HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium pseudodiphtheriticum (GCA_028527665.1)

Select a Genome:
BAKTA Annotations for GCA_028527665.1
Genome Selected: Corynebacterium pseudodiphtheriticum
ContigsBases CDSrRNA tmRNAtRNA
30 2288602 2055 3 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4224 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 4224 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 JAQPSI010000009.1 GCA028527665_02018 CDS open 2794-3363 _na     189_aa Permease
3002 JAQPSI010000009.1 GCA028527665_02019 CDS open 3480-5156 _na     558_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
3003 JAQPSI010000009.1 GCA028527665_02020 CDS open 5308-6246 _na     312_aa ABC transmembrane type-1 domain-containing protein
3004 JAQPSI010000009.1 GCA028527665_02021 CDS open 6246-7301 _na     351_aa ABC transporter domain-containing protein
3005 JAQPSI010000009.1 GCA028527665_02022 CDS open 7573-8241 _na     222_aa recX Regulatory protein RecX
3006 JAQPSI010000009.1 GCA028527665_02023 CDS open 8204-9355 _na     383_aa recA recombinase RecA
3007 JAQPSI010000009.1 GCA028527665_02024 CDS open 9564-9779 _na     71_aa DUF3046 domain-containing protein
3008 JAQPSI010000009.1 GCA028527665_02025 CDS open 9825-10664 _na     279_aa PspA/IM30 family protein
3009 JAQPSI010000009.1 GCA028527665_02026 CDS open 10810-11301 _na     163_aa HTH cro/C1-type domain-containing protein
3010 JAQPSI010000009.1 GCA028527665_02027 CDS open 11357-11857 _na     166_aa cinA CinA C-terminal domain-containing protein
3011 JAQPSI010000009.1 GCA028527665_02028 CDS open 11859-12419 _na     186_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
3012 JAQPSI010000009.1 GCA028527665_02029 CDS open 12456-13469 _na     337_aa terC TerC family integral membrane protein
3013 JAQPSI010000009.1 GCA028527665_02030 CDS open 13694-17221 _na     1175_aa ftsK DNA translocase ftsK
3014 JAQPSI010000009.1 GCA028527665_02031 CDS open 17307-17933 _na     208_aa TIGR03085 family protein
3015 JAQPSI010000009.1 GCA028527665_02032 CDS open 17982-20246 _na     754_aa Ribonuclease J
3016 JAQPSI010000009.1 GCA028527665_02033 CDS open 20247-21155 _na     302_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
3017 JAQPSI010000009.1 GCA028527665_02034 CDS open 21273-22028 _na     251_aa thyX FAD-dependent thymidylate synthase
3018 JAQPSI010000009.1 GCA028527665_02035 CDS open 22032-22781 _na     249_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
3019 JAQPSI010000009.1 GCA028527665_02036 CDS open 22927-23622 _na     231_aa AMIN domain-containing protein
3020 JAQPSI010000009.1 GCA028527665_02037 CDS open 23764-26070 _na     768_aa polyribonucleotide nucleotidyltransferase
3021 JAQPSI010000009.1 GCA028527665_02038 CDS open 26304-26573 _na     89_aa rpsO 30S ribosomal protein S15
3022 JAQPSI010000009.1 GCA028527665_02039 CDS open 26729-27784 _na     351_aa bifunctional riboflavin kinase/FAD synthetase
3023 JAQPSI010000009.1 GCA028527665_02040 CDS open 27833-28816 _na     327_aa truB tRNA pseudouridine(55) synthase TruB
3024 JAQPSI010000009.1 GCA028527665_02041 CDS open 28859-29536 _na     225_aa 4'-phosphopantetheinyl transferase domain-containing protein
3025 JAQPSI010000009.1 GCA028527665_02042 CDS open 29533-30450 _na     305_aa Calcineurin-like phosphoesterase domain-containing protein
3026 JAQPSI010000009.1 GCA028527665_02043 CDS open 30447-31799 _na     450_aa MATE efflux family protein
3027 JAQPSI010000009.1 GCA028527665_02044 CDS open 31796-32761 _na     321_aa DDH domain-containing protein
3028 JAQPSI010000009.1 GCA028527665_02045 CDS open 32787-33218 _na     143_aa rbfA 30S ribosome-binding factor RbfA
3029 JAQPSI010000009.1 GCA028527665_02046 CDS open 33390-36284 _na     964_aa infB translation initiation factor IF-2
3030 JAQPSI010000009.1 GCA028527665_02047 CDS open 36386-36694 _na     102_aa ylxR YlxR domain-containing protein
3031 JAQPSI010000009.1 GCA028527665_02048 CDS open 36798-38045 _na     415_aa nusA Transcription termination/antitermination protein NusA
3032 JAQPSI010000009.1 GCA028527665_02049 CDS open 38057-38746 _na     229_aa rimP ribosome maturation factor RimP
3033 JAQPSI010000009.1 GCA028527665_02050 CDS open 38784-39653 _na     289_aa DUF4439 domain-containing protein
3034 JAQPSI010000009.1 GCA028527665_02051 CDS open 39663-40553 _na     296_aa phzF Phenazine biosynthesis protein PhzF family protein
3035 JAQPSI010000009.1 GCA028527665_02052 CDS open 40624-42450 _na     608_aa proline--tRNA ligase
3036 JAQPSI010000009.1 GCA028527665_02053 CDS open 42506-43279 _na     257_aa yaaA peroxide stress protein YaaA
3037 JAQPSI010000009.1 GCA028527665_02054 CDS open 43475-44407 _na     310_aa Ornithine cyclodeaminase
3038 JAQPSI010000009.1 GCA028527665_02055 CDS open 44411-45877 _na     488_aa selO Protein adenylyltransferase SelO
3039 JAQPSI010000009.1 GCA028527665_02056 CDS open 46010-47440 _na     476_aa mqo malate dehydrogenase (quinone)
3040 JAQPSI010000009.1 GCA028527665_02057 CDS open 47773-48837 _na     354_aa Serine aminopeptidase S33 domain-containing protein
3041 JAQPSI010000009.1 GCA028527665_02058 CDS open 48855-50282 _na     475_aa mtr mycothione reductase
3042 JAQPSI010000009.1 GCA028527665_02059 CDS open 50381-51247 _na     288_aa map type I methionyl aminopeptidase
3043 JAQPSI010000009.1 GCA028527665_02060 CDS open 51494-53347 _na     617_aa Penicillin-binding protein transpeptidase domain-containing protein
3044 JAQPSI010000009.1 GCA028527665_02061 CDS open 53380-54543 _na     387_aa ispG flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase
3045 JAQPSI010000009.1 GCA028527665_02062 CDS open 54611-55831 _na     406_aa Zinc metalloprotease Rip1
3046 JAQPSI010000009.1 GCA028527665_02063 CDS open 55900-57135 _na     411_aa dxr 1-deoxy-D-xylulose-5-phosphate reductoisomerase
3047 JAQPSI010000009.1 GCA028527665_02064 CDS open 57283-57720 _na     145_aa DUF2631 domain-containing protein
3048 JAQPSI010000009.1 GCA028527665_02065 CDS open 57883-59019 _na     378_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
3049 JAQPSI010000009.1 GCA028527665_02066 CDS open 59051-59944 _na     297_aa Phosphatidate cytidylyltransferase
3050 JAQPSI010000009.1 GCA028527665_02067 CDS open 60121-60678 _na     185_aa frr ribosome recycling factor
3051 JAQPSI010000009.1 GCA028527665_02068 CDS open 60750-61490 _na     246_aa pyrH UMP kinase
3052 JAQPSI010000009.1 GCA028527665_02069 CDS open 61689-62516 _na     275_aa tsf translation elongation factor Ts
3053 JAQPSI010000009.1 GCA028527665_02070 CDS open 62592-63410 _na     272_aa rpsB 30S ribosomal protein S2
3054 JAQPSI010000009.1 GCA028527665_02071 CDS open 63835-64443 _na     202_aa Peptidase M23 domain-containing protein
3055 JAQPSI010000009.1 GCA028527665_02072 CDS open 64473-65426 _na     317_aa xerC Tyrosine recombinase XerC
3056 JAQPSI010000009.1 GCA028527665_02073 CDS open 65505-66716 _na     403_aa dprA DNA-processing protein DprA
3057 JAQPSI010000009.1 GCA028527665_02074 CDS open 66713-68263 _na     516_aa Mg chelatase-like protein
3058 JAQPSI010000009.1 GCA028527665_02075 CDS open 68250-68651 _na     133_aa yraN YraN family protein
3059 JAQPSI010000009.1 GCA028527665_02076 CDS open 68871-69179 _na     102_aa Protein often found in actinomycetes clustered with signal peptidase and/or RNaseHII
3060 JAQPSI010000009.1 GCA028527665_02077 CDS open 69303-69995 _na     230_aa ribonuclease HII
3061 JAQPSI010000009.1 GCA028527665_02078 CDS open 70000-70662 _na     220_aa lepB signal peptidase I
3062 JAQPSI010000009.1 GCA028527665_02079 CDS open 70718-71608 _na     296_aa lepB signal peptidase I
3063 JAQPSI010000009.1 GCA028527665_02080 CDS open 71744-72088 _na     114_aa rplS 50S ribosomal protein L19
3064 JAQPSI010000009.1 GCA028527665_02081 CDS open 72266-74113 _na     615_aa thiO glycine oxidase ThiO
3065 JAQPSI010000009.1 GCA028527665_02082 CDS open 74197-74430 _na     77_aa thiS sulfur carrier protein ThiS
3066 JAQPSI010000009.1 GCA028527665_02083 CDS open 74438-75220 _na     260_aa Thiazole synthase
3067 JAQPSI010000009.1 GCA028527665_02084 CDS open 75230-76462 _na     410_aa thiF ThiF family adenylyltransferase
3068 JAQPSI010000009.1 GCA028527665_02085 CDS open 76537-76704 _na     55_aa hypothetical protein
3069 JAQPSI010000009.1 GCA028527665_02086 CDS open 76890-79235 _na     781_aa S1 motif domain-containing protein
3070 JAQPSI010000009.1 GCA028527665_02087 CDS open 79326-80210 _na     294_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
3071 JAQPSI010000009.1 GCA028527665_02088 CDS open 80207-80770 _na     187_aa rimM ribosome maturation factor RimM
3072 JAQPSI010000009.1 GCA028527665_02089 CDS open 80816-81298 _na     160_aa rpsP 30S ribosomal protein S16
3073 JAQPSI010000009.1 GCA028527665_02090 CDS open 81710-83800 _na     696_aa Acyltransferase 3 domain-containing protein
3074 JAQPSI010000009.1 GCA028527665_02091 CDS open 83802-85376 _na     524_aa ffh signal recognition particle protein
3075 JAQPSI010000009.1 GCA028527665_02092 CDS open 85683-86075 _na     130_aa Monovalent cation/proton antiporter%2C MnhG/PhaG subunit
3076 JAQPSI010000009.1 GCA028527665_02093 CDS open 86075-86335 _na     86_aa Pesticidal protein Cry26Aa
3077 JAQPSI010000009.1 GCA028527665_02094 CDS open 86335-86706 _na     123_aa Na+/H+ ion antiporter subunit
3078 JAQPSI010000009.1 GCA028527665_02095 CDS open 86706-88298 _na     530_aa NADH:quinone oxidoreductase/Mrp antiporter transmembrane domain-containing protein
3079 JAQPSI010000009.1 GCA028527665_02096 CDS open 88298-88645 _na     115_aa Na(+)/H(+) antiporter subunit C
3080 JAQPSI010000009.1 GCA028527665_02097 CDS open 88649-91465 _na     938_aa DUF4040 domain-containing protein
3081 JAQPSI010000009.1 GCA028527665_02098 CDS open 91490-93037 _na     515_aa ftsY Signal recognition particle receptor FtsY
3082 JAQPSI010000009.1 GCA028527665_02099 CDS open 93125-93976 _na     283_aa ABC-type glycine betaine transport system substrate-binding domain-containing protein
3083 JAQPSI010000009.1 GCA028527665_02100 CDS open 94127-97594 _na     1155_aa smc chromosome segregation protein SMC
3084 JAQPSI010000009.1 GCA028527665_02101 CDS open 97634-99115 _na     493_aa Amino acid carrier protein
3085 JAQPSI010000009.1 GCA028527665_02102 CDS open 99135-100043 _na     302_aa mutM bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase
3086 JAQPSI010000009.1 GCA028527665_02103 CDS open 100049-100810 _na     253_aa rnc ribonuclease III
3087 JAQPSI010000009.1 GCA028527665_02104 CDS open 100803-101345 _na     180_aa DUF177 domain-containing protein
3088 JAQPSI010000009.1 GCA028527665_02105 CDS open 101377-102099 _na     240_aa DivIVA domain-containing protein
3089 JAQPSI010000009.1 GCA028527665_02106 CDS open 102193-103578 _na     461_aa gdhA NADP-specific glutamate dehydrogenase
3090 JAQPSI010000009.1 GCA028527665_02107 CDS open 103704-104918 _na     404_aa Glycerate kinase
3091 JAQPSI010000009.1 GCA028527665_02108 CDS open 104944-105342 _na     132_aa 2'-5' RNA ligase
3092 JAQPSI010000009.1 GCA028527665_02109 CDS open 105584-106921 _na     445_aa Protein G-related albumin-binding (GA) module domain-containing protein
3093 JAQPSI010000009.1 GCA028527665_02110 CDS open 107216-108556 _na     446_aa GA module-containing protein
3094 JAQPSI010000009.1 GCA028527665_02016 gene open 167-1531
3095 JAQPSI010000009.1 GCA028527665_02017 gene open 1550-2797
3096 JAQPSI010000009.1 GCA028527665_02018 gene open 2794-3363
3097 JAQPSI010000009.1 GCA028527665_02019 gene open 3480-5156 miaB
3098 JAQPSI010000009.1 GCA028527665_02020 gene open 5308-6246
3099 JAQPSI010000009.1 GCA028527665_02021 gene open 6246-7301
3100 JAQPSI010000009.1 GCA028527665_02022 gene open 7573-8241 recX
3101 JAQPSI010000009.1 GCA028527665_02023 gene open 8204-9355 recA
3102 JAQPSI010000009.1 GCA028527665_02024 gene open 9564-9779
3103 JAQPSI010000009.1 GCA028527665_02025 gene open 9825-10664
3104 JAQPSI010000009.1 GCA028527665_02026 gene open 10810-11301
3105 JAQPSI010000009.1 GCA028527665_02027 gene open 11357-11857 cinA
3106 JAQPSI010000009.1 GCA028527665_02028 gene open 11859-12419 pgsA
3107 JAQPSI010000009.1 GCA028527665_02029 gene open 12456-13469 terC
3108 JAQPSI010000009.1 GCA028527665_02030 gene open 13694-17221 ftsK
3109 JAQPSI010000009.1 GCA028527665_02031 gene open 17307-17933
3110 JAQPSI010000009.1 GCA028527665_02032 gene open 17982-20246
3111 JAQPSI010000009.1 GCA028527665_02033 gene open 20247-21155 dapA
3112 JAQPSI010000009.1 GCA028527665_02034 gene open 21273-22028 thyX
3113 JAQPSI010000009.1 GCA028527665_02035 gene open 22032-22781 dapB
3114 JAQPSI010000009.1 GCA028527665_02036 gene open 22927-23622
3115 JAQPSI010000009.1 GCA028527665_02037 gene open 23764-26070
3116 JAQPSI010000009.1 GCA028527665_02038 gene open 26304-26573 rpsO
3117 JAQPSI010000009.1 GCA028527665_02039 gene open 26729-27784
3118 JAQPSI010000009.1 GCA028527665_02040 gene open 27833-28816 truB
3119 JAQPSI010000009.1 GCA028527665_02041 gene open 28859-29536
3120 JAQPSI010000009.1 GCA028527665_02042 gene open 29533-30450
3121 JAQPSI010000009.1 GCA028527665_02043 gene open 30447-31799
3122 JAQPSI010000009.1 GCA028527665_02044 gene open 31796-32761
3123 JAQPSI010000009.1 GCA028527665_02045 gene open 32787-33218 rbfA
3124 JAQPSI010000009.1 GCA028527665_02046 gene open 33390-36284 infB
3125 JAQPSI010000009.1 GCA028527665_02047 gene open 36386-36694 ylxR
3126 JAQPSI010000009.1 GCA028527665_02048 gene open 36798-38045 nusA
3127 JAQPSI010000009.1 GCA028527665_02049 gene open 38057-38746 rimP
3128 JAQPSI010000009.1 GCA028527665_02050 gene open 38784-39653
3129 JAQPSI010000009.1 GCA028527665_02051 gene open 39663-40553 phzF
3130 JAQPSI010000009.1 GCA028527665_02052 gene open 40624-42450
3131 JAQPSI010000009.1 GCA028527665_02053 gene open 42506-43279 yaaA
3132 JAQPSI010000009.1 GCA028527665_02054 gene open 43475-44407
3133 JAQPSI010000009.1 GCA028527665_02055 gene open 44411-45877 selO
3134 JAQPSI010000009.1 GCA028527665_02056 gene open 46010-47440 mqo
3135 JAQPSI010000009.1 GCA028527665_02057 gene open 47773-48837
3136 JAQPSI010000009.1 GCA028527665_02058 gene open 48855-50282 mtr
3137 JAQPSI010000009.1 GCA028527665_02059 gene open 50381-51247 map
3138 JAQPSI010000009.1 GCA028527665_02060 gene open 51494-53347
3139 JAQPSI010000009.1 GCA028527665_02061 gene open 53380-54543 ispG
3140 JAQPSI010000009.1 GCA028527665_02062 gene open 54611-55831
3141 JAQPSI010000009.1 GCA028527665_02063 gene open 55900-57135 dxr
3142 JAQPSI010000009.1 GCA028527665_02064 gene open 57283-57720
3143 JAQPSI010000009.1 GCA028527665_02065 gene open 57883-59019 rlmN
3144 JAQPSI010000009.1 GCA028527665_02066 gene open 59051-59944
3145 JAQPSI010000009.1 GCA028527665_02067 gene open 60121-60678 frr
3146 JAQPSI010000009.1 GCA028527665_02068 gene open 60750-61490 pyrH
3147 JAQPSI010000009.1 GCA028527665_02069 gene open 61689-62516 tsf
3148 JAQPSI010000009.1 GCA028527665_02070 gene open 62592-63410 rpsB
3149 JAQPSI010000009.1 GCA028527665_02071 gene open 63835-64443
3150 JAQPSI010000009.1 GCA028527665_02072 gene open 64473-65426 xerC
3151 JAQPSI010000009.1 GCA028527665_02073 gene open 65505-66716 dprA
3152 JAQPSI010000009.1 GCA028527665_02074 gene open 66713-68263
3153 JAQPSI010000009.1 GCA028527665_02075 gene open 68250-68651 yraN
3154 JAQPSI010000009.1 GCA028527665_02076 gene open 68871-69179
3155 JAQPSI010000009.1 GCA028527665_02077 gene open 69303-69995
3156 JAQPSI010000009.1 GCA028527665_02078 gene open 70000-70662 lepB
3157 JAQPSI010000009.1 GCA028527665_02079 gene open 70718-71608 lepB
3158 JAQPSI010000009.1 GCA028527665_02080 gene open 71744-72088 rplS
3159 JAQPSI010000009.1 GCA028527665_02081 gene open 72266-74113 thiO
3160 JAQPSI010000009.1 GCA028527665_02082 gene open 74197-74430 thiS
3161 JAQPSI010000009.1 GCA028527665_02083 gene open 74438-75220
3162 JAQPSI010000009.1 GCA028527665_02084 gene open 75230-76462 thiF
3163 JAQPSI010000009.1 GCA028527665_02085 gene open 76537-76704
3164 JAQPSI010000009.1 GCA028527665_02086 gene open 76890-79235
3165 JAQPSI010000009.1 GCA028527665_02087 gene open 79326-80210 trmD
3166 JAQPSI010000009.1 GCA028527665_02088 gene open 80207-80770 rimM
3167 JAQPSI010000009.1 GCA028527665_02089 gene open 80816-81298 rpsP
3168 JAQPSI010000009.1 GCA028527665_02090 gene open 81710-83800
3169 JAQPSI010000009.1 GCA028527665_02091 gene open 83802-85376 ffh
3170 JAQPSI010000009.1 GCA028527665_02092 gene open 85683-86075
3171 JAQPSI010000009.1 GCA028527665_02093 gene open 86075-86335
3172 JAQPSI010000009.1 GCA028527665_02094 gene open 86335-86706
3173 JAQPSI010000009.1 GCA028527665_02095 gene open 86706-88298
3174 JAQPSI010000009.1 GCA028527665_02096 gene open 88298-88645
3175 JAQPSI010000009.1 GCA028527665_02097 gene open 88649-91465
3176 JAQPSI010000009.1 GCA028527665_02098 gene open 91490-93037 ftsY
3177 JAQPSI010000009.1 GCA028527665_02099 gene open 93125-93976
3178 JAQPSI010000009.1 GCA028527665_02100 gene open 94127-97594 smc
3179 JAQPSI010000009.1 GCA028527665_02101 gene open 97634-99115
3180 JAQPSI010000009.1 GCA028527665_02102 gene open 99135-100043 mutM
3181 JAQPSI010000009.1 GCA028527665_02103 gene open 100049-100810 rnc
3182 JAQPSI010000009.1 GCA028527665_02104 gene open 100803-101345
3183 JAQPSI010000009.1 GCA028527665_02105 gene open 101377-102099
3184 JAQPSI010000009.1 GCA028527665_02106 gene open 102193-103578 gdhA
3185 JAQPSI010000009.1 GCA028527665_02107 gene open 103704-104918
3186 JAQPSI010000009.1 GCA028527665_02108 gene open 104944-105342
3187 JAQPSI010000009.1 GCA028527665_02109 gene open 105584-106921
3188 JAQPSI010000009.1 GCA028527665_02110 gene open 107216-108556
3189 JAQPSI010000010.1 GCA028527665_00318 CDS open 285-1286 _na     333_aa Fe/B12 periplasmic-binding domain-containing protein
3190 JAQPSI010000010.1 GCA028527665_00319 CDS open 1323-2237 _na     304_aa Iron ABC transporter permease
3191 JAQPSI010000010.1 GCA028527665_00320 CDS open 2227-3192 _na     321_aa Enterobactin ABC transporter permease
3192 JAQPSI010000010.1 GCA028527665_00321 CDS open 3189-3947 _na     252_aa ABC transporter domain-containing protein
3193 JAQPSI010000010.1 GCA028527665_00322 CDS open 3992-4450 _na     152_aa cynS cyanase
3194 JAQPSI010000010.1 GCA028527665_00323 CDS open 4553-5179 _na     208_aa Methyltransferase domain-containing protein
3195 JAQPSI010000010.1 GCA028527665_00324 CDS open 5183-5893 _na     236_aa lysoplasmalogenase family protein
3196 JAQPSI010000010.1 GCA028527665_00325 CDS open 6006-6779 _na     257_aa Hemerythrin-like domain-containing protein
3197 JAQPSI010000010.1 GCA028527665_00326 CDS open 6844-7311 _na     155_aa Fido domain-containing protein
3198 JAQPSI010000010.1 GCA028527665_00327 CDS open 7333-7905 _na     190_aa Antitoxin SocA-like Panacea domain-containing protein
3199 JAQPSI010000010.1 GCA028527665_00328 CDS open 8310-9836 _na     508_aa Sodium:proton antiporter
3200 JAQPSI010000010.1 GCA028527665_00329 CDS open 10022-10708 _na     228_aa 4Fe-4S Mo/W bis-MGD-type domain-containing protein
3201 JAQPSI010000010.1 GCA028527665_00330 CDS open 10817-13441 _na     874_aa Formate dehydrogenase%2C alpha subunit
3202 JAQPSI010000010.1 GCA028527665_00331 CDS open 13448-14575 _na     375_aa 4Fe-4S ferredoxin-type domain-containing protein
3203 JAQPSI010000010.1 GCA028527665_00332 CDS open 14572-15690 _na     372_aa Nitrite reductase
3204 JAQPSI010000010.1 GCA028527665_00333 CDS open 15743-16798 _na     351_aa selD selenide%2C water dikinase SelD
3205 JAQPSI010000010.1 GCA028527665_00335 CDS open 17064-18434 _na     456_aa selA L-seryl-tRNA(Sec) selenium transferase
3206 JAQPSI010000010.1 GCA028527665_00336 CDS open 18435-20273 _na     612_aa selB selenocysteine-specific translation elongation factor
3207 JAQPSI010000010.1 GCA028527665_00337 CDS open 20447-21382 _na     311_aa BRCT domain-containing protein
3208 JAQPSI010000010.1 GCA028527665_00338 CDS open 21668-22288 _na     206_aa DUF4230 domain-containing protein
3209 JAQPSI010000010.1 GCA028527665_00339 CDS open 22541-23632 _na     363_aa Restriction endonuclease
3210 JAQPSI010000010.1 GCA028527665_00340 CDS open 23619-26198 _na     859_aa AAA family ATPase
3211 JAQPSI010000010.1 GCA028527665_00341 CDS open 26233-29088 _na     951_aa site-specific DNA-methyltransferase (adenine-specific)
3212 JAQPSI010000010.1 GCA028527665_00342 CDS open 29136-29297 _na     53_aa HNH endonuclease
3213 JAQPSI010000010.1 GCA028527665_00343 CDS open 29334-29675 _na     113_aa Helix-turn-helix transcriptional regulator
3214 JAQPSI010000010.1 GCA028527665_00344 CDS open 29672-30496 _na     274_aa ImmA/IrrE family metallo-endopeptidase
3215 JAQPSI010000010.1 GCA028527665_00345 CDS open 30496-31134 _na     212_aa DUF3800 domain-containing protein
3216 JAQPSI010000010.1 GCA028527665_00346 CDS open 31532-32023 _na     163_aa HTH cro/C1-type domain-containing protein
3217 JAQPSI010000010.1 GCA028527665_00347 CDS open 32202-33518 _na     438_aa DUF2254 domain-containing protein
3218 JAQPSI010000010.1 GCA028527665_00348 CDS open 33876-35075 _na     399_aa Peptidase M24 domain-containing protein
3219 JAQPSI010000010.1 GCA028527665_00349 CDS open 35230-36225 _na     331_aa MaoC-like domain-containing protein
3220 JAQPSI010000010.1 GCA028527665_00350 CDS open 36258-37574 _na     438_aa 3-oxoacyl-ACP reductase
3221 JAQPSI010000010.1 GCA028527665_00351 CDS open 37735-39030 _na     431_aa acetyl-CoA C-acetyltransferase
3222 JAQPSI010000010.1 GCA028527665_00352 CDS open 39135-41285 _na     716_aa Acyl-CoA oxidase
3223 JAQPSI010000010.1 GCA028527665_00353 CDS open 41282-42283 _na     333_aa prephenate dehydrogenase
3224 JAQPSI010000010.1 GCA028527665_00354 CDS open 42350-42844 _na     164_aa tRNA adenosine deaminase-associated protein
3225 JAQPSI010000010.1 GCA028527665_00355 CDS open 42857-43477 _na     206_aa tRNA-specific adenosine deaminase
3226 JAQPSI010000010.1 GCA028527665_00356 CDS open 43535-43759 _na     74_aa CsbD-like domain-containing protein
3227 JAQPSI010000010.1 GCA028527665_00358 CDS open 44496-46973 _na     825_aa SSD domain-containing protein
3228 JAQPSI010000010.1 GCA028527665_00359 CDS open 46998-48248 _na     416_aa tgt tRNA guanosine(34) transglycosylase Tgt
3229 JAQPSI010000010.1 GCA028527665_00360 CDS open 48211-49194 _na     327_aa gluQRS tRNA glutamyl-Q(34) synthetase GluQRS
3230 JAQPSI010000010.1 GCA028527665_00361 CDS open 49244-49957 _na     237_aa HTH tetR-type domain-containing protein
3231 JAQPSI010000010.1 GCA028527665_00362 CDS open 49954-51498 _na     514_aa Major facilitator superfamily (MFS) profile domain-containing protein
3232 JAQPSI010000010.1 GCA028527665_00363 CDS open 51840-53849 _na     669_aa Betaine/carnitine/choline transporter (BCCT) family transporter
3233 JAQPSI010000010.1 GCA028527665_00364 CDS open 53908-54192 _na     94_aa Antitoxin
3234 JAQPSI010000010.1 GCA028527665_00365 CDS open 54271-55344 _na     357_aa Tellurite resistance protein
3235 JAQPSI010000010.1 GCA028527665_00366 CDS open 55373-56728 _na     451_aa Major facilitator superfamily (MFS) profile domain-containing protein
3236 JAQPSI010000010.1 GCA028527665_00367 CDS open 56874-57905 _na     343_aa C4-dicarboxylate transporter/malic acid transporter
3237 JAQPSI010000010.1 GCA028527665_00368 CDS open 57952-58683 _na     243_aa ABC-2 type transporter domain-containing protein
3238 JAQPSI010000010.1 GCA028527665_00369 CDS open 58687-59619 _na     310_aa ABC transporter domain-containing protein
3239 JAQPSI010000010.1 GCA028527665_00370 CDS open 59706-60413 _na     235_aa DNA-binding response regulator
3240 JAQPSI010000010.1 GCA028527665_00371 CDS open 60431-61603 _na     390_aa histidine kinase
3241 JAQPSI010000010.1 GCA028527665_00372 CDS open 61660-62280 _na     206_aa NADPH-dependent FMN reductase
3242 JAQPSI010000010.1 GCA028527665_00373 CDS open 62417-62698 _na     93_aa Transcriptional regulator
3243 JAQPSI010000010.1 GCA028527665_00374 CDS open 62881-64146 _na     421_aa ABC transporter ATP-binding protein
3244 JAQPSI010000010.1 GCA028527665_00375 CDS open 64178-64534 _na     118_aa ABC transporter transmembrane domain-containing protein
3245 JAQPSI010000010.1 GCA028527665_00376 CDS open 64521-64661 _na     46_aa hypothetical protein
3246 JAQPSI010000010.1 GCA028527665_00377 CDS open 64704-65054 _na     116_aa Transposase
3247 JAQPSI010000010.1 GCA028527665_00378 CDS open 65008-65427 _na     139_aa DDE-type integrase/transposase/recombinase
3248 JAQPSI010000010.1 GCA028527665_00379 CDS open 65577-65900 _na     107_aa IS3 family transposase
3249 JAQPSI010000010.1 GCA028527665_00380 CDS open 66539-66790 _na     83_aa Mutator family transposase
3250 JAQPSI010000010.1 GCA028527665_00381 CDS open 66845-67276 _na     143_aa Bacterial Pleckstrin-like y domain-containing protein
3251 JAQPSI010000010.1 GCA028527665_00382 CDS open 67295-68230 _na     311_aa hypothetical protein
3252 JAQPSI010000010.1 GCA028527665_00383 CDS open 68224-68472 _na     82_aa hypothetical protein
3253 JAQPSI010000010.1 GCA028527665_00384 CDS open 68797-69537 _na     246_aa hypothetical protein
3254 JAQPSI010000010.1 GCA028527665_00385 CDS open 70514-70765 _na     83_aa integrase core domain-containing protein
3255 JAQPSI010000010.1 GCA028527665_00387 CDS open 71243-72745 _na     500_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
3256 JAQPSI010000010.1 GCA028527665_00388 CDS open 72749-74095 _na     448_aa DUF3068 domain-containing protein
3257 JAQPSI010000010.1 GCA028527665_00389 CDS open 74221-75357 _na     378_aa Acyltransferase 3 domain-containing protein
3258 JAQPSI010000010.1 GCA028527665_00390 CDS open 75264-78743 _na     1159_aa Arabinofuranosyl transferase
3259 JAQPSI010000010.1 GCA028527665_00391 CDS open 78751-78960 _na     69_aa DUF2613 domain-containing protein
3260 JAQPSI010000010.1 GCA028527665_00392 CDS open 79002-79517 _na     171_aa uspA UspA domain-containing protein
3261 JAQPSI010000010.1 GCA028527665_00393 CDS open 79643-81286 _na     547_aa YoaR-like putative peptidoglycan binding domain-containing protein
3262 JAQPSI010000010.1 GCA028527665_00394 CDS open 81350-81913 _na     187_aa dcd dCTP deaminase
3263 JAQPSI010000010.1 GCA028527665_00395 CDS open 81954-83348 _na     464_aa UDP-glucose 6-dehydrogenase
3264 JAQPSI010000010.1 GCA028527665_00396 CDS open 83747-84229 _na     160_aa Ferritin
3265 JAQPSI010000010.1 GCA028527665_00318 gene open 285-1286
3266 JAQPSI010000010.1 GCA028527665_00319 gene open 1323-2237
3267 JAQPSI010000010.1 GCA028527665_00320 gene open 2227-3192
3268 JAQPSI010000010.1 GCA028527665_00321 gene open 3189-3947
3269 JAQPSI010000010.1 GCA028527665_00322 gene open 3992-4450 cynS
3270 JAQPSI010000010.1 GCA028527665_00323 gene open 4553-5179
3271 JAQPSI010000010.1 GCA028527665_00324 gene open 5183-5893
3272 JAQPSI010000010.1 GCA028527665_00325 gene open 6006-6779
3273 JAQPSI010000010.1 GCA028527665_00326 gene open 6844-7311
3274 JAQPSI010000010.1 GCA028527665_00327 gene open 7333-7905
3275 JAQPSI010000010.1 GCA028527665_00328 gene open 8310-9836
3276 JAQPSI010000010.1 GCA028527665_00329 gene open 10022-10708
3277 JAQPSI010000010.1 GCA028527665_00330 gene open 10817-13441
3278 JAQPSI010000010.1 GCA028527665_00331 gene open 13448-14575
3279 JAQPSI010000010.1 GCA028527665_00332 gene open 14572-15690
3280 JAQPSI010000010.1 GCA028527665_00333 gene open 15743-16798 selD
3281 JAQPSI010000010.1 GCA028527665_00335 gene open 17064-18434 selA
3282 JAQPSI010000010.1 GCA028527665_00336 gene open 18435-20273 selB
3283 JAQPSI010000010.1 GCA028527665_00337 gene open 20447-21382
3284 JAQPSI010000010.1 GCA028527665_00338 gene open 21668-22288
3285 JAQPSI010000010.1 GCA028527665_00339 gene open 22541-23632
3286 JAQPSI010000010.1 GCA028527665_00340 gene open 23619-26198
3287 JAQPSI010000010.1 GCA028527665_00341 gene open 26233-29088
3288 JAQPSI010000010.1 GCA028527665_00342 gene open 29136-29297
3289 JAQPSI010000010.1 GCA028527665_00343 gene open 29334-29675
3290 JAQPSI010000010.1 GCA028527665_00344 gene open 29672-30496
3291 JAQPSI010000010.1 GCA028527665_00345 gene open 30496-31134
3292 JAQPSI010000010.1 GCA028527665_00346 gene open 31532-32023
3293 JAQPSI010000010.1 GCA028527665_00347 gene open 32202-33518
3294 JAQPSI010000010.1 GCA028527665_00348 gene open 33876-35075
3295 JAQPSI010000010.1 GCA028527665_00349 gene open 35230-36225
3296 JAQPSI010000010.1 GCA028527665_00350 gene open 36258-37574
3297 JAQPSI010000010.1 GCA028527665_00351 gene open 37735-39030
3298 JAQPSI010000010.1 GCA028527665_00352 gene open 39135-41285
3299 JAQPSI010000010.1 GCA028527665_00353 gene open 41282-42283
3300 JAQPSI010000010.1 GCA028527665_00354 gene open 42350-42844
3301 JAQPSI010000010.1 GCA028527665_00355 gene open 42857-43477
3302 JAQPSI010000010.1 GCA028527665_00356 gene open 43535-43759
3303 JAQPSI010000010.1 GCA028527665_00358 gene open 44496-46973
3304 JAQPSI010000010.1 GCA028527665_00359 gene open 46998-48248 tgt
3305 JAQPSI010000010.1 GCA028527665_00360 gene open 48211-49194 gluQRS
3306 JAQPSI010000010.1 GCA028527665_00361 gene open 49244-49957
3307 JAQPSI010000010.1 GCA028527665_00362 gene open 49954-51498
3308 JAQPSI010000010.1 GCA028527665_00363 gene open 51840-53849
3309 JAQPSI010000010.1 GCA028527665_00364 gene open 53908-54192
3310 JAQPSI010000010.1 GCA028527665_00365 gene open 54271-55344
3311 JAQPSI010000010.1 GCA028527665_00366 gene open 55373-56728
3312 JAQPSI010000010.1 GCA028527665_00367 gene open 56874-57905
3313 JAQPSI010000010.1 GCA028527665_00368 gene open 57952-58683
3314 JAQPSI010000010.1 GCA028527665_00369 gene open 58687-59619
3315 JAQPSI010000010.1 GCA028527665_00370 gene open 59706-60413
3316 JAQPSI010000010.1 GCA028527665_00371 gene open 60431-61603
3317 JAQPSI010000010.1 GCA028527665_00372 gene open 61660-62280
3318 JAQPSI010000010.1 GCA028527665_00373 gene open 62417-62698
3319 JAQPSI010000010.1 GCA028527665_00374 gene open 62881-64146
3320 JAQPSI010000010.1 GCA028527665_00375 gene open 64178-64534
3321 JAQPSI010000010.1 GCA028527665_00376 gene open 64521-64661
3322 JAQPSI010000010.1 GCA028527665_00377 gene open 64704-65054
3323 JAQPSI010000010.1 GCA028527665_00378 gene open 65008-65427
3324 JAQPSI010000010.1 GCA028527665_00379 gene open 65577-65900
3325 JAQPSI010000010.1 GCA028527665_00380 gene open 66539-66790
3326 JAQPSI010000010.1 GCA028527665_00381 gene open 66845-67276
3327 JAQPSI010000010.1 GCA028527665_00382 gene open 67295-68230
3328 JAQPSI010000010.1 GCA028527665_00383 gene open 68224-68472
3329 JAQPSI010000010.1 GCA028527665_00384 gene open 68797-69537
3330 JAQPSI010000010.1 GCA028527665_00385 gene open 70514-70765
3331 JAQPSI010000010.1 GCA028527665_00387 gene open 71243-72745
3332 JAQPSI010000010.1 GCA028527665_00388 gene open 72749-74095
3333 JAQPSI010000010.1 GCA028527665_00389 gene open 74221-75357
3334 JAQPSI010000010.1 GCA028527665_00390 gene open 75264-78743
3335 JAQPSI010000010.1 GCA028527665_00391 gene open 78751-78960
3336 JAQPSI010000010.1 GCA028527665_00392 gene open 79002-79517 uspA
3337 JAQPSI010000010.1 GCA028527665_00393 gene open 79643-81286
3338 JAQPSI010000010.1 GCA028527665_00394 gene open 81350-81913 dcd
3339 JAQPSI010000010.1 GCA028527665_00395 gene open 81954-83348
3340 JAQPSI010000010.1 GCA028527665_00396 gene open 83747-84229
3341 JAQPSI010000010.1 GCA028527665_00334 gene open 16898-16993 trnU
3342 JAQPSI010000010.1 GCA028527665_00357 gene open 44218-44308 trnS
3343 JAQPSI010000010.1 GCA028527665_00386 gene open 71083-71171 trnS
3344 JAQPSI010000010.1 GCA028527665_00334 tRNA open 16898-16993 trnU tRNA-SeC(tca)
3345 JAQPSI010000010.1 GCA028527665_00357 tRNA open 44218-44308 trnS tRNA-Ser(cga)
3346 JAQPSI010000010.1 GCA028527665_00386 tRNA open 71083-71171 trnS tRNA-Ser(gga)
3347 JAQPSI010000011.1 repeat_region open 67905-68736 CRISPR array with 14 repeats of length 28%2C consensus sequence GGCTCATCCCCGCATGCGCGGGGAAAAC and spacer length 33
3348 JAQPSI010000011.1 GCA028527665_00398 CDS open 234-1817 _na     527_aa Divalent anion:Na+ symporter (DASS) family transporter
3349 JAQPSI010000011.1 GCA028527665_00399 CDS open 1884-3248 _na     454_aa mgtE magnesium transporter
3350 JAQPSI010000011.1 GCA028527665_00400 CDS open 3394-4134 _na     246_aa DUF2470 domain-containing protein
3351 JAQPSI010000011.1 GCA028527665_00401 CDS open 4164-5552 _na     462_aa Heparan-alpha-glucosaminide N-acetyltransferase catalytic domain-containing protein
3352 JAQPSI010000011.1 GCA028527665_00403 CDS open 5817-6851 _na     344_aa hisC histidinol-phosphate transaminase
3353 JAQPSI010000011.1 GCA028527665_00404 CDS open 6851-7270 _na     139_aa Phage holin family protein
3354 JAQPSI010000011.1 GCA028527665_00405 CDS open 7457-7678 _na     73_aa Cell wall anchor protein
3355 JAQPSI010000011.1 GCA028527665_00407 CDS open 7961-9001 _na     346_aa Enoyl reductase (ER) domain-containing protein
3356 JAQPSI010000011.1 GCA028527665_00408 CDS open 8998-10233 _na     411_aa Aminotransferase class V domain-containing protein
3357 JAQPSI010000011.1 GCA028527665_00409 CDS open 10390-11307 _na     305_aa ABC-2 type transporter transmembrane domain-containing protein
3358 JAQPSI010000011.1 GCA028527665_00410 CDS open 11353-12138 _na     261_aa ABC transporter domain-containing protein
3359 JAQPSI010000011.1 GCA028527665_00411 CDS open 12183-13127 _na     314_aa Glycosyltransferase 2-like domain-containing protein
3360 JAQPSI010000011.1 GCA028527665_00412 CDS open 13204-13740 _na     178_aa Suppressor of fused-like domain-containing protein
3361 JAQPSI010000011.1 GCA028527665_00413 CDS open 13777-14244 _na     155_aa GtrA/DPMS transmembrane domain-containing protein
3362 JAQPSI010000011.1 GCA028527665_00414 CDS open 14313-15170 _na     285_aa DUF2877 domain-containing protein
3363 JAQPSI010000011.1 GCA028527665_00415 CDS open 15237-15485 _na     82_aa hypothetical protein
3364 JAQPSI010000011.1 GCA028527665_00416 CDS open 15494-16909 _na     471_aa FAD-binding PCMH-type domain-containing protein
3365 JAQPSI010000011.1 GCA028527665_00417 CDS open 16958-17719 _na     253_aa decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase
3366 JAQPSI010000011.1 GCA028527665_00418 CDS open 17750-19663 _na     637_aa Galactan 5-O-arabinofuranosyltransferase
3367 JAQPSI010000011.1 GCA028527665_00419 CDS open 19754-23089 _na     1111_aa Arabinosyltransferase C
3368 JAQPSI010000011.1 GCA028527665_00420 CDS open 23093-25117 _na     674_aa Galactan 5-O-arabinofuranosyltransferase
3369 JAQPSI010000011.1 GCA028527665_00421 CDS open 25142-26074 _na     310_aa NAD-dependent epimerase/dehydratase domain-containing protein
3370 JAQPSI010000011.1 GCA028527665_00422 CDS open 26135-26542 _na     135_aa DUF2304 domain-containing protein
3371 JAQPSI010000011.1 GCA028527665_00423 CDS open 26543-27235 _na     230_aa Glycosyltransferase 2-like domain-containing protein
3372 JAQPSI010000011.1 GCA028527665_00424 CDS open 27252-28592 _na     446_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
3373 JAQPSI010000011.1 GCA028527665_00425 CDS open 28605-29498 _na     297_aa Glycosyltransferase 2-like domain-containing protein
3374 JAQPSI010000011.1 GCA028527665_00426 CDS open 29498-30403 _na     301_aa Alpha/beta hydrolase fold domain-containing protein
3375 JAQPSI010000011.1 GCA028527665_00427 CDS open 30521-31135 _na     204_aa Maltokinase N-terminal cap domain-containing protein
3376 JAQPSI010000011.1 GCA028527665_00428 CDS open 31181-33166 _na     661_aa Peptidase M13
3377 JAQPSI010000011.1 GCA028527665_00429 CDS open 33195-33896 _na     233_aa DUF3515 domain-containing protein
3378 JAQPSI010000011.1 GCA028527665_00430 CDS open 33899-34753 _na     284_aa prsW Protease PrsW
3379 JAQPSI010000011.1 GCA028527665_00431 CDS open 34754-36352 _na     532_aa Aldehyde dehydrogenase domain-containing protein
3380 JAQPSI010000011.1 GCA028527665_00432 CDS open 36435-37196 _na     253_aa Peptidase S1 domain-containing protein
3381 JAQPSI010000011.1 GCA028527665_00433 CDS open 37355-38296 _na     313_aa Peptidase S1 domain-containing protein
3382 JAQPSI010000011.1 GCA028527665_00434 CDS open 38424-38597 _na     57_aa hypothetical protein
3383 JAQPSI010000011.1 GCA028527665_00435 CDS open 38734-40893 _na     719_aa High-affinity choline transporter
3384 JAQPSI010000011.1 GCA028527665_00436 CDS open 41099-42901 _na     600_aa betA choline dehydrogenase
3385 JAQPSI010000011.1 GCA028527665_00437 CDS open 42918-44507 _na     529_aa PepSY domain-containing protein
3386 JAQPSI010000011.1 GCA028527665_00438 CDS open 44735-45664 _na     309_aa aldose epimerase
3387 JAQPSI010000011.1 GCA028527665_00439 CDS open 45833-47488 _na     551_aa Solute:sodium symporter (SSS) family transporter
3388 JAQPSI010000011.1 GCA028527665_00440 CDS open 47507-47839 _na     110_aa Cell wall anchor protein
3389 JAQPSI010000011.1 GCA028527665_00441 CDS open 47854-49098 _na     414_aa galT galactose-1-phosphate uridylyltransferase
3390 JAQPSI010000011.1 GCA028527665_00442 CDS open 49091-50392 _na     433_aa galK galactokinase
3391 JAQPSI010000011.1 GCA028527665_00443 CDS open 50544-50948 _na     134_aa panD aspartate 1-decarboxylase
3392 JAQPSI010000011.1 GCA028527665_00444 CDS open 50950-52410 _na     486_aa Divalent anion:Na+ symporter (DASS) family transporter
3393 JAQPSI010000011.1 GCA028527665_00445 CDS open 52427-53734 _na     435_aa dcuA C4-dicarboxylate transporter DcuA
3394 JAQPSI010000011.1 GCA028527665_00446 CDS open 54270-55907 _na     545_aa HNH nuclease domain-containing protein
3395 JAQPSI010000011.1 GCA028527665_00447 CDS open 56162-56926 _na     254_aa MOSC domain-containing protein
3396 JAQPSI010000011.1 GCA028527665_00448 CDS open 57053-58417 _na     454_aa Major facilitator superfamily (MFS) profile domain-containing protein
3397 JAQPSI010000011.1 GCA028527665_00449 CDS open 58642-59472 _na     276_aa VOC domain-containing protein
3398 JAQPSI010000011.1 GCA028527665_00450 CDS open 59472-59780 _na     102_aa RNA-binding S4 domain-containing protein
3399 JAQPSI010000011.1 GCA028527665_00451 CDS open 59814-60533 _na     239_aa SDR family oxidoreductase
3400 JAQPSI010000011.1 GCA028527665_00452 CDS open 60575-61627 _na     350_aa Ammonia monooxygenase
3401 JAQPSI010000011.1 GCA028527665_00453 CDS open 62134-62436 _na     100_aa hypothetical protein
3402 JAQPSI010000011.1 GCA028527665_00454 CDS open 62686-63516 _na     276_aa yaeC YaeC family lipoprotein
3403 JAQPSI010000011.1 GCA028527665_00455 CDS open 63547-64605 _na     352_aa ABC transporter domain-containing protein
3404 JAQPSI010000011.1 GCA028527665_00456 CDS open 64605-65282 _na     225_aa ABC transmembrane type-1 domain-containing protein
3405 JAQPSI010000011.1 GCA028527665_00457 CDS open 65906-66292 _na     128_aa hypothetical protein
3406 JAQPSI010000011.1 GCA028527665_00458 CDS open 66621-66968 _na     115_aa HTH cro/C1-type domain-containing protein
3407 JAQPSI010000011.1 GCA028527665_00459 CDS open 66971-67132 _na     53_aa hypothetical protein
3408 JAQPSI010000011.1 GCA028527665_00460 CDS open 67252-67491 _na     79_aa hypothetical protein
3409 JAQPSI010000011.1 GCA028527665_00461 CDS open 67488-67739 _na     83_aa hypothetical protein
3410 JAQPSI010000011.1 GCA028527665_00462 CDS open 69042-71885 _na     947_aa CRISPR-associated helicase Cas3
3411 JAQPSI010000011.1 GCA028527665_00398 gene open 234-1817
3412 JAQPSI010000011.1 GCA028527665_00399 gene open 1884-3248 mgtE
3413 JAQPSI010000011.1 GCA028527665_00400 gene open 3394-4134
3414 JAQPSI010000011.1 GCA028527665_00401 gene open 4164-5552
3415 JAQPSI010000011.1 GCA028527665_00403 gene open 5817-6851 hisC
3416 JAQPSI010000011.1 GCA028527665_00404 gene open 6851-7270
3417 JAQPSI010000011.1 GCA028527665_00405 gene open 7457-7678
3418 JAQPSI010000011.1 GCA028527665_00407 gene open 7961-9001
3419 JAQPSI010000011.1 GCA028527665_00408 gene open 8998-10233
3420 JAQPSI010000011.1 GCA028527665_00409 gene open 10390-11307
3421 JAQPSI010000011.1 GCA028527665_00410 gene open 11353-12138
3422 JAQPSI010000011.1 GCA028527665_00411 gene open 12183-13127
3423 JAQPSI010000011.1 GCA028527665_00412 gene open 13204-13740
3424 JAQPSI010000011.1 GCA028527665_00413 gene open 13777-14244
3425 JAQPSI010000011.1 GCA028527665_00414 gene open 14313-15170
3426 JAQPSI010000011.1 GCA028527665_00415 gene open 15237-15485
3427 JAQPSI010000011.1 GCA028527665_00416 gene open 15494-16909
3428 JAQPSI010000011.1 GCA028527665_00417 gene open 16958-17719
3429 JAQPSI010000011.1 GCA028527665_00418 gene open 17750-19663
3430 JAQPSI010000011.1 GCA028527665_00419 gene open 19754-23089
3431 JAQPSI010000011.1 GCA028527665_00420 gene open 23093-25117
3432 JAQPSI010000011.1 GCA028527665_00421 gene open 25142-26074
3433 JAQPSI010000011.1 GCA028527665_00422 gene open 26135-26542
3434 JAQPSI010000011.1 GCA028527665_00423 gene open 26543-27235
3435 JAQPSI010000011.1 GCA028527665_00424 gene open 27252-28592
3436 JAQPSI010000011.1 GCA028527665_00425 gene open 28605-29498
3437 JAQPSI010000011.1 GCA028527665_00426 gene open 29498-30403
3438 JAQPSI010000011.1 GCA028527665_00427 gene open 30521-31135
3439 JAQPSI010000011.1 GCA028527665_00428 gene open 31181-33166
3440 JAQPSI010000011.1 GCA028527665_00429 gene open 33195-33896
3441 JAQPSI010000011.1 GCA028527665_00430 gene open 33899-34753 prsW
3442 JAQPSI010000011.1 GCA028527665_00431 gene open 34754-36352
3443 JAQPSI010000011.1 GCA028527665_00432 gene open 36435-37196
3444 JAQPSI010000011.1 GCA028527665_00433 gene open 37355-38296
3445 JAQPSI010000011.1 GCA028527665_00434 gene open 38424-38597
3446 JAQPSI010000011.1 GCA028527665_00435 gene open 38734-40893
3447 JAQPSI010000011.1 GCA028527665_00436 gene open 41099-42901 betA
3448 JAQPSI010000011.1 GCA028527665_00437 gene open 42918-44507
3449 JAQPSI010000011.1 GCA028527665_00438 gene open 44735-45664
3450 JAQPSI010000011.1 GCA028527665_00439 gene open 45833-47488
3451 JAQPSI010000011.1 GCA028527665_00440 gene open 47507-47839
3452 JAQPSI010000011.1 GCA028527665_00441 gene open 47854-49098 galT
3453 JAQPSI010000011.1 GCA028527665_00442 gene open 49091-50392 galK
3454 JAQPSI010000011.1 GCA028527665_00443 gene open 50544-50948 panD
3455 JAQPSI010000011.1 GCA028527665_00444 gene open 50950-52410
3456 JAQPSI010000011.1 GCA028527665_00445 gene open 52427-53734 dcuA
3457 JAQPSI010000011.1 GCA028527665_00446 gene open 54270-55907
3458 JAQPSI010000011.1 GCA028527665_00447 gene open 56162-56926
3459 JAQPSI010000011.1 GCA028527665_00448 gene open 57053-58417
3460 JAQPSI010000011.1 GCA028527665_00449 gene open 58642-59472
3461 JAQPSI010000011.1 GCA028527665_00450 gene open 59472-59780
3462 JAQPSI010000011.1 GCA028527665_00451 gene open 59814-60533
3463 JAQPSI010000011.1 GCA028527665_00452 gene open 60575-61627
3464 JAQPSI010000011.1 GCA028527665_00453 gene open 62134-62436
3465 JAQPSI010000011.1 GCA028527665_00454 gene open 62686-63516 yaeC
3466 JAQPSI010000011.1 GCA028527665_00455 gene open 63547-64605
3467 JAQPSI010000011.1 GCA028527665_00456 gene open 64605-65282
3468 JAQPSI010000011.1 GCA028527665_00457 gene open 65906-66292
3469 JAQPSI010000011.1 GCA028527665_00458 gene open 66621-66968
3470 JAQPSI010000011.1 GCA028527665_00459 gene open 66971-67132
3471 JAQPSI010000011.1 GCA028527665_00460 gene open 67252-67491
3472 JAQPSI010000011.1 GCA028527665_00461 gene open 67488-67739
3473 JAQPSI010000011.1 GCA028527665_00462 gene open 69042-71885
3474 JAQPSI010000011.1 GCA028527665_00397 gene open 4-76 trnR
3475 JAQPSI010000011.1 GCA028527665_00402 gene open 5648-5736 trnS
3476 JAQPSI010000011.1 GCA028527665_00406 gene open 7846-7933 trnS
3477 JAQPSI010000011.1 GCA028527665_00397 tRNA open 4-76 trnR tRNA-Arg(acg)
3478 JAQPSI010000011.1 GCA028527665_00402 tRNA open 5648-5736 trnS tRNA-Ser(gct)
3479 JAQPSI010000011.1 GCA028527665_00406 tRNA open 7846-7933 trnS tRNA-Ser(tga)
3480 JAQPSI010000012.1 GCA028527665_00464 CDS open 361-900 _na     179_aa YbhB/YbcL family Raf kinase inhibitor-like protein
3481 JAQPSI010000012.1 GCA028527665_00465 CDS open 924-1340 _na     138_aa MFS transporter
3482 JAQPSI010000012.1 GCA028527665_00466 CDS open 1337-2512 _na     391_aa quinone-dependent dihydroorotate dehydrogenase
3483 JAQPSI010000012.1 GCA028527665_00467 CDS open 2515-3483 _na     322_aa lppL Prolipoprotein LppL
3484 JAQPSI010000012.1 GCA028527665_00468 CDS open 3573-4598 _na     341_aa undecaprenyl-diphosphate phosphatase
3485 JAQPSI010000012.1 GCA028527665_00469 CDS open 4620-5873 _na     417_aa mshC cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase
3486 JAQPSI010000012.1 GCA028527665_00470 CDS open 5892-6164 _na     90_aa phosphoribosyl-ATP diphosphatase
3487 JAQPSI010000012.1 GCA028527665_00471 CDS open 6189-7034 _na     281_aa hisG ATP phosphoribosyltransferase
3488 JAQPSI010000012.1 GCA028527665_00472 CDS open 7110-8630 _na     506_aa aspA aspartate ammonia-lyase
3489 JAQPSI010000012.1 GCA028527665_00473 CDS open 8737-10410 _na     557_aa formate--tetrahydrofolate ligase
3490 JAQPSI010000012.1 GCA028527665_00474 CDS open 10500-11354 _na     284_aa PD-(D/E)XK endonuclease-like domain-containing protein
3491 JAQPSI010000012.1 GCA028527665_00475 CDS open 11446-12732 _na     428_aa M18 family aminopeptidase
3492 JAQPSI010000012.1 GCA028527665_00476 CDS open 12836-13672 _na     278_aa trmI tRNA (adenine(58)-N(1))-methyltransferase TrmI
3493 JAQPSI010000012.1 GCA028527665_00477 CDS open 13897-15423 _na     508_aa arc proteasome ATPase
3494 JAQPSI010000012.1 GCA028527665_00478 CDS open 15366-17066 _na     566_aa dop depupylase/deamidase Dop
3495 JAQPSI010000012.1 GCA028527665_00479 CDS open 17193-17402 _na     69_aa Prokaryotic ubiquitin-like protein Pup
3496 JAQPSI010000012.1 GCA028527665_00480 CDS open 17399-18835 _na     478_aa pafA Pup--protein ligase
3497 JAQPSI010000012.1 GCA028527665_00481 CDS open 18841-19848 _na     335_aa WYL domain-containing protein
3498 JAQPSI010000012.1 GCA028527665_00482 CDS open 19845-20846 _na     333_aa WYL domain-containing protein
3499 JAQPSI010000012.1 GCA028527665_00483 CDS open 20910-21233 _na     107_aa tatA Sec-independent protein translocase subunit TatA
3500 JAQPSI010000012.1 GCA028527665_00484 CDS open 21497-22435 _na     312_aa tatC twin-arginine translocase subunit TatC