HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium pseudodiphtheriticum (GCA_028527665.1)

Select a Genome:
BAKTA Annotations for GCA_028527665.1
Genome Selected: Corynebacterium pseudodiphtheriticum
ContigsBases CDSrRNA tmRNAtRNA
30 2288602 2055 3 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4224 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 4224 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 JAQPSI010000002.1 GCA028527665_00930 gene open 139402-140436
1002 JAQPSI010000002.1 GCA028527665_00931 gene open 140481-141917 aldA
1003 JAQPSI010000002.1 GCA028527665_00932 gene open 141965-142849
1004 JAQPSI010000002.1 GCA028527665_00933 gene open 142850-143665
1005 JAQPSI010000002.1 GCA028527665_00934 gene open 143710-144495
1006 JAQPSI010000002.1 GCA028527665_00935 gene open 144601-145374 iclR
1007 JAQPSI010000002.1 GCA028527665_00936 gene open 145628-146917
1008 JAQPSI010000002.1 GCA028527665_00937 gene open 146985-148367 fucP
1009 JAQPSI010000002.1 GCA028527665_00938 gene open 148370-148795 fucU
1010 JAQPSI010000002.1 GCA028527665_00939 gene open 148952-149998 hisC
1011 JAQPSI010000002.1 GCA028527665_00940 gene open 150033-151373
1012 JAQPSI010000002.1 GCA028527665_00941 gene open 151510-153249
1013 JAQPSI010000002.1 GCA028527665_00942 gene open 153550-154161
1014 JAQPSI010000002.1 GCA028527665_00943 gene open 154318-155523
1015 JAQPSI010000002.1 GCA028527665_00944 gene open 155639-156700
1016 JAQPSI010000002.1 GCA028527665_00945 gene open 156742-158367
1017 JAQPSI010000002.1 GCA028527665_00946 gene open 158396-160039
1018 JAQPSI010000002.1 GCA028527665_00947 gene open 160297-163575
1019 JAQPSI010000002.1 GCA028527665_00948 gene open 163724-163912
1020 JAQPSI010000002.1 GCA028527665_00949 gene open 163983-164270
1021 JAQPSI010000002.1 GCA028527665_00950 gene open 164332-164784
1022 JAQPSI010000002.1 GCA028527665_00951 gene open 164781-165308
1023 JAQPSI010000002.1 GCA028527665_00952 gene open 165348-165542
1024 JAQPSI010000002.1 GCA028527665_00953 gene open 165493-166284
1025 JAQPSI010000002.1 GCA028527665_00954 gene open 166386-166841
1026 JAQPSI010000002.1 GCA028527665_00955 gene open 166971-167120
1027 JAQPSI010000002.1 GCA028527665_00956 gene open 167388-167792
1028 JAQPSI010000002.1 GCA028527665_00957 gene open 167844-168641
1029 JAQPSI010000002.1 GCA028527665_00958 gene open 168638-170437
1030 JAQPSI010000002.1 GCA028527665_00959 gene open 170593-171393
1031 JAQPSI010000002.1 GCA028527665_00960 gene open 171486-172238
1032 JAQPSI010000002.1 GCA028527665_00961 gene open 172308-172571
1033 JAQPSI010000002.1 GCA028527665_00962 gene open 172791-175328
1034 JAQPSI010000002.1 GCA028527665_00963 gene open 175344-176132
1035 JAQPSI010000002.1 GCA028527665_00964 gene open 176183-177193
1036 JAQPSI010000002.1 GCA028527665_00965 gene open 177206-177643
1037 JAQPSI010000002.1 GCA028527665_00966 gene open 177819-178427
1038 JAQPSI010000002.1 GCA028527665_00967 gene open 178593-179042
1039 JAQPSI010000002.1 GCA028527665_00968 gene open 179039-180619
1040 JAQPSI010000002.1 GCA028527665_00969 gene open 180616-181086
1041 JAQPSI010000002.1 GCA028527665_00970 gene open 181101-181961
1042 JAQPSI010000002.1 GCA028527665_00971 gene open 181951-182367
1043 JAQPSI010000002.1 GCA028527665_00972 gene open 182417-183808
1044 JAQPSI010000002.1 GCA028527665_00973 gene open 183795-184316
1045 JAQPSI010000002.1 GCA028527665_00974 gene open 184346-185449
1046 JAQPSI010000002.1 GCA028527665_00975 gene open 185571-186689
1047 JAQPSI010000002.1 GCA028527665_00976 gene open 186932-188284
1048 JAQPSI010000002.1 GCA028527665_00977 gene open 188601-190817
1049 JAQPSI010000002.1 GCA028527665_00978 gene open 190923-192278
1050 JAQPSI010000002.1 GCA028527665_00979 gene open 192328-193263
1051 JAQPSI010000002.1 GCA028527665_00980 gene open 193361-194140
1052 JAQPSI010000002.1 GCA028527665_00981 gene open 194196-194387
1053 JAQPSI010000002.1 GCA028527665_00982 gene open 194495-195526 trpS
1054 JAQPSI010000002.1 GCA028527665_00983 gene open 195693-196781 yhjD
1055 JAQPSI010000002.1 GCA028527665_00984 gene open 196850-198253
1056 JAQPSI010000002.1 GCA028527665_00985 gene open 198408-199472
1057 JAQPSI010000002.1 GCA028527665_00986 gene open 199469-200719
1058 JAQPSI010000002.1 GCA028527665_00987 gene open 200852-201868
1059 JAQPSI010000002.1 GCA028527665_00988 gene open 201881-202252
1060 JAQPSI010000002.1 GCA028527665_00989 gene open 202333-202977 upp
1061 JAQPSI010000002.1 GCA028527665_00990 gene open 203196-203657
1062 JAQPSI010000002.1 GCA028527665_00991 gene open 203765-204955
1063 JAQPSI010000002.1 GCA028527665_00992 gene open 205137-206564
1064 JAQPSI010000002.1 GCA028527665_00993 gene open 206730-210158
1065 JAQPSI010000002.1 GCA028527665_00994 gene open 210190-211296
1066 JAQPSI010000002.1 GCA028527665_00995 gene open 211542-212042
1067 JAQPSI010000002.1 GCA028527665_00996 gene open 212102-213880
1068 JAQPSI010000002.1 GCA028527665_00997 gene open 214062-214952
1069 JAQPSI010000002.1 GCA028527665_00998 gene open 215025-216227
1070 JAQPSI010000002.1 GCA028527665_00999 gene open 216245-216727
1071 JAQPSI010000002.1 GCA028527665_01000 gene open 216787-217473
1072 JAQPSI010000002.1 GCA028527665_01001 gene open 217418-217621
1073 JAQPSI010000002.1 GCA028527665_01002 gene open 217668-219260
1074 JAQPSI010000002.1 GCA028527665_01003 gene open 219313-219531
1075 JAQPSI010000002.1 GCA028527665_01004 gene open 219585-221204
1076 JAQPSI010000002.1 GCA028527665_01005 gene open 221351-221524
1077 JAQPSI010000002.1 GCA028527665_01006 gene open 221530-222402
1078 JAQPSI010000002.1 GCA028527665_01007 gene open 222403-223461
1079 JAQPSI010000002.1 GCA028527665_01008 gene open 223463-224797
1080 JAQPSI010000002.1 GCA028527665_01009 gene open 224959-226080
1081 JAQPSI010000002.1 GCA028527665_01010 gene open 226113-226862
1082 JAQPSI010000002.1 GCA028527665_01011 gene open 226862-227377
1083 JAQPSI010000002.1 GCA028527665_01012 gene open 227459-228784
1084 JAQPSI010000002.1 GCA028527665_01013 gene open 228861-229409
1085 JAQPSI010000002.1 GCA028527665_01014 gene open 229593-230588
1086 JAQPSI010000002.1 GCA028527665_01015 gene open 230648-232273
1087 JAQPSI010000002.1 GCA028527665_01016 gene open 232548-233864
1088 JAQPSI010000002.1 GCA028527665_01017 gene open 233892-235421 nikD
1089 JAQPSI010000002.1 GCA028527665_01018 gene open 235418-236254
1090 JAQPSI010000002.1 GCA028527665_01019 gene open 236251-237105
1091 JAQPSI010000002.1 GCA028527665_01020 gene open 237083-237214
1092 JAQPSI010000002.1 GCA028527665_01021 gene open 237211-238743
1093 JAQPSI010000002.1 GCA028527665_01022 gene open 238774-239826
1094 JAQPSI010000002.1 GCA028527665_01023 gene open 239924-241327 brnQ
1095 JAQPSI010000002.1 GCA028527665_01024 gene open 241434-242630
1096 JAQPSI010000002.1 GCA028527665_01025 gene open 242687-244549
1097 JAQPSI010000002.1 GCA028527665_01026 gene open 244832-245395
1098 JAQPSI010000002.1 GCA028527665_01027 gene open 245485-246816
1099 JAQPSI010000002.1 GCA028527665_01028 gene open 246820-247584
1100 JAQPSI010000002.1 GCA028527665_01029 gene open 247590-249236
1101 JAQPSI010000002.1 GCA028527665_01030 gene open 249998-250357
1102 JAQPSI010000002.1 GCA028527665_01031 gene open 250302-251051
1103 JAQPSI010000002.1 GCA028527665_00799 gene open 4312-4384 trnT
1104 JAQPSI010000002.1 GCA028527665_00800 gene open 4428-4499 trnM
1105 JAQPSI010000002.1 GCA028527665_00801 gene open 4619-4694 trnW
1106 JAQPSI010000002.1 GCA028527665_00799 tRNA open 4312-4384 trnT tRNA-Thr(ggt)
1107 JAQPSI010000002.1 GCA028527665_00800 tRNA open 4428-4499 trnM tRNA-Met(cat)
1108 JAQPSI010000002.1 GCA028527665_00801 tRNA open 4619-4694 trnW tRNA-Trp(cca)
1109 JAQPSI010000003.1 GCA028527665_01137 gene open 71200-71294 Bacteria_small_SRP
1110 JAQPSI010000003.1 GCA028527665_01137 ncRNA open 71200-71294 Bacterial small signal recognition particle RNA
1111 JAQPSI010000003.1 repeat_region open 161572-161810 CRISPR array with 4 repeats of length 36%2C consensus sequence GCTGGGGTTCAGTTCTCATTACCCCTGATATACTTC and spacer length 28
1112 JAQPSI010000003.1 GCA028527665_01072 CDS open 75-1013 _na     312_aa squalene/phytoene synthase family protein
1113 JAQPSI010000003.1 GCA028527665_01073 CDS open 1010-2707 _na     565_aa Amine oxidase domain-containing protein
1114 JAQPSI010000003.1 GCA028527665_01074 CDS open 2718-3722 _na     334_aa Pseudouridine synthase RsuA/RluA-like domain-containing protein
1115 JAQPSI010000003.1 GCA028527665_01075 CDS open 4102-4998 _na     298_aa uspA UspA domain-containing protein
1116 JAQPSI010000003.1 GCA028527665_01076 CDS open 5002-5259 _na     85_aa GlsB/YeaQ/YmgE family stress response membrane protein
1117 JAQPSI010000003.1 GCA028527665_01077 CDS open 5448-6074 _na     208_aa HTH tetR-type domain-containing protein
1118 JAQPSI010000003.1 GCA028527665_01078 CDS open 6071-7333 _na     420_aa yidC Membrane protein insertase YidC
1119 JAQPSI010000003.1 GCA028527665_01079 CDS open 7443-8765 _na     440_aa Histidine kinase domain-containing protein
1120 JAQPSI010000003.1 GCA028527665_01080 CDS open 8819-9457 _na     212_aa Response regulatory domain-containing protein
1121 JAQPSI010000003.1 GCA028527665_01081 CDS open 9467-10102 _na     211_aa DUF6474 domain-containing protein
1122 JAQPSI010000003.1 GCA028527665_01082 CDS open 10189-11859 _na     556_aa yprB YprB ribonuclease H-like domain-containing protein
1123 JAQPSI010000003.1 GCA028527665_01083 CDS open 11860-13074 _na     404_aa Major facilitator superfamily (MFS) profile domain-containing protein
1124 JAQPSI010000003.1 GCA028527665_01084 CDS open 13261-14001 _na     246_aa ABC transporter ATP-binding protein
1125 JAQPSI010000003.1 GCA028527665_01085 CDS open 14012-15382 _na     456_aa ABC transporter permease
1126 JAQPSI010000003.1 GCA028527665_01086 CDS open 15671-15784 _na     37_aa hypothetical protein
1127 JAQPSI010000003.1 GCA028527665_01087 CDS open 15989-16279 _na     96_aa transposase
1128 JAQPSI010000003.1 GCA028527665_01088 CDS open 16463-16684 _na     73_aa DDE-type integrase/transposase/recombinase
1129 JAQPSI010000003.1 GCA028527665_01089 CDS open 17173-17574 _na     133_aa Major facilitator superfamily (MFS) profile domain-containing protein
1130 JAQPSI010000003.1 GCA028527665_01090 CDS open 17717-18319 _na     200_aa Superoxide dismutase
1131 JAQPSI010000003.1 GCA028527665_01091 CDS open 18435-18527 _na     30_aa hypothetical protein
1132 JAQPSI010000003.1 GCA028527665_01092 CDS open 18514-19170 _na     218_aa msrA Peptide methionine sulfoxide reductase MsrA
1133 JAQPSI010000003.1 GCA028527665_01093 CDS open 19216-19941 _na     241_aa GP-PDE domain-containing protein
1134 JAQPSI010000003.1 GCA028527665_01094 CDS open 20046-20468 _na     140_aa rhuM RhuM family protein
1135 JAQPSI010000003.1 GCA028527665_01095 CDS open 20417-20890 _na     157_aa rhuM RhuM family protein
1136 JAQPSI010000003.1 GCA028527665_01096 CDS open 20972-21892 _na     306_aa DUF5926 domain-containing protein
1137 JAQPSI010000003.1 GCA028527665_01097 CDS open 22011-23099 _na     362_aa NADH:flavin oxidoreductase/NADH oxidase N-terminal domain-containing protein
1138 JAQPSI010000003.1 GCA028527665_01098 CDS open 23147-25033 _na     628_aa Cell envelope-related transcriptional attenuator domain-containing protein
1139 JAQPSI010000003.1 GCA028527665_01099 CDS open 25094-26110 _na     338_aa amidase
1140 JAQPSI010000003.1 GCA028527665_01100 CDS open 26195-27166 _na     323_aa pheA prephenate dehydratase
1141 JAQPSI010000003.1 GCA028527665_01101 CDS open 27169-27822 _na     217_aa Phosphoglycerate mutase
1142 JAQPSI010000003.1 GCA028527665_01102 CDS open 27869-28216 _na     115_aa Metallopeptidase family protein
1143 JAQPSI010000003.1 GCA028527665_01103 CDS open 28276-29262 _na     328_aa Septum formation-related domain-containing protein
1144 JAQPSI010000003.1 GCA028527665_01104 CDS open 29280-30593 _na     437_aa serS serine--tRNA ligase
1145 JAQPSI010000003.1 GCA028527665_01105 CDS open 30590-31486 _na     298_aa Phospholipid/glycerol acyltransferase domain-containing protein
1146 JAQPSI010000003.1 GCA028527665_01106 CDS open 31504-32337 _na     277_aa Cof-like hydrolase
1147 JAQPSI010000003.1 GCA028527665_01107 CDS open 32345-33910 _na     521_aa glpK glycerol kinase GlpK
1148 JAQPSI010000003.1 GCA028527665_01108 CDS open 33907-36057 _na     716_aa Peptidoglycan recognition protein family domain-containing protein
1149 JAQPSI010000003.1 GCA028527665_01109 CDS open 36350-37540 _na     396_aa glf UDP-galactopyranose mutase
1150 JAQPSI010000003.1 GCA028527665_01110 CDS open 37635-39569 _na     644_aa Glycosyltransferase
1151 JAQPSI010000003.1 GCA028527665_01111 CDS open 39559-40089 _na     176_aa Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
1152 JAQPSI010000003.1 GCA028527665_01112 CDS open 40090-41073 _na     327_aa decaprenyl-phosphate phosphoribosyltransferase
1153 JAQPSI010000003.1 GCA028527665_01113 CDS open 41280-42302 _na     340_aa Acyl-CoA:diacylglycerol acyltransferase
1154 JAQPSI010000003.1 GCA028527665_01114 CDS open 42646-44643 _na     665_aa Trehalose O-mycolyltransferase
1155 JAQPSI010000003.1 GCA028527665_01115 CDS open 44643-45269 _na     208_aa DUF732 domain-containing protein
1156 JAQPSI010000003.1 GCA028527665_01116 CDS open 45334-46245 _na     303_aa Cutinase
1157 JAQPSI010000003.1 GCA028527665_01117 CDS open 46518-48362 _na     614_aa FadD32-like long-chain-fatty-acid--AMP ligase
1158 JAQPSI010000003.1 GCA028527665_01118 CDS open 48363-53402 _na     1679_aa pks13 polyketide synthase Pks13
1159 JAQPSI010000003.1 GCA028527665_01119 CDS open 53403-54947 _na     514_aa Propionyl-CoA carboxylase beta chain 5
1160 JAQPSI010000003.1 GCA028527665_01120 CDS open 54940-55206 _na     88_aa hypothetical protein
1161 JAQPSI010000003.1 GCA028527665_01121 CDS open 55734-56702 _na     322_aa rarD EamA family transporter RarD
1162 JAQPSI010000003.1 GCA028527665_01122 CDS open 56616-57014 _na     132_aa Major facilitator superfamily (MFS) profile domain-containing protein
1163 JAQPSI010000003.1 GCA028527665_01123 CDS open 57020-58057 _na     345_aa TIGR00374 family protein
1164 JAQPSI010000003.1 GCA028527665_01124 CDS open 58070-60427 _na     785_aa Membrane transport protein MMPL domain-containing protein
1165 JAQPSI010000003.1 GCA028527665_01125 CDS open 60436-61095 _na     219_aa NYN domain-containing protein
1166 JAQPSI010000003.1 GCA028527665_01126 CDS open 61236-62033 _na     265_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
1167 JAQPSI010000003.1 GCA028527665_01127 CDS open 62299-64131 _na     610_aa phosphoenolpyruvate carboxykinase (GTP)
1168 JAQPSI010000003.1 GCA028527665_01128 CDS open 64370-64717 _na     115_aa hypothetical protein
1169 JAQPSI010000003.1 GCA028527665_01129 CDS open 64757-64930 _na     57_aa hypothetical protein
1170 JAQPSI010000003.1 GCA028527665_01130 CDS open 64902-65360 _na     152_aa Phage holin family protein
1171 JAQPSI010000003.1 GCA028527665_01131 CDS open 65366-66139 _na     257_aa Methyltransferase type 11 domain-containing protein
1172 JAQPSI010000003.1 GCA028527665_01132 CDS open 66455-67078 _na     207_aa Ion transport domain-containing protein
1173 JAQPSI010000003.1 GCA028527665_01133 CDS open 67146-68306 _na     386_aa Glycosyl transferase family 1 domain-containing protein
1174 JAQPSI010000003.1 GCA028527665_01134 CDS open 68369-69316 _na     315_aa FAD-binding FR-type domain-containing protein
1175 JAQPSI010000003.1 GCA028527665_01135 CDS open 69694-71067 _na     457_aa YibE/F family protein
1176 JAQPSI010000003.1 GCA028527665_01136 CDS open 71134-71310 _na     58_aa hypothetical protein
1177 JAQPSI010000003.1 GCA028527665_01138 CDS open 71413-72228 _na     271_aa hypothetical protein
1178 JAQPSI010000003.1 GCA028527665_01139 CDS open 72335-72496 _na     53_aa hypothetical protein
1179 JAQPSI010000003.1 GCA028527665_01140 CDS open 72477-72860 _na     127_aa Aminoacyl-tRNA synthetase class II (D/K/N) domain-containing protein
1180 JAQPSI010000003.1 GCA028527665_01141 CDS open 72927-73217 _na     96_aa hypothetical protein
1181 JAQPSI010000003.1 GCA028527665_01142 CDS open 73349-74557 _na     402_aa nitric oxide dioxygenase
1182 JAQPSI010000003.1 GCA028527665_01143 CDS open 74577-75062 _na     161_aa Rrf2 family transcriptional regulator
1183 JAQPSI010000003.1 GCA028527665_01144 CDS open 75302-75442 _na     46_aa hypothetical protein
1184 JAQPSI010000003.1 GCA028527665_01145 CDS open 75566-75937 _na     123_aa Transposase IS110-like N-terminal domain-containing protein
1185 JAQPSI010000003.1 GCA028527665_01146 CDS open 75954-76460 _na     168_aa Transposase IS116/IS110/IS902 C-terminal domain-containing protein
1186 JAQPSI010000003.1 GCA028527665_01147 CDS open 76515-76769 _na     84_aa DUF6968 domain-containing protein
1187 JAQPSI010000003.1 GCA028527665_01148 CDS open 77617-78807 _na     396_aa SsuA/THI5-like domain-containing protein
1188 JAQPSI010000003.1 GCA028527665_01149 CDS open 78817-79746 _na     309_aa ABC transporter permease
1189 JAQPSI010000003.1 GCA028527665_01150 CDS open 79739-80569 _na     276_aa ABC transporter domain-containing protein
1190 JAQPSI010000003.1 GCA028527665_01151 CDS open 80721-81989 _na     422_aa Aminotransferase class I/classII domain-containing protein
1191 JAQPSI010000003.1 GCA028527665_01152 CDS open 81937-82548 _na     203_aa Suppressor of fused-like domain-containing protein
1192 JAQPSI010000003.1 GCA028527665_01153 CDS open 82627-85443 _na     938_aa DNA polymerase III subunit gamma and tau
1193 JAQPSI010000003.1 GCA028527665_01154 CDS open 85570-85908 _na     112_aa YbaB/EbfC family nucleoid-associated protein
1194 JAQPSI010000003.1 GCA028527665_01155 CDS open 85909-86568 _na     219_aa recR recombination mediator RecR
1195 JAQPSI010000003.1 GCA028527665_01156 CDS open 86625-87542 _na     305_aa FAD-binding FR-type domain-containing protein
1196 JAQPSI010000003.1 GCA028527665_01157 CDS open 87592-88428 _na     278_aa gatD Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD
1197 JAQPSI010000003.1 GCA028527665_01158 CDS open 88444-89880 _na     478_aa murT Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT
1198 JAQPSI010000003.1 GCA028527665_01159 CDS open 89911-91365 _na     484_aa DNA polymerase III subunit epsilon
1199 JAQPSI010000003.1 GCA028527665_01160 CDS open 91482-93305 _na     607_aa leuA 2-isopropylmalate synthase
1200 JAQPSI010000003.1 GCA028527665_01161 CDS open 93655-94920 _na     421_aa aspartate kinase
1201 JAQPSI010000003.1 GCA028527665_01162 CDS open 94965-96002 _na     345_aa aspartate-semialdehyde dehydrogenase
1202 JAQPSI010000003.1 GCA028527665_01163 CDS open 96109-97416 _na     435_aa ykvI Membrane protein YkvI
1203 JAQPSI010000003.1 GCA028527665_01164 CDS open 97505-98053 _na     182_aa RNA polymerase sigma factor
1204 JAQPSI010000003.1 GCA028527665_01165 CDS open 98205-99752 _na     515_aa Catalase core domain-containing protein
1205 JAQPSI010000003.1 GCA028527665_01166 CDS open 99972-101504 _na     510_aa X-X-X-Leu-X-X-Gly heptad repeats protein
1206 JAQPSI010000003.1 GCA028527665_01167 CDS open 101592-101882 _na     96_aa Peptidase M23
1207 JAQPSI010000003.1 GCA028527665_01168 CDS open 102107-103468 _na     453_aa Collagen-like protein
1208 JAQPSI010000003.1 GCA028527665_01170 CDS open 103991-104893 _na     300_aa Calcineurin-like phosphoesterase domain-containing protein
1209 JAQPSI010000003.1 GCA028527665_01171 CDS open 105018-105509 _na     163_aa GatB/YqeY domain-containing protein
1210 JAQPSI010000003.1 GCA028527665_01172 CDS open 105506-107887 _na     793_aa peptidoglycan glycosyltransferase
1211 JAQPSI010000003.1 GCA028527665_01173 CDS open 108068-108421 _na     117_aa whiB Transcriptional regulator WhiB
1212 JAQPSI010000003.1 GCA028527665_01174 CDS open 108497-108652 _na     51_aa DUF4177 domain-containing protein
1213 JAQPSI010000003.1 GCA028527665_01175 CDS open 108654-109124 _na     156_aa Endoribonuclease L-PSP/chorismate mutase-like domain-containing protein
1214 JAQPSI010000003.1 GCA028527665_01176 CDS open 109202-110029 _na     275_aa Metallo-beta-lactamase domain-containing protein
1215 JAQPSI010000003.1 GCA028527665_01177 CDS open 110235-110918 _na     227_aa Transcriptional regulator%2C Crp family protein
1216 JAQPSI010000003.1 GCA028527665_01178 CDS open 111277-111960 _na     227_aa Thioredoxin domain-containing protein
1217 JAQPSI010000003.1 GCA028527665_01179 CDS open 111960-112709 _na     249_aa Nudix hydrolase domain-containing protein
1218 JAQPSI010000003.1 GCA028527665_01180 CDS open 112745-113941 _na     398_aa marP MarP family serine protease
1219 JAQPSI010000003.1 GCA028527665_01181 CDS open 113980-114945 _na     321_aa AB hydrolase-1 domain-containing protein
1220 JAQPSI010000003.1 GCA028527665_01182 CDS open 115006-115509 _na     167_aa Phage holin family protein
1221 JAQPSI010000003.1 GCA028527665_01183 CDS open 115506-116489 _na     327_aa HAD family hydrolase
1222 JAQPSI010000003.1 GCA028527665_01184 CDS open 116760-117974 _na     404_aa ssd septum site-determining protein Ssd
1223 JAQPSI010000003.1 GCA028527665_01185 CDS open 118072-119286 _na     404_aa Helicase/secretion neighborhood ATPase
1224 JAQPSI010000003.1 GCA028527665_01186 CDS open 119283-120083 _na     266_aa gspF Type II secretion system protein GspF domain-containing protein
1225 JAQPSI010000003.1 GCA028527665_01187 CDS open 120080-120664 _na     194_aa gspF Type II secretion system protein GspF domain-containing protein
1226 JAQPSI010000003.1 GCA028527665_01188 CDS open 120715-121023 _na     102_aa DUF4244 domain-containing protein
1227 JAQPSI010000003.1 GCA028527665_01189 CDS open 120974-121354 _na     126_aa tadE TadE family protein
1228 JAQPSI010000003.1 GCA028527665_01190 CDS open 121351-121725 _na     124_aa Helicase/secretion neighborhood TadE-like protein
1229 JAQPSI010000003.1 GCA028527665_01191 CDS open 121759-124143 _na     794_aa DEAD/DEAH box helicase
1230 JAQPSI010000003.1 GCA028527665_01192 CDS open 124330-124533 _na     67_aa Cold-shock protein A
1231 JAQPSI010000003.1 GCA028527665_01193 CDS open 124760-127744 _na     994_aa topA type I DNA topoisomerase
1232 JAQPSI010000003.1 GCA028527665_01194 CDS open 127748-129097 _na     449_aa DUF418 domain-containing protein
1233 JAQPSI010000003.1 GCA028527665_01195 CDS open 129198-130724 _na     508_aa Adenylate cyclase
1234 JAQPSI010000003.1 GCA028527665_01196 CDS open 130768-132153 _na     461_aa DNA polymerase III subunit delta'
1235 JAQPSI010000003.1 GCA028527665_01198 CDS open 132577-132870 _na     97_aa hypothetical protein
1236 JAQPSI010000003.1 GCA028527665_01199 CDS open 133170-133868 _na     232_aa ATP-binding protein
1237 JAQPSI010000003.1 GCA028527665_01200 CDS open 133865-134131 _na     88_aa hypothetical protein
1238 JAQPSI010000003.1 GCA028527665_01201 CDS open 134800-136443 _na     547_aa AMP-dependent synthetase/ligase domain-containing protein
1239 JAQPSI010000003.1 GCA028527665_01202 CDS open 136666-137859 _na     397_aa S-(hydroxymethyl)mycothiol dehydrogenase
1240 JAQPSI010000003.1 GCA028527665_01203 CDS open 137865-138482 _na     205_aa Metallo-beta-lactamase domain-containing protein
1241 JAQPSI010000003.1 GCA028527665_01204 CDS open 138595-139455 _na     286_aa Cytochrome C biogenesis protein transmembrane domain-containing protein
1242 JAQPSI010000003.1 GCA028527665_01205 CDS open 139473-140414 _na     313_aa Thioredoxin domain-containing protein
1243 JAQPSI010000003.1 GCA028527665_01206 CDS open 140466-141332 _na     288_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
1244 JAQPSI010000003.1 GCA028527665_01207 CDS open 141339-142703 _na     454_aa rfbD dTDP-4-dehydrorhamnose reductase
1245 JAQPSI010000003.1 GCA028527665_01208 CDS open 142719-143705 _na     328_aa rfbB dTDP-glucose 4%2C6-dehydratase
1246 JAQPSI010000003.1 GCA028527665_01209 CDS open 143939-145063 _na     374_aa Esterase
1247 JAQPSI010000003.1 GCA028527665_01210 CDS open 145554-145661 _na     35_aa hypothetical protein
1248 JAQPSI010000003.1 GCA028527665_01211 CDS open 145855-147282 _na     475_aa lpdA dihydrolipoyl dehydrogenase
1249 JAQPSI010000003.1 GCA028527665_01212 CDS open 147637-148392 _na     251_aa B558 family succinate dehydrogenase (Or fumarate reductase) cytochrome B subunit
1250 JAQPSI010000003.1 GCA028527665_01213 CDS open 148459-150468 _na     669_aa Succinate dehydrogenase or fumarate reductase%2C flavoprotein subunit
1251 JAQPSI010000003.1 GCA028527665_01214 CDS open 150468-151217 _na     249_aa succinate dehydrogenase
1252 JAQPSI010000003.1 GCA028527665_01215 CDS open 151356-151724 _na     122_aa DUF2628 domain-containing protein
1253 JAQPSI010000003.1 GCA028527665_01216 CDS open 151845-153233 _na     462_aa DUF445 domain-containing protein
1254 JAQPSI010000003.1 GCA028527665_01217 CDS open 153327-153764 _na     145_aa Transposase
1255 JAQPSI010000003.1 GCA028527665_01218 CDS open 153878-154267 _na     129_aa DUF2516 domain-containing protein
1256 JAQPSI010000003.1 GCA028527665_01219 CDS open 154314-155213 _na     299_aa Deoxyribose-phosphate aldolase
1257 JAQPSI010000003.1 GCA028527665_01220 CDS open 155245-156135 _na     296_aa DUF2993 domain-containing protein
1258 JAQPSI010000003.1 GCA028527665_01221 CDS open 156165-156656 _na     163_aa DUF2505 domain-containing protein
1259 JAQPSI010000003.1 GCA028527665_01222 CDS open 156683-157879 _na     398_aa UDP-N-acetylmuramate dehydrogenase
1260 JAQPSI010000003.1 GCA028527665_01223 CDS open 157913-158428 _na     171_aa Bacterial spore germination immunoglobulin-like domain-containing protein
1261 JAQPSI010000003.1 GCA028527665_01224 CDS open 158487-159728 _na     413_aa Esterase
1262 JAQPSI010000003.1 GCA028527665_01225 CDS open 159909-160364 _na     151_aa Bacterial Pleckstrin-like y domain-containing protein
1263 JAQPSI010000003.1 GCA028527665_01226 CDS open 160367-161332 _na     321_aa Polysaccharide deacetylase family protein
1264 JAQPSI010000003.1 GCA028527665_01227 CDS open 161849-162154 _na     101_aa cas2 CRISPR-associated endonuclease Cas2
1265 JAQPSI010000003.1 GCA028527665_01228 CDS open 162162-163076 _na     304_aa cas1 type II CRISPR-associated endonuclease Cas1
1266 JAQPSI010000003.1 GCA028527665_01229 CDS open 163079-166369 _na     1096_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
1267 JAQPSI010000003.1 GCA028527665_01230 CDS open 166539-175859 _na     3106_aa Ketosynthase family 3 (KS3) domain-containing protein
1268 JAQPSI010000003.1 GCA028527665_01231 CDS open 176109-177896 _na     595_aa long-chain-fatty-acid--CoA ligase
1269 JAQPSI010000003.1 GCA028527665_01232 CDS open 178153-179961 _na     602_aa long-chain-fatty-acid--CoA ligase
1270 JAQPSI010000003.1 GCA028527665_01233 CDS open 180435-182153 _na     572_aa long-chain-fatty-acid--CoA ligase
1271 JAQPSI010000003.1 GCA028527665_01234 CDS open 182428-183747 _na     439_aa mshA D-inositol-3-phosphate glycosyltransferase
1272 JAQPSI010000003.1 GCA028527665_01235 CDS open 183818-184606 _na     262_aa phosphoglyceromutase
1273 JAQPSI010000003.1 GCA028527665_01236 CDS open 184612-186036 _na     474_aa senX3 Sensor-like histidine kinase SenX3
1274 JAQPSI010000003.1 GCA028527665_01237 CDS open 186147-186845 _na     232_aa regX3 Sensory transduction protein RegX3
1275 JAQPSI010000003.1 GCA028527665_01238 CDS open 186858-187760 _na     300_aa DUF3109 domain-containing protein
1276 JAQPSI010000003.1 GCA028527665_01239 CDS open 187794-188723 _na     309_aa Ppx/GppA phosphatase N-terminal domain-containing protein
1277 JAQPSI010000003.1 GCA028527665_01240 CDS open 188735-190183 _na     482_aa hypothetical protein
1278 JAQPSI010000003.1 GCA028527665_01241 CDS open 190307-191155 _na     282_aa proC pyrroline-5-carboxylate reductase
1279 JAQPSI010000003.1 GCA028527665_01242 CDS open 191509-191700 _na     63_aa Helix-turn-helix domain-containing protein
1280 JAQPSI010000003.1 GCA028527665_01243 CDS open 191952-192053 _na     33_aa 30S ribosomal protein bS22
1281 JAQPSI010000003.1 GCA028527665_01244 CDS open 192209-193840 _na     543_aa HNH nuclease domain-containing protein
1282 JAQPSI010000003.1 GCA028527665_01245 CDS open 194059-195135 _na     358_aa HAD hydrolase%2C family IB
1283 JAQPSI010000003.1 GCA028527665_01246 CDS open 195466-195849 _na     127_aa Glutaredoxin domain-containing protein
1284 JAQPSI010000003.1 GCA028527665_01247 CDS open 196109-197575 _na     488_aa glutamyl-tRNA reductase
1285 JAQPSI010000003.1 GCA028527665_01248 CDS open 197647-198540 _na     297_aa hemC hydroxymethylbilane synthase
1286 JAQPSI010000003.1 GCA028527665_01249 CDS open 198820-200556 _na     578_aa Tetrapyrrole methylase domain-containing protein
1287 JAQPSI010000003.1 GCA028527665_01250 CDS open 200731-201720 _na     329_aa hemB porphobilinogen synthase
1288 JAQPSI010000003.1 GCA028527665_01251 CDS open 201794-202609 _na     271_aa hypothetical protein
1289 JAQPSI010000003.1 GCA028527665_01252 CDS open 202842-203792 _na     316_aa hemE uroporphyrinogen decarboxylase
1290 JAQPSI010000003.1 GCA028527665_01253 CDS open 203886-205448 _na     520_aa protoporphyrinogen oxidase
1291 JAQPSI010000003.1 GCA028527665_01254 CDS open 205525-206973 _na     482_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
1292 JAQPSI010000003.1 GCA028527665_01255 CDS open 207215-207931 _na     238_aa Phosphoglycerate mutase
1293 JAQPSI010000003.1 GCA028527665_01256 CDS open 208020-208646 _na     208_aa Thioredoxin domain-containing protein
1294 JAQPSI010000003.1 GCA028527665_01257 CDS open 208689-209645 _na     318_aa Cytochrome C biogenesis protein transmembrane domain-containing protein
1295 JAQPSI010000003.1 GCA028527665_01258 CDS open 209735-211399 _na     554_aa ResB-like domain-containing protein
1296 JAQPSI010000003.1 GCA028527665_01259 CDS open 211669-212661 _na     330_aa ccsB c-type cytochrome biogenesis protein CcsB
1297 JAQPSI010000003.1 GCA028527665_01260 CDS open 212869-213279 _na     136_aa Secreted protein
1298 JAQPSI010000003.1 GCA028527665_01261 CDS open 213316-213786 _na     156_aa DUF4229 domain-containing protein
1299 JAQPSI010000003.1 GCA028527665_01262 CDS open 213802-214731 _na     309_aa AEC family transporter
1300 JAQPSI010000003.1 GCA028527665_01263 CDS open 214873-215763 _na     296_aa 1%2C4-dihydroxy-2-naphthoate polyprenyltransferase
1301 JAQPSI010000003.1 GCA028527665_01264 CDS open 215928-217010 _na     360_aa NADP-dependent oxidoreductase domain-containing protein
1302 JAQPSI010000003.1 GCA028527665_01265 CDS open 217072-218265 _na     397_aa menE o-succinylbenzoate--CoA ligase
1303 JAQPSI010000003.1 GCA028527665_01266 CDS open 218357-219376 _na     339_aa 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
1304 JAQPSI010000003.1 GCA028527665_01267 CDS open 219404-220558 _na     384_aa o-succinylbenzoate synthase
1305 JAQPSI010000003.1 GCA028527665_01268 CDS open 220500-223235 _na     911_aa UvrABC system protein A
1306 JAQPSI010000003.1 GCA028527665_01269 CDS open 223272-224039 _na     255_aa hypothetical protein
1307 JAQPSI010000003.1 GCA028527665_01270 CDS open 224177-225955 _na     592_aa menD 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase
1308 JAQPSI010000003.1 GCA028527665_01271 CDS open 225968-226540 _na     190_aa DUF3592 domain-containing protein
1309 JAQPSI010000003.1 GCA028527665_01272 CDS open 226616-227809 _na     397_aa Glycosyltransferase family 1 protein
1310 JAQPSI010000003.1 GCA028527665_01273 CDS open 227819-228619 _na     266_aa demethylmenaquinone methyltransferase
1311 JAQPSI010000003.1 GCA028527665_01274 CDS open 228944-230377 _na     477_aa FAD-binding domain-containing protein
1312 JAQPSI010000003.1 GCA028527665_01275 CDS open 230488-231504 _na     338_aa Geranylgeranyl pyrophosphate synthase
1313 JAQPSI010000003.1 GCA028527665_01072 gene open 75-1013
1314 JAQPSI010000003.1 GCA028527665_01073 gene open 1010-2707
1315 JAQPSI010000003.1 GCA028527665_01074 gene open 2718-3722
1316 JAQPSI010000003.1 GCA028527665_01075 gene open 4102-4998 uspA
1317 JAQPSI010000003.1 GCA028527665_01076 gene open 5002-5259
1318 JAQPSI010000003.1 GCA028527665_01077 gene open 5448-6074
1319 JAQPSI010000003.1 GCA028527665_01078 gene open 6071-7333 yidC
1320 JAQPSI010000003.1 GCA028527665_01079 gene open 7443-8765
1321 JAQPSI010000003.1 GCA028527665_01080 gene open 8819-9457
1322 JAQPSI010000003.1 GCA028527665_01081 gene open 9467-10102
1323 JAQPSI010000003.1 GCA028527665_01082 gene open 10189-11859 yprB
1324 JAQPSI010000003.1 GCA028527665_01083 gene open 11860-13074
1325 JAQPSI010000003.1 GCA028527665_01084 gene open 13261-14001
1326 JAQPSI010000003.1 GCA028527665_01085 gene open 14012-15382
1327 JAQPSI010000003.1 GCA028527665_01086 gene open 15671-15784
1328 JAQPSI010000003.1 GCA028527665_01087 gene open 15989-16279
1329 JAQPSI010000003.1 GCA028527665_01088 gene open 16463-16684
1330 JAQPSI010000003.1 GCA028527665_01089 gene open 17173-17574
1331 JAQPSI010000003.1 GCA028527665_01090 gene open 17717-18319
1332 JAQPSI010000003.1 GCA028527665_01091 gene open 18435-18527
1333 JAQPSI010000003.1 GCA028527665_01092 gene open 18514-19170 msrA
1334 JAQPSI010000003.1 GCA028527665_01093 gene open 19216-19941
1335 JAQPSI010000003.1 GCA028527665_01094 gene open 20046-20468 rhuM
1336 JAQPSI010000003.1 GCA028527665_01095 gene open 20417-20890 rhuM
1337 JAQPSI010000003.1 GCA028527665_01096 gene open 20972-21892
1338 JAQPSI010000003.1 GCA028527665_01097 gene open 22011-23099
1339 JAQPSI010000003.1 GCA028527665_01098 gene open 23147-25033
1340 JAQPSI010000003.1 GCA028527665_01099 gene open 25094-26110
1341 JAQPSI010000003.1 GCA028527665_01100 gene open 26195-27166 pheA
1342 JAQPSI010000003.1 GCA028527665_01101 gene open 27169-27822
1343 JAQPSI010000003.1 GCA028527665_01102 gene open 27869-28216
1344 JAQPSI010000003.1 GCA028527665_01103 gene open 28276-29262
1345 JAQPSI010000003.1 GCA028527665_01104 gene open 29280-30593 serS
1346 JAQPSI010000003.1 GCA028527665_01105 gene open 30590-31486
1347 JAQPSI010000003.1 GCA028527665_01106 gene open 31504-32337
1348 JAQPSI010000003.1 GCA028527665_01107 gene open 32345-33910 glpK
1349 JAQPSI010000003.1 GCA028527665_01108 gene open 33907-36057
1350 JAQPSI010000003.1 GCA028527665_01109 gene open 36350-37540 glf
1351 JAQPSI010000003.1 GCA028527665_01110 gene open 37635-39569
1352 JAQPSI010000003.1 GCA028527665_01111 gene open 39559-40089
1353 JAQPSI010000003.1 GCA028527665_01112 gene open 40090-41073
1354 JAQPSI010000003.1 GCA028527665_01113 gene open 41280-42302
1355 JAQPSI010000003.1 GCA028527665_01114 gene open 42646-44643
1356 JAQPSI010000003.1 GCA028527665_01115 gene open 44643-45269
1357 JAQPSI010000003.1 GCA028527665_01116 gene open 45334-46245
1358 JAQPSI010000003.1 GCA028527665_01117 gene open 46518-48362
1359 JAQPSI010000003.1 GCA028527665_01118 gene open 48363-53402 pks13
1360 JAQPSI010000003.1 GCA028527665_01119 gene open 53403-54947
1361 JAQPSI010000003.1 GCA028527665_01120 gene open 54940-55206
1362 JAQPSI010000003.1 GCA028527665_01121 gene open 55734-56702 rarD
1363 JAQPSI010000003.1 GCA028527665_01122 gene open 56616-57014
1364 JAQPSI010000003.1 GCA028527665_01123 gene open 57020-58057
1365 JAQPSI010000003.1 GCA028527665_01124 gene open 58070-60427
1366 JAQPSI010000003.1 GCA028527665_01125 gene open 60436-61095
1367 JAQPSI010000003.1 GCA028527665_01126 gene open 61236-62033 trmB
1368 JAQPSI010000003.1 GCA028527665_01127 gene open 62299-64131
1369 JAQPSI010000003.1 GCA028527665_01128 gene open 64370-64717
1370 JAQPSI010000003.1 GCA028527665_01129 gene open 64757-64930
1371 JAQPSI010000003.1 GCA028527665_01130 gene open 64902-65360
1372 JAQPSI010000003.1 GCA028527665_01131 gene open 65366-66139
1373 JAQPSI010000003.1 GCA028527665_01132 gene open 66455-67078
1374 JAQPSI010000003.1 GCA028527665_01133 gene open 67146-68306
1375 JAQPSI010000003.1 GCA028527665_01134 gene open 68369-69316
1376 JAQPSI010000003.1 GCA028527665_01135 gene open 69694-71067
1377 JAQPSI010000003.1 GCA028527665_01136 gene open 71134-71310
1378 JAQPSI010000003.1 GCA028527665_01138 gene open 71413-72228
1379 JAQPSI010000003.1 GCA028527665_01139 gene open 72335-72496
1380 JAQPSI010000003.1 GCA028527665_01140 gene open 72477-72860
1381 JAQPSI010000003.1 GCA028527665_01141 gene open 72927-73217
1382 JAQPSI010000003.1 GCA028527665_01142 gene open 73349-74557
1383 JAQPSI010000003.1 GCA028527665_01143 gene open 74577-75062
1384 JAQPSI010000003.1 GCA028527665_01144 gene open 75302-75442
1385 JAQPSI010000003.1 GCA028527665_01145 gene open 75566-75937
1386 JAQPSI010000003.1 GCA028527665_01146 gene open 75954-76460
1387 JAQPSI010000003.1 GCA028527665_01147 gene open 76515-76769
1388 JAQPSI010000003.1 GCA028527665_01148 gene open 77617-78807
1389 JAQPSI010000003.1 GCA028527665_01149 gene open 78817-79746
1390 JAQPSI010000003.1 GCA028527665_01150 gene open 79739-80569
1391 JAQPSI010000003.1 GCA028527665_01151 gene open 80721-81989
1392 JAQPSI010000003.1 GCA028527665_01152 gene open 81937-82548
1393 JAQPSI010000003.1 GCA028527665_01153 gene open 82627-85443
1394 JAQPSI010000003.1 GCA028527665_01154 gene open 85570-85908
1395 JAQPSI010000003.1 GCA028527665_01155 gene open 85909-86568 recR
1396 JAQPSI010000003.1 GCA028527665_01156 gene open 86625-87542
1397 JAQPSI010000003.1 GCA028527665_01157 gene open 87592-88428 gatD
1398 JAQPSI010000003.1 GCA028527665_01158 gene open 88444-89880 murT
1399 JAQPSI010000003.1 GCA028527665_01159 gene open 89911-91365
1400 JAQPSI010000003.1 GCA028527665_01160 gene open 91482-93305 leuA
1401 JAQPSI010000003.1 GCA028527665_01161 gene open 93655-94920
1402 JAQPSI010000003.1 GCA028527665_01162 gene open 94965-96002
1403 JAQPSI010000003.1 GCA028527665_01163 gene open 96109-97416 ykvI
1404 JAQPSI010000003.1 GCA028527665_01164 gene open 97505-98053
1405 JAQPSI010000003.1 GCA028527665_01165 gene open 98205-99752
1406 JAQPSI010000003.1 GCA028527665_01166 gene open 99972-101504
1407 JAQPSI010000003.1 GCA028527665_01167 gene open 101592-101882
1408 JAQPSI010000003.1 GCA028527665_01168 gene open 102107-103468
1409 JAQPSI010000003.1 GCA028527665_01170 gene open 103991-104893
1410 JAQPSI010000003.1 GCA028527665_01171 gene open 105018-105509
1411 JAQPSI010000003.1 GCA028527665_01172 gene open 105506-107887
1412 JAQPSI010000003.1 GCA028527665_01173 gene open 108068-108421 whiB
1413 JAQPSI010000003.1 GCA028527665_01174 gene open 108497-108652
1414 JAQPSI010000003.1 GCA028527665_01175 gene open 108654-109124
1415 JAQPSI010000003.1 GCA028527665_01176 gene open 109202-110029
1416 JAQPSI010000003.1 GCA028527665_01177 gene open 110235-110918
1417 JAQPSI010000003.1 GCA028527665_01178 gene open 111277-111960
1418 JAQPSI010000003.1 GCA028527665_01179 gene open 111960-112709
1419 JAQPSI010000003.1 GCA028527665_01180 gene open 112745-113941 marP
1420 JAQPSI010000003.1 GCA028527665_01181 gene open 113980-114945
1421 JAQPSI010000003.1 GCA028527665_01182 gene open 115006-115509
1422 JAQPSI010000003.1 GCA028527665_01183 gene open 115506-116489
1423 JAQPSI010000003.1 GCA028527665_01184 gene open 116760-117974 ssd
1424 JAQPSI010000003.1 GCA028527665_01185 gene open 118072-119286
1425 JAQPSI010000003.1 GCA028527665_01186 gene open 119283-120083 gspF
1426 JAQPSI010000003.1 GCA028527665_01187 gene open 120080-120664 gspF
1427 JAQPSI010000003.1 GCA028527665_01188 gene open 120715-121023
1428 JAQPSI010000003.1 GCA028527665_01189 gene open 120974-121354 tadE
1429 JAQPSI010000003.1 GCA028527665_01190 gene open 121351-121725
1430 JAQPSI010000003.1 GCA028527665_01191 gene open 121759-124143
1431 JAQPSI010000003.1 GCA028527665_01192 gene open 124330-124533
1432 JAQPSI010000003.1 GCA028527665_01193 gene open 124760-127744 topA
1433 JAQPSI010000003.1 GCA028527665_01194 gene open 127748-129097
1434 JAQPSI010000003.1 GCA028527665_01195 gene open 129198-130724
1435 JAQPSI010000003.1 GCA028527665_01196 gene open 130768-132153
1436 JAQPSI010000003.1 GCA028527665_01198 gene open 132577-132870
1437 JAQPSI010000003.1 GCA028527665_01199 gene open 133170-133868
1438 JAQPSI010000003.1 GCA028527665_01200 gene open 133865-134131
1439 JAQPSI010000003.1 GCA028527665_01201 gene open 134800-136443
1440 JAQPSI010000003.1 GCA028527665_01202 gene open 136666-137859
1441 JAQPSI010000003.1 GCA028527665_01203 gene open 137865-138482
1442 JAQPSI010000003.1 GCA028527665_01204 gene open 138595-139455
1443 JAQPSI010000003.1 GCA028527665_01205 gene open 139473-140414
1444 JAQPSI010000003.1 GCA028527665_01206 gene open 140466-141332 rfbA
1445 JAQPSI010000003.1 GCA028527665_01207 gene open 141339-142703 rfbD
1446 JAQPSI010000003.1 GCA028527665_01208 gene open 142719-143705 rfbB
1447 JAQPSI010000003.1 GCA028527665_01209 gene open 143939-145063
1448 JAQPSI010000003.1 GCA028527665_01210 gene open 145554-145661
1449 JAQPSI010000003.1 GCA028527665_01211 gene open 145855-147282 lpdA
1450 JAQPSI010000003.1 GCA028527665_01212 gene open 147637-148392
1451 JAQPSI010000003.1 GCA028527665_01213 gene open 148459-150468
1452 JAQPSI010000003.1 GCA028527665_01214 gene open 150468-151217
1453 JAQPSI010000003.1 GCA028527665_01215 gene open 151356-151724
1454 JAQPSI010000003.1 GCA028527665_01216 gene open 151845-153233
1455 JAQPSI010000003.1 GCA028527665_01217 gene open 153327-153764
1456 JAQPSI010000003.1 GCA028527665_01218 gene open 153878-154267
1457 JAQPSI010000003.1 GCA028527665_01219 gene open 154314-155213
1458 JAQPSI010000003.1 GCA028527665_01220 gene open 155245-156135
1459 JAQPSI010000003.1 GCA028527665_01221 gene open 156165-156656
1460 JAQPSI010000003.1 GCA028527665_01222 gene open 156683-157879
1461 JAQPSI010000003.1 GCA028527665_01223 gene open 157913-158428
1462 JAQPSI010000003.1 GCA028527665_01224 gene open 158487-159728
1463 JAQPSI010000003.1 GCA028527665_01225 gene open 159909-160364
1464 JAQPSI010000003.1 GCA028527665_01226 gene open 160367-161332
1465 JAQPSI010000003.1 GCA028527665_01227 gene open 161849-162154 cas2
1466 JAQPSI010000003.1 GCA028527665_01228 gene open 162162-163076 cas1
1467 JAQPSI010000003.1 GCA028527665_01229 gene open 163079-166369 cas9
1468 JAQPSI010000003.1 GCA028527665_01230 gene open 166539-175859
1469 JAQPSI010000003.1 GCA028527665_01231 gene open 176109-177896
1470 JAQPSI010000003.1 GCA028527665_01232 gene open 178153-179961
1471 JAQPSI010000003.1 GCA028527665_01233 gene open 180435-182153
1472 JAQPSI010000003.1 GCA028527665_01234 gene open 182428-183747 mshA
1473 JAQPSI010000003.1 GCA028527665_01235 gene open 183818-184606
1474 JAQPSI010000003.1 GCA028527665_01236 gene open 184612-186036 senX3
1475 JAQPSI010000003.1 GCA028527665_01237 gene open 186147-186845 regX3
1476 JAQPSI010000003.1 GCA028527665_01238 gene open 186858-187760
1477 JAQPSI010000003.1 GCA028527665_01239 gene open 187794-188723
1478 JAQPSI010000003.1 GCA028527665_01240 gene open 188735-190183
1479 JAQPSI010000003.1 GCA028527665_01241 gene open 190307-191155 proC
1480 JAQPSI010000003.1 GCA028527665_01242 gene open 191509-191700
1481 JAQPSI010000003.1 GCA028527665_01243 gene open 191952-192053
1482 JAQPSI010000003.1 GCA028527665_01244 gene open 192209-193840
1483 JAQPSI010000003.1 GCA028527665_01245 gene open 194059-195135
1484 JAQPSI010000003.1 GCA028527665_01246 gene open 195466-195849
1485 JAQPSI010000003.1 GCA028527665_01247 gene open 196109-197575
1486 JAQPSI010000003.1 GCA028527665_01248 gene open 197647-198540 hemC
1487 JAQPSI010000003.1 GCA028527665_01249 gene open 198820-200556
1488 JAQPSI010000003.1 GCA028527665_01250 gene open 200731-201720 hemB
1489 JAQPSI010000003.1 GCA028527665_01251 gene open 201794-202609
1490 JAQPSI010000003.1 GCA028527665_01252 gene open 202842-203792 hemE
1491 JAQPSI010000003.1 GCA028527665_01253 gene open 203886-205448
1492 JAQPSI010000003.1 GCA028527665_01254 gene open 205525-206973 hemL
1493 JAQPSI010000003.1 GCA028527665_01255 gene open 207215-207931
1494 JAQPSI010000003.1 GCA028527665_01256 gene open 208020-208646
1495 JAQPSI010000003.1 GCA028527665_01257 gene open 208689-209645
1496 JAQPSI010000003.1 GCA028527665_01258 gene open 209735-211399
1497 JAQPSI010000003.1 GCA028527665_01259 gene open 211669-212661 ccsB
1498 JAQPSI010000003.1 GCA028527665_01260 gene open 212869-213279
1499 JAQPSI010000003.1 GCA028527665_01261 gene open 213316-213786
1500 JAQPSI010000003.1 GCA028527665_01262 gene open 213802-214731