HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Pseudomonas oleovorans (GCA_029843895.1)

Select a Genome:
BAKTA Annotations for GCA_029843895.1
Genome Selected: Pseudomonas oleovorans
ContigsBases CDSrRNA tmRNAtRNA
3 4684111 4442 12 1 65
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 9129 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 9129 [19 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer
Range
(bp)
Show Sequences
(length) NA / AA
BAKTA
Gene
BAKTA
GeneProduct
1 JAOCJE010000001.1 GCA029843895_02776 gene open 2888442-2888833 ssrA
2 JAOCJE010000001.1 GCA029843895_02776 tmRNA open 2888442-2888833 ssrA transfer-messenger RNA%2C SsrA
3 JAOCJE010000001.1 rep_origin open 1728068-1728557
4 JAOCJE010000001.1 rep_origin open 1734943-1735462
5 JAOCJE010000001.1 GCA029843895_00109 gene open 102316-102511 rgsA
6 JAOCJE010000001.1 GCA029843895_00166 gene open 156820-156952 PrrB_RsmZ
7 JAOCJE010000001.1 GCA029843895_00320 gene open 319443-319551 rsmX
8 JAOCJE010000001.1 GCA029843895_00617 gene open 620661-620776 rrf
9 JAOCJE010000001.1 GCA029843895_00618 gene open 620916-623808 rrl
10 JAOCJE010000001.1 GCA029843895_00621 gene open 624327-625863 rrs
11 JAOCJE010000001.1 GCA029843895_00639 gene open 644972-645121 prrF
12 JAOCJE010000001.1 GCA029843895_00655 gene open 661708-662093 crcZ
13 JAOCJE010000001.1 GCA029843895_00688 gene open 697990-698068 P31
14 JAOCJE010000001.1 GCA029843895_00814 gene open 824080-824329 P24
15 JAOCJE010000001.1 GCA029843895_00986 gene open 991099-991164 P26
16 JAOCJE010000001.1 GCA029843895_00989 gene open 992119-992317 P27
17 JAOCJE010000001.1 GCA029843895_01002 gene open 999152-999267 rrf
18 JAOCJE010000001.1 GCA029843895_01003 gene open 999407-1002299 rrl
19 JAOCJE010000001.1 GCA029843895_01006 gene open 1002818-1004354 rrs
20 JAOCJE010000001.1 GCA029843895_01087 gene open 1092179-1092297 rsmY
21 JAOCJE010000001.1 GCA029843895_01389 gene open 1423977-1424092 rrf
22 JAOCJE010000001.1 GCA029843895_01390 gene open 1424242-1427134 rrl
23 JAOCJE010000001.1 GCA029843895_01393 gene open 1427653-1429189 rrs
24 JAOCJE010000001.1 GCA029843895_01791 gene open 1859768-1859884 Pseudomon-1
25 JAOCJE010000001.1 GCA029843895_01927 gene open 2003402-2003580 6S
26 JAOCJE010000001.1 GCA029843895_01952 gene open 2024904-2025083 P1
27 JAOCJE010000001.1 GCA029843895_02073 gene open 2159448-2159595 proV
28 JAOCJE010000001.1 GCA029843895_02129 gene open 2217319-2217613 asponA
29 JAOCJE010000001.1 GCA029843895_02322 gene open 2421863-2422146 5_ureB_sRNA
30 JAOCJE010000001.1 GCA029843895_02527 gene open 2640656-2641003 RNaseP_bact_a
31 JAOCJE010000001.1 GCA029843895_03109 gene open 3204023-3204240 phrS
32 JAOCJE010000001.1 GCA029843895_03113 gene open 3206401-3206535 P18
33 JAOCJE010000001.1 GCA029843895_03167 gene open 3264279-3264374 t44
34 JAOCJE010000001.1 GCA029843895_03237 gene open 3331863-3331987 P15
35 JAOCJE010000001.1 GCA029843895_03489 gene open 3589206-3589300 Bacteria_small_SRP
36 JAOCJE010000001.1 GCA029843895_03597 gene open 3689036-3689132 Bacteria_small_SRP
37 JAOCJE010000001.1 GCA029843895_03877 gene open 3987545-3987680 P14
38 JAOCJE010000001.1 GCA029843895_03911 gene open 4025541-4025680 P11
39 JAOCJE010000001.1 GCA029843895_04095 gene open 4215013-4215099 C4
40 JAOCJE010000001.1 GCA029843895_04096 gene open 4215162-4215214 c4-a1b1
41 JAOCJE010000001.1 GCA029843895_04189 gene open 4289779-4290001 srbA
42 JAOCJE010000001.1 GCA029843895_04366 gene open 4492602-4492717 rrf
43 JAOCJE010000001.1 GCA029843895_04367 gene open 4492867-4495759 rrl
44 JAOCJE010000001.1 GCA029843895_04370 gene open 4496278-4497814 rrs
45 JAOCJE010000001.1 GCA029843895_00109 ncRNA open 102316-102511 rgsA RgsA sRNA
46 JAOCJE010000001.1 GCA029843895_00166 ncRNA open 156820-156952 PrrB/RsmZ RNA family
47 JAOCJE010000001.1 GCA029843895_00320 ncRNA open 319443-319551 rsmX rsmX
48 JAOCJE010000001.1 GCA029843895_00639 ncRNA open 644972-645121 prrF PrrF RNA
49 JAOCJE010000001.1 GCA029843895_00655 ncRNA open 661708-662093 crcZ Pseudomonas sRNA CrcZ
50 JAOCJE010000001.1 GCA029843895_00688 ncRNA open 697990-698068 Pseudomonas sRNA P31
51 JAOCJE010000001.1 GCA029843895_00814 ncRNA open 824080-824329 Pseudomonas sRNA P24
52 JAOCJE010000001.1 GCA029843895_00986 ncRNA open 991099-991164 Pseudomonas sRNA P26
53 JAOCJE010000001.1 GCA029843895_00989 ncRNA open 992119-992317 Pseudomonas sRNA P27
54 JAOCJE010000001.1 GCA029843895_01087 ncRNA open 1092179-1092297 rsmY RsmY RNA family
55 JAOCJE010000001.1 GCA029843895_01791 ncRNA open 1859768-1859884 Pseudomon-1/ErsA RNA
56 JAOCJE010000001.1 GCA029843895_01927 ncRNA open 2003402-2003580 6S / SsrS RNA
57 JAOCJE010000001.1 GCA029843895_01952 ncRNA open 2024904-2025083 Pseudomonas sRNA P1
58 JAOCJE010000001.1 GCA029843895_02073 ncRNA open 2159448-2159595 proV proV RNA
59 JAOCJE010000001.1 GCA029843895_02129 ncRNA open 2217319-2217613 anti ponA RNA
60 JAOCJE010000001.1 GCA029843895_02322 ncRNA open 2421863-2422146 5' ureB small RNA
61 JAOCJE010000001.1 GCA029843895_02527 ncRNA open 2640656-2641003 Bacterial RNase P class A
62 JAOCJE010000001.1 GCA029843895_03109 ncRNA open 3204023-3204240 phrS PhrS
63 JAOCJE010000001.1 GCA029843895_03113 ncRNA open 3206401-3206535 Pseudomonas sRNA P18
64 JAOCJE010000001.1 GCA029843895_03167 ncRNA open 3264279-3264374 t44 RNA
65 JAOCJE010000001.1 GCA029843895_03237 ncRNA open 3331863-3331987 Pseudomonas sRNA P15
66 JAOCJE010000001.1 GCA029843895_03489 ncRNA open 3589206-3589300 Bacterial small signal recognition particle RNA
67 JAOCJE010000001.1 GCA029843895_03597 ncRNA open 3689036-3689132 Bacterial small signal recognition particle RNA
68 JAOCJE010000001.1 GCA029843895_03877 ncRNA open 3987545-3987680 Pseudomonas sRNA P14
69 JAOCJE010000001.1 GCA029843895_03911 ncRNA open 4025541-4025680 Pseudomonas sRNA P11
70 JAOCJE010000001.1 GCA029843895_04095 ncRNA open 4215013-4215099 C4 antisense RNA
71 JAOCJE010000001.1 GCA029843895_04096 ncRNA open 4215162-4215214 a1%2C b1 targets of C4 antisense RNA
72 JAOCJE010000001.1 GCA029843895_04189 ncRNA open 4289779-4290001 srbA sRNA regulator of biofilms A
73 JAOCJE010000001.1 regulatory_region open 117025-117298 rne-II RNA
74 JAOCJE010000001.1 regulatory_region open 148283-148419 rmf RNA
75 JAOCJE010000001.1 regulatory_region open 598419-598470 terC RNA
76 JAOCJE010000001.1 regulatory_region open 679496-679592 Ribosomal S15 leader
77 JAOCJE010000001.1 regulatory_region open 746328-746428 Manganese Mn2+ riboswitch aptamer (yybP-ykoY)
78 JAOCJE010000001.1 regulatory_region open 765547-765663 Pseudomon-groES RNA
79 JAOCJE010000001.1 regulatory_region open 831461-831663 Cobalamin riboswitch aptamer
80 JAOCJE010000001.1 regulatory_region open 929660-929852 Cobalamin riboswitch aptamer
81 JAOCJE010000001.1 regulatory_region open 939748-939902 FMN riboswitch aptamer (RFN element)
82 JAOCJE010000001.1 regulatory_region open 967056-967151 Alpha operon ribosome binding site
83 JAOCJE010000001.1 regulatory_region open 982466-982591 Pseudomonas rpsL leader
84 JAOCJE010000001.1 regulatory_region open 1594519-1594712 Cobalamin riboswitch aptamer
85 JAOCJE010000001.1 regulatory_region open 1597977-1598301 Cobalamin riboswitch aptamer
86 JAOCJE010000001.1 regulatory_region open 1626038-1626232 Cobalamin riboswitch aptamer
87 JAOCJE010000001.1 regulatory_region open 1921079-1921140 gabT RNA
88 JAOCJE010000001.1 regulatory_region open 1989033-1989133 Pseudomon-Rho RNA
89 JAOCJE010000001.1 regulatory_region open 2105394-2105475 SAH (S-adenosyl-L-homocysteine) riboswitch aptamer
90 JAOCJE010000001.1 regulatory_region open 2294505-2294611 TPP riboswitch aptamer (THI element)
91 JAOCJE010000001.1 regulatory_region open 3695647-3695714 Repression of heat shock gene expression (ROSE) element
92 JAOCJE010000001.1 regulatory_region open 3964046-3964265 sucA-II RNA
93 JAOCJE010000001.1 regulatory_region open 3970064-3970132 sucC RNA
94 JAOCJE010000001.1 regulatory_region open 4029012-4029083 narK RNA
95 JAOCJE010000001.1 regulatory_region open 4088201-4088267 putative aminoglycoside riboswitch / attI site
96 JAOCJE010000001.1 regulatory_region open 4329115-4329172 terC RNA
97 JAOCJE010000001.1 regulatory_region open 4485725-4485810 gyrA RNA
98 JAOCJE010000001.1 GCA029843895_00617 rRNA open 620661-620776 rrf 5S ribosomal RNA
99 JAOCJE010000001.1 GCA029843895_00618 rRNA open 620916-623808 rrl 23S ribosomal RNA
100 JAOCJE010000001.1 GCA029843895_00621 rRNA open 624327-625863 rrs 16S ribosomal RNA
101 JAOCJE010000001.1 GCA029843895_01002 rRNA open 999152-999267 rrf 5S ribosomal RNA
102 JAOCJE010000001.1 GCA029843895_01003 rRNA open 999407-1002299 rrl 23S ribosomal RNA
103 JAOCJE010000001.1 GCA029843895_01006 rRNA open 1002818-1004354 rrs 16S ribosomal RNA
104 JAOCJE010000001.1 GCA029843895_01389 rRNA open 1423977-1424092 rrf 5S ribosomal RNA
105 JAOCJE010000001.1 GCA029843895_01390 rRNA open 1424242-1427134 rrl 23S ribosomal RNA
106 JAOCJE010000001.1 GCA029843895_01393 rRNA open 1427653-1429189 rrs 16S ribosomal RNA
107 JAOCJE010000001.1 GCA029843895_04366 rRNA open 4492602-4492717 rrf 5S ribosomal RNA
108 JAOCJE010000001.1 GCA029843895_04367 rRNA open 4492867-4495759 rrl 23S ribosomal RNA
109 JAOCJE010000001.1 GCA029843895_04370 rRNA open 4496278-4497814 rrs 16S ribosomal RNA
110 JAOCJE010000001.1 repeat_region open 831765-832230 CRISPR array with 8 repeats of length 29%2C consensus sequence CGGTTCATCCCCGCTGGCGCGGGGAACAC and spacer length 32
111 JAOCJE010000001.1 repeat_region open 834693-838331 CRISPR array with 60 repeats of length 29%2C consensus sequence CGGTTCATCCCCGCTGGCGCGGGGAACAC and spacer length 32
112 JAOCJE010000001.1 repeat_region open 849434-850692 CRISPR array with 21 repeats of length 29%2C consensus sequence CGGTTCATCCCCGCTGGCGCGGGGAACAC and spacer length 32
113 JAOCJE010000001.1 repeat_region open 850777-852157 CRISPR array with 23 repeats of length 28%2C consensus sequence GGTTCATCCCCGCTGGCGCGGGGAACAC and spacer length 33
114 JAOCJE010000001.1 repeat_region open 1487284-1487501 CRISPR array with 4 repeats of length 29%2C consensus sequence CGTTCACTGCCGTGTAGGCAGCTCAGAAA and spacer length 31
115 JAOCJE010000001.1 repeat_region open 1487584-1488963 CRISPR array with 23 repeats of length 28%2C consensus sequence GTTCACTGCCGTGTAGGCAGCTCAGAAA and spacer length 32
116 JAOCJE010000001.1 GCA029843895_00001 CDS open 415-1227 _na     270_aa Antibiotic biosynthesis monooxygenase
117 JAOCJE010000001.1 GCA029843895_00002 CDS open 1258-1797 _na     179_aa glxA HTH araC/xylS-type domain-containing protein
118 JAOCJE010000001.1 GCA029843895_00003 CDS open 2675-3013 _na     112_aa Aldehyde dehydrogenase family protein
119 JAOCJE010000001.1 GCA029843895_00004 CDS open 3076-4200 _na     374_aa fadH NADH:flavin oxidoreductase
120 JAOCJE010000001.1 GCA029843895_00005 CDS open 4267-5253 _na     328_aa ssuD Alkanal monooxygenase alpha chain
121 JAOCJE010000001.1 GCA029843895_00006 CDS open 5435-5671 _na     78_aa Glutaredoxin 2
122 JAOCJE010000001.1 GCA029843895_00007 CDS open 5721-6860 _na     379_aa DUF5610 domain-containing protein
123 JAOCJE010000001.1 GCA029843895_00008 CDS open 7180-8439 _na     419_aa Outer membrane porin
124 JAOCJE010000001.1 GCA029843895_00009 CDS open 8679-8951 _na     90_aa Rho-binding antiterminator
125 JAOCJE010000001.1 GCA029843895_00010 CDS open 9006-9545 _na     179_aa DUF2058 domain-containing protein
126 JAOCJE010000001.1 GCA029843895_00011 CDS open 9848-10675 _na     275_aa mazG nucleoside triphosphate pyrophosphohydrolase
127 JAOCJE010000001.1 GCA029843895_00012 CDS open 10769-13012 _na     747_aa relA GTP diphosphokinase
128 JAOCJE010000001.1 GCA029843895_00013 CDS open 13290-14648 _na     452_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
129 JAOCJE010000001.1 GCA029843895_00014 CDS open 14648-15553 _na     301_aa cysM cysteine synthase CysM
130 JAOCJE010000001.1 GCA029843895_00015 CDS open 15652-16989 _na     445_aa histidine kinase
131 JAOCJE010000001.1 GCA029843895_00016 CDS open 16986-17696 _na     236_aa DNA-binding response regulator
132 JAOCJE010000001.1 GCA029843895_00017 CDS open 17815-20565 _na     916_aa histidine kinase
133 JAOCJE010000001.1 GCA029843895_00018 CDS open 20575-20682 _na     35_aa D-lactate dehydrogenase
134 JAOCJE010000001.1 GCA029843895_00019 CDS open 20778-20948 _na     56_aa hypothetical protein
135 JAOCJE010000001.1 GCA029843895_00020 CDS open 20976-21407 _na     143_aa pilZ PilZ domain-containing protein
136 JAOCJE010000001.1 GCA029843895_00021 CDS open 21412-21810 _na     132_aa META domain-containing protein
137 JAOCJE010000001.1 GCA029843895_00022 CDS open 21956-23041 _na     361_aa dinB DNA polymerase IV
138 JAOCJE010000001.1 GCA029843895_00023 CDS open 23143-23691 _na     182_aa ATP-binding cassette domain-containing protein
139 JAOCJE010000001.1 GCA029843895_00024 CDS open 23726-24190 _na     154_aa Helicase C-terminal domain-containing protein
140 JAOCJE010000001.1 GCA029843895_00025 CDS open 24349-25032 _na     227_aa istA IS21 family transposase
141 JAOCJE010000001.1 GCA029843895_00026 CDS open 25136-25399 _na     87_aa lysR LysR family transcriptional regulator
142 JAOCJE010000001.1 GCA029843895_00027 CDS open 25539-26528 _na     329_aa qor Enoyl reductase (ER) domain-containing protein
143 JAOCJE010000001.1 GCA029843895_00030 CDS open 27478-28026 _na     182_aa Cytochrome b561 bacterial/Ni-hydrogenase domain-containing protein
144 JAOCJE010000001.1 GCA029843895_00031 CDS open 28124-29446 _na     440_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
145 JAOCJE010000001.1 GCA029843895_00032 CDS open 29549-30259 _na     236_aa rluF Dual-specificity RNA pseudouridine synthase RluF
146 JAOCJE010000001.1 GCA029843895_00033 CDS open 30303-30509 _na     68_aa Secreted protein
147 JAOCJE010000001.1 GCA029843895_00034 CDS open 30520-31224 _na     234_aa tsaA tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO
148 JAOCJE010000001.1 GCA029843895_00035 CDS open 31329-31565 _na     78_aa ABM domain-containing protein
149 JAOCJE010000001.1 GCA029843895_00036 CDS open 31579-32040 _na     153_aa Putative ring-cleaving dioxygenase
150 JAOCJE010000001.1 GCA029843895_00037 CDS open 32185-34137 _na     650_aa Laminin subunit alphmethyl-accepting chemotaxis sensory transducer
151 JAOCJE010000001.1 GCA029843895_00038 CDS open 34427-35887 _na     486_aa Transporter
152 JAOCJE010000001.1 GCA029843895_00039 CDS open 35977-36627 _na     216_aa maiA maleylacetoacetate isomerase
153 JAOCJE010000001.1 GCA029843895_00040 CDS open 36718-37701 _na     327_aa 4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase
154 JAOCJE010000001.1 GCA029843895_00041 CDS open 37784-38923 _na     379_aa Homogentisate 1%2C2-dioxygenase
155 JAOCJE010000001.1 GCA029843895_00042 CDS open 38928-40022 _na     364_aa hppD 4-hydroxyphenylpyruvate dioxygenase
156 JAOCJE010000001.1 GCA029843895_00043 CDS open 40264-41016 _na     250_aa lysR LysR family transcriptional regulator
157 JAOCJE010000001.1 GCA029843895_00044 CDS open 41319-43100 _na     593_aa ABC transporter
158 JAOCJE010000001.1 GCA029843895_00045 CDS open 43093-43725 _na     210_aa DSBA-like thioredoxin domain-containing protein
159 JAOCJE010000001.1 GCA029843895_00046 CDS open 43729-44667 _na     312_aa trhO rhodanese-related sulfurtransferase
160 JAOCJE010000001.1 GCA029843895_00047 CDS open 44864-45157 _na     97_aa bolA BolA family transcriptional regulator
161 JAOCJE010000001.1 GCA029843895_00048 CDS open 45169-45666 _na     165_aa DUF2059 domain-containing protein
162 JAOCJE010000001.1 GCA029843895_00049 CDS open 46015-46479 _na     154_aa DUF2804 domain-containing protein
163 JAOCJE010000001.1 GCA029843895_00050 CDS open 46604-47998 _na     464_aa class II fumarate hydratase
164 JAOCJE010000001.1 GCA029843895_00051 CDS open 47991-48608 _na     205_aa Flavodoxin-like fold domain-containing protein
165 JAOCJE010000001.1 GCA029843895_00052 CDS open 48672-49436 _na     254_aa phnP phosphonate metabolism protein PhnP
166 JAOCJE010000001.1 GCA029843895_00053 CDS open 49427-50008 _na     193_aa phnN phosphonate metabolism protein/1%2C5-bisphosphokinase (PRPP-forming) PhnN
167 JAOCJE010000001.1 GCA029843895_00054 CDS open 50008-51153 _na     381_aa alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase
168 JAOCJE010000001.1 GCA029843895_00055 CDS open 51143-51859 _na     238_aa phnL phosphonate C-P lyase system protein PhnL
169 JAOCJE010000001.1 GCA029843895_00056 CDS open 51962-52771 _na     269_aa phnK phosphonate C-P lyase system protein PhnK
170 JAOCJE010000001.1 GCA029843895_00057 CDS open 52768-53637 _na     289_aa Alpha-D-ribose 1-methylphosphonate 5-phosphate C-P lyase
171 JAOCJE010000001.1 GCA029843895_00058 CDS open 53637-54713 _na     358_aa phnI Alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnI
172 JAOCJE010000001.1 GCA029843895_00059 CDS open 54713-55324 _na     203_aa phnH phosphonate C-P lyase system protein PhnH
173 JAOCJE010000001.1 GCA029843895_00060 CDS open 55324-55773 _na     149_aa phnG phosphonate C-P lyase system protein PhnG
174 JAOCJE010000001.1 GCA029843895_00061 CDS open 55785-56507 _na     240_aa phnF phosphonate metabolism transcriptional regulator PhnF
175 JAOCJE010000001.1 GCA029843895_00062 CDS open 56528-57319 _na     263_aa phnE phosphonate ABC transporter%2C permease protein PhnE
176 JAOCJE010000001.1 GCA029843895_00063 CDS open 57402-58403 _na     333_aa phnD phosphonate ABC transporter substrate-binding protein
177 JAOCJE010000001.1 GCA029843895_00064 CDS open 58454-59278 _na     274_aa phnC phosphonate ABC transporter ATP-binding protein
178 JAOCJE010000001.1 GCA029843895_00065 CDS open 59672-59989 _na     105_aa Arc domain-containing protein
179 JAOCJE010000001.1 GCA029843895_00066 CDS open 60128-60373 _na     81_aa Transposase
180 JAOCJE010000001.1 GCA029843895_00067 CDS open 60394-61836 _na     480_aa mgtE magnesium transporter
181 JAOCJE010000001.1 GCA029843895_00068 CDS open 62159-62653 _na     164_aa DUF4124 domain-containing protein
182 JAOCJE010000001.1 GCA029843895_00069 CDS open 62748-64115 _na     455_aa ltrA group II intron reverse transcriptase/maturase
183 JAOCJE010000001.1 GCA029843895_00074 CDS open 65414-65599 _na     61_aa csrA carbon storage regulator CsrA
184 JAOCJE010000001.1 GCA029843895_00075 CDS open 65790-67028 _na     412_aa lysC aspartate kinase
185 JAOCJE010000001.1 GCA029843895_00076 CDS open 67131-69755 _na     874_aa alaS alanine--tRNA ligase
186 JAOCJE010000001.1 GCA029843895_00077 CDS open 70095-71099 _na     334_aa ltaE low-specificity L-threonine aldolase
187 JAOCJE010000001.1 GCA029843895_00078 CDS open 71260-72273 _na     337_aa astE succinylglutamate desuccinylase
188 JAOCJE010000001.1 GCA029843895_00079 CDS open 72366-72644 _na     92_aa Topoisomerase II
189 JAOCJE010000001.1 GCA029843895_00080 CDS open 72671-74017 _na     448_aa astB N-succinylarginine dihydrolase
190 JAOCJE010000001.1 GCA029843895_00081 CDS open 74017-75480 _na     487_aa astD succinylglutamate-semialdehyde dehydrogenase
191 JAOCJE010000001.1 GCA029843895_00082 CDS open 75544-76560 _na     338_aa astA arginine N-succinyltransferase
192 JAOCJE010000001.1 GCA029843895_00083 CDS open 76642-77658 _na     338_aa aruF arginine/ornithine succinyltransferase subunit alpha
193 JAOCJE010000001.1 GCA029843895_00084 CDS open 77832-79052 _na     406_aa Acetylornithine aminotransferase
194 JAOCJE010000001.1 GCA029843895_00085 CDS open 79472-80452 _na     326_aa argR transcriptional regulator ArgR
195 JAOCJE010000001.1 GCA029843895_00086 CDS open 80508-81296 _na     262_aa aotP Arginine/ornithine transport ATP-binding protein AotP
196 JAOCJE010000001.1 GCA029843895_00087 CDS open 81301-81999 _na     232_aa hisM Histidine/lysine/arginine/ornithine transport system permease protein HisM
197 JAOCJE010000001.1 GCA029843895_00088 CDS open 81996-82685 _na     229_aa Polar amino acid ABC transporter permease
198 JAOCJE010000001.1 GCA029843895_00089 CDS open 82864-83637 _na     257_aa Arginine/ornithine binding protein
199 JAOCJE010000001.1 GCA029843895_00090 CDS open 84183-84704 _na     173_aa Type II secretion system protein M
200 JAOCJE010000001.1 GCA029843895_00091 CDS open 84710-85837 _na     375_aa gspL type II secretion system protein GspL
201 JAOCJE010000001.1 GCA029843895_00092 CDS open 85969-87060 _na     363_aa tnp IS5 family transposase
202 JAOCJE010000001.1 GCA029843895_00093 CDS open 87286-88989 _na     567_aa amidase
203 JAOCJE010000001.1 GCA029843895_00094 CDS open 89205-89561 _na     118_aa hypothetical protein
204 JAOCJE010000001.1 GCA029843895_00095 CDS open 89705-90094 _na     129_aa GFA
205 JAOCJE010000001.1 GCA029843895_00096 CDS open 90101-90568 _na     155_aa Type 11 methyltransferase
206 JAOCJE010000001.1 GCA029843895_00097 CDS open 90871-91020 _na     49_aa Membrane protein
207 JAOCJE010000001.1 GCA029843895_00098 CDS open 91451-93394 _na     647_aa Diguanylate cyclase
208 JAOCJE010000001.1 GCA029843895_00099 CDS open 93360-93905 _na     181_aa IS30 family transposase
209 JAOCJE010000001.1 GCA029843895_00100 CDS open 93983-94222 _na     79_aa Transposase
210 JAOCJE010000001.1 GCA029843895_00101 CDS open 94452-96119 _na     555_aa Diguanylate cyclase
211 JAOCJE010000001.1 GCA029843895_00102 CDS open 96417-96842 _na     141_aa N-acetyltransferase
212 JAOCJE010000001.1 GCA029843895_00103 CDS open 96918-97487 _na     189_aa DUF1285 domain-containing protein
213 JAOCJE010000001.1 GCA029843895_00104 CDS open 97592-98194 _na     200_aa DUF4823 domain-containing protein
214 JAOCJE010000001.1 GCA029843895_00105 CDS open 98268-99161 _na     297_aa Oxygen-independent coproporphyrinogen III oxidase
215 JAOCJE010000001.1 GCA029843895_00106 CDS open 99430-100398 _na     322_aa GTP 3'%2C8-cyclase
216 JAOCJE010000001.1 GCA029843895_00107 CDS open 100478-101101 _na     207_aa acrR Biofilm operon icaADBC HTH-type negative transcriptional regulator IcaR
217 JAOCJE010000001.1 GCA029843895_00108 CDS open 101177-102310 _na     377_aa Class V aminotransferase
218 JAOCJE010000001.1 GCA029843895_00110 CDS open 102662-103450 _na     262_aa ycfH putative deoxyribonuclease YcfH
219 JAOCJE010000001.1 GCA029843895_00111 CDS open 103565-103921 _na     118_aa pilZ type 4 fimbrial biogenesis protein PilZ
220 JAOCJE010000001.1 GCA029843895_00112 CDS open 104048-105040 _na     330_aa DNA polymerase III subunit delta'
221 JAOCJE010000001.1 GCA029843895_00113 CDS open 105033-105665 _na     210_aa tmk dTMP kinase
222 JAOCJE010000001.1 GCA029843895_00114 CDS open 105675-106730 _na     351_aa Endolytic murein transglycosylase
223 JAOCJE010000001.1 GCA029843895_00115 CDS open 106734-107549 _na     271_aa pabC aminodeoxychorismate lyase
224 JAOCJE010000001.1 GCA029843895_00116 CDS open 107549-108793 _na     414_aa fabF beta-ketoacyl-ACP synthase II
225 JAOCJE010000001.1 GCA029843895_00117 CDS open 108905-109141 _na     78_aa acpP acyl carrier protein
226 JAOCJE010000001.1 GCA029843895_00118 CDS open 109370-110113 _na     247_aa fabG 3-oxoacyl-ACP reductase FabG
227 JAOCJE010000001.1 GCA029843895_00119 CDS open 110129-111067 _na     312_aa fabD ACP S-malonyltransferase
228 JAOCJE010000001.1 GCA029843895_00120 CDS open 111354-112334 _na     326_aa plsX phosphate acyltransferase PlsX
229 JAOCJE010000001.1 GCA029843895_00121 CDS open 112368-112550 _na     60_aa rpmF 50S ribosomal protein L32
230 JAOCJE010000001.1 GCA029843895_00122 CDS open 112564-113091 _na     175_aa yceD Large ribosomal RNA subunit accumulation protein YceD
231 JAOCJE010000001.1 GCA029843895_00123 CDS open 113480-114061 _na     193_aa 7-methyl-GTP pyrophosphatase
232 JAOCJE010000001.1 GCA029843895_00124 CDS open 114120-115097 _na     325_aa sppA Signal peptide peptidase SppA
233 JAOCJE010000001.1 GCA029843895_00125 CDS open 115087-115782 _na     231_aa HAD family hydrolase
234 JAOCJE010000001.1 GCA029843895_00126 CDS open 115775-116728 _na     317_aa rluC 23S rRNA pseudouridine(955/2504/2580) synthase RluC
235 JAOCJE010000001.1 GCA029843895_00127 CDS open 117309-120326 _na     1005_aa rne ribonuclease E
236 JAOCJE010000001.1 GCA029843895_00128 CDS open 120441-121460 _na     339_aa murB UDP-N-acetylmuramate dehydrogenase
237 JAOCJE010000001.1 GCA029843895_00129 CDS open 121457-121921 _na     154_aa protein-tyrosine-phosphatase
238 JAOCJE010000001.1 GCA029843895_00130 CDS open 121921-122685 _na     254_aa kdsB 3-deoxy-manno-octulosonate cytidylyltransferase
239 JAOCJE010000001.1 GCA029843895_00131 CDS open 122686-122871 _na     61_aa trm112 UPF0434 protein PSPPH_1629
240 JAOCJE010000001.1 GCA029843895_00132 CDS open 122894-123895 _na     333_aa lpxK tetraacyldisaccharide 4'-kinase
241 JAOCJE010000001.1 GCA029843895_00133 CDS open 123897-124325 _na     142_aa Biopolymer transport protein ExbD/TolR
242 JAOCJE010000001.1 GCA029843895_00134 CDS open 124322-124954 _na     210_aa exbB Biopolymer transport protein ExbB
243 JAOCJE010000001.1 GCA029843895_00135 CDS open 125011-127236 _na     741_aa DNA internalization-related competence protein ComEC/Rec2
244 JAOCJE010000001.1 GCA029843895_00136 CDS open 127363-127890 _na     175_aa DUF2062 domain-containing protein
245 JAOCJE010000001.1 GCA029843895_00137 CDS open 127928-129172 _na     414_aa lipoprotein-releasing ABC transporter permease subunit
246 JAOCJE010000001.1 GCA029843895_00138 CDS open 129172-129885 _na     237_aa lolD lipoprotein-releasing ABC transporter ATP-binding protein LolD
247 JAOCJE010000001.1 GCA029843895_00139 CDS open 129878-131125 _na     415_aa lipoprotein-releasing ABC transporter permease subunit
248 JAOCJE010000001.1 GCA029843895_00140 CDS open 131344-131988 _na     214_aa pilZ Type IV pilus assembly PilZ
249 JAOCJE010000001.1 GCA029843895_00141 CDS open 132008-132310 _na     100_aa Phosphodiesterase
250 JAOCJE010000001.1 GCA029843895_00142 CDS open 132313-133032 _na     239_aa Glycerophosphodiester phosphodiesterase
251 JAOCJE010000001.1 GCA029843895_00143 CDS open 133416-133733 _na     105_aa DUF883 domain-containing protein
252 JAOCJE010000001.1 GCA029843895_00144 CDS open 133742-134101 _na     119_aa Phage holin family protein
253 JAOCJE010000001.1 GCA029843895_00145 CDS open 134098-134397 _na     99_aa DUF3618 domain-containing protein
254 JAOCJE010000001.1 GCA029843895_00146 CDS open 134499-135662 _na     387_aa Diguanylate phosphodiesterase
255 JAOCJE010000001.1 GCA029843895_00147 CDS open 135818-136264 _na     148_aa Fatty acid cistrans isomerase
256 JAOCJE010000001.1 GCA029843895_00148 CDS open 136529-136717 _na     62_aa hypothetical protein
257 JAOCJE010000001.1 GCA029843895_00149 CDS open 136703-137365 _na     220_aa senC Electron transporter SenC
258 JAOCJE010000001.1 GCA029843895_00150 CDS open 138171-139502 _na     443_aa deoxyguanosinetriphosphate triphosphohydrolase
259 JAOCJE010000001.1 GCA029843895_00151 CDS open 139515-140579 _na     354_aa Integral membrane bound transporter domain-containing protein
260 JAOCJE010000001.1 GCA029843895_00152 CDS open 140650-141696 _na     348_aa Metal dependent phosphohydrolase
261 JAOCJE010000001.1 GCA029843895_00153 CDS open 141753-143600 _na     615_aa Metal dependent phosphohydrolase
262 JAOCJE010000001.1 GCA029843895_00154 CDS open 143737-144078 _na     113_aa DUF469 domain-containing protein
263 JAOCJE010000001.1 GCA029843895_00155 CDS open 144326-145762 _na     478_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
264 JAOCJE010000001.1 GCA029843895_00156 CDS open 145838-148018 _na     726_aa rlmL bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL
265 JAOCJE010000001.1 GCA029843895_00157 CDS open 148437-148652 _na     71_aa rmf ribosome modulation factor
266 JAOCJE010000001.1 GCA029843895_00158 CDS open 148746-149768 _na     340_aa pyrD quinone-dependent dihydroorotate dehydrogenase
267 JAOCJE010000001.1 GCA029843895_00159 CDS open 149855-150076 _na     73_aa DUF2835 domain-containing protein
268 JAOCJE010000001.1 GCA029843895_00160 CDS open 150158-151102 _na     314_aa DUF6685 domain-containing protein
269 JAOCJE010000001.1 GCA029843895_00161 CDS open 151116-151577 _na     153_aa recX recombination regulator RecX
270 JAOCJE010000001.1 GCA029843895_00162 CDS open 151589-152632 _na     347_aa recA recombinase RecA
271 JAOCJE010000001.1 GCA029843895_00163 CDS open 152720-153220 _na     166_aa cinA CinA domain-containing protein
272 JAOCJE010000001.1 GCA029843895_00164 CDS open 153485-156052 _na     855_aa mutS DNA mismatch repair protein MutS
273 JAOCJE010000001.1 GCA029843895_00165 CDS open 156190-156513 _na     107_aa fdxA ferredoxin FdxA
274 JAOCJE010000001.1 GCA029843895_00167 CDS open 157257-157565 _na     102_aa transposase domain-containing protein
275 JAOCJE010000001.1 GCA029843895_00168 CDS open 157591-157809 _na     72_aa Transposase IS66
276 JAOCJE010000001.1 GCA029843895_00169 CDS open 157829-158188 _na     119_aa tnpB IS66 family insertion sequence element accessory protein TnpB
277 JAOCJE010000001.1 GCA029843895_00170 CDS open 158240-158410 _na     56_aa hypothetical protein
278 JAOCJE010000001.1 GCA029843895_00171 CDS open 158624-160018 _na     464_aa sthA Si-specific NAD(P)(+) transhydrogenase
279 JAOCJE010000001.1 GCA029843895_00172 CDS open 160115-160345 _na     76_aa apbE ApbE family protein
280 JAOCJE010000001.1 GCA029843895_00173 CDS open 160342-161265 _na     307_aa FAD:protein FMN transferase
281 JAOCJE010000001.1 GCA029843895_00174 CDS open 161371-162594 _na     407_aa nqrF NADH:ubiquinone reductase (Na(+)-transporting) subunit F
282 JAOCJE010000001.1 GCA029843895_00175 CDS open 162610-163218 _na     202_aa nqrE NADH:ubiquinone reductase (Na(+)-transporting) subunit E
283 JAOCJE010000001.1 GCA029843895_00176 CDS open 163218-163886 _na     222_aa NADH:ubiquinone reductase (Na(+)-transporting) subunit D
284 JAOCJE010000001.1 GCA029843895_00177 CDS open 163889-164677 _na     262_aa Na(+)-translocating NADH-quinone reductase subunit C
285 JAOCJE010000001.1 GCA029843895_00178 CDS open 164670-165881 _na     403_aa nqrB NADH:ubiquinone reductase (Na(+)-transporting) subunit B
286 JAOCJE010000001.1 GCA029843895_00179 CDS open 165885-167222 _na     445_aa Na(+)-translocating NADH-quinone reductase subunit A
287 JAOCJE010000001.1 GCA029843895_00180 CDS open 167534-169000 _na     488_aa gap2 glyceraldehyde-3-phosphate dehydrogenase
288 JAOCJE010000001.1 GCA029843895_00181 CDS open 169132-172569 _na     1145_aa mfd transcription-repair coupling factor
289 JAOCJE010000001.1 GCA029843895_00182 CDS open 172581-173102 _na     173_aa csiV Peptidoglycan-binding protein CsiV
290 JAOCJE010000001.1 GCA029843895_00183 CDS open 173255-173992 _na     245_aa S-methyl-5'-thioinosine phosphorylase
291 JAOCJE010000001.1 GCA029843895_00184 CDS open 174003-175001 _na     332_aa nagZ beta-N-acetylhexosaminidase
292 JAOCJE010000001.1 GCA029843895_00185 CDS open 175014-175541 _na     175_aa L%2CD-TPase catalytic domain-containing protein
293 JAOCJE010000001.1 GCA029843895_00186 CDS open 175595-176302 _na     235_aa tetR TetR family transcriptional regulator
294 JAOCJE010000001.1 GCA029843895_00187 CDS open 176531-177145 _na     204_aa lexA transcriptional repressor LexA
295 JAOCJE010000001.1 GCA029843895_00188 CDS open 177155-177628 _na     157_aa sulA SOS-induced cell division inhibitor SulA
296 JAOCJE010000001.1 GCA029843895_00189 CDS open 177689-177925 _na     78_aa ABC transporter ATP-binding protein
297 JAOCJE010000001.1 GCA029843895_00190 CDS open 178006-178524 _na     172_aa pasA PasA protein
298 JAOCJE010000001.1 GCA029843895_00191 CDS open 178653-181259 _na     868_aa topA type I DNA topoisomerase
299 JAOCJE010000001.1 GCA029843895_00192 CDS open 181503-181745 _na     80_aa DUF1653 domain-containing protein
300 JAOCJE010000001.1 GCA029843895_00193 CDS open 181820-182995 _na     391_aa fadA acetyl-CoA C-acyltransferase FadA
301 JAOCJE010000001.1 GCA029843895_00194 CDS open 183026-185173 _na     715_aa fadB fatty acid oxidation complex subunit alpha FadB
302 JAOCJE010000001.1 GCA029843895_00195 CDS open 185642-186463 _na     273_aa F0F1-type ATP synthase subunit beta
303 JAOCJE010000001.1 GCA029843895_00196 CDS open 186613-187062 _na     149_aa Universal stress protein
304 JAOCJE010000001.1 GCA029843895_00197 CDS open 187343-188029 _na     228_aa hypothetical protein
305 JAOCJE010000001.1 GCA029843895_00198 CDS open 188048-189973 _na     641_aa abc-f ribosomal protection-like ABC-F family protein
306 JAOCJE010000001.1 GCA029843895_00199 CDS open 190213-192144 _na     643_aa Lytic transglycosylase
307 JAOCJE010000001.1 GCA029843895_00200 CDS open 192386-193192 _na     268_aa MOSC domain-containing protein
308 JAOCJE010000001.1 GCA029843895_00201 CDS open 193320-194252 _na     310_aa cheV Chemotaxis protein CheV
309 JAOCJE010000001.1 GCA029843895_00202 CDS open 194345-195262 _na     305_aa yegS lipid kinase YegS
310 JAOCJE010000001.1 GCA029843895_00203 CDS open 195440-196138 _na     232_aa Quercetin 2%2C3-dioxygenase
311 JAOCJE010000001.1 GCA029843895_00204 CDS open 196380-197975 _na     531_aa Carbohydrate kinase
312 JAOCJE010000001.1 GCA029843895_00205 CDS open 197976-199667 _na     563_aa FAD dependent oxidoreductase
313 JAOCJE010000001.1 GCA029843895_00206 CDS open 199670-201265 _na     531_aa Putative FAD-linked oxidoreductase
314 JAOCJE010000001.1 GCA029843895_00207 CDS open 201391-202425 _na     344_aa virS HTH-type transcriptional regulator VirS
315 JAOCJE010000001.1 GCA029843895_00208 CDS open 202807-204105 _na     432_aa tnp IS1182 family ISPst13 transposase
316 JAOCJE010000001.1 GCA029843895_00209 CDS open 204564-204974 _na     136_aa gtrA GtrA family protein
317 JAOCJE010000001.1 GCA029843895_00210 CDS open 205031-206911 _na     626_aa PAS domain S-box/diguanylate cyclase (GGDEF) domain-containing protein
318 JAOCJE010000001.1 GCA029843895_00211 CDS open 207201-208043 _na     280_aa eamA EamA domain-containing protein
319 JAOCJE010000001.1 GCA029843895_00212 CDS open 208544-211027 _na     827_aa plsB glycerol-3-phosphate 1-O-acyltransferase PlsB
320 JAOCJE010000001.1 GCA029843895_00213 CDS open 211169-211882 _na     237_aa Trypsin
321 JAOCJE010000001.1 GCA029843895_00214 CDS open 212571-213938 _na     455_aa ltrA group II intron reverse transcriptase/maturase
322 JAOCJE010000001.1 GCA029843895_00215 CDS open 214378-215985 _na     535_aa malate:quinone oxidoreductase
323 JAOCJE010000001.1 GCA029843895_00216 CDS open 216284-216967 _na     227_aa lrgB LrgB family protein
324 JAOCJE010000001.1 GCA029843895_00217 CDS open 216964-217317 _na     117_aa cidA Holin-like protein CidA
325 JAOCJE010000001.1 GCA029843895_00218 CDS open 217314-217832 _na     172_aa Oxidoreductase
326 JAOCJE010000001.1 GCA029843895_00219 CDS open 217829-219496 _na     555_aa Nitrite and sulfite reductase 4Fe-4S region
327 JAOCJE010000001.1 GCA029843895_00220 CDS open 219839-221251 _na     470_aa ccoG cytochrome c oxidase accessory protein CcoG
328 JAOCJE010000001.1 GCA029843895_00221 CDS open 221445-222920 _na     491_aa Regulatory protein GntR%2C HTH:aminotransferase%2C class I and II
329 JAOCJE010000001.1 GCA029843895_00222 CDS open 222972-223937 _na     321_aa glucokinase
330 JAOCJE010000001.1 GCA029843895_00223 CDS open 224260-225432 _na     390_aa ubiM 5-demethoxyubiquinol-8 5-hydroxylase UbiM
331 JAOCJE010000001.1 GCA029843895_00224 CDS open 225437-226093 _na     218_aa TIGR04211 family SH3 domain-containing protein
332 JAOCJE010000001.1 GCA029843895_00225 CDS open 226325-227686 _na     453_aa Diguanylate phosphodiesterase
333 JAOCJE010000001.1 GCA029843895_00226 CDS open 228181-228726 _na     181_aa Chalcone isomerase domain-containing protein
334 JAOCJE010000001.1 GCA029843895_00227 CDS open 228735-229268 _na     177_aa DUF3833 domain-containing protein
335 JAOCJE010000001.1 GCA029843895_00228 CDS open 229265-229963 _na     232_aa Short-chain dehydrogenase/reductase SDR
336 JAOCJE010000001.1 GCA029843895_00229 CDS open 229970-230371 _na     133_aa Ribosomal protein S3AE
337 JAOCJE010000001.1 GCA029843895_00230 CDS open 230490-231167 _na     225_aa DUF4197 domain-containing protein
338 JAOCJE010000001.1 GCA029843895_00231 CDS open 231389-232189 _na     266_aa Diguanylate phosphodiesterase
339 JAOCJE010000001.1 GCA029843895_00232 CDS open 232220-232456 _na     78_aa Methyl-accepting transducer domain-containing protein
340 JAOCJE010000001.1 GCA029843895_00233 CDS open 232616-234577 _na     653_aa acs acetate--CoA ligase
341 JAOCJE010000001.1 GCA029843895_00234 CDS open 234790-235086 _na     98_aa C4-dicarboxylate-binding protein
342 JAOCJE010000001.1 GCA029843895_00235 CDS open 235206-235637 _na     143_aa tnpA IS200/IS605 family transposase
343 JAOCJE010000001.1 GCA029843895_00236 CDS open 235845-236765 _na     306_aa lysR DNA-binding transcriptional regulator%2C LysR family
344 JAOCJE010000001.1 GCA029843895_00237 CDS open 236934-238136 _na     400_aa Formyl-CoA transferase
345 JAOCJE010000001.1 GCA029843895_00238 CDS open 238290-239225 _na     311_aa yngG Hydroxymethylglutaryl-CoA lyase YngG
346 JAOCJE010000001.1 GCA029843895_00239 CDS open 239605-240600 _na     331_aa C4-dicarboxylate-binding periplasmic protein
347 JAOCJE010000001.1 GCA029843895_00240 CDS open 240730-241551 _na     273_aa Citrate lyase subunit beta
348 JAOCJE010000001.1 GCA029843895_00241 CDS open 241661-242863 _na     400_aa CaiB/BaiF family protein
349 JAOCJE010000001.1 GCA029843895_00242 CDS open 242878-244230 _na     450_aa MmgE/PrpD family protein%2C putative
350 JAOCJE010000001.1 GCA029843895_00243 CDS open 244241-245404 _na     387_aa caiA Acyl-CoA dehydrogenase MmgC
351 JAOCJE010000001.1 GCA029843895_00244 CDS open 245533-246360 _na     275_aa Mesaconyl-C(4)-CoA hydratase
352 JAOCJE010000001.1 GCA029843895_00245 CDS open 246561-247448 _na     295_aa lysR DNA-binding transcriptional regulator%2C LysR family
353 JAOCJE010000001.1 GCA029843895_00246 CDS open 247677-248231 _na     184_aa CMP/dCMP deaminase zinc-binding protein
354 JAOCJE010000001.1 GCA029843895_00247 CDS open 248318-249871 _na     517_aa tyrR HTH-type transcriptional regulatory protein TyrR
355 JAOCJE010000001.1 GCA029843895_00248 CDS open 250309-251094 _na     261_aa phhA phenylalanine 4-monooxygenase
356 JAOCJE010000001.1 GCA029843895_00249 CDS open 251324-251677 _na     117_aa phhB 4a-hydroxytetrahydrobiopterin dehydratase
357 JAOCJE010000001.1 GCA029843895_00250 CDS open 251674-252870 _na     398_aa Aromatic-amino-acid aminotransferase
358 JAOCJE010000001.1 GCA029843895_00251 CDS open 253075-254337 _na     420_aa MFS transporter
359 JAOCJE010000001.1 GCA029843895_00252 CDS open 254455-256713 _na     752_aa ggpS glucosylglycerol-phosphate synthase
360 JAOCJE010000001.1 GCA029843895_00253 CDS open 256792-258480 _na     562_aa Methyl-accepting chemotaxis sensory transducer
361 JAOCJE010000001.1 GCA029843895_00254 CDS open 258474-258713 _na     79_aa methyl-accepting chemotaxis protein
362 JAOCJE010000001.1 GCA029843895_00255 CDS open 258855-259526 _na     223_aa 2-dehydro-3-deoxy-phosphogluconate aldolase
363 JAOCJE010000001.1 GCA029843895_00256 CDS open 259528-260241 _na     237_aa 6-phosphogluconolactonase
364 JAOCJE010000001.1 GCA029843895_00257 CDS open 260228-261697 _na     489_aa zwf glucose-6-phosphate dehydrogenase
365 JAOCJE010000001.1 GCA029843895_00258 CDS open 261901-262770 _na     289_aa Transcriptional regulator
366 JAOCJE010000001.1 GCA029843895_00259 CDS open 262918-263865 _na     315_aa Bile acid:sodium symporter
367 JAOCJE010000001.1 GCA029843895_00260 CDS open 264007-264321 _na     104_aa sugE quaternary ammonium compound efflux SMR transporter SugE
368 JAOCJE010000001.1 GCA029843895_00261 CDS open 264445-266319 _na     624_aa Phospholipid/glycerol acyltransferase
369 JAOCJE010000001.1 GCA029843895_00262 CDS open 266927-267631 _na     234_aa Enterobactin synthase component D
370 JAOCJE010000001.1 GCA029843895_00263 CDS open 267900-269507 _na     535_aa histidine kinase
371 JAOCJE010000001.1 GCA029843895_00264 CDS open 269518-270279 _na     253_aa rstA Transcriptional regulatory protein RstA
372 JAOCJE010000001.1 GCA029843895_00265 CDS open 271180-274089 _na     969_aa ribonucleoside-diphosphate reductase subunit alpha
373 JAOCJE010000001.1 GCA029843895_00266 CDS open 274550-275800 _na     416_aa nrdB ribonucleotide-diphosphate reductase subunit beta
374 JAOCJE010000001.1 GCA029843895_00267 CDS open 276186-276566 _na     126_aa NAD(P)H dehydrogenase (Quinone)
375 JAOCJE010000001.1 GCA029843895_00268 CDS open 276602-277378 _na     258_aa Methyltransferase type 12
376 JAOCJE010000001.1 GCA029843895_00269 CDS open 277630-277875 _na     81_aa hypothetical protein
377 JAOCJE010000001.1 GCA029843895_00270 CDS open 278087-278434 _na     115_aa (S)-ureidoglycine aminohydrolase cupin domain-containing protein
378 JAOCJE010000001.1 GCA029843895_00271 CDS open 278702-279043 _na     113_aa Ecotin
379 JAOCJE010000001.1 GCA029843895_00272 CDS open 279081-279452 _na     123_aa HTH cro/C1-type domain-containing protein
380 JAOCJE010000001.1 GCA029843895_00273 CDS open 279497-279910 _na     137_aa Bro-N domain-containing protein
381 JAOCJE010000001.1 GCA029843895_00274 CDS open 279956-280600 _na     214_aa yecA YecA family protein
382 JAOCJE010000001.1 GCA029843895_00275 CDS open 280747-282756 _na     669_aa yhbU Putative protease YhbU
383 JAOCJE010000001.1 GCA029843895_00276 CDS open 282842-283150 _na     102_aa Antibiotic biosynthesis monooxygenase
384 JAOCJE010000001.1 GCA029843895_00277 CDS open 283304-283891 _na     195_aa NAD(P)H dehydrogenase
385 JAOCJE010000001.1 GCA029843895_00278 CDS open 283905-284765 _na     286_aa SCP domain-containing protein
386 JAOCJE010000001.1 GCA029843895_00279 CDS open 284951-285991 _na     346_aa diguanylate cyclase
387 JAOCJE010000001.1 GCA029843895_00280 CDS open 286003-286452 _na     149_aa Lytic transglycosylase
388 JAOCJE010000001.1 GCA029843895_00281 CDS open 286588-286929 _na     113_aa Lipoprotein
389 JAOCJE010000001.1 GCA029843895_00282 CDS open 287097-287378 _na     93_aa Peptidyl-prolyl cis-trans isomerase C
390 JAOCJE010000001.1 GCA029843895_00283 CDS open 287460-288989 _na     509_aa diguanylate cyclase
391 JAOCJE010000001.1 GCA029843895_00284 CDS open 289049-289588 _na     179_aa DUF1003 domain-containing protein
392 JAOCJE010000001.1 GCA029843895_00285 CDS open 289773-290666 _na     297_aa eamA EamA domain-containing protein
393 JAOCJE010000001.1 GCA029843895_00286 CDS open 290807-291541 _na     244_aa putative membrane transporter protein
394 JAOCJE010000001.1 GCA029843895_00287 CDS open 291662-292363 _na     233_aa putative transcriptional regulatory protein Psefu_2968
395 JAOCJE010000001.1 GCA029843895_00288 CDS open 292502-292909 _na     135_aa ADP-ribose pyrophosphatase YjhB%2C NUDIX family
396 JAOCJE010000001.1 GCA029843895_00289 CDS open 293051-293380 _na     109_aa PA1123-like domain-containing protein
397 JAOCJE010000001.1 GCA029843895_00290 CDS open 293524-294432 _na     302_aa Smad nuclear-interacting protein 1
398 JAOCJE010000001.1 GCA029843895_00291 CDS open 294448-295926 _na     492_aa Putative serine/threonine protein kinase
399 JAOCJE010000001.1 GCA029843895_00292 CDS open 295943-296731 _na     262_aa Protein phosphatase 2C domain-containing protein
400 JAOCJE010000001.1 GCA029843895_00293 CDS open 296872-297282 _na     136_aa GCN5 family acetyltransferase
401 JAOCJE010000001.1 GCA029843895_00294 CDS open 297391-298437 _na     348_aa diguanylate cyclase
402 JAOCJE010000001.1 GCA029843895_00295 CDS open 298442-298768 _na     108_aa Secreted protein
403 JAOCJE010000001.1 GCA029843895_00297 CDS open 299041-299883 _na     280_aa S1 motif domain-containing protein
404 JAOCJE010000001.1 GCA029843895_00298 CDS open 300124-300315 _na     63_aa sutA Transcriptional regulator SutA RNAP-binding domain-containing protein
405 JAOCJE010000001.1 GCA029843895_00299 CDS open 300355-301299 _na     314_aa PQQ-dependent sugar dehydrogenase
406 JAOCJE010000001.1 GCA029843895_00300 CDS open 301287-301499 _na     70_aa Glucose sorbosone dehydrogenase
407 JAOCJE010000001.1 GCA029843895_00301 CDS open 301583-302308 _na     241_aa Extracellular solute-binding protein
408 JAOCJE010000001.1 GCA029843895_00302 CDS open 302456-303433 _na     325_aa enoyl-[acyl-carrier-protein] reductase
409 JAOCJE010000001.1 GCA029843895_00303 CDS open 303656-303925 _na     89_aa hypothetical protein
410 JAOCJE010000001.1 GCA029843895_00304 CDS open 304152-304796 _na     214_aa hypothetical protein
411 JAOCJE010000001.1 GCA029843895_00305 CDS open 304845-305699 _na     284_aa hypothetical protein
412 JAOCJE010000001.1 GCA029843895_00306 CDS open 305938-306723 _na     261_aa Hydroxypyruvate isomerase
413 JAOCJE010000001.1 GCA029843895_00307 CDS open 306720-307610 _na     296_aa 2-hydroxy-3-oxopropionate reductase
414 JAOCJE010000001.1 GCA029843895_00308 CDS open 307740-308591 _na     283_aa phnD Phosphate-import protein PhnD
415 JAOCJE010000001.1 GCA029843895_00309 CDS open 308588-309388 _na     266_aa Phosphonate ABC transporter
416 JAOCJE010000001.1 GCA029843895_00310 CDS open 309382-310209 _na     275_aa ABC transporter permease
417 JAOCJE010000001.1 GCA029843895_00311 CDS open 310206-310967 _na     253_aa phnE phosphonate ABC transporter%2C permease protein PhnE
418 JAOCJE010000001.1 GCA029843895_00312 CDS open 310847-311254 _na     135_aa lysR LysR family transcriptional regulator
419 JAOCJE010000001.1 GCA029843895_00313 CDS open 311380-311553 _na     57_aa hypothetical protein
420 JAOCJE010000001.1 GCA029843895_00314 CDS open 311791-312411 _na     206_aa lysE LysE family translocator
421 JAOCJE010000001.1 GCA029843895_00315 CDS open 312603-314090 _na     495_aa pap polyphosphate:AMP phosphotransferase
422 JAOCJE010000001.1 GCA029843895_00316 CDS open 314225-316201 _na     658_aa mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
423 JAOCJE010000001.1 GCA029843895_00317 CDS open 316141-316314 _na     57_aa hypothetical protein
424 JAOCJE010000001.1 GCA029843895_00318 CDS open 316353-317246 _na     297_aa eamA EamA domain-containing protein
425 JAOCJE010000001.1 GCA029843895_00319 CDS open 317396-319282 _na     628_aa DNA 3'-5' helicase II
426 JAOCJE010000001.1 GCA029843895_00321 CDS open 319636-320166 _na     176_aa Cytochrome b561
427 JAOCJE010000001.1 GCA029843895_00322 CDS open 320358-322898 _na     846_aa mdoH glucans biosynthesis glucosyltransferase MdoH
428 JAOCJE010000001.1 GCA029843895_00323 CDS open 322891-324426 _na     511_aa Glucans biosynthesis protein G
429 JAOCJE010000001.1 GCA029843895_00324 CDS open 324687-326981 _na     764_aa bglX beta-glucosidase BglX
430 JAOCJE010000001.1 GCA029843895_00325 CDS open 327199-328071 _na     290_aa araC AraC family transcriptional regulator
431 JAOCJE010000001.1 GCA029843895_00326 CDS open 328219-330849 _na     876_aa Non-specific serine/threonine protein kinase
432 JAOCJE010000001.1 GCA029843895_00327 CDS open 330898-331392 _na     164_aa psiE Protein PsiE
433 JAOCJE010000001.1 GCA029843895_00328 CDS open 331619-332593 _na     324_aa Organophosphorus hydrolase
434 JAOCJE010000001.1 GCA029843895_00329 CDS open 332702-332965 _na     87_aa yebG YebG family protein
435 JAOCJE010000001.1 GCA029843895_00330 CDS open 333023-333265 _na     80_aa 30S ribosomal protein S3
436 JAOCJE010000001.1 GCA029843895_00331 CDS open 333419-334441 _na     340_aa Leucine dehydrogenase
437 JAOCJE010000001.1 GCA029843895_00332 CDS open 334543-335346 _na     267_aa sirB1 Protein SirB1 N-terminal domain-containing protein
438 JAOCJE010000001.1 GCA029843895_00333 CDS open 335360-335716 _na     118_aa pilZ Pilus assembly protein PilZ
439 JAOCJE010000001.1 GCA029843895_00334 CDS open 335920-336342 _na     140_aa Glutaredoxin
440 JAOCJE010000001.1 GCA029843895_00335 CDS open 336417-336791 _na     124_aa Tetratricopeptide repeat protein
441 JAOCJE010000001.1 GCA029843895_00336 CDS open 337038-337946 _na     302_aa uspA UspA domain-containing protein
442 JAOCJE010000001.1 GCA029843895_00337 CDS open 338018-339469 _na     483_aa pyk pyruvate kinase
443 JAOCJE010000001.1 GCA029843895_00338 CDS open 339606-340379 _na     257_aa Enoyl-CoA hydratase
444 JAOCJE010000001.1 GCA029843895_00339 CDS open 340441-341379 _na     312_aa iron-sulfur-binding ferredoxin reductase
445 JAOCJE010000001.1 GCA029843895_00340 CDS open 341372-342499 _na     375_aa diguanylate cyclase
446 JAOCJE010000001.1 GCA029843895_00341 CDS open 342974-344497 _na     507_aa ttdA Fumarate hydratase class I
447 JAOCJE010000001.1 GCA029843895_00342 CDS open 344658-346022 _na     454_aa dsdA D-serine ammonia-lyase
448 JAOCJE010000001.1 GCA029843895_00343 CDS open 346162-346836 _na     224_aa DUF1028 domain-containing protein
449 JAOCJE010000001.1 GCA029843895_00344 CDS open 346833-347807 _na     324_aa araC AraC family transcriptional regulator
450 JAOCJE010000001.1 GCA029843895_00345 CDS open 347902-348450 _na     182_aa Putative isochorismatase
451 JAOCJE010000001.1 GCA029843895_00346 CDS open 348452-349561 _na     369_aa zapE cell division protein ZapE
452 JAOCJE010000001.1 GCA029843895_00347 CDS open 349567-350451 _na     294_aa Nitrilase-like protein
453 JAOCJE010000001.1 GCA029843895_00348 CDS open 350448-351038 _na     196_aa N-acetyltransferase domain-containing protein
454 JAOCJE010000001.1 GCA029843895_00349 CDS open 351150-351548 _na     132_aa yesE SnoaL-like domain-containing protein
455 JAOCJE010000001.1 GCA029843895_00350 CDS open 351615-352661 _na     348_aa DUF1016 domain-containing protein
456 JAOCJE010000001.1 GCA029843895_00351 CDS open 352889-353578 _na     229_aa Thermostable hemolysin
457 JAOCJE010000001.1 GCA029843895_00352 CDS open 353562-355010 _na     482_aa Long-chain-fatty-acid--CoA ligase
458 JAOCJE010000001.1 GCA029843895_00353 CDS open 355007-355666 _na     219_aa Heme oxygenase
459 JAOCJE010000001.1 GCA029843895_00354 CDS open 355671-356462 _na     263_aa SDR family oxidoreductase
460 JAOCJE010000001.1 GCA029843895_00355 CDS open 356474-357124 _na     216_aa Tetratricopeptide repeat protein
461 JAOCJE010000001.1 GCA029843895_00356 CDS open 357152-357808 _na     218_aa qseB Transcriptional regulatory protein QseB
462 JAOCJE010000001.1 GCA029843895_00357 CDS open 357805-359292 _na     495_aa histidine kinase
463 JAOCJE010000001.1 GCA029843895_00358 CDS open 359423-359521 _na     32_aa hypothetical protein
464 JAOCJE010000001.1 GCA029843895_00359 CDS open 359523-359825 _na     100_aa Ribbon-helix-helix domain-containing protein
465 JAOCJE010000001.1 GCA029843895_00360 CDS open 359980-360561 _na     193_aa General stress protein 18
466 JAOCJE010000001.1 GCA029843895_00361 CDS open 360795-361706 _na     303_aa Short-chain dehydrogenase/reductase SDR
467 JAOCJE010000001.1 GCA029843895_00362 CDS open 361819-362115 _na     98_aa Serine protease autotransporter
468 JAOCJE010000001.1 GCA029843895_00363 CDS open 362222-362752 _na     176_aa DUF1569 domain-containing protein
469 JAOCJE010000001.1 GCA029843895_00364 CDS open 362745-363638 _na     297_aa Alpha/beta hydrolase fold protein
470 JAOCJE010000001.1 GCA029843895_00365 CDS open 363635-364411 _na     258_aa novR Decarboxylase NovR
471 JAOCJE010000001.1 GCA029843895_00366 CDS open 364571-365038 _na     155_aa DUF985 domain-containing protein
472 JAOCJE010000001.1 GCA029843895_00367 CDS open 365040-365489 _na     149_aa flavodoxin
473 JAOCJE010000001.1 GCA029843895_00368 CDS open 365592-366038 _na     148_aa Blue-light photoreceptor
474 JAOCJE010000001.1 GCA029843895_00369 CDS open 366104-366712 _na     202_aa pilZ PilZ domain-containing protein
475 JAOCJE010000001.1 GCA029843895_00370 CDS open 366734-367699 _na     321_aa merR MerR family transcriptional regulator
476 JAOCJE010000001.1 GCA029843895_00371 CDS open 368055-368621 _na     188_aa ABM domain-containing protein
477 JAOCJE010000001.1 GCA029843895_00372 CDS open 368939-369649 _na     236_aa folM dihydromonapterin reductase
478 JAOCJE010000001.1 GCA029843895_00373 CDS open 369672-370232 _na     186_aa folE GTP cyclohydrolase I FolE
479 JAOCJE010000001.1 GCA029843895_00374 CDS open 370232-370603 _na     123_aa folX dihydroneopterin triphosphate 2'-epimerase
480 JAOCJE010000001.1 GCA029843895_00375 CDS open 370669-370962 _na     97_aa SMc04008-like domain-containing protein
481 JAOCJE010000001.1 GCA029843895_00376 CDS open 370959-371300 _na     113_aa hopJ HopJ type III effector protein
482 JAOCJE010000001.1 GCA029843895_00377 CDS open 371480-371824 _na     114_aa Glycolipid-binding domain-containing protein
483 JAOCJE010000001.1 GCA029843895_00378 CDS open 371784-372047 _na     87_aa putative glycolipid-binding domain-containing protein
484 JAOCJE010000001.1 GCA029843895_00379 CDS open 372075-372404 _na     109_aa Branched-chain amino acid transport
485 JAOCJE010000001.1 GCA029843895_00380 CDS open 372404-373114 _na     236_aa ygaZ Inner membrane protein YgaZ
486 JAOCJE010000001.1 GCA029843895_00381 CDS open 373357-374769 _na     470_aa di-heme oxidoredictase family protein
487 JAOCJE010000001.1 GCA029843895_00382 CDS open 374780-375841 _na     353_aa Imelysin-like domain-containing protein
488 JAOCJE010000001.1 GCA029843895_00383 CDS open 375844-376947 _na     367_aa DUF1513 domain-containing protein
489 JAOCJE010000001.1 GCA029843895_00384 CDS open 376948-377238 _na     96_aa lacI LacI family transcriptional regulator
490 JAOCJE010000001.1 GCA029843895_00385 CDS open 377447-378058 _na     203_aa dctM TRAP dicarboxylate transporter subunit DctM
491 JAOCJE010000001.1 GCA029843895_00386 CDS open 378272-379174 _na     300_aa rhtA Threonine/homoserine efflux transporter RhtA
492 JAOCJE010000001.1 GCA029843895_00387 CDS open 379182-379937 _na     251_aa lutR HTH-type transcriptional regulator LutR
493 JAOCJE010000001.1 GCA029843895_00388 CDS open 380045-380251 _na     68_aa Aldose 1-epimerase
494 JAOCJE010000001.1 GCA029843895_00389 CDS open 380318-380548 _na     76_aa Aldose 1-epimerase
495 JAOCJE010000001.1 GCA029843895_00390 CDS open 380784-381008 _na     74_aa Beta-ketoadipyl CoA thiolase
496 JAOCJE010000001.1 GCA029843895_00391 CDS open 381134-382609 _na     491_aa AAA+ ATPase domain-containing protein
497 JAOCJE010000001.1 GCA029843895_00392 CDS open 382718-384643 _na     641_aa mcpB Methyl-accepting chemotaxis protein mcpB
498 JAOCJE010000001.1 GCA029843895_00393 CDS open 384695-384865 _na     56_aa Membrane protein
499 JAOCJE010000001.1 GCA029843895_00394 CDS open 384877-385302 _na     141_aa CBS domain-containing protein
500 JAOCJE010000001.1 GCA029843895_00395 CDS open 385346-386197 _na     283_aa purU formyltetrahydrofolate deformylase