEC010000027.1 GCA027665525_01969 CDS open 12789-13130 _na     113_aa Cupin type-2 domain-containing protein
3958 JAQDEC010000027.1 GCA027665525_01970 CDS open 13199-13294 _na     31_aa hypothetical protein
3959 JAQDEC010000027.1 GCA027665525_01971 CDS open 13339-13575 _na     78_aa CBM6 domain-containing protein
3960 JAQDEC010000027.1 GCA027665525_01972 CDS open 13603-14871 _na     422_aa Metal-independent alpha-mannosidase
3961 JAQDEC010000027.1 GCA027665525_01973 CDS open 14983-16032 _na     349_aa Glycosyl hydrolase
3962 JAQDEC010000027.1 GCA027665525_01974 CDS open 16032-17150 _na     372_aa Glycosyl hydrolase
3963 JAQDEC010000027.1 GCA027665525_01975 CDS open 17170-18096 _na     308_aa Multiple sugar transport system permease
3964 JAQDEC010000027.1 GCA027665525_01976 CDS open 18093-18980 _na     295_aa Multiple sugar transport system permease
3965 JAQDEC010000027.1 GCA027665525_01977 CDS open 19009-20328 _na     439_aa Multiple sugar transport system substrate-binding protein
3966 JAQDEC010000027.1 GCA027665525_01978 CDS open 21081-22277 _na     398_aa HTH gntR-type domain-containing protein
3967 JAQDEC010000027.1 GCA027665525_01979 CDS open 22387-23268 _na     293_aa fructokinase
3968 JAQDEC010000027.1 GCA027665525_01980 CDS open 23539-24495 _na     318_aa CMP-binding protein
3969 JAQDEC010000027.1 GCA027665525_01981 CDS open 24653-26914 _na     753_aa FMN-binding domain-containing protein
3970 JAQDEC010000027.1 GCA027665525_01982 CDS open 27323-28708 _na     461_aa hypothetical protein
3971 JAQDEC010000027.1 GCA027665525_01983 CDS open 28705-32691 _na     1328_aa hypothetical protein
3972 JAQDEC010000027.1 GCA027665525_01984 CDS open 32961-34280 _na     439_aa Major facilitator superfamily (MFS) profile domain-containing protein
3973 JAQDEC010000027.1 GCA027665525_01985 CDS open 34327-36300 _na     657_aa Glycoside hydrolase family 127 protein
3974 JAQDEC010000027.1 GCA027665525_01986 CDS open 36432-37313 _na     293_aa HTH araC/xylS-type domain-containing protein
3975 JAQDEC010000027.1 GCA027665525_01987 CDS open 37374-38132 _na     252_aa Lipoprotein
3976 JAQDEC010000027.1 GCA027665525_01988 CDS open 38159-38602 _na     147_aa dsbB Disulfide bond formation protein DsbB
3977 JAQDEC010000027.1 GCA027665525_01989 CDS open 38624-39337 _na     237_aa Thioredoxin domain-containing protein
3978 JAQDEC010000027.1 GCA027665525_01990 CDS open 39718-41430 _na     570_aa Phosphoenolpyruvate-protein phosphotransferase
3979 JAQDEC010000027.1 GCA027665525_01991 CDS open 41423-41698 _na     91_aa Phosphocarrier protein HPr
3980 JAQDEC010000027.1 GCA027665525_01992 CDS open 41831-43906 _na     691_aa PTS system%2C glucose-specific IIBC component
3981 JAQDEC010000027.1 GCA027665525_01993 CDS open 44139-44984 _na     281_aa glcT glucose PTS transporter transcription antiterminator GlcT
3982 JAQDEC010000027.1 GCA027665525_01994 CDS open 45176-46762 _na     528_aa Flotillin
3983 JAQDEC010000027.1 GCA027665525_01995 CDS open 46787-47317 _na     176_aa NfeD-like C-terminal domain-containing protein
3984 JAQDEC010000027.1 GCA027665525_01996 CDS open 47464-48627 _na     387_aa gldA Alcohol dehydrogenase iron-type/glycerol dehydrogenase GldA domain-containing protein
3985 JAQDEC010000027.1 GCA027665525_01997 CDS open 48816-50393 _na     525_aa Galactose-1-phosphate uridylyltransferase
3986 JAQDEC010000027.1 GCA027665525_01998 CDS open 50408-51394 _na     328_aa galE UDP-glucose 4-epimerase GalE
3987 JAQDEC010000027.1 GCA027665525_01999 CDS open 51400-52596 _na     398_aa galactokinase
3988 JAQDEC010000027.1 GCA027665525_02000 CDS open 52712-53617 _na     301_aa araC AraC family transcriptional regulator
3989 JAQDEC010000027.1 GCA027665525_02001 CDS open 53645-54394 _na     249_aa NAD-dependent protein deacylase
3990 JAQDEC010000027.1 GCA027665525_02002 CDS open 54408-55187 _na     259_aa HAD hydrolase%2C family IA
3991 JAQDEC010000027.1 GCA027665525_01957 gene open 543-1424
3992 JAQDEC010000027.1 GCA027665525_01958 gene open 1451-2371
3993 JAQDEC010000027.1 GCA027665525_01959 gene open 2542-3573
3994 JAQDEC010000027.1 GCA027665525_01960 gene open 3800-5242
3995 JAQDEC010000027.1 GCA027665525_01961 gene open 5230-6855
3996 JAQDEC010000027.1 GCA027665525_01962 gene open 6772-8151
3997 JAQDEC010000027.1 GCA027665525_01963 gene open 8165-8812
3998 JAQDEC010000027.1 GCA027665525_01964 gene open 8834-9868
3999 JAQDEC010000027.1 GCA027665525_01965 gene open 9923-10825
4000 JAQDEC010000027.1 GCA027665525_01966 gene open 10866-11648