BAKTAGenome Explorer: Rothia aeria (GCA_029851025.1)
Select a Genome:
|
BAKTA Annotations for GCA_029851025.1
|
Search & Sort all 4734 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 4501 | JAOVAS010000017.1 | GCA029851025_00396 | CDS | open | 25652-26860 | _na 402_aa | ygfZ | Glycine cleavage system aminomethyltransferase T |
| 4502 | JAOVAS010000017.1 | GCA029851025_00397 | CDS | open | 27169-28473 | _na 434_aa | Endo-1%2C4-beta-xylanase A | |
| 4503 | JAOVAS010000017.1 | GCA029851025_00374 | gene | open | 469-1473 | |||
| 4504 | JAOVAS010000017.1 | GCA029851025_00375 | gene | open | 1641-2096 | maoC | ||
| 4505 | JAOVAS010000017.1 | GCA029851025_00376 | gene | open | 2096-2557 | maoC | ||
| 4506 | JAOVAS010000017.1 | GCA029851025_00377 | gene | open | 2697-3806 | murB | ||
| 4507 | JAOVAS010000017.1 | GCA029851025_00378 | gene | open | 3927-4463 | |||
| 4508 | JAOVAS010000017.1 | GCA029851025_00379 | gene | open | 4538-6268 | |||
| 4509 | JAOVAS010000017.1 | GCA029851025_00380 | gene | open | 6572-7927 | uhpC | ||
| 4510 | JAOVAS010000017.1 | GCA029851025_00381 | gene | open | 8095-8913 | |||
| 4511 | JAOVAS010000017.1 | GCA029851025_00382 | gene | open | 9118-9936 | |||
| 4512 | JAOVAS010000017.1 | GCA029851025_00383 | gene | open | 10223-11140 | |||
| 4513 | JAOVAS010000017.1 | GCA029851025_00384 | gene | open | 11248-12825 | |||
| 4514 | JAOVAS010000017.1 | GCA029851025_00385 | gene | open | 12846-13697 | |||
| 4515 | JAOVAS010000017.1 | GCA029851025_00386 | gene | open | 13968-14486 | |||
| 4516 | JAOVAS010000017.1 | GCA029851025_00387 | gene | open | 15058-15408 | |||
| 4517 | JAOVAS010000017.1 | GCA029851025_00388 | gene | open | 15637-16728 | asd | ||
| 4518 | JAOVAS010000017.1 | GCA029851025_00389 | gene | open | 16995-17681 | folA | ||
| 4519 | JAOVAS010000017.1 | GCA029851025_00390 | gene | open | 17690-18598 | thyA | ||
| 4520 | JAOVAS010000017.1 | GCA029851025_00391 | gene | open | 18750-19748 | |||
| 4521 | JAOVAS010000017.1 | GCA029851025_00392 | gene | open | 20009-22261 | ppk | ||
| 4522 | JAOVAS010000017.1 | GCA029851025_00393 | gene | open | 22381-23427 | mshD | ||
| 4523 | JAOVAS010000017.1 | GCA029851025_00394 | gene | open | 23554-24234 | phoP | ||
| 4524 | JAOVAS010000017.1 | GCA029851025_00395 | gene | open | 24864-25541 | |||
| 4525 | JAOVAS010000017.1 | GCA029851025_00396 | gene | open | 25652-26860 | ygfZ | ||
| 4526 | JAOVAS010000017.1 | GCA029851025_00397 | gene | open | 27169-28473 | |||
| 4527 | JAOVAS010000017.1 | GCA029851025_00372 | gene | open | 84-157 | trnM | ||
| 4528 | JAOVAS010000017.1 | GCA029851025_00373 | gene | open | 159-230 | trnT | ||
| 4529 | JAOVAS010000017.1 | GCA029851025_00372 | tRNA | open | 84-157 | trnM | tRNA-Met(cat) | |
| 4530 | JAOVAS010000017.1 | GCA029851025_00373 | tRNA | open | 159-230 | trnT | tRNA-Thr(ggt) | |
| 4531 | JAOVAS010000018.1 | GCA029851025_00398 | CDS | open | 131-1495 | _na 454_aa | dnaB | replicative DNA helicase |
| 4532 | JAOVAS010000018.1 | GCA029851025_00399 | CDS | open | 1760-2467 | _na 235_aa | Divinyl chlorophyllide a 8-vinyl-reductase%2C chloroplastic | |
| 4533 | JAOVAS010000018.1 | GCA029851025_00400 | CDS | open | 2511-3716 | _na 401_aa | Erythromycin biosynthesis protein CIII-like C-terminal domain-containing protein | |
| 4534 | JAOVAS010000018.1 | GCA029851025_00401 | CDS | open | 3891-4691 | _na 266_aa | ubiE | putative S-adenosylmethionine-dependent methyltransferase MSMEG_2350 |
| 4535 | JAOVAS010000018.1 | GCA029851025_00402 | CDS | open | 5660-6109 | _na 149_aa | hypothetical protein | |
| 4536 | JAOVAS010000018.1 | GCA029851025_00403 | CDS | open | 6155-7024 | _na 289_aa | ABC transporter permease | |
| 4537 | JAOVAS010000018.1 | GCA029851025_00404 | CDS | open | 7030-8130 | _na 366_aa | drrA | Daunorubicin/doxorubicin resistance ATP-binding protein DrrA |
| 4538 | JAOVAS010000018.1 | GCA029851025_00405 | CDS | open | 8321-9346 | _na 341_aa | CAAX amino terminal protease self- immunity | |
| 4539 | JAOVAS010000018.1 | GCA029851025_00406 | CDS | open | 9406-9780 | _na 124_aa | 2-hydroxy-6-oxo-6-phenylhexa-2%2C4-dienoate hydrolase | |
| 4540 | JAOVAS010000018.1 | GCA029851025_00407 | CDS | open | 9863-10027 | _na 54_aa | hypothetical protein | |
| 4541 | JAOVAS010000018.1 | GCA029851025_00408 | CDS | open | 10185-11837 | _na 550_aa | hypothetical protein | |
| 4542 | JAOVAS010000018.1 | GCA029851025_00409 | CDS | open | 11932-12291 | _na 119_aa | hypothetical protein | |
| 4543 | JAOVAS010000018.1 | GCA029851025_00410 | CDS | open | 12272-12376 | _na 34_aa | hypothetical protein | |
| 4544 | JAOVAS010000018.1 | GCA029851025_00411 | CDS | open | 12532-12984 | _na 150_aa | rplI | 50S ribosomal protein L9 |
| 4545 | JAOVAS010000018.1 | GCA029851025_00412 | CDS | open | 13008-13244 | _na 78_aa | rpsR | 30S ribosomal protein S18 |
| 4546 | JAOVAS010000018.1 | GCA029851025_00413 | CDS | open | 13330-13986 | _na 218_aa | Single-stranded DNA-binding protein | |
| 4547 | JAOVAS010000018.1 | GCA029851025_00414 | CDS | open | 14077-14382 | _na 101_aa | rpsF | 30S ribosomal protein S6 |
| 4548 | JAOVAS010000018.1 | GCA029851025_00415 | CDS | open | 14627-15019 | _na 130_aa | TM2 domain-containing protein | |
| 4549 | JAOVAS010000018.1 | GCA029851025_00416 | CDS | open | 15151-16581 | _na 476_aa | CCA tRNA nucleotidyltransferase | |
| 4550 | JAOVAS010000018.1 | GCA029851025_00417 | CDS | open | 16672-17172 | _na 166_aa | MutT/nudix family protein | |
| 4551 | JAOVAS010000018.1 | GCA029851025_00418 | CDS | open | 17200-18867 | _na 555_aa | murJ | murein biosynthesis integral membrane protein MurJ |
| 4552 | JAOVAS010000018.1 | GCA029851025_00419 | CDS | open | 18972-20141 | _na 389_aa | Serine/threonine protein kinase | |
| 4553 | JAOVAS010000018.1 | GCA029851025_00420 | CDS | open | 20376-21422 | _na 348_aa | trxB | thioredoxin-disulfide reductase |
| 4554 | JAOVAS010000018.1 | GCA029851025_00421 | CDS | open | 21438-21764 | _na 108_aa | trxA | thioredoxin |
| 4555 | JAOVAS010000018.1 | GCA029851025_00398 | gene | open | 131-1495 | dnaB | ||
| 4556 | JAOVAS010000018.1 | GCA029851025_00399 | gene | open | 1760-2467 | |||
| 4557 | JAOVAS010000018.1 | GCA029851025_00400 | gene | open | 2511-3716 | |||
| 4558 | JAOVAS010000018.1 | GCA029851025_00401 | gene | open | 3891-4691 | ubiE | ||
| 4559 | JAOVAS010000018.1 | GCA029851025_00402 | gene | open | 5660-6109 | |||
| 4560 | JAOVAS010000018.1 | GCA029851025_00403 | gene | open | 6155-7024 | |||
| 4561 | JAOVAS010000018.1 | GCA029851025_00404 | gene | open | 7030-8130 | drrA | ||
| 4562 | JAOVAS010000018.1 | GCA029851025_00405 | gene | open | 8321-9346 | |||
| 4563 | JAOVAS010000018.1 | GCA029851025_00406 | gene | open | 9406-9780 | |||
| 4564 | JAOVAS010000018.1 | GCA029851025_00407 | gene | open | 9863-10027 | |||
| 4565 | JAOVAS010000018.1 | GCA029851025_00408 | gene | open | 10185-11837 | |||
| 4566 | JAOVAS010000018.1 | GCA029851025_00409 | gene | open | 11932-12291 | |||
| 4567 | JAOVAS010000018.1 | GCA029851025_00410 | gene | open | 12272-12376 | |||
| 4568 | JAOVAS010000018.1 | GCA029851025_00411 | gene | open | 12532-12984 | rplI | ||
| 4569 | JAOVAS010000018.1 | GCA029851025_00412 | gene | open | 13008-13244 | rpsR | ||
| 4570 | JAOVAS010000018.1 | GCA029851025_00413 | gene | open | 13330-13986 | |||
| 4571 | JAOVAS010000018.1 | GCA029851025_00414 | gene | open | 14077-14382 | rpsF | ||
| 4572 | JAOVAS010000018.1 | GCA029851025_00415 | gene | open | 14627-15019 | |||
| 4573 | JAOVAS010000018.1 | GCA029851025_00416 | gene | open | 15151-16581 | |||
| 4574 | JAOVAS010000018.1 | GCA029851025_00417 | gene | open | 16672-17172 | |||
| 4575 | JAOVAS010000018.1 | GCA029851025_00418 | gene | open | 17200-18867 | murJ | ||
| 4576 | JAOVAS010000018.1 | GCA029851025_00419 | gene | open | 18972-20141 | |||
| 4577 | JAOVAS010000018.1 | GCA029851025_00420 | gene | open | 20376-21422 | trxB | ||
| 4578 | JAOVAS010000018.1 | GCA029851025_00421 | gene | open | 21438-21764 | trxA | ||
| 4579 | JAOVAS010000019.1 | GCA029851025_00422 | CDS | open | 103-1311 | _na 402_aa | Methyltransferase | |
| 4580 | JAOVAS010000019.1 | GCA029851025_00423 | CDS | open | 1319-2929 | _na 536_aa | RNA helicase | |
| 4581 | JAOVAS010000019.1 | GCA029851025_00424 | CDS | open | 3274-3501 | _na 75_aa | PF11305 family protein | |
| 4582 | JAOVAS010000019.1 | GCA029851025_00425 | CDS | open | 3700-4947 | _na 415_aa | glutamyl-tRNA reductase | |
| 4583 | JAOVAS010000019.1 | GCA029851025_00426 | CDS | open | 5176-6372 | _na 398_aa | hemE | uroporphyrinogen decarboxylase |
| 4584 | JAOVAS010000019.1 | GCA029851025_00427 | CDS | open | 6422-7921 | _na 499_aa | hemG | protoporphyrinogen oxidase |
| 4585 | JAOVAS010000019.1 | GCA029851025_00428 | CDS | open | 8047-8889 | _na 280_aa | hemQ | hydrogen peroxide-dependent heme synthase |
| 4586 | JAOVAS010000019.1 | GCA029851025_00429 | CDS | open | 8886-10286 | _na 466_aa | ferrochelatase | |
| 4587 | JAOVAS010000019.1 | GCA029851025_00430 | CDS | open | 10399-11502 | _na 367_aa | hemC | hydroxymethylbilane synthase |
| 4588 | JAOVAS010000019.1 | GCA029851025_00431 | CDS | open | 11502-12332 | _na 276_aa | Uroporphyrinogen-III synthase | |
| 4589 | JAOVAS010000019.1 | GCA029851025_00432 | CDS | open | 12325-12840 | _na 171_aa | SMI1/KNR4 family protein | |
| 4590 | JAOVAS010000019.1 | GCA029851025_00433 | CDS | open | 12888-13883 | _na 331_aa | hemB | porphobilinogen synthase |
| 4591 | JAOVAS010000019.1 | GCA029851025_00434 | CDS | open | 13897-14532 | _na 211_aa | DUF1643 domain-containing protein | |
| 4592 | JAOVAS010000019.1 | GCA029851025_00435 | CDS | open | 14766-15767 | _na 333_aa | MFS transporter | |
| 4593 | JAOVAS010000019.1 | GCA029851025_00436 | CDS | open | 15866-17215 | _na 449_aa | hemL | glutamate-1-semialdehyde 2%2C1-aminomutase |
| 4594 | JAOVAS010000019.1 | GCA029851025_00437 | CDS | open | 17327-17875 | _na 182_aa | hypothetical protein | |
| 4595 | JAOVAS010000019.1 | GCA029851025_00438 | CDS | open | 17927-18331 | _na 134_aa | UPF0310 protein HMPREF0733_10101 | |
| 4596 | JAOVAS010000019.1 | GCA029851025_00439 | CDS | open | 18426-18794 | _na 122_aa | gloA | putative enzyme related to lactoylglutathione lyase |
| 4597 | JAOVAS010000019.1 | GCA029851025_00440 | CDS | open | 18869-19297 | _na 142_aa | Transcriptional regulator | |
| 4598 | JAOVAS010000019.1 | GCA029851025_00441 | CDS | open | 19441-20127 | _na 228_aa | Tat pathway signal sequence domain protein | |
| 4599 | JAOVAS010000019.1 | GCA029851025_00442 | CDS | open | 20198-20887 | _na 229_aa | DUF3592 domain-containing protein | |
| 4600 | JAOVAS010000019.1 | GCA029851025_00443 | CDS | open | 20961-21677 | _na 238_aa | PH domain-containing protein | |
| 4601 | JAOVAS010000019.1 | GCA029851025_00422 | gene | open | 103-1311 | |||
| 4602 | JAOVAS010000019.1 | GCA029851025_00423 | gene | open | 1319-2929 | |||
| 4603 | JAOVAS010000019.1 | GCA029851025_00424 | gene | open | 3274-3501 | |||
| 4604 | JAOVAS010000019.1 | GCA029851025_00425 | gene | open | 3700-4947 | |||
| 4605 | JAOVAS010000019.1 | GCA029851025_00426 | gene | open | 5176-6372 | hemE | ||
| 4606 | JAOVAS010000019.1 | GCA029851025_00427 | gene | open | 6422-7921 | hemG | ||
| 4607 | JAOVAS010000019.1 | GCA029851025_00428 | gene | open | 8047-8889 | hemQ | ||
| 4608 | JAOVAS010000019.1 | GCA029851025_00429 | gene | open | 8886-10286 | |||
| 4609 | JAOVAS010000019.1 | GCA029851025_00430 | gene | open | 10399-11502 | hemC | ||
| 4610 | JAOVAS010000019.1 | GCA029851025_00431 | gene | open | 11502-12332 | |||
| 4611 | JAOVAS010000019.1 | GCA029851025_00432 | gene | open | 12325-12840 | |||
| 4612 | JAOVAS010000019.1 | GCA029851025_00433 | gene | open | 12888-13883 | hemB | ||
| 4613 | JAOVAS010000019.1 | GCA029851025_00434 | gene | open | 13897-14532 | |||
| 4614 | JAOVAS010000019.1 | GCA029851025_00435 | gene | open | 14766-15767 | |||
| 4615 | JAOVAS010000019.1 | GCA029851025_00436 | gene | open | 15866-17215 | hemL | ||
| 4616 | JAOVAS010000019.1 | GCA029851025_00437 | gene | open | 17327-17875 | |||
| 4617 | JAOVAS010000019.1 | GCA029851025_00438 | gene | open | 17927-18331 | |||
| 4618 | JAOVAS010000019.1 | GCA029851025_00439 | gene | open | 18426-18794 | gloA | ||
| 4619 | JAOVAS010000019.1 | GCA029851025_00440 | gene | open | 18869-19297 | |||
| 4620 | JAOVAS010000019.1 | GCA029851025_00441 | gene | open | 19441-20127 | |||
| 4621 | JAOVAS010000019.1 | GCA029851025_00442 | gene | open | 20198-20887 | |||
| 4622 | JAOVAS010000019.1 | GCA029851025_00443 | gene | open | 20961-21677 | |||
| 4623 | JAOVAS010000020.1 | rep_origin | open | 6626-7573 | ||||
| 4624 | JAOVAS010000020.1 | GCA029851025_00952 | CDS | open | 389-1993 | _na 534_aa | parB | putative chromosome-partitioning protein parB |
| 4625 | JAOVAS010000020.1 | GCA029851025_00953 | CDS | open | 2145-2984 | _na 279_aa | parA | Chromosome (Plasmid) partitioning protein ParA |
| 4626 | JAOVAS010000020.1 | GCA029851025_00954 | CDS | open | 3309-3944 | _na 211_aa | rsmG | 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG |
| 4627 | JAOVAS010000020.1 | GCA029851025_00955 | CDS | open | 3945-4484 | _na 179_aa | RNA-binding protein | |
| 4628 | JAOVAS010000020.1 | GCA029851025_00956 | CDS | open | 4534-5565 | _na 343_aa | yidC | membrane protein insertase YidC |
| 4629 | JAOVAS010000020.1 | GCA029851025_00957 | CDS | open | 5621-6046 | _na 141_aa | yidD | membrane protein insertion efficiency factor YidD |
| 4630 | JAOVAS010000020.1 | GCA029851025_00958 | CDS | open | 6039-6419 | _na 126_aa | rnpA | ribonuclease P protein component |
| 4631 | JAOVAS010000020.1 | GCA029851025_00959 | CDS | open | 6488-6625 | _na 45_aa | rpmH | 50S ribosomal protein L34 |
| 4632 | JAOVAS010000020.1 | GCA029851025_00960 | CDS | open | 7082-8881 | _na 599_aa | dnaA | chromosomal replication initiator protein DnaA |
| 4633 | JAOVAS010000020.1 | GCA029851025_00961 | CDS | open | 9403-10530 | _na 375_aa | dnaN | DNA polymerase III subunit beta |
| 4634 | JAOVAS010000020.1 | GCA029851025_00962 | CDS | open | 10588-11796 | _na 402_aa | recF | DNA replication/repair protein RecF |
| 4635 | JAOVAS010000020.1 | GCA029851025_00963 | CDS | open | 11789-12472 | _na 227_aa | DUF721 domain-containing protein | |
| 4636 | JAOVAS010000020.1 | GCA029851025_00964 | CDS | open | 12751-14775 | _na 674_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 4637 | JAOVAS010000020.1 | GCA029851025_00965 | CDS | open | 14854-17496 | _na 880_aa | gyrA | DNA gyrase subunit A |
| 4638 | JAOVAS010000020.1 | GCA029851025_00966 | CDS | open | 17496-18050 | _na 184_aa | Transmembrane PF12089 domain protein | |
| 4639 | JAOVAS010000020.1 | GCA029851025_00968 | CDS | open | 18278-18391 | _na 37_aa | SE2200 family small protein | |
| 4640 | JAOVAS010000020.1 | GCA029851025_00952 | gene | open | 389-1993 | parB | ||
| 4641 | JAOVAS010000020.1 | GCA029851025_00953 | gene | open | 2145-2984 | parA | ||
| 4642 | JAOVAS010000020.1 | GCA029851025_00954 | gene | open | 3309-3944 | rsmG | ||
| 4643 | JAOVAS010000020.1 | GCA029851025_00955 | gene | open | 3945-4484 | |||
| 4644 | JAOVAS010000020.1 | GCA029851025_00956 | gene | open | 4534-5565 | yidC | ||
| 4645 | JAOVAS010000020.1 | GCA029851025_00957 | gene | open | 5621-6046 | yidD | ||
| 4646 | JAOVAS010000020.1 | GCA029851025_00958 | gene | open | 6039-6419 | rnpA | ||
| 4647 | JAOVAS010000020.1 | GCA029851025_00959 | gene | open | 6488-6625 | rpmH | ||
| 4648 | JAOVAS010000020.1 | GCA029851025_00960 | gene | open | 7082-8881 | dnaA | ||
| 4649 | JAOVAS010000020.1 | GCA029851025_00961 | gene | open | 9403-10530 | dnaN | ||
| 4650 | JAOVAS010000020.1 | GCA029851025_00962 | gene | open | 10588-11796 | recF | ||
| 4651 | JAOVAS010000020.1 | GCA029851025_00963 | gene | open | 11789-12472 | |||
| 4652 | JAOVAS010000020.1 | GCA029851025_00964 | gene | open | 12751-14775 | gyrB | ||
| 4653 | JAOVAS010000020.1 | GCA029851025_00965 | gene | open | 14854-17496 | gyrA | ||
| 4654 | JAOVAS010000020.1 | GCA029851025_00966 | gene | open | 17496-18050 | |||
| 4655 | JAOVAS010000020.1 | GCA029851025_00968 | gene | open | 18278-18391 | |||
| 4656 | JAOVAS010000020.1 | GCA029851025_00967 | gene | open | 18181-18254 | trnI | ||
| 4657 | JAOVAS010000020.1 | GCA029851025_00967 | tRNA | open | 18181-18254 | trnI | tRNA-Ile(gat) | |
| 4658 | JAOVAS010000021.1 | repeat_region | open | 7643-8121 | CRISPR array with 7 repeats of length 37%2C consensus sequence CCCTCAATGAAAGTCACCCATTCTCATGGGTGAGAC and spacer length 36 | |||
| 4659 | JAOVAS010000021.1 | GCA029851025_00969 | CDS | open | 138-671 | _na 177_aa | SLH domain-containing protein | |
| 4660 | JAOVAS010000021.1 | GCA029851025_00970 | CDS | open | 1169-2947 | _na 592_aa | Endo-1%2C4-beta-xylanase A | |
| 4661 | JAOVAS010000021.1 | GCA029851025_00971 | CDS | open | 3121-4017 | _na 298_aa | Nif3-like dinuclear metal center hexameric protein | |
| 4662 | JAOVAS010000021.1 | GCA029851025_00972 | CDS | open | 4120-4641 | _na 173_aa | msrA | Peptide methionine sulfoxide reductase MsrA |
| 4663 | JAOVAS010000021.1 | GCA029851025_00974 | CDS | open | 5048-7189 | _na 713_aa | LPXTG-motif protein cell wall anchor domain protein | |
| 4664 | JAOVAS010000021.1 | GCA029851025_00975 | CDS | open | 8305-8607 | _na 100_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 4665 | JAOVAS010000021.1 | GCA029851025_00976 | CDS | open | 8889-9944 | _na 351_aa | CRISPR-associated protein | |
| 4666 | JAOVAS010000021.1 | GCA029851025_00977 | CDS | open | 9944-12712 | _na 922_aa | cas3u | type I-U CRISPR-associated helicase/endonuclease Cas3 |
| 4667 | JAOVAS010000021.1 | GCA029851025_00978 | CDS | open | 12702-14273 | _na 523_aa | csb2 | type I-U CRISPR-associated protein Csb2 |
| 4668 | JAOVAS010000021.1 | GCA029851025_00979 | CDS | open | 14273-15511 | _na 412_aa | type I-U CRISPR-associated RAMP protein Csb1/Cas7u | |
| 4669 | JAOVAS010000021.1 | GCA029851025_00969 | gene | open | 138-671 | |||
| 4670 | JAOVAS010000021.1 | GCA029851025_00970 | gene | open | 1169-2947 | |||
| 4671 | JAOVAS010000021.1 | GCA029851025_00971 | gene | open | 3121-4017 | |||
| 4672 | JAOVAS010000021.1 | GCA029851025_00972 | gene | open | 4120-4641 | msrA | ||
| 4673 | JAOVAS010000021.1 | GCA029851025_00974 | gene | open | 5048-7189 | |||
| 4674 | JAOVAS010000021.1 | GCA029851025_00975 | gene | open | 8305-8607 | cas2 | ||
| 4675 | JAOVAS010000021.1 | GCA029851025_00976 | gene | open | 8889-9944 | |||
| 4676 | JAOVAS010000021.1 | GCA029851025_00977 | gene | open | 9944-12712 | cas3u | ||
| 4677 | JAOVAS010000021.1 | GCA029851025_00978 | gene | open | 12702-14273 | csb2 | ||
| 4678 | JAOVAS010000021.1 | GCA029851025_00979 | gene | open | 14273-15511 | |||
| 4679 | JAOVAS010000021.1 | GCA029851025_00973 | gene | open | 4706-4778 | trnE | ||
| 4680 | JAOVAS010000021.1 | GCA029851025_00973 | tRNA | open | 4706-4778 | trnE | tRNA-Glu(ctc) | |
| 4681 | JAOVAS010000022.1 | GCA029851025_00980 | CDS | open | 21-767 | _na 248_aa | S-layer-like y domain-containing protein | |
| 4682 | JAOVAS010000022.1 | GCA029851025_00984 | CDS | open | 1933-2808 | _na 291_aa | PD-(D/E)XK nuclease superfamily | |
| 4683 | JAOVAS010000022.1 | GCA029851025_00985 | CDS | open | 2884-3462 | _na 192_aa | def | peptide deformylase |
| 4684 | JAOVAS010000022.1 | GCA029851025_00986 | CDS | open | 3470-4399 | _na 309_aa | fmt | methionyl-tRNA formyltransferase |
| 4685 | JAOVAS010000022.1 | GCA029851025_00987 | CDS | open | 4396-6144 | _na 582_aa | Ribosomal RNA small subunit methyltransferase B | |
| 4686 | JAOVAS010000022.1 | GCA029851025_00988 | CDS | open | 6180-6869 | _na 229_aa | rpe | ribulose-phosphate 3-epimerase |
| 4687 | JAOVAS010000022.1 | GCA029851025_00989 | CDS | open | 7126-8169 | _na 347_aa | Iron-siderophore ABC transporter substrate-binding protein | |
| 4688 | JAOVAS010000022.1 | GCA029851025_00980 | gene | open | 21-767 | |||
| 4689 | JAOVAS010000022.1 | GCA029851025_00984 | gene | open | 1933-2808 | |||
| 4690 | JAOVAS010000022.1 | GCA029851025_00985 | gene | open | 2884-3462 | def | ||
| 4691 | JAOVAS010000022.1 | GCA029851025_00986 | gene | open | 3470-4399 | fmt | ||
| 4692 | JAOVAS010000022.1 | GCA029851025_00987 | gene | open | 4396-6144 | |||
| 4693 | JAOVAS010000022.1 | GCA029851025_00988 | gene | open | 6180-6869 | rpe | ||
| 4694 | JAOVAS010000022.1 | GCA029851025_00989 | gene | open | 7126-8169 | |||
| 4695 | JAOVAS010000022.1 | GCA029851025_00981 | gene | open | 1051-1122 | trnQ | ||
| 4696 | JAOVAS010000022.1 | GCA029851025_00982 | gene | open | 1149-1221 | trnE | ||
| 4697 | JAOVAS010000022.1 | GCA029851025_00983 | gene | open | 1446-1517 | trnV | ||
| 4698 | JAOVAS010000022.1 | GCA029851025_00981 | tRNA | open | 1051-1122 | trnQ | tRNA-Gln(ctg) | |
| 4699 | JAOVAS010000022.1 | GCA029851025_00982 | tRNA | open | 1149-1221 | trnE | tRNA-Glu(ctc) | |
| 4700 | JAOVAS010000022.1 | GCA029851025_00983 | tRNA | open | 1446-1517 | trnV | tRNA-Val(cac) | |
| 4701 | JAOVAS010000023.1 | GCA029851025_00990 | CDS | open | 84-575 | _na 163_aa | yajQ | YajQ family cyclic di-GMP-binding protein |
| 4702 | JAOVAS010000023.1 | GCA029851025_00991 | CDS | open | 736-1098 | _na 120_aa | hypothetical protein | |
| 4703 | JAOVAS010000023.1 | GCA029851025_00993 | CDS | open | 1534-1905 | _na 123_aa | Thioredoxin | |
| 4704 | JAOVAS010000023.1 | GCA029851025_00994 | CDS | open | 2015-3130 | _na 371_aa | 3-methyladenine DNA glycosylase | |
| 4705 | JAOVAS010000023.1 | GCA029851025_00995 | CDS | open | 3386-5209 | _na 607_aa | Tat pathway signal sequence domain protein | |
| 4706 | JAOVAS010000023.1 | GCA029851025_00996 | CDS | open | 5757-7784 | _na 675_aa | deaD | ATP-dependent RNA helicase DeaD |
| 4707 | JAOVAS010000023.1 | GCA029851025_00990 | gene | open | 84-575 | yajQ | ||
| 4708 | JAOVAS010000023.1 | GCA029851025_00991 | gene | open | 736-1098 | |||
| 4709 | JAOVAS010000023.1 | GCA029851025_00993 | gene | open | 1534-1905 | |||
| 4710 | JAOVAS010000023.1 | GCA029851025_00994 | gene | open | 2015-3130 | |||
| 4711 | JAOVAS010000023.1 | GCA029851025_00995 | gene | open | 3386-5209 | |||
| 4712 | JAOVAS010000023.1 | GCA029851025_00996 | gene | open | 5757-7784 | deaD | ||
| 4713 | JAOVAS010000023.1 | GCA029851025_00992 | gene | open | 1217-1298 | trnY | ||
| 4714 | JAOVAS010000023.1 | GCA029851025_00992 | tRNA | open | 1217-1298 | trnY | tRNA-Tyr(gta) | |
| 4715 | JAOVAS010000024.1 | GCA029851025_00997 | CDS | open | 348-1142 | _na 264_aa | hypothetical protein | |
| 4716 | JAOVAS010000024.1 | GCA029851025_00998 | CDS | open | 2272-2382 | _na 36_aa | hypothetical protein | |
| 4717 | JAOVAS010000024.1 | GCA029851025_00999 | CDS | open | 6284-6565 | _na 93_aa | pyrophosphorylase | |
| 4718 | JAOVAS010000024.1 | GCA029851025_01000 | CDS | open | 7209-7436 | _na 75_aa | hypothetical protein | |
| 4719 | JAOVAS010000024.1 | GCA029851025_00997 | gene | open | 348-1142 | |||
| 4720 | JAOVAS010000024.1 | GCA029851025_00998 | gene | open | 2272-2382 | |||
| 4721 | JAOVAS010000024.1 | GCA029851025_00999 | gene | open | 6284-6565 | |||
| 4722 | JAOVAS010000024.1 | GCA029851025_01000 | gene | open | 7209-7436 | |||
| 4723 | JAOVAS010000025.1 | GCA029851025_01001 | gene | open | 69-3167 | rrl | ||
| 4724 | JAOVAS010000025.1 | GCA029851025_01002 | gene | open | 3488-5013 | rrs | ||
| 4725 | JAOVAS010000025.1 | GCA029851025_01001 | rRNA | open | 69-3167 | rrl | 23S ribosomal RNA | |
| 4726 | JAOVAS010000025.1 | GCA029851025_01002 | rRNA | open | 3488-5013 | rrs | 16S ribosomal RNA | |
| 4727 | JAOVAS010000026.1 | GCA029851025_01003 | CDS | open | 163-3258 | _na 1031_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 4728 | JAOVAS010000026.1 | GCA029851025_01004 | CDS | open | 3234-3497 | _na 87_aa | hypothetical protein | |
| 4729 | JAOVAS010000026.1 | GCA029851025_01003 | gene | open | 163-3258 | |||
| 4730 | JAOVAS010000026.1 | GCA029851025_01004 | gene | open | 3234-3497 | |||
| 4731 | JAOVAS010000027.1 | GCA029851025_01005 | CDS | open | 112-1215 | _na 367_aa | hypothetical protein | |
| 4732 | JAOVAS010000027.1 | GCA029851025_01005 | gene | open | 112-1215 | |||
| 4733 | JAOVAS010000044.1 | GCA029851025_01563 | CDS | open | 23-142 | _na 39_aa | hypothetical protein | |
| 4734 | JAOVAS010000044.1 | GCA029851025_01563 | gene | open | 23-142 |

