HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Faecalibacterium prausnitzii (GCA_027683585.1)

Select a Genome:
BAKTA Annotations for GCA_027683585.1
Genome Selected: Faecalibacterium prausnitzii
ContigsBases CDSrRNA tmRNAtRNA
34 3271509 3058 4 1 79
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 6337 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:11]    |    Number of Records Found: 6337 [13 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
5001 JAQCXO010000009.1 GCA027683585_03102 CDS open 54822-55667 _na     281_aa Sortase (Surface protein transpeptidase)
5002 JAQCXO010000009.1 GCA027683585_03103 CDS open 55748-57214 _na     488_aa SpaH/EbpB family LPXTG-anchored major pilin
5003 JAQCXO010000009.1 GCA027683585_03104 CDS open 57364-62364 _na     1666_aa Gram-positive cocci surface proteins LPxTG domain-containing protein
5004 JAQCXO010000009.1 GCA027683585_03105 CDS open 62387-62977 _na     196_aa lepB signal peptidase I
5005 JAQCXO010000009.1 GCA027683585_03106 CDS open 62974-63513 _na     179_aa ATPase
5006 JAQCXO010000009.1 GCA027683585_03107 CDS open 63918-64151 _na     77_aa Bacteriocin
5007 JAQCXO010000009.1 GCA027683585_03108 CDS open 64198-64653 _na     151_aa Internalin-A
5008 JAQCXO010000009.1 GCA027683585_03110 CDS open 65178-65879 _na     233_aa gntR GntR family transcriptional regulator
5009 JAQCXO010000009.1 GCA027683585_03111 CDS open 66263-67357 _na     364_aa yiaO Extracytoplasmic solute receptor protein yiaO
5010 JAQCXO010000009.1 GCA027683585_03112 CDS open 67529-67984 _na     151_aa TRAP transporter small permease
5011 JAQCXO010000009.1 GCA027683585_03113 CDS open 68006-68623 _na     205_aa TRAP transporter large permease subunit
5012 JAQCXO010000009.1 GCA027683585_03114 CDS open 68571-69299 _na     242_aa TRAP transporter large permease subunit
5013 JAQCXO010000009.1 GCA027683585_03115 CDS open 69384-70181 _na     265_aa 2%2C4-dihydroxyhept-2-ene-1%2C7-dioic acid aldolase
5014 JAQCXO010000009.1 GCA027683585_03116 CDS open 70323-71120 _na     265_aa Aminoglycoside N(3)-acetyltransferase
5015 JAQCXO010000009.1 GCA027683585_03117 CDS open 71168-72100 _na     310_aa rhaS L-rhamnose operon regulatory protein rhaS
5016 JAQCXO010000009.1 GCA027683585_03118 CDS open 72368-72622 _na     84_aa Polya polymerase
5017 JAQCXO010000009.1 GCA027683585_03119 CDS open 72783-73421 _na     212_aa Coil containing protein
5018 JAQCXO010000009.1 GCA027683585_03120 CDS open 73836-73991 _na     51_aa hypothetical protein
5019 JAQCXO010000009.1 GCA027683585_03121 CDS open 74101-74877 _na     258_aa traX TraX protein
5020 JAQCXO010000009.1 GCA027683585_03122 CDS open 75325-78264 _na     979_aa 2-hydroxyisocaproyl-CoA dehydratase activator
5021 JAQCXO010000009.1 GCA027683585_03123 CDS open 78345-79661 _na     438_aa 2-hydroxyglutaryl-CoA dehydratase
5022 JAQCXO010000009.1 GCA027683585_03124 CDS open 79900-80805 _na     301_aa Collagenase and related proteases
5023 JAQCXO010000009.1 GCA027683585_03125 CDS open 80982-83564 _na     860_aa Elongation factor G
5024 JAQCXO010000009.1 GCA027683585_03126 CDS open 83826-84725 _na     299_aa ADP-dependent (S)-NAD(P)H-hydrate dehydratase
5025 JAQCXO010000009.1 GCA027683585_03127 CDS open 84806-85540 _na     244_aa FMN reductase [NAD(P)H]
5026 JAQCXO010000009.1 GCA027683585_03128 CDS open 85563-86570 _na     335_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
5027 JAQCXO010000009.1 GCA027683585_03129 CDS open 86572-89145 _na     857_aa polA DNA polymerase I
5028 JAQCXO010000009.1 GCA027683585_03130 CDS open 89420-89608 _na     62_aa Ferredoxin
5029 JAQCXO010000009.1 GCA027683585_03131 CDS open 89720-90061 _na     113_aa arsC Arsenate reductase and related proteins%2C glutaredoxin family
5030 JAQCXO010000009.1 GCA027683585_03132 CDS open 90164-91072 _na     302_aa Ice-structuring protein
5031 JAQCXO010000009.1 GCA027683585_03133 CDS open 91134-92135 _na     333_aa wcaE Glycosyltransferase family 2 protein
5032 JAQCXO010000009.1 GCA027683585_03134 CDS open 92358-92735 _na     125_aa ydcR putative HTH-type transcriptional regulator ydcR
5033 JAQCXO010000009.1 GCA027683585_03135 CDS open 92728-93426 _na     232_aa ABC transporter ATP-binding protein
5034 JAQCXO010000009.1 GCA027683585_03136 CDS open 93420-94238 _na     272_aa ABC transporter permease
5035 JAQCXO010000009.1 GCA027683585_03137 CDS open 94307-94864 _na     185_aa DUF4358 domain-containing protein
5036 JAQCXO010000009.1 GCA027683585_03138 CDS open 95022-95462 _na     146_aa asnC AsnC family transcriptional regulator
5037 JAQCXO010000009.1 GCA027683585_03139 CDS open 95994-97256 _na     420_aa hflX GTPase HflX
5038 JAQCXO010000009.1 GCA027683585_03140 CDS open 97253-97861 _na     202_aa N-acetyltransferase
5039 JAQCXO010000009.1 GCA027683585_03141 CDS open 98013-99797 _na     594_aa bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase
5040 JAQCXO010000009.1 GCA027683585_03142 CDS open 99823-100788 _na     321_aa Glycosyltransferase%2C group 2 family protein
5041 JAQCXO010000009.1 GCA027683585_03143 CDS open 100808-102337 _na     509_aa Polysaccharide biosynthesis protein
5042 JAQCXO010000009.1 GCA027683585_03144 CDS open 102334-103320 _na     328_aa Glycosyltransferase
5043 JAQCXO010000009.1 GCA027683585_03145 CDS open 103643-106348 _na     901_aa valS valine--tRNA ligase
5044 JAQCXO010000009.1 GCA027683585_03146 CDS open 106320-106865 _na     181_aa vanZ VanZ family protein
5045 JAQCXO010000009.1 GCA027683585_03147 CDS open 106862-108127 _na     421_aa folC Bifunctional protein folC
5046 JAQCXO010000009.1 GCA027683585_03148 CDS open 108226-108549 _na     107_aa Anti-sigma factor antagonist
5047 JAQCXO010000009.1 GCA027683585_03149 CDS open 108546-108986 _na     146_aa spoIIAB anti-sigma F factor
5048 JAQCXO010000009.1 GCA027683585_03150 CDS open 109008-109682 _na     224_aa Stage II sporulation protein AC
5049 JAQCXO010000009.1 GCA027683585_03050 gene open 296-742
5050 JAQCXO010000009.1 GCA027683585_03051 gene open 908-1147
5051 JAQCXO010000009.1 GCA027683585_03052 gene open 1158-1628
5052 JAQCXO010000009.1 GCA027683585_03053 gene open 1695-2627
5053 JAQCXO010000009.1 GCA027683585_03054 gene open 2584-3417 parA
5054 JAQCXO010000009.1 GCA027683585_03055 gene open 3417-4313
5055 JAQCXO010000009.1 GCA027683585_03056 gene open 4276-4530
5056 JAQCXO010000009.1 GCA027683585_03057 gene open 4527-4787
5057 JAQCXO010000009.1 GCA027683585_03059 gene open 6137-7534
5058 JAQCXO010000009.1 GCA027683585_03060 gene open 7640-8857 pepT
5059 JAQCXO010000009.1 GCA027683585_03061 gene open 9133-10128
5060 JAQCXO010000009.1 GCA027683585_03062 gene open 10282-11361 pfkA
5061 JAQCXO010000009.1 GCA027683585_03065 gene open 11917-12567
5062 JAQCXO010000009.1 GCA027683585_03066 gene open 12583-13110 queT
5063 JAQCXO010000009.1 GCA027683585_03067 gene open 13452-14039 rutF
5064 JAQCXO010000009.1 GCA027683585_03068 gene open 14036-15016
5065 JAQCXO010000009.1 GCA027683585_03069 gene open 15055-15735
5066 JAQCXO010000009.1 GCA027683585_03070 gene open 15923-16972
5067 JAQCXO010000009.1 GCA027683585_03071 gene open 17104-18588
5068 JAQCXO010000009.1 GCA027683585_03072 gene open 18870-19625
5069 JAQCXO010000009.1 GCA027683585_03073 gene open 19622-20527 pfkB
5070 JAQCXO010000009.1 GCA027683585_03074 gene open 20555-22483
5071 JAQCXO010000009.1 GCA027683585_03075 gene open 22747-24240
5072 JAQCXO010000009.1 GCA027683585_03076 gene open 24380-25750
5073 JAQCXO010000009.1 GCA027683585_03077 gene open 25819-27558 ade
5074 JAQCXO010000009.1 GCA027683585_03078 gene open 27740-28510 fdhD
5075 JAQCXO010000009.1 GCA027683585_03079 gene open 28689-29606
5076 JAQCXO010000009.1 GCA027683585_03080 gene open 29629-30273 hybA
5077 JAQCXO010000009.1 GCA027683585_03081 gene open 30286-32442 ydhV
5078 JAQCXO010000009.1 GCA027683585_03082 gene open 32469-33386
5079 JAQCXO010000009.1 GCA027683585_03083 gene open 33828-35066 glp
5080 JAQCXO010000009.1 GCA027683585_03084 gene open 35056-35574 mobB
5081 JAQCXO010000009.1 GCA027683585_03085 gene open 35588-36607 moeA
5082 JAQCXO010000009.1 GCA027683585_03086 gene open 36682-37179 moaC
5083 JAQCXO010000009.1 GCA027683585_03087 gene open 37172-38149 moaA
5084 JAQCXO010000009.1 GCA027683585_03088 gene open 38156-39088 yiiM
5085 JAQCXO010000009.1 GCA027683585_03089 gene open 39163-40047 modA
5086 JAQCXO010000009.1 GCA027683585_03090 gene open 40058-40729 modB
5087 JAQCXO010000009.1 GCA027683585_03091 gene open 40726-41775 potA
5088 JAQCXO010000009.1 GCA027683585_03092 gene open 41919-42266
5089 JAQCXO010000009.1 GCA027683585_03093 gene open 42272-43525
5090 JAQCXO010000009.1 GCA027683585_03094 gene open 43518-44963 lhgO
5091 JAQCXO010000009.1 GCA027683585_03095 gene open 45204-45770
5092 JAQCXO010000009.1 GCA027683585_03096 gene open 45806-47023 yxeP
5093 JAQCXO010000009.1 GCA027683585_03097 gene open 47107-49947 secA
5094 JAQCXO010000009.1 GCA027683585_03098 gene open 50213-51049
5095 JAQCXO010000009.1 GCA027683585_03099 gene open 51206-51460 rpsO
5096 JAQCXO010000009.1 GCA027683585_03100 gene open 51671-53812 pnp
5097 JAQCXO010000009.1 GCA027683585_03101 gene open 53969-54835
5098 JAQCXO010000009.1 GCA027683585_03102 gene open 54822-55667
5099 JAQCXO010000009.1 GCA027683585_03103 gene open 55748-57214
5100 JAQCXO010000009.1 GCA027683585_03104 gene open 57364-62364
5101 JAQCXO010000009.1 GCA027683585_03105 gene open 62387-62977 lepB
5102 JAQCXO010000009.1 GCA027683585_03106 gene open 62974-63513
5103 JAQCXO010000009.1 GCA027683585_03107 gene open 63918-64151
5104 JAQCXO010000009.1 GCA027683585_03108 gene open 64198-64653
5105 JAQCXO010000009.1 GCA027683585_03110 gene open 65178-65879 gntR
5106 JAQCXO010000009.1 GCA027683585_03111 gene open 66263-67357 yiaO
5107 JAQCXO010000009.1 GCA027683585_03112 gene open 67529-67984
5108 JAQCXO010000009.1 GCA027683585_03113 gene open 68006-68623
5109 JAQCXO010000009.1 GCA027683585_03114 gene open 68571-69299
5110 JAQCXO010000009.1 GCA027683585_03115 gene open 69384-70181
5111 JAQCXO010000009.1 GCA027683585_03116 gene open 70323-71120
5112 JAQCXO010000009.1 GCA027683585_03117 gene open 71168-72100 rhaS
5113 JAQCXO010000009.1 GCA027683585_03118 gene open 72368-72622
5114 JAQCXO010000009.1 GCA027683585_03119 gene open 72783-73421
5115 JAQCXO010000009.1 GCA027683585_03120 gene open 73836-73991
5116 JAQCXO010000009.1 GCA027683585_03121 gene open 74101-74877 traX
5117 JAQCXO010000009.1 GCA027683585_03122 gene open 75325-78264
5118 JAQCXO010000009.1 GCA027683585_03123 gene open 78345-79661
5119 JAQCXO010000009.1 GCA027683585_03124 gene open 79900-80805
5120 JAQCXO010000009.1 GCA027683585_03125 gene open 80982-83564
5121 JAQCXO010000009.1 GCA027683585_03126 gene open 83826-84725
5122 JAQCXO010000009.1 GCA027683585_03127 gene open 84806-85540
5123 JAQCXO010000009.1 GCA027683585_03128 gene open 85563-86570 tsaD
5124 JAQCXO010000009.1 GCA027683585_03129 gene open 86572-89145 polA
5125 JAQCXO010000009.1 GCA027683585_03130 gene open 89420-89608
5126 JAQCXO010000009.1 GCA027683585_03131 gene open 89720-90061 arsC
5127 JAQCXO010000009.1 GCA027683585_03132 gene open 90164-91072
5128 JAQCXO010000009.1 GCA027683585_03133 gene open 91134-92135 wcaE
5129 JAQCXO010000009.1 GCA027683585_03134 gene open 92358-92735 ydcR
5130 JAQCXO010000009.1 GCA027683585_03135 gene open 92728-93426
5131 JAQCXO010000009.1 GCA027683585_03136 gene open 93420-94238
5132 JAQCXO010000009.1 GCA027683585_03137 gene open 94307-94864
5133 JAQCXO010000009.1 GCA027683585_03138 gene open 95022-95462 asnC
5134 JAQCXO010000009.1 GCA027683585_03139 gene open 95994-97256 hflX
5135 JAQCXO010000009.1 GCA027683585_03140 gene open 97253-97861
5136 JAQCXO010000009.1 GCA027683585_03141 gene open 98013-99797
5137 JAQCXO010000009.1 GCA027683585_03142 gene open 99823-100788
5138 JAQCXO010000009.1 GCA027683585_03143 gene open 100808-102337
5139 JAQCXO010000009.1 GCA027683585_03144 gene open 102334-103320
5140 JAQCXO010000009.1 GCA027683585_03145 gene open 103643-106348 valS
5141 JAQCXO010000009.1 GCA027683585_03146 gene open 106320-106865 vanZ
5142 JAQCXO010000009.1 GCA027683585_03147 gene open 106862-108127 folC
5143 JAQCXO010000009.1 GCA027683585_03148 gene open 108226-108549
5144 JAQCXO010000009.1 GCA027683585_03149 gene open 108546-108986 spoIIAB
5145 JAQCXO010000009.1 GCA027683585_03150 gene open 109008-109682
5146 JAQCXO010000009.1 GCA027683585_03058 gene open 5185-5258 trnR
5147 JAQCXO010000009.1 GCA027683585_03063 gene open 11634-11707 trnQ
5148 JAQCXO010000009.1 GCA027683585_03064 gene open 11739-11814 trnP
5149 JAQCXO010000009.1 GCA027683585_03109 gene open 65064-65137 trnQ
5150 JAQCXO010000009.1 GCA027683585_03152 gene open 111866-111941 trnA
5151 JAQCXO010000009.1 GCA027683585_03153 gene open 111945-112021 trnI
5152 JAQCXO010000009.1 GCA027683585_03058 tRNA open 5185-5258 trnR tRNA-Arg(cct)
5153 JAQCXO010000009.1 GCA027683585_03063 tRNA open 11634-11707 trnQ tRNA-Gln(ctg)
5154 JAQCXO010000009.1 GCA027683585_03064 tRNA open 11739-11814 trnP tRNA-Pro(cgg)
5155 JAQCXO010000009.1 GCA027683585_03109 tRNA open 65064-65137 trnQ tRNA-Gln(ttg)
5156 JAQCXO010000009.1 GCA027683585_03152 tRNA open 111866-111941 trnA tRNA-Ala(tgc)
5157 JAQCXO010000009.1 GCA027683585_03153 tRNA open 111945-112021 trnI tRNA-Ile(gat)
5158 JAQCXO010000010.1 repeat_region open 12088-12496 CRISPR array with 7 repeats of length 20%2C consensus sequence TCCAGCTGGGTCAGCTGGTT and spacer length 43
5159 JAQCXO010000010.1 GCA027683585_00807 CDS open 354-776 _na     140_aa DUF3846 domain-containing protein
5160 JAQCXO010000010.1 GCA027683585_00808 CDS open 840-1766 _na     308_aa ParB-like protein
5161 JAQCXO010000010.1 GCA027683585_00809 CDS open 1723-2559 _na     278_aa Sporulation initiation inhibitor protein Soj
5162 JAQCXO010000010.1 GCA027683585_00810 CDS open 2556-3437 _na     293_aa Replication initiator protein A domain protein
5163 JAQCXO010000010.1 GCA027683585_00811 CDS open 3780-4061 _na     93_aa tnpA IS200/IS605 family transposase
5164 JAQCXO010000010.1 GCA027683585_00812 CDS open 4549-5556 _na     335_aa Helix-turn-helix domain-containing protein
5165 JAQCXO010000010.1 GCA027683585_00813 CDS open 5856-7688 _na     610_aa Xaa-Pro dipeptidyl-peptidase-like domain-containing protein
5166 JAQCXO010000010.1 GCA027683585_00814 CDS open 7811-8137 _na     108_aa Replication initiator A N-terminal domain-containing protein
5167 JAQCXO010000010.1 GCA027683585_00816 CDS open 9201-10703 _na     500_aa leucine-rich repeat domain-containing protein
5168 JAQCXO010000010.1 GCA027683585_00817 CDS open 13438-15966 _na     842_aa Internalin
5169 JAQCXO010000010.1 GCA027683585_00818 CDS open 15983-16492 _na     169_aa Lipoprotein
5170 JAQCXO010000010.1 GCA027683585_00819 CDS open 16523-17539 _na     338_aa 5'-nucleotidase C-terminal domain-containing protein
5171 JAQCXO010000010.1 GCA027683585_00820 CDS open 17570-18019 _na     149_aa ushA Trifunctional nucleotide phosphoesterase protein YfkN
5172 JAQCXO010000010.1 GCA027683585_00821 CDS open 18054-19127 _na     357_aa DUF4367 domain-containing protein
5173 JAQCXO010000010.1 GCA027683585_00822 CDS open 19163-19801 _na     212_aa Gamma-glutamyltranspeptidase
5174 JAQCXO010000010.1 GCA027683585_00823 CDS open 19817-20362 _na     181_aa DUF6935 domain-containing protein
5175 JAQCXO010000010.1 GCA027683585_00824 CDS open 20397-20828 _na     143_aa prgI PrgI family protein
5176 JAQCXO010000010.1 GCA027683585_00825 CDS open 20842-21690 _na     282_aa TPM domain-containing protein
5177 JAQCXO010000010.1 GCA027683585_00826 CDS open 21705-22796 _na     363_aa rPC10 DNA-directed RNA polymerase subunit P
5178 JAQCXO010000010.1 GCA027683585_00827 CDS open 22886-23986 _na     366_aa twin-arginine translocation signal domain-containing protein
5179 JAQCXO010000010.1 GCA027683585_00828 CDS open 24007-24873 _na     288_aa DUF4428 domain-containing protein
5180 JAQCXO010000010.1 GCA027683585_00829 CDS open 24902-26338 _na     478_aa SPFH domain-containing protein
5181 JAQCXO010000010.1 GCA027683585_00830 CDS open 26409-27401 _na     330_aa hypothetical protein
5182 JAQCXO010000010.1 GCA027683585_00831 CDS open 27438-29021 _na     527_aa Acid-shock protein
5183 JAQCXO010000010.1 GCA027683585_00832 CDS open 29041-30564 _na     507_aa Acid-shock protein
5184 JAQCXO010000010.1 GCA027683585_00833 CDS open 30591-31259 _na     222_aa Tat (Twin-arginine translocation) pathway signal sequence
5185 JAQCXO010000010.1 GCA027683585_00834 CDS open 31345-31869 _na     174_aa twin-arginine translocation signal domain-containing protein
5186 JAQCXO010000010.1 GCA027683585_00835 CDS open 32274-33605 _na     443_aa Carbohydrate ABC transporter substrate-binding protein
5187 JAQCXO010000010.1 GCA027683585_00836 CDS open 33638-35170 _na     510_aa luxR Transcriptional regulator%2C LuxR family
5188 JAQCXO010000010.1 GCA027683585_00837 CDS open 35606-38818 _na     1070_aa Stage 0 sporulation A-like protein
5189 JAQCXO010000010.1 GCA027683585_00838 CDS open 39116-39916 _na     266_aa putative oxidoreductase SAV2478
5190 JAQCXO010000010.1 GCA027683585_00839 CDS open 40205-40750 _na     181_aa N-acetyltransferase
5191 JAQCXO010000010.1 GCA027683585_00840 CDS open 40768-41514 _na     248_aa GNAT family N-acetyltransferase
5192 JAQCXO010000010.1 GCA027683585_00841 CDS open 41535-41960 _na     141_aa RNHCP domain-containing protein
5193 JAQCXO010000010.1 GCA027683585_00842 CDS open 42154-42777 _na     207_aa Intercellular adhesion protein R
5194 JAQCXO010000010.1 GCA027683585_00843 CDS open 42965-46219 _na     1084_aa Stage 0 sporulation A-like protein
5195 JAQCXO010000010.1 GCA027683585_00844 CDS open 46591-47310 _na     239_aa 4Fe-4S binding domain protein
5196 JAQCXO010000010.1 GCA027683585_00845 CDS open 47411-48076 _na     221_aa crp Crp/Fnr family transcriptional regulator
5197 JAQCXO010000010.1 GCA027683585_00846 CDS open 48214-49701 _na     495_aa yesM histidine kinase
5198 JAQCXO010000010.1 GCA027683585_00847 CDS open 49698-50489 _na     263_aa yesN Stage 0 sporulation A-like protein
5199 JAQCXO010000010.1 GCA027683585_00848 CDS open 50714-51739 _na     341_aa dctP Extracytoplasmic solute receptor protein yiaO
5200 JAQCXO010000010.1 GCA027683585_00849 CDS open 51751-52305 _na     184_aa dctM 2%2C3-diketo-L-gulonate TRAP transporter small permease protein yiaM
5201 JAQCXO010000010.1 GCA027683585_00850 CDS open 52309-53610 _na     433_aa dctQ TRAP C4-dicarboxylate transport system permease DctM subunit domain-containing protein
5202 JAQCXO010000010.1 GCA027683585_00851 CDS open 53736-54722 _na     328_aa dctP C4-dicarboxylate-binding periplasmic protein
5203 JAQCXO010000010.1 GCA027683585_00852 CDS open 54865-55761 _na     298_aa cmpR HTH-type transcriptional activator CmpR
5204 JAQCXO010000010.1 GCA027683585_00853 CDS open 55878-57269 _na     463_aa yocR Sodium:neurotransmitter symporter family protein
5205 JAQCXO010000010.1 GCA027683585_00854 CDS open 57504-58436 _na     310_aa yfdV putative permeases
5206 JAQCXO010000010.1 GCA027683585_00855 CDS open 58502-59350 _na     282_aa Citrate transporter
5207 JAQCXO010000010.1 GCA027683585_00856 CDS open 59347-59631 _na     94_aa hypothetical protein
5208 JAQCXO010000010.1 GCA027683585_00857 CDS open 59719-59859 _na     46_aa hypothetical protein
5209 JAQCXO010000010.1 GCA027683585_00858 CDS open 59856-60698 _na     280_aa O-methyltransferase domain protein
5210 JAQCXO010000010.1 GCA027683585_00859 CDS open 60787-61269 _na     160_aa Methyltransferase%2C UbiE/COQ5 family
5211 JAQCXO010000010.1 GCA027683585_00860 CDS open 61218-61457 _na     79_aa Methyltransferase family protein
5212 JAQCXO010000010.1 GCA027683585_00861 CDS open 61704-62486 _na     260_aa zupT Zinc transporter ZupT
5213 JAQCXO010000010.1 GCA027683585_00862 CDS open 62777-63613 _na     278_aa hypothetical protein
5214 JAQCXO010000010.1 GCA027683585_00863 CDS open 63734-63940 _na     68_aa YbaK/aminoacyl-tRNA synthetase-associated domain-containing protein
5215 JAQCXO010000010.1 GCA027683585_00864 CDS open 63959-64717 _na     252_aa putative metal-dependent hydrolase
5216 JAQCXO010000010.1 GCA027683585_00865 CDS open 65004-65771 _na     255_aa Ferredoxin
5217 JAQCXO010000010.1 GCA027683585_00866 CDS open 65831-66088 _na     85_aa DUF2007 domain-containing protein
5218 JAQCXO010000010.1 GCA027683585_00867 CDS open 66383-67366 _na     327_aa 1%2C5-anhydro-D-fructose reductase
5219 JAQCXO010000010.1 GCA027683585_00868 CDS open 67569-68222 _na     217_aa nnr1 NAD(P)H-hydrate epimerase
5220 JAQCXO010000010.1 GCA027683585_00869 CDS open 68477-69136 _na     219_aa VWFA domain-containing protein
5221 JAQCXO010000010.1 GCA027683585_00870 CDS open 69228-70283 _na     351_aa ymdB O-acetyl-ADP-ribose deacetylase
5222 JAQCXO010000010.1 GCA027683585_00871 CDS open 70465-70842 _na     125_aa Desulfoferrodoxin
5223 JAQCXO010000010.1 GCA027683585_00872 CDS open 70955-71170 _na     71_aa HFLK protein
5224 JAQCXO010000010.1 GCA027683585_00873 CDS open 71268-71765 _na     165_aa YolD-like protein
5225 JAQCXO010000010.1 GCA027683585_00874 CDS open 71746-73263 _na     505_aa dinP DNA methylase
5226 JAQCXO010000010.1 GCA027683585_00875 CDS open 73434-75488 _na     684_aa yicI Alpha-xylosidase
5227 JAQCXO010000010.1 GCA027683585_00876 CDS open 75640-76695 _na     351_aa pilZ PilZ domain-containing protein
5228 JAQCXO010000010.1 GCA027683585_00877 CDS open 76841-77656 _na     271_aa menH 3-oxoadipate enol-lactonase 2
5229 JAQCXO010000010.1 GCA027683585_00878 CDS open 77807-78346 _na     179_aa sigma-70 family RNA polymerase sigma factor
5230 JAQCXO010000010.1 GCA027683585_00879 CDS open 78259-79335 _na     358_aa HipA-like C-terminal domain-containing protein
5231 JAQCXO010000010.1 GCA027683585_00880 CDS open 79664-79900 _na     78_aa Transposase
5232 JAQCXO010000010.1 GCA027683585_00881 CDS open 79961-80344 _na     127_aa mazF mRNA interferase
5233 JAQCXO010000010.1 GCA027683585_00882 CDS open 80430-81227 _na     265_aa DUF6551 domain-containing protein
5234 JAQCXO010000010.1 GCA027683585_00883 CDS open 81224-82345 _na     373_aa ParB/Sulfiredoxin domain-containing protein
5235 JAQCXO010000010.1 GCA027683585_00884 CDS open 82326-82568 _na     80_aa Conjugal transfer protein
5236 JAQCXO010000010.1 GCA027683585_00885 CDS open 82641-82853 _na     70_aa Phosphohydrolase
5237 JAQCXO010000010.1 GCA027683585_00886 CDS open 83209-83910 _na     233_aa Tat pathway signal sequence domain protein
5238 JAQCXO010000010.1 GCA027683585_00887 CDS open 83971-84450 _na     159_aa Conjugal transfer protein
5239 JAQCXO010000010.1 GCA027683585_00888 CDS open 84597-85199 _na     200_aa L-2-amino-thiazoline-4-carboxylic acid hydrolase
5240 JAQCXO010000010.1 GCA027683585_00889 CDS open 85206-85838 _na     210_aa L-2-amino-thiazoline-4-carboxylic acid hydrolase
5241 JAQCXO010000010.1 GCA027683585_00890 CDS open 85835-86761 _na     308_aa panE Ketopantoate reductase family protein
5242 JAQCXO010000010.1 GCA027683585_00891 CDS open 86963-87679 _na     238_aa L-2-amino-thiazoline-4-carboxylic acid hydrolase
5243 JAQCXO010000010.1 GCA027683585_00892 CDS open 87676-88539 _na     287_aa gloB putative polyketide biosynthesis zinc-dependent hydrolase BaeB
5244 JAQCXO010000010.1 GCA027683585_00893 CDS open 88549-89157 _na     202_aa ubiE Demethylrebeccamycin-D-glucose O-methyltransferase
5245 JAQCXO010000010.1 GCA027683585_00894 CDS open 89159-89773 _na     204_aa Class I SAM-dependent methyltransferase
5246 JAQCXO010000010.1 GCA027683585_00895 CDS open 90230-90451 _na     73_aa hypothetical protein
5247 JAQCXO010000010.1 GCA027683585_00896 CDS open 90590-91102 _na     170_aa NADH pyrophosphatase
5248 JAQCXO010000010.1 GCA027683585_00897 CDS open 91105-91596 _na     163_aa rnaY HD domain-containing protein
5249 JAQCXO010000010.1 GCA027683585_00898 CDS open 92051-92644 _na     197_aa wbbJ Acetyltransferase
5250 JAQCXO010000010.1 GCA027683585_00899 CDS open 92966-94000 _na     344_aa tdh NADP-dependent alcohol dehydrogenase
5251 JAQCXO010000010.1 GCA027683585_00900 CDS open 94236-94700 _na     154_aa ibpA SHSP domain-containing protein
5252 JAQCXO010000010.1 GCA027683585_00901 CDS open 94925-95269 _na     114_aa pyridoxal-phosphate dependent enzyme
5253 JAQCXO010000010.1 GCA027683585_00902 CDS open 95294-95803 _na     169_aa Alkylhydroperoxidase
5254 JAQCXO010000010.1 GCA027683585_00903 CDS open 96177-97001 _na     274_aa purine-nucleoside phosphorylase
5255 JAQCXO010000010.1 GCA027683585_00904 CDS open 97377-99176 _na     599_aa GmrSD restriction endonucleases N-terminal domain-containing protein
5256 JAQCXO010000010.1 GCA027683585_00905 CDS open 99342-100223 _na     293_aa Phage protein Gp37/Gp68
5257 JAQCXO010000010.1 GCA027683585_00906 CDS open 100238-100399 _na     53_aa hypothetical protein
5258 JAQCXO010000010.1 GCA027683585_00907 CDS open 100480-100932 _na     150_aa pth2 peptidyl-tRNA hydrolase
5259 JAQCXO010000010.1 GCA027683585_00908 CDS open 100945-101532 _na     195_aa dotG Pentapeptide repeat-containing protein
5260 JAQCXO010000010.1 GCA027683585_00909 CDS open 101620-102396 _na     258_aa ybjI Phosphatase YbjI
5261 JAQCXO010000010.1 GCA027683585_00910 CDS open 102381-102842 _na     153_aa ybbK putative conserved protein
5262 JAQCXO010000010.1 GCA027683585_00911 CDS open 102928-103227 _na     99_aa hipB HTH cro/C1-type domain-containing protein
5263 JAQCXO010000010.1 GCA027683585_00912 CDS open 103901-104386 _na     161_aa hypothetical protein
5264 JAQCXO010000010.1 GCA027683585_00913 CDS open 104227-104892 _na     221_aa sfsA DNA/RNA nuclease SfsA
5265 JAQCXO010000010.1 GCA027683585_00914 CDS open 104896-105417 _na     173_aa O-acetyl-ADP-ribose deacetylase
5266 JAQCXO010000010.1 GCA027683585_00915 CDS open 105428-105955 _na     175_aa Isochorismatase family protein
5267 JAQCXO010000010.1 GCA027683585_00807 gene open 354-776
5268 JAQCXO010000010.1 GCA027683585_00808 gene open 840-1766
5269 JAQCXO010000010.1 GCA027683585_00809 gene open 1723-2559
5270 JAQCXO010000010.1 GCA027683585_00810 gene open 2556-3437
5271 JAQCXO010000010.1 GCA027683585_00811 gene open 3780-4061 tnpA
5272 JAQCXO010000010.1 GCA027683585_00812 gene open 4549-5556
5273 JAQCXO010000010.1 GCA027683585_00813 gene open 5856-7688
5274 JAQCXO010000010.1 GCA027683585_00814 gene open 7811-8137
5275 JAQCXO010000010.1 GCA027683585_00816 gene open 9201-10703
5276 JAQCXO010000010.1 GCA027683585_00817 gene open 13438-15966
5277 JAQCXO010000010.1 GCA027683585_00818 gene open 15983-16492
5278 JAQCXO010000010.1 GCA027683585_00819 gene open 16523-17539
5279 JAQCXO010000010.1 GCA027683585_00820 gene open 17570-18019 ushA
5280 JAQCXO010000010.1 GCA027683585_00821 gene open 18054-19127
5281 JAQCXO010000010.1 GCA027683585_00822 gene open 19163-19801
5282 JAQCXO010000010.1 GCA027683585_00823 gene open 19817-20362
5283 JAQCXO010000010.1 GCA027683585_00824 gene open 20397-20828 prgI
5284 JAQCXO010000010.1 GCA027683585_00825 gene open 20842-21690
5285 JAQCXO010000010.1 GCA027683585_00826 gene open 21705-22796 rPC10
5286 JAQCXO010000010.1 GCA027683585_00827 gene open 22886-23986
5287 JAQCXO010000010.1 GCA027683585_00828 gene open 24007-24873
5288 JAQCXO010000010.1 GCA027683585_00829 gene open 24902-26338
5289 JAQCXO010000010.1 GCA027683585_00830 gene open 26409-27401
5290 JAQCXO010000010.1 GCA027683585_00831 gene open 27438-29021
5291 JAQCXO010000010.1 GCA027683585_00832 gene open 29041-30564
5292 JAQCXO010000010.1 GCA027683585_00833 gene open 30591-31259
5293 JAQCXO010000010.1 GCA027683585_00834 gene open 31345-31869
5294 JAQCXO010000010.1 GCA027683585_00835 gene open 32274-33605
5295 JAQCXO010000010.1 GCA027683585_00836 gene open 33638-35170 luxR
5296 JAQCXO010000010.1 GCA027683585_00837 gene open 35606-38818
5297 JAQCXO010000010.1 GCA027683585_00838 gene open 39116-39916
5298 JAQCXO010000010.1 GCA027683585_00839 gene open 40205-40750
5299 JAQCXO010000010.1 GCA027683585_00840 gene open 40768-41514
5300 JAQCXO010000010.1 GCA027683585_00841 gene open 41535-41960
5301 JAQCXO010000010.1 GCA027683585_00842 gene open 42154-42777
5302 JAQCXO010000010.1 GCA027683585_00843 gene open 42965-46219
5303 JAQCXO010000010.1 GCA027683585_00844 gene open 46591-47310
5304 JAQCXO010000010.1 GCA027683585_00845 gene open 47411-48076 crp
5305 JAQCXO010000010.1 GCA027683585_00846 gene open 48214-49701 yesM
5306 JAQCXO010000010.1 GCA027683585_00847 gene open 49698-50489 yesN
5307 JAQCXO010000010.1 GCA027683585_00848 gene open 50714-51739 dctP
5308 JAQCXO010000010.1 GCA027683585_00849 gene open 51751-52305 dctM
5309 JAQCXO010000010.1 GCA027683585_00850 gene open 52309-53610 dctQ
5310 JAQCXO010000010.1 GCA027683585_00851 gene open 53736-54722 dctP
5311 JAQCXO010000010.1 GCA027683585_00852 gene open 54865-55761 cmpR
5312 JAQCXO010000010.1 GCA027683585_00853 gene open 55878-57269 yocR
5313 JAQCXO010000010.1 GCA027683585_00854 gene open 57504-58436 yfdV
5314 JAQCXO010000010.1 GCA027683585_00855 gene open 58502-59350
5315 JAQCXO010000010.1 GCA027683585_00856 gene open 59347-59631
5316 JAQCXO010000010.1 GCA027683585_00857 gene open 59719-59859
5317 JAQCXO010000010.1 GCA027683585_00858 gene open 59856-60698
5318 JAQCXO010000010.1 GCA027683585_00859 gene open 60787-61269
5319 JAQCXO010000010.1 GCA027683585_00860 gene open 61218-61457
5320 JAQCXO010000010.1 GCA027683585_00861 gene open 61704-62486 zupT
5321 JAQCXO010000010.1 GCA027683585_00862 gene open 62777-63613
5322 JAQCXO010000010.1 GCA027683585_00863 gene open 63734-63940
5323 JAQCXO010000010.1 GCA027683585_00864 gene open 63959-64717
5324 JAQCXO010000010.1 GCA027683585_00865 gene open 65004-65771
5325 JAQCXO010000010.1 GCA027683585_00866 gene open 65831-66088
5326 JAQCXO010000010.1 GCA027683585_00867 gene open 66383-67366
5327 JAQCXO010000010.1 GCA027683585_00868 gene open 67569-68222 nnr1
5328 JAQCXO010000010.1 GCA027683585_00869 gene open 68477-69136
5329 JAQCXO010000010.1 GCA027683585_00870 gene open 69228-70283 ymdB
5330 JAQCXO010000010.1 GCA027683585_00871 gene open 70465-70842
5331 JAQCXO010000010.1 GCA027683585_00872 gene open 70955-71170
5332 JAQCXO010000010.1 GCA027683585_00873 gene open 71268-71765
5333 JAQCXO010000010.1 GCA027683585_00874 gene open 71746-73263 dinP
5334 JAQCXO010000010.1 GCA027683585_00875 gene open 73434-75488 yicI
5335 JAQCXO010000010.1 GCA027683585_00876 gene open 75640-76695 pilZ
5336 JAQCXO010000010.1 GCA027683585_00877 gene open 76841-77656 menH
5337 JAQCXO010000010.1 GCA027683585_00878 gene open 77807-78346
5338 JAQCXO010000010.1 GCA027683585_00879 gene open 78259-79335
5339 JAQCXO010000010.1 GCA027683585_00880 gene open 79664-79900
5340 JAQCXO010000010.1 GCA027683585_00881 gene open 79961-80344 mazF
5341 JAQCXO010000010.1 GCA027683585_00882 gene open 80430-81227
5342 JAQCXO010000010.1 GCA027683585_00883 gene open 81224-82345
5343 JAQCXO010000010.1 GCA027683585_00884 gene open 82326-82568
5344 JAQCXO010000010.1 GCA027683585_00885 gene open 82641-82853
5345 JAQCXO010000010.1 GCA027683585_00886 gene open 83209-83910
5346 JAQCXO010000010.1 GCA027683585_00887 gene open 83971-84450
5347 JAQCXO010000010.1 GCA027683585_00888 gene open 84597-85199
5348 JAQCXO010000010.1 GCA027683585_00889 gene open 85206-85838
5349 JAQCXO010000010.1 GCA027683585_00890 gene open 85835-86761 panE
5350 JAQCXO010000010.1 GCA027683585_00891 gene open 86963-87679
5351 JAQCXO010000010.1 GCA027683585_00892 gene open 87676-88539 gloB
5352 JAQCXO010000010.1 GCA027683585_00893 gene open 88549-89157 ubiE
5353 JAQCXO010000010.1 GCA027683585_00894 gene open 89159-89773
5354 JAQCXO010000010.1 GCA027683585_00895 gene open 90230-90451
5355 JAQCXO010000010.1 GCA027683585_00896 gene open 90590-91102
5356 JAQCXO010000010.1 GCA027683585_00897 gene open 91105-91596 rnaY
5357 JAQCXO010000010.1 GCA027683585_00898 gene open 92051-92644 wbbJ
5358 JAQCXO010000010.1 GCA027683585_00899 gene open 92966-94000 tdh
5359 JAQCXO010000010.1 GCA027683585_00900 gene open 94236-94700 ibpA
5360 JAQCXO010000010.1 GCA027683585_00901 gene open 94925-95269
5361 JAQCXO010000010.1 GCA027683585_00902 gene open 95294-95803
5362 JAQCXO010000010.1 GCA027683585_00903 gene open 96177-97001
5363 JAQCXO010000010.1 GCA027683585_00904 gene open 97377-99176
5364 JAQCXO010000010.1 GCA027683585_00905 gene open 99342-100223
5365 JAQCXO010000010.1 GCA027683585_00906 gene open 100238-100399
5366 JAQCXO010000010.1 GCA027683585_00907 gene open 100480-100932 pth2
5367 JAQCXO010000010.1 GCA027683585_00908 gene open 100945-101532 dotG
5368 JAQCXO010000010.1 GCA027683585_00909 gene open 101620-102396 ybjI
5369 JAQCXO010000010.1 GCA027683585_00910 gene open 102381-102842 ybbK
5370 JAQCXO010000010.1 GCA027683585_00911 gene open 102928-103227 hipB
5371 JAQCXO010000010.1 GCA027683585_00912 gene open 103901-104386
5372 JAQCXO010000010.1 GCA027683585_00913 gene open 104227-104892 sfsA
5373 JAQCXO010000010.1 GCA027683585_00914 gene open 104896-105417
5374 JAQCXO010000010.1 GCA027683585_00915 gene open 105428-105955
5375 JAQCXO010000010.1 GCA027683585_00815 gene open 8671-8749 trnA
5376 JAQCXO010000010.1 GCA027683585_00815 tRNA open 8671-8749 trnA tRNA-Ala(cgc)
5377 JAQCXO010000011.1 GCA027683585_00916 gene open 85-201 rrf
5378 JAQCXO010000011.1 regulatory_region open 12020-12128 TPP riboswitch aptamer (THI element)
5379 JAQCXO010000011.1 regulatory_region open 50955-51221 T-box leader
5380 JAQCXO010000011.1 GCA027683585_00916 rRNA open 85-201 rrf 5S ribosomal RNA
5381 JAQCXO010000011.1 GCA027683585_00917 CDS open 313-993 _na     226_aa DUF1287 domain-containing protein
5382 JAQCXO010000011.1 GCA027683585_00918 CDS open 1081-1944 _na     287_aa fba class II fructose-1%2C6-bisphosphate aldolase
5383 JAQCXO010000011.1 GCA027683585_00919 CDS open 2735-3541 _na     268_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
5384 JAQCXO010000011.1 GCA027683585_00920 CDS open 3584-6298 _na     904_aa ompA Cell envelope biogenesis protein OmpA
5385 JAQCXO010000011.1 GCA027683585_00921 CDS open 6365-7750 _na     461_aa Amino acid carrier protein
5386 JAQCXO010000011.1 GCA027683585_00922 CDS open 8010-9320 _na     436_aa thiC phosphomethylpyrimidine synthase ThiC
5387 JAQCXO010000011.1 GCA027683585_00923 CDS open 9779-10417 _na     212_aa Thiamine-phosphate synthase
5388 JAQCXO010000011.1 GCA027683585_00924 CDS open 10404-11225 _na     273_aa thiM hydroxyethylthiazole kinase
5389 JAQCXO010000011.1 GCA027683585_00925 CDS open 11241-11756 _na     171_aa thiW energy coupling factor transporter S component ThiW
5390 JAQCXO010000011.1 GCA027683585_00926 CDS open 12648-15083 _na     811_aa Cellobiose phosphorylase
5391 JAQCXO010000011.1 GCA027683585_00927 CDS open 15611-16618 _na     335_aa Ribose operon repressor
5392 JAQCXO010000011.1 GCA027683585_00928 CDS open 16697-18142 _na     481_aa ugpB ABC transporter substrate-binding protein
5393 JAQCXO010000011.1 GCA027683585_00929 CDS open 18123-19217 _na     364_aa ugpA sn-glycerol-3-phosphate transport system permease protein ugpA
5394 JAQCXO010000011.1 GCA027683585_00930 CDS open 19220-20086 _na     288_aa ugpE Inner membrane ABC transporter permease protein ycjP
5395 JAQCXO010000011.1 GCA027683585_00931 CDS open 20178-20588 _na     136_aa peptide deformylase
5396 JAQCXO010000011.1 GCA027683585_00932 CDS open 20602-21882 _na     426_aa brnQ branched-chain amino acid transport system II carrier protein
5397 JAQCXO010000011.1 GCA027683585_00933 CDS open 22094-22864 _na     256_aa Nitrate ABC transporter permease
5398 JAQCXO010000011.1 GCA027683585_00934 CDS open 22858-23436 _na     192_aa fbpC Fe(3+) ions import ATP-binding protein FbpC
5399 JAQCXO010000011.1 GCA027683585_00935 CDS open 23500-24717 _na     405_aa Cell division protein
5400 JAQCXO010000011.1 GCA027683585_00936 CDS open 24964-26175 _na     403_aa Gingipain domain-containing protein
5401 JAQCXO010000011.1 GCA027683585_00937 CDS open 26261-26686 _na     141_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
5402 JAQCXO010000011.1 GCA027683585_00938 CDS open 26683-27393 _na     236_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
5403 JAQCXO010000011.1 GCA027683585_00939 CDS open 27435-27881 _na     148_aa rpiB ribose 5-phosphate isomerase B
5404 JAQCXO010000011.1 GCA027683585_00940 CDS open 28022-28648 _na     208_aa upp uracil phosphoribosyltransferase
5405 JAQCXO010000011.1 GCA027683585_00941 CDS open 28842-30170 _na     442_aa norM putative multidrug resistance protein NorM
5406 JAQCXO010000011.1 GCA027683585_00942 CDS open 30208-31119 _na     303_aa Cysteine synthase
5407 JAQCXO010000011.1 GCA027683585_00943 CDS open 31346-31729 _na     127_aa UPF0122 protein C4N21_06030
5408 JAQCXO010000011.1 GCA027683585_00944 CDS open 31756-33111 _na     451_aa ffh signal recognition particle protein
5409 JAQCXO010000011.1 GCA027683585_00945 CDS open 33181-33423 _na     80_aa rpsP 30S ribosomal protein S16
5410 JAQCXO010000011.1 GCA027683585_00946 CDS open 33441-33674 _na     77_aa ylqC RNA-binding protein KhpA
5411 JAQCXO010000011.1 GCA027683585_00947 CDS open 33897-34433 _na     178_aa rimM Ribosome maturation factor RimM
5412 JAQCXO010000011.1 GCA027683585_00948 CDS open 34437-35684 _na     415_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
5413 JAQCXO010000011.1 GCA027683585_00949 CDS open 35967-36230 _na     87_aa ptsH Phosphocarrier protein HPr
5414 JAQCXO010000011.1 GCA027683585_00950 CDS open 36357-38207 _na     616_aa uvrC excinuclease ABC subunit UvrC
5415 JAQCXO010000011.1 GCA027683585_00951 CDS open 38263-39363 _na     366_aa DUF1700 domain-containing protein
5416 JAQCXO010000011.1 GCA027683585_00952 CDS open 39367-39684 _na     105_aa Lineage-specific thermal regulator protein
5417 JAQCXO010000011.1 GCA027683585_00953 CDS open 39905-40732 _na     275_aa Amino acid ABC transporter substrate-binding protein%2C PAAT family (TC 3-A1-3-)
5418 JAQCXO010000011.1 GCA027683585_00954 CDS open 40781-41581 _na     266_aa tcyC L-cystine import ATP-binding protein TcyC
5419 JAQCXO010000011.1 GCA027683585_00955 CDS open 41600-42283 _na     227_aa tcyB L-cystine transport system permease protein tcyB
5420 JAQCXO010000011.1 GCA027683585_00956 CDS open 42647-43681 _na     344_aa Glycerol-3-phosphate dehydrogenase [NAD(P)+]
5421 JAQCXO010000011.1 GCA027683585_00957 CDS open 43908-44705 _na     265_aa Phospholipase C/D domain-containing protein
5422 JAQCXO010000011.1 GCA027683585_00958 CDS open 44748-46004 _na     418_aa Permeases of the major facilitator superfamily
5423 JAQCXO010000011.1 GCA027683585_00959 CDS open 46531-47820 _na     429_aa mET17 Methionine gamma-lyase
5424 JAQCXO010000011.1 GCA027683585_00960 CDS open 47998-48612 _na     204_aa iclR Transcriptional regulator%2C IclR family protein
5425 JAQCXO010000011.1 GCA027683585_00961 CDS open 48785-50635 _na     616_aa ftsH ATP-dependent zinc metalloprotease FtsH
5426 JAQCXO010000011.1 GCA027683585_00962 CDS open 51431-53083 _na     550_aa leuA 2-isopropylmalate synthase
5427 JAQCXO010000011.1 GCA027683585_00963 CDS open 53100-54359 _na     419_aa leuC 3-isopropylmalate dehydratase large subunit
5428 JAQCXO010000011.1 GCA027683585_00964 CDS open 54378-54860 _na     160_aa leuD 3-isopropylmalate dehydratase small subunit
5429 JAQCXO010000011.1 GCA027683585_00965 CDS open 55147-56220 _na     357_aa leuB 3-isopropylmalate dehydrogenase
5430 JAQCXO010000011.1 GCA027683585_00966 CDS open 56300-57064 _na     254_aa artM Arginine transport ATP-binding protein ArtM
5431 JAQCXO010000011.1 GCA027683585_00967 CDS open 57054-57818 _na     254_aa hisM Amino acid ABC transporter permease
5432 JAQCXO010000011.1 GCA027683585_00968 CDS open 57931-58767 _na     278_aa ABC transporter substrate-binding protein
5433 JAQCXO010000011.1 GCA027683585_00969 CDS open 58976-59551 _na     191_aa Nitroreductase
5434 JAQCXO010000011.1 GCA027683585_00970 CDS open 59769-60386 _na     205_aa Twin-arginine translocation signal domain-containing protein
5435 JAQCXO010000011.1 GCA027683585_00971 CDS open 60796-61245 _na     149_aa thrE Threonine/Serine exporter ThrE domain-containing protein
5436 JAQCXO010000011.1 GCA027683585_00972 CDS open 61242-62033 _na     263_aa Threonine/serine exporter-like N-terminal domain-containing protein
5437 JAQCXO010000011.1 GCA027683585_00973 CDS open 62920-63822 _na     300_aa 29 kDa protein
5438 JAQCXO010000011.1 GCA027683585_00974 CDS open 63841-64854 _na     337_aa abcC ATP-binding cassette domain-containing protein
5439 JAQCXO010000011.1 GCA027683585_00975 CDS open 64851-65507 _na     218_aa metP D-methionine transport system permease protein metI
5440 JAQCXO010000011.1 GCA027683585_00976 CDS open 65601-66875 _na     424_aa mET17 Methionine gamma-lyase
5441 JAQCXO010000011.1 GCA027683585_00977 CDS open 66972-67907 _na     311_aa metA homoserine O-succinyltransferase
5442 JAQCXO010000011.1 GCA027683585_00978 CDS open 68076-68948 _na     290_aa degV DegV family protein
5443 JAQCXO010000011.1 GCA027683585_00979 CDS open 68957-69463 _na     168_aa trmL Putative tRNA (cytidine(34)-2'-O)-methyltransferase
5444 JAQCXO010000011.1 GCA027683585_00980 CDS open 69460-70308 _na     282_aa pyridoxal kinase
5445 JAQCXO010000011.1 GCA027683585_00981 CDS open 70473-70679 _na     68_aa ytxH YtxH domain-containing protein
5446 JAQCXO010000011.1 GCA027683585_00982 CDS open 70730-71203 _na     157_aa Pilin
5447 JAQCXO010000011.1 GCA027683585_00983 CDS open 71430-72983 _na     517_aa nar1 Iron hydrogenase 1
5448 JAQCXO010000011.1 GCA027683585_00984 CDS open 73229-74524 _na     431_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
5449 JAQCXO010000011.1 GCA027683585_00985 CDS open 74705-75040 _na     111_aa Twin-arginine translocation signal domain-containing protein
5450 JAQCXO010000011.1 GCA027683585_00986 CDS open 75268-76500 _na     410_aa serine-type D-Ala-D-Ala carboxypeptidase
5451 JAQCXO010000011.1 GCA027683585_00987 CDS open 76726-78057 _na     443_aa pgi glucose-6-phosphate isomerase
5452 JAQCXO010000011.1 GCA027683585_00988 CDS open 78120-78524 _na     134_aa pilT Twitching motility protein PilT
5453 JAQCXO010000011.1 GCA027683585_00989 CDS open 78670-79173 _na     167_aa putative metal-binding%2C possibly nucleic acid-binding protein
5454 JAQCXO010000011.1 GCA027683585_00990 CDS open 79197-79376 _na     59_aa rpmF 50S ribosomal protein L32
5455 JAQCXO010000011.1 GCA027683585_00991 CDS open 79469-80806 _na     445_aa Fe-S oxidoreductase%2C related to NifB/MoaA family
5456 JAQCXO010000011.1 GCA027683585_00992 CDS open 80857-82200 _na     447_aa der ribosome biogenesis GTPase Der
5457 JAQCXO010000011.1 GCA027683585_00993 CDS open 82219-82881 _na     220_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
5458 JAQCXO010000011.1 GCA027683585_00994 CDS open 82948-83478 _na     176_aa Transporter
5459 JAQCXO010000011.1 GCA027683585_00995 CDS open 83566-84570 _na     334_aa Tat pathway signal sequence domain protein
5460 JAQCXO010000011.1 GCA027683585_00996 CDS open 84588-86216 _na     542_aa DUF5046 domain-containing protein
5461 JAQCXO010000011.1 GCA027683585_00997 CDS open 86338-87726 _na     462_aa mepA Multidrug export protein MepA
5462 JAQCXO010000011.1 GCA027683585_00998 CDS open 88006-88860 _na     284_aa Ricin-type beta-trefoil lectin domain
5463 JAQCXO010000011.1 GCA027683585_00999 CDS open 88931-89821 _na     296_aa DUF4825 domain-containing protein
5464 JAQCXO010000011.1 GCA027683585_01001 CDS open 90296-91315 _na     339_aa lldD L-lactate oxidase
5465 JAQCXO010000011.1 GCA027683585_01002 CDS open 91480-92430 _na     316_aa rluA Pseudouridine synthase%2C RluA family
5466 JAQCXO010000011.1 GCA027683585_01003 CDS open 92535-93251 _na     238_aa Lipoprotein
5467 JAQCXO010000011.1 GCA027683585_01004 CDS open 93678-96338 _na     886_aa alaS alanine--tRNA ligase
5468 JAQCXO010000011.1 GCA027683585_01005 CDS open 96417-96749 _na     110_aa hinT Purine nucleoside phosphoramidase
5469 JAQCXO010000011.1 GCA027683585_01006 CDS open 96777-97316 _na     179_aa apt Adenine phosphoribosyltransferase
5470 JAQCXO010000011.1 GCA027683585_01007 CDS open 97407-99446 _na     679_aa ComEC/Rec2-like protein
5471 JAQCXO010000011.1 GCA027683585_01008 CDS open 99515-100543 _na     342_aa holA DNA polymerase III subunit delta
5472 JAQCXO010000011.1 GCA027683585_01009 CDS open 100540-101154 _na     204_aa DUF4093 domain-containing protein
5473 JAQCXO010000011.1 GCA027683585_01010 CDS open 101158-101841 _na     227_aa RNA polymerase sigma factor
5474 JAQCXO010000011.1 GCA027683585_01011 CDS open 101988-102728 _na     246_aa Alpha/beta fold hydrolase
5475 JAQCXO010000011.1 GCA027683585_01012 CDS open 102842-103279 _na     145_aa marR Radical SAM mobile pair system MarR family transcriptional regulator
5476 JAQCXO010000011.1 GCA027683585_01013 CDS open 103417-104106 _na     229_aa radical SAM mobile pair protein A
5477 JAQCXO010000011.1 GCA027683585_00917 gene open 313-993
5478 JAQCXO010000011.1 GCA027683585_00918 gene open 1081-1944 fba
5479 JAQCXO010000011.1 GCA027683585_00919 gene open 2735-3541 rlmB
5480 JAQCXO010000011.1 GCA027683585_00920 gene open 3584-6298 ompA
5481 JAQCXO010000011.1 GCA027683585_00921 gene open 6365-7750
5482 JAQCXO010000011.1 GCA027683585_00922 gene open 8010-9320 thiC
5483 JAQCXO010000011.1 GCA027683585_00923 gene open 9779-10417
5484 JAQCXO010000011.1 GCA027683585_00924 gene open 10404-11225 thiM
5485 JAQCXO010000011.1 GCA027683585_00925 gene open 11241-11756 thiW
5486 JAQCXO010000011.1 GCA027683585_00926 gene open 12648-15083
5487 JAQCXO010000011.1 GCA027683585_00927 gene open 15611-16618
5488 JAQCXO010000011.1 GCA027683585_00928 gene open 16697-18142 ugpB
5489 JAQCXO010000011.1 GCA027683585_00929 gene open 18123-19217 ugpA
5490 JAQCXO010000011.1 GCA027683585_00930 gene open 19220-20086 ugpE
5491 JAQCXO010000011.1 GCA027683585_00931 gene open 20178-20588
5492 JAQCXO010000011.1 GCA027683585_00932 gene open 20602-21882 brnQ
5493 JAQCXO010000011.1 GCA027683585_00933 gene open 22094-22864
5494 JAQCXO010000011.1 GCA027683585_00934 gene open 22858-23436 fbpC
5495 JAQCXO010000011.1 GCA027683585_00935 gene open 23500-24717
5496 JAQCXO010000011.1 GCA027683585_00936 gene open 24964-26175
5497 JAQCXO010000011.1 GCA027683585_00937 gene open 26261-26686 tsaE
5498 JAQCXO010000011.1 GCA027683585_00938 gene open 26683-27393 tsaB
5499 JAQCXO010000011.1 GCA027683585_00939 gene open 27435-27881 rpiB
5500 JAQCXO010000011.1 GCA027683585_00940 gene open 28022-28648 upp